Implants for inducing soft and hard tissue integration
09849212 · 2017-12-26
Assignee
Inventors
- Marta Monjo Cabrer (Palma de Mallorca, ES)
- Joana María Ramis Morey (Palma de Mallorca, ES)
- Alba Córdoba Insensé (Palma de Mallorca, ES)
- María Satué Sahún (Palma de Mallorca, ES)
- Manuel Gómez Florit (Palma de Mallorca, ES)
Cpc classification
A61L31/16
HUMAN NECESSITIES
A61L2430/02
HUMAN NECESSITIES
A61L2400/18
HUMAN NECESSITIES
A61L27/54
HUMAN NECESSITIES
International classification
A61L31/16
HUMAN NECESSITIES
Abstract
The present invention provides a biocompatible implant comprising one or more metal(s), metal alloy(s), metal oxide(s) or a combination thereof, wherein an antioxidant compound selected from the group of flavonoids or methoxytryptophols, an ester thereof, a pharmaceutically acceptable salt thereof or a combination thereof, is/are coated to at least a part of a metal, metal alloy or metal oxide surface of said biocompatible implant. This implant is useful for replace bone tissue in vertebrate animals, and furthermore restore the normal function of said tissue, mainly due to its ability of induce osseointegration and soft tissue attachment.
Claims
1. A biocompatible implant for improved osseointegration and soft tissue attachment when implanted into a mammalian body, comprising a combination of: one or more metal(s), metal alloy(s), metal oxide(s) or a combination thereof, the one or more metal(s), metal alloy(s), metal oxide(s) or a combination thereof having at least one surface, and, a coating containing a methoxytryptophol or flavonoid compound either directly attached to the at least one surface by a covalent bond, or attached through an optional linker; wherein the methoxytryptophol or flavonoid compound is selected from the group of flavonoids, methoxytryptophols, an ester thereof, a pharmaceutically acceptable salt thereof, and a combination thereof, wherein the methoxytryptophol or flavonoid compound is/are coated to at least a part of the surface of the metal, metal alloy or metal oxide of said biocompatible implant, wherein the methoxytryptophol or flavonoid compound is covalently attached to the surface of the metal, metal alloy or metal oxide so that either the methoxytryptophol or flavonoid compound is directly attached to the one or more of the metal, metal alloy or metal oxide forming a covalent bond therewith, or the methoxytryptophol or flavonoid compound is bound to the surface of the one or more of the metal, metal alloy or metal oxide through the optional linker forming a covalent bond between the methoxytryptophol or flavonoid compound and the linker and between the linker and the one or more of the metal, metal alloy or metal oxide; and wherein the linker is selected from the group of one or more of anhydrides, alcohols, acids, amines, epoxides, isocyanates, silanes, thiol, alkyl, aryl, and halogenated groups; and whereby the combination is configured to provide improved osseointegration and soft tissue attachment when implanted into a mammalian body.
2. The biocompatible implant according to claim 1, wherein the flavonoid compound comprises at least one carbonyl group.
3. The biocompatible implant according to claim 2, wherein the flavonoid is selected from quercitrin, taxifolin, galangin, diosmetin, chrysin or derivatives thereof.
4. The biocompatible implant according to claim 1, wherein the methoxytryptophol compound is selected from 5-methoxytryptophol or 6-methoxytryptophol.
5. The biocompatible implant according to claim 1 wherein the linker is a silane.
6. The biocompatible implant according to claim 5 wherein the silane is selected from 3-aminopropyltriethoxysilane or triethoxysilanepropylsuccinic acid.
7. The biocompatible implant according to claim 1 wherein the linker is a polyether.
8. The biocompatible implant according to claim 7, wherein the polyether is polyethilenglycol or its derivatives.
9. The biocompatible implant according to claim 1, wherein said metal(s), metal alloy(s) or metal oxide(s) is/are selected from titanium, an alloy or an oxide thereof, zirconium, an alloy or an oxide thereof, tantalum, an alloy or an oxide thereof, hafnium, an alloy or an oxide thereof, niobium, or an alloy or an oxide thereof, chromium-vanadium alloy and stainless steel.
10. The biocompatible implant according to claim 9 wherein said metal, metal alloy or metal oxide is titanium.
11. The biocompatible implant according to claim 1, wherein the implant is selected from a surgical implant, an orthopedic implant, a dental implant, an orthopedic fixation device, an orthopedic joint replacement, a prosthetic disc for spinal fixation, a graft material.
12. The biocompatible implant according to claim 1, wherein the implant comprises a metal oxide scaffold comprising titanium oxide.
13. A biocompatible implant for improved osseointegration and soft tissue attachment when implanted into a mammalian body, comprising a combination of: one or more metal(s), metal alloy(s), metal oxide(s) or a combination thereof, the one or more metal(s), metal alloy(s), metal oxide(s) or a combination thereof having at least one surface, and a coating containing a methoxytryptophol or flavonoid compound either directly attached to the at least one surface by a covalent bond, or attached through an optional linker; wherein the methoxytryptophol or flavonoid compound is selected from the group of flavonoids, methoxytryptophols, an ester thereof, a pharmaceutically acceptable salt thereof, and a combination thereof, wherein the methoxytryptophol or flavonoid compound is/are coated to at least a part of the surface of the metal, metal alloy or metal oxide of said biocompatible implant, wherein the methoxytryptophol or flavonoid compound is covalently attached to the surface of the metal, metal alloy or metal oxide so that either the methoxytryptophol or flavonoid compound is directly attached to the one or more of the metal, metal alloy or metal oxide forming a covalent bond therewith, or the methoxytryptophol or flavonoid compound is bound to the surface of the one or more of the metal, metal alloy or metal oxide through the optional linker forming a covalent bond between the methoxytryptophol or flavonoid compound and the linker and between the linker and the one or more of the metal, metal alloy or metal oxide; and wherein the linker is selected from the group of one or more of anhydrides, alcohols, acids, amines, epoxides, isocyanates, silanes, thiol, alkyl, aryl, and halogenated groups; and whereby the combination is configured to provide improved osseointegration and soft tissue attachment when implanted into a mammalian body; and wherein further biomolecules are present on the surface of the metal, metal alloy or metal oxide of the implant, said biomolecules being selected from natural biomolecules, synthetic biomolecules, and recombinant biomolecules, cell attachment factors, biopolymers, blood proteins, enzymes, extracellular matrix proteins and biomolecules, growth factors and hormones, nucleic acids, receptors, synthetic biomolecules, vitamins, drugs, biphosphonates, biologically active ions, and marker biomolecules.
14. A method for producing a biocompatible implant according to claim 1, comprising reacting an antioxidant compound as defined in claim 1 with the surface of said biocompatible implant.
15. The method according to claim 14, comprising: a) chemically pre-treating the surface of an implant b) reacting a linker with said chemically pre-treated surface obtained in the pre-treating operation hereof, and c) reacting an antioxidant compound selected from the group of flavonoids, methoxytryptophols, an ester thereof, a pharmaceutically acceptable salt thereof, and a combination thereof, with said linker.
16. The method according to claim 14, comprising: a) chemically pre-treating the surface of an implant b) reacting a linker with the antioxidant compound, wherein the antioxidant compound is selected from the group of flavonoids, methoxytryptophols, an ester thereof, a pharmaceutically acceptable salt thereof, and a combination thereof, and c) reacting the antioxidant-linker conjugate thus obtained, with said pretreated surface obtained in the pre-treating operation hereof.
17. The method according to claim 14, further including reacting an antioxidant compound with a linker, wherein after reacting the antioxidant compound with the linker, a reduction is performed.
18. The method according to claim 17 wherein the reduction is carried out with sodium cyanoborohydride.
19. The method according to claim 14, further including a pre-treatment of the surface of an implant, wherein the pretreatment step-is selected from piranha attack, passivation, UV irradiation, acid or alkaline attack.
20. A method to replace bone tissue and/or restore a function of the body of a vertebrate animal comprising implanting the biocompatible implant according to claim 1, in particular a mammal, such as a human.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
EXAMPLES
Example 1
Immobilization of Flavonoids on Titanium Surfaces by Adsorption, Covalent Binding and Drop Casting Procedures
(20) This example shows how flavonoids taxifolin and quercitrin (
(21) Materials and Methods
(22) 1.1 Reagents and Materials.
(23) Titanium disks, cp grade IV, polished or machined, had 6.25 mm diameter and 2 mm height. Technical acetone was purchased to Fisher Scientific. Nitric acid 69.5%, reagent grade, and absolute ethanol and anhydrous toluene were purchased to Scharlau. Deionized milliQ water was obtained from a Millipore system. Hellmanex III solution was purchased to Helima Hispania. (3-aminopropyl)triethoxysilane (APTES), taxifolin, quercitrin and NaCNBH.sub.3 5M in 1M NaOH were purchased from Sigma.
(24) 1.2 Titanium Cleaning and Surface Pretreatment
(25) Polished or machined grade 4 Ti disks were cleaned according to the following steps: Immersion in deionized (DI) water for 30 s followed by 70% ethanol for 30 s. Then ultrasonication in DI water at 40° C., 5 min. Immersion in 40% NaOH, 40° C., 10 min. Again ultrasonication in DI water at 40° C., 5 min. Rinsed with DI water until pH=6. Ultrasonication in DI water, 50° C., 5 min. Immersion in 50% HNO.sub.3, 50° C., 10 min. Again ultrasonication in DI water, 40° C., 5 min. Finally, Ti disks were rinsed with DI water until pH=6 and stored in 70% Ethanol.
(26) Ti surfaces were hydroxilated before the flavonoid immobilization procedure according to one of the following methods: UV irradiation or passivation. UV irradiation: Ti surfaces were exposed to UV irradiation (λ=302 nm) for 48 h immediately before flavonoid immobilization. This ensures a high hydrophilicity (contact angle=0°) immediately after. Passivation: Passivation of titanium disks was performed following ASTM F86 standard: immersion in 3:7 (v/v) HNO.sub.3-DI water solution, 30 min, RT. Rinsed with DI water and placed in a covered ultrapure water bath for 24 h. Implants were dried in a nitrogen stream immediately prior to the next functionalization step.
(27) 1.3 Immobilization by Adsorption
(28) Pretreated Ti implants were immersed in a flavonoid solution in ethanol (taxifolin 400 μM or quercitrin 1000 μM) and stirred 24 h at 4° C. Then disks were rinsed with ethanol and dried with N.sub.2.
(29) 1.4 Immobilization by Drop Casting
(30) Pretreated Ti substrates were placed in a 96 well plate and 10 μl of flavonoid solution in absolute ethanol were drop casted on each implant surface. The implants were left to air dry for 30 min.
(31) 1.5 Covalent Immobilization
(32)
1.6 Surface Physic-Chemical Characterization by Infrared Spectroscopy—Attenuated Total Reflectance (FTIR-ATR) Coupled to Optical Microscopy.
(33) Samples were characterized using an FTIR-ATR spectrophotometer (Bruker Tensor 27) coupled to an UV-vis/IR microscope (Bruker Hyperion 3000). For each sample, a representative area of the implant surface was selected and at least 10 random measurement points were chosen. An FTIR spectrum was recorded for each point (resolution: 4 cm.sup.−1, n° scans: 16, reference: air). Two sample replicates were measured. FTIR spectra of pure taxifolin and quercitrin were obtained from 50 mM stock solutions in ethanol using the ATR accessory (4 μl of the biomolecule solution were deposited on the ATR crystal and the measurement was done after solvent evaporation).
(34) 1.7 Biomolecule Release by UV-vis Spectrometry
(35) The biomolecule release from functionalized implants after 24 h incubation in water at pH 7.5 and 37° C. was determined by UV-Vis spectroscopy. Implants were placed in a 96 well plate and 200 μl of water at pH 7.5 were added to each well. Samples were incubated at 37° C. during 24 h. Then, a 150 μl aliquot was withdrawn and the absorbance (λ.sub.max taxifolin=290 nm, λ.sub.max quercitrin=350 nm) was measured using a Biotek UV-vis plate reader spectrophotometer. Two sample replicates were measured.
(36) Results
(37) 1.11 Results for Adsorption Technique
(38) Table 1 shows the experiments carried out for immobilizing taxifolin and quercitrin by adsorption on Ti polished disks, either passivated (FL1) or UV treated (FL2). To check the presence of the flavonoids on the substrates, the amount of biomolecule released in water at pH 7.5—to simulate physiologic conditions—was determined by UV-Vis spectroscopy after 24 h incubation at 37° C.
(39) TABLE-US-00001 TABLE 1 Adsorption experiments carried out for the functionalization of Ti substrates with taxifolin (TX) and quercitrin (QR) and biomolecule released to water media at pH 7.5, after 24 h incubation at 37° C. C is the concentration of flavonoid released to 200 μl of water media. Imm. Ti Biomol- C μM, Method Experiment pretreat. ecule 24 h Adsorption FL1 Passivation FL1 TX 20.88 ± 3.30 FL1 QR 39.23 ± 13.51 FL2 UV FL2 TX 21.87 ± 7.53 FL2 QR 30.69 ± 3.28
(40) In all cases either taxifolin or quercitrin was detected in the aqueous media after 24 h incubation. The released amount of quercitrin was slightly higher than taxifolin in both experiments FL1 and FL2, maybe due to the higher initial concentration of quercitrin used (1 mM quercitrin, 400 μM taxifolin). Comparing Ti pretreatments, the amount of flavonoid released from adsorption samples is similar for Ti pretreatments, passivation and UV irradiation.
(41) 1.12 Results for Drop Casting Technique
(42) Table 2 shows the experiments carried out for immobilizing taxifolin and quercitrin by drop casting. Machined Ti was used for these experiments since this method was also used to test the in vitro effect of the implants (Examples 2 and 3) and machined surfaces are preferred for in vitro studies. Passivation was used as Ti pretreatment.
(43)
(44) TABLE-US-00002 TABLE 2 Drop Casting experiments carried out for the functionalization of Ti substrates with taxifolin (TX) and quercitrin (QR) and biomolecule released water media at pH 7.5, after 24 h ncubation at 37° C. C is the concentration of flavonoid released to 200 μl of water media. Expected C max is the expected concentration of biomolecule assuming that the entire amount of flavonoid initially added is released in these conditions. Imm. Biomol- C μM, Expected Method Experiment ecule 24 h C.sub.max μM Drop FL13 FL13 TX 28.5 ± 1.8 30 Casting FL13 QR 408.3 ± 18.4 500 FL16 FL16 TX 98.8 ± 3.3 100 FL16 QR 167.6 ± 13.2 250
1.13. Results for Covalent Immobilization Technique
(45) Table 3 shows the evaluated groups to covalently immobilize taxifolin and quercitrin on Ti subtrates. Ti substrates were either UV irradiated or passivated. For each pretreatment, Schiff base formation and Schiff base reduction were evaluated. Samples were characterized by FTIR-ATR spectroscopy to check the presence of the flavonoid on the surface. Biomolecule release after 24 h incubation in water at pH 7.5 and 37° C. was also determined.
(46) TABLE-US-00003 TABLE 3 Covalent functionalization of Ti substrates with taxifolin (TX) and quercitrin (QR) through an APTES coupling agent. The table shows the Ti pretreatment (UV irradiation or passivation), the reduction or not of the Schiff base obtained, the biomolecule used and the release (C μM) of flavonoid to water media after 24 h of incubation in water at pH 7.5 and 37° C. Imm. Ti Reduction Biomol- C μM, Method Pretreat. step ecule 24 h Covalent No TX 5.06 ± 0.59 linking QR 3.33 ± 0.10 UV Yes TX No det. QR No det. Passiv No TX 10.22 ± 1.88 QR 8.54 ± 0.41 Yes TX No det. QR No det.
(47) Flavonoids were homogenously detected by FTIR-ATR for all the groups studied.
(48) Table 3 also shows the amount of flavonoid released after 24 h at 37° C. from covalently bound samples, measured by UV-vis spectroscopy. As the table shows, in all Schiff base formation experiments without reduction step, taxifolin or quercitrin were detected in the water media, in low concentrations. The flavonoid detected could correspond to some crystal aggregates observed by SEM, being probably flavonoid residues of the rinsing step. However, since Schiff bases have weak bonds that rapidly hydrolyze (reverse), some part of the detected concentration could also correspond to the hydrolysis of the Schiff base. By the other hand, the concentration of flavonoid released to water media from reduced Schiff base samples was no detectable. This agrees with the expected formation of an irreversible bond between the flavonoid and the silanized surface when reducing the Schiff base with NaCNBH.sub.3.
Conclusions Example 1
(49) Flavonoids taxifolin and quercitrin can be grafted to Ti surfaces either by adsorption, drop casting and covalent linking methods. UV irradiation and passivation are effective pretreatments for Ti surface activation before the immobilization of the biomolecule.
(50) Flavonoid-coated samples by adsorption and drop casting showed a high release of the flavonoid from the surface after 24 h incubation in water at physiological conditions.
(51) Covalently grafted samples showed different release behaviors depending on the reduction step. Non-reduced samples showed a low release of the flavonoid from the surface in water after 24 h incubation, while reduced samples using the same conditions did not show release of the flavonoid. As FTIR-ATR analysis of covalently immobilized samples showed the presence of the flavonoids on the Ti surface both for non-reduced and reduced samples, this demonstrates that the flavonoids are covalently linked to the substrate through the APTES silane crosslinker.
Example 2
Titanium Surfaces Functionalized with Flavonoids: Biocompatibility and Bioactivity on Human Gingival Fibroblasts
(52) Machined titanium surfaces were functionalized by three methodologies: drop casting, covalent linking by Schiff base formation and covalent linking by reduced Schiff base, as described in Example 1. Surface chemical analysis was carried out by FTIR-ATR spectroscopy. Flavonoid release profiles up to 14 days from the different surfaces were determined by UV-Vis spectroscopy. The biocompatibility and bioactivity of the different flavonoid-coated titanium surfaces were assessed in cell culture models of human gingival fibroblasts (HGF), as a cell model for soft tissue around titanium implants. Fibroblasts cultured on flavonoid modified titanium surfaces were tested for cell toxicity, determined by lactate dehydrogenase (LDH) activity after 24 hours of incubation, cell morphology, determined by SEM and cytoskeleton and nuclei staining, and gene expression of differentiation markers after 14 days of culture.
(53) Table 4 shows the different surfaces produced. Prior to biomolecule immobilization, passivation of machined titanium disks was carried out for all groups.
(54) TABLE-US-00004 TABLE 4 Groups used in the study. Group Modification FL13B Passivated, Ti/TiO.sub.2 FL13TX Drop casting, Ti/TiO.sub.2/Taxifolin FL13QR Drop Casting, Ti/TiO.sub.2/Quercitrin FL14A Silanized Ti, Ti/TiO.sub.2/APTES FL14TX Schiff base, Ti/TiO.sub.2/APTES/Taxifolin FL14QR Schiff base, Ti/TiO.sub.2/APTES/Quercitrin FL15TX Reduced Schiff base, Ti/TiO.sub.2/APTES/Taxifolin FL15QR Reduced Schiff base, Ti/TiO.sub.2/APTES/Quercitrin
2.1. Flavonoid Release Profile by UV-Vis Spectroscopy
(55) The flavonoid release profile from coated surfaces in water media, simulating physiologic conditions (pH 7.5, 37° C.) was measured by UV-Vis spectroscopy. Implants were placed in a 96 well plate and 200 μl of water at pH 7.5 were added to each well. Aqueous media (200 μl/sample) was changed at time 1 h, 1 day and 4, 6, 8, 11 days, simulating culture media changes. Each time, a 150 μl aliquot was withdrawn and the absorbance (λ.sub.Taxifolin=290 nm, λ.sub.Quercitrin=350 nm) was measured in a 96 well Elisa plate using a Biotek UV-vis plate reader spectrophotometer. The concentration of flavonoid was calculated from interpolation of data in flavonoid standard calibration curves. Two replicates were measured for each sample. Passivated Ti substrates were used as blank samples for drop casted implants. Silanized Ti substrates were used as blank for covalently linked samples.
(56) 2.2. Cell Culture
(57) Human gingival fibroblasts (HGF) were obtained from Provitro GmbH (Berlin, Germany). HGF cells were routinely cultured at 37° C. in a humidified atmosphere of 5% CO2, and maintained in fibroblast growth medium supplemented with 10% fetal calf serum (FCS) and antibiotics (50 ng amphotericin/ml and 50 μg gentamicin/ml) (Provitro GmbH, Berlin, Germany). Cells were subcultured 1:4 before reaching confluence using PBS and trypsin/EDTA, as recommended by suppliers. Experiments were performed with HGF cells at passage 7.
(58) Titanium coin-shaped implants were placed in 96-well plates and HGF were seeded at a density of 1.0×10.sup.4 cells/well for all control and test samples. Trypan blue stain was used to determine total and viable cell number. Culture media was refreshed every other day. Culture media was collected after 24 hours to test LDH activity. Some samples were processed by scanning electron microscopy and confocal microscopy. Cells were harvested after 14 days to study gene expression.
(59) 2.3. Determination of Cytotoxicity The presence of LDH activity in the culture media after 48 hours of incubation was used as an index of cell death. LDH activity was determined spectrophotometrically after 30 min of incubation at 25° C. of 50 μl of culture media and 50 μl of the reaction mixture, by measuring the oxidation of NADH at 490 nm in the presence of pyruvate, according to the manufacturer's kit instructions (Cytotoxicity Detection kit, Roche Diagnostics). Results from all the samples were presented relative to the LDH activity in the medium of cells treated with the vehicle control for each case, 1% ethanol or 0.6% DMSO, (low control, 0% of cell death) and of cells treated with 1% Triton X-100 (high control, 100% cell death). The percentage of LDH activity was calculated using the following equation: Cytotoxicity (%)=(exp.value−low control)/(high control−low control)*100.
2.4. Microscopic Analysis of Cells Grown on the Modified Ti Surfaces
(60) A scanning electron microscope (SEM) using Back Scattered Electrons (BSE), 40 Pa of pressure and 10 kV of voltage was used to acquire images of cells grown on coin-shaped implants. Cells were washed twice with PBS and fixed with glutaraldehyde 4% in PBS for 1 hour. The fixative solution was removed, and the cells were washed with distilled water twice. At 30 minute intervals, the cells were dehydrated by the addition of 50%, 70%, 90% and 100% ethanol solutions. Finally, the ethanol was removed, and the cells were left at room temperature to evaporate the remaining ethanol prior to analysis.
(61) Then, the samples were rehidrated by the addition of 90%, 70% and 50% ethanol solutions and water for 5 minutes periods. Cells were stained with Phalloidin-FITC 5 μg/ml (Sigma, St. Louis, Mo., USA) in PBS Triton X-100 0.2% for 30 minutes in the dark. Cells were washed with PBS and coin-shaped implants were placed on slides. Finally, a drop of Fluoroshield TM with DAPI (Sigma, St. Louis, Mo., USA) was added and cover glasses were mounted on the implants. Two implants of each group were used to perform the experiment and three images of each implant were taken with the confocal microscope (Leica DMI 4000B equipped with Leica TCS SPE laser system). Excitation wavelengths of DAPI and Phalloidin-FITC were set at 405 and 488 nm respectively; fluorescence was captured between 430-480 nm for DAPI and between 500-525 nm for Phalloidin-FITC.
(62) 2.5. RNA Isolation and Real-Time RT-PCR Analysis Total RNA was isolated using Tripure® (Roche Diagnostics, Mannheim, Germany), according to the manufacturer's protocol. Total RNA was quantified at 260 nm using a Nanodrop spectrophotometer (NanoDrop Technologies, Wilmington, Del., USA). The same amount of RNA (0.2 μg) was reverse transcribed to cDNA at 42° C. for 60 min using High Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, Calif.), according to the protocol of the supplier. Aliquots of each cDNA were frozen (−20° C.) until the PCR reactions were carried out. Real-time PCR was performed for two reference genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and beta-actin (B-actin), and target genes (Table 5). Target genes genes are covering different aspects of gingival fibroblast function like ECM production and organization, and inflammation as detailed in the following table.
(63) TABLE-US-00005 TABLE 5 Function of selected genes. Gene Function Collagen III α1 The gingival connective tissue consists of a dense (COL3A1) network of collagen fibrils bundles that provide firmness to the gingiva and attach the gingiva to the tooth and alveolar bone. They also regulate functions of the connective tissue cells. COL3A1 is found in extensible connective tissues such as skin, lung, and the vascular system, frequently in association with type I collagen. Interleukin-6 IL-6 is known to mediate important signals in the (IL6) inflammatory cytokine network. Gingival fibroblasts secrete cytokines upon stimulation with inflammatory mediators, including IL-6.
(64) Real-time PCR was performed in the Lightcycler 480® (Roche Diagnostics, Mannheim, Germany) using SYBR green detection. Each reaction contained 7 μl Lightcycler-FastStart DNA MasterPLUS SYBR Green I (containing Fast Start Taq polymerase, reaction buffer, dNTPs mix, SYBRGreen I dye and MgCl2), 0.5 μM of each, the sense and the antisense specific primers (Table 6) and 3 μl of the cDNA dilution in a final volume of 10 μl. The amplification program consisted of a pre-incubation step for denaturation of the template cDNA (5 min 95° C.), followed by 45 cycles consisting of a denaturation step (10 s 95° C.), an annealing step (10 s 60° C.) and an extension step (10 s 72° C.). After each cycle, fluorescence was measured at 72° C. A negative control without cDNA template was run in each assay.
(65) TABLE-US-00006 TABLE 6 Primers used in the real-time PCR of reference and target genes. S: sense, A: antisense, bp: base pairs Product GeneBank Gene Primer sequence size Accession Nr. CollagenIII S: GGCCTACTGGGCCTGGTGGT 190 bp NM_000090.3 α1 A: CCACGTTCACCAGGGGCACC (COL3A1) (target gene) Interleukin-6 S: AGGAGACTTGCCTGGTGAAA 196 bp NM_000600.3 (IL6) (target A: GCATTTGTGGTTGGGTCAG gene) β-Actin S: CTGGAACGGTGAAGGTGACA 136 bp NM_001101.3 (reference A: AAGGGACTTCCTGTAACAATGCA gene) GAPDH S: TGCACCACCAACTGCTTAGC 87 bp NM_002046.3 (ref. gene) A: GGCATGGACTGTGGTCATGAG
(66) Real-time efficiencies (E) were calculated from the given slopes in the
(67) LightCycler 480 software using serial dilutions, showing all the investigated transcripts high real-time PCR efficiency rates, and high linearity when different concentrations were used. PCR products were subjected to a melting curve analysis on the LightCycler and subsequently 2% agarose/TAE gel electrophoresis to confirm amplification specificity, Tm and amplicon size, respectively. All samples were normalized by the geometric mean of the expression levels of ACTBL2 and GAPDH and fold changes were related to the control groups using the following mathematical model: ratio=E.sub.target.sup.ΔCp target (mean control−sample)/E.sub.reference.sup.ΔCp target (mean control−sample), where Cp is the is the crossing point of the reaction amplification curve as determined by the LightCycler 480 software. Stability of reference genes was calculated using the BestKeeper tool.
(68) All in vitro data are presented as mean values±SEM (standard error of the mean). The Kolmogorov-Smirnov test was done to assume parametric or non-parametric distributions for the normality tests. Differences between groups were assessed by Mann-Whitney-test or by Student t-test depending on their normal distribution. SPSS® program for Windows, version 17.0 (SPSS, Chicago, Ill., USA) was used. Results were considered statistically significant at p-values ≦0.05.
(69) Results
(70) 2.6. Chemical Analysis of Flavonoid Coated Substrates by FTIR-ATR
(71) The presence of flavonoids on the different surfaces was detected as shown in example 1.
(72) 2.7. Flavonoid Release Profile by UV-Vis Spectroscopy
(73)
(74) Drop Casted substrates. The initial flavonoid amount deposited on the Ti surface by drop casting was 6 nmol/disk for taxifolin implants and 100 nmol/disk for quercitrin. Taxifolin release profile shows that almost 3.2±0.4 nmol were released to the media after 1 h of incubation and the release was almost complete at day 1. Quercitrin release profile from drop casted implants showed an initial burst at 1 h of 72.8±4.1 nmol. After 1 day of incubation, a 81.7% of the initially added amount (100 nmol/disk) was released to the media. From day 4 to day 14, the amount of quercitrin released to media was not detectable.
(75) Covalently linked subtrates.
(76) 2.8. Biocompatibility of Flavonoid-Coated Titanium Surfaces with Human Gingival Fibroblasts.
(77) Cytotoxicity of treatments was evaluated by measuring the release of LDH from HGF to the culture media after 24 hours of treatment (
(78) 2.9. Effect of the Different Flavonoid-Coated Titanium Surfaces on Cell Morphology.
(79) After 24 hours of culture on the different surfaces, HGF possessed the typical fibroblastic spindle-shaped morphology and were distributed throughout the entire surface (
(80) 2.10. Effect of the Different Flavonoids on Gene Expression.
(81) Real-time RT-PCR was performed to observe the effect of the different flavonoid-coated Ti surfaces on the expression of genes involved on extracellular matrix production and organization, regulation of cell adhesion and inflammation (
(82) Regarding the gene expression of the selected markers, mRNA levels of interleukin-6 (IL6), an inflammatory marker, were significantly lower in all flavonoid-coated surfaces compared with its controls without flavonoids (
(83) Surprisingly, COL3A1 increased only in all covalently-bonded flavonoid-coated groups compared with the silanized Ti/TiO.sub.2 control (FL14A) and in quercitrin reduced Schiff base (FL15QR) compared with the non reduced surfaces (FL14QR). (
Conclusions Example 2
(84) None of the flavonoid-coated surfaces were toxic for HGF. After 24 hours of culture on the different surfaces, HGF possessed the typical fibroblastic spindle-shaped morphology and were distributed throughout the entire surface, without differences among the groups. This demonstrates that despite of the chemical modifications of the metallic surface of the implant by binding the linker and the flavonoid, toxicity has not been increased. Cytoskeleton and nuclei staining also revealed good cell spreading on all surfaces and the formation of prolongations and filopodia to contact each other and to attach to surfaces.
(85) The different surface modification methods were effective in decreasing inflammation in HGF cells, as shown by the IL-6 mRNA levels. However, only flavonoids that were covalently attached to the implant surface were effective increasing the differentiation of HGF, as shown by the COL3A1 mRNA levels. Thus, to regenerate the gingival soft tissue around titanium implants with fibroblasts that are able to attach and differentiate (secreating collagen to the extracellular matrix), a coating that contains flavonoids covalently attached to the surface are prefered than those only physically adsorbed on the surface.
Example 3
Titanium Surfaces Functionalized with Flavonoids: Biocompatibility and Bioactivity on Human Umbilical Cord Mesenchymal Stem Cells
(86) Titanium surfaces were functionalized by drop casting and covalent linking (Schiff base and reduced Schiff base formation) as previously described in examples 1 and 2. Flavonoid release profiles from the different surfaces were also determined by UV-Vis spectroscopy. The biocompatibility and bioactivity of the different flavonoid-coated titanium surfaces were assessed in cell culture models of human umbilical cord mesenchymal stem cells (hUC-MSCs) differentiated to the osteogenic lineage, as a cell model for hard tissue around titanium implants. Cells cultured on flavonoid modified titanium surfaces were tested for cell toxicity, determined by LDH activity after 24 hours of incubation, cell morphology, determined by SEM and cytoskeleton and nuclei staining, and gene expression of differentiation markers after 14 days of culture.
(87) Table 7 shows the different surfaces produced. Prior to flavonoid immobilization, passivation of machined titanium disks was carried out.
(88) TABLE-US-00007 TABLE 7 Groups used in the study. Group Modification FL16B Passivated, Ti/TiO.sub.2 FL16TX Drop casting, Ti/TiO.sub.2/Taxifolin FL16QR Drop Casting, Ti/TiO.sub.2/Quercitrin FL17A Silanized Ti, Ti/TiO.sub.2/APTES FL17TX Schiff base, Ti/TiO.sub.2/APTES/Taxifolin FL17QR Schiff base, Ti/TiO.sub.2/APTES/Quercitrin FL18TX Reduced Schiff base, Ti/TiO.sub.2/APTES/Taxifolin FL18QR Reduced Schiff base, Ti/TiO.sub.2/APTES/Quercitrin
(89) The flavonoid release profile was measured by UV-Vis spectroscopy as described in previous example, but in this case the aqueous media was changed at time 1 h, 1 day and 4, 7, 11 days, simulating hUC-MSCs culture media changes. Determination of citotoxicity, microscopic analysis of cell growth on the modified Ti surfaces and RNA isolation and real-time RT-PCR analysis was carried out as described in previous example. Primers used in the real-time PCR are detailed in table 8 and the function of genes selected as markers is explained in table 9.
(90) TABLE-US-00008 TABLE 8 Primers used in the real-time PCR of reference and target genes. S: sense, A: antisense, bp: base pairs GeneBank Product Accession Gene Primer sequence size Nr. ALP S: CCGCTATCCTGGCTCCGTGC 108 bp NM_000478.3 A: GGTGGGCTGGCAGTGGTCAG Coll-1 S: CCTGACGCACGGCCAAGAGG 122 bp NM_000088.3 A: GGCAGGGCTCGGGTTTCCAC OC S: GAAGCCCAGCGGTGCA 70 bp NM_199173 A: CACTACCTCGCTGCCCTCC Runx2 S: GCCTTCAAGGTGGTAGCCC 67 bp NM_004348 A: CGTTACCCGCCATGACAGTA
(91) TABLE-US-00009 TABLE 9 Function of selected genes. Gene Function ALP Alkaline phosphatase is linked to phosphate metabolism and matrix maturation. It is one of the first functional genes expressed in the calcification process. Coll-1 Collagen type-1 is an early marker which supports cell differentiation stage. OC It is the most abundant non-collagenous protein in the bone and is implicated in bone mineralization and calcium ion homeostasis. Osteocalcin is normally used as a preliminary biomarker on the effectiveness of a given treatment on bone formation. Runx2 It is a key transcriptional factor involved in osteoblast differentiation.
3.1. Cell Culture
(92) Human umbilical cord derived mesenchymal stem cells (hUC-MSC) were isolated from umbilical cords obtained in the process of human umbilical cord blood donation under the Concordia Cord Blood Donation. The samples were obtained after informed consent and with the approval of the Ethical Committee of Balearic Islands (CEIC-IB). Once isolated, hUC-MSCs cells were routinely cultured at 37° C. in a humidified atmosphere of 5% CO.sub.2. Cells were seeded at a density of 7.0×10.sup.3 cells/well over the titanium coin-shaped implants and grown until confluence in a “growing media” consisting of DMEM-LG supplemented with penicillin (50 IU/mL), streptomycin (50 μg/mL) and 20% FBS (FB-1001, lot number 4253, Biosera, Boussens, France). At confluence (designated as day 0), cells were grown in “differentiation media” consisting of growing media supplemented with hydrocortisone (200 nM), ascorbic acid (50 μg/mL) and β-glycerophosphate (10 nM). Media was replaced twice weekly. Culture media was collected after 24 hours to test LDH activity. Some samples were processed by scanning electron microscopy and confocal microscopy to check cell morphology. Cells were harvested after 14 days to study gene expression.
(93) Results
(94) 3.2. Flavonoid Release Profile by UV-Vis Spectroscopy
(95)
(96) Drop Casted substrates. The initial flavonoid amount deposited on the Ti surface by drop casting was 20 nmol/disk for taxifolin implants and 50 nmol/disk for quercitrin. For both drop casted surfaces the maximum release took place within the first hour of sample incubation. The total taxifolin amount released to media was 19.7±0.7 nmol. The total quercitrin amount released represented a 78% of the expected value (39 nmol vs 50 nmol).
(97) Covalently linked subtrates.
(98) No taxifolin neither quercitrin were detected in the media from reduced Schiff base surfaces (experiment FL18). This agrees with the expected formation of an irreversible stable bond between the flavonoid and the APTES/Ti surface.
(99) 3.3. Biocompatibility of Flavonoid-Coated Titanium Surfaces with Human Umbilical Cord Mesenchymal Stem Cells.
(100) Cytotoxicity of treatments was evaluated by measuring the release of LDH from hUC-MSCs to the culture media after 24 hours of treatment (
(101) 3.4. Effect of the Different Flavonoid-Coated Titanium Surfaces on Cell Morphology.
(102) After 24 hours of culture on the different surfaces, hUC-MSCs showed the typical morphology with long thin cell bodies and prominent nucleous which were placed throughout the entire surface, without differences among the groups (
(103) 3.5. Effect of the Different Flavonoid-Modified Surfaces on Gene Expression.
(104) Real-time RT-PCR was performed to observe the effect of the different flavonoid-coated Ti surfaces on the expression of genes involved on osteoblast differentiation, matrix maturation and mineralization (
(105) Moreover, a good consistence of the bestkeeper index was proved as its contributing reference genes were tightly correlated with it (0.879<r<0.900), with a significance level of p=0.001 for all reference genes.
(106) Regarding the gene expression of the selected markers (
Conclusions Example 3
(107) None of the surfaces was toxic for hUC-MSCs. After 24 hours of culture on the different surfaces, hUC-MSCs showed the typical morphology with long thin cell bodies and prominent nucleous, which were placed throughout the entire surface, without differences among the groups.
(108) As regards to the differentiation profile of the hUC-MSCs, cells cultured on implants that had flavonoids covalently attached showed superior differentiation than cells cultured on flavonoid drop-casted implants, as shown by the higher collagen-1, osteocalcin and, more importantly, runx2. Runx2 is a master organizer of gene transcription in developing and maturing osteoblasts, which are the main cells in hard tissue supporting osseointegrated implants.
Example 4
Covalent Immobilization Of 5-Methoxytryptophol On Titanium Surfaces
(109) 5-methoxytryptophol (5-MTX) can be covalently immobilized to pretreated Ti surfaces through an esterification reaction. A coupling agent with a carboxylic, acid anhydride or acyl chloride functionality can react with the hydroxyl moiety of 5-MTX to give an ester (
(110) Acid anhydride functionalization of Ti surfaces can be carried out by using triethoxysilylpropyl succinic anhydride (TESPSA) as a crosslinker. TESPSA is a silane, structurally similar to APTES but with a succinic anhydride end instead of an amine. Hydrolysis of the anhydride will give the carboxylic acid functionality, which is also reactive towards hydroxyl esterification although in a slower manner than the acid anhydride.
(111) 4.1. Procedure of Covalent Immovilization.
(112) Prior to the functionalization, activation of the Ti surface by UV irradiation or passivation is carried out, as described in Example 1.
(113) The silanization of the Ti/TiO.sub.2 substrates with TESPSA was carried out in anhydrous conditions to avoid hydrolysis of the succinic anhydride moiety of TESPSA. Immediately after Ti pretreatment, the implants were immersed in a 10% v/v TESPSA solution in dry toluene for 24 h at room temperature. Anhydrous MgSO.sub.4 was added to scavenge the water formed from the condensation of the etoxy groups of the silane with the hydroxilated Ti surface. Then rinse gently with dry toluene.
(114) For the immobilization of 5-MTX, a solution of 1 mM 5-MTX in dry toluene was prepared and anhydrous MgSO.sub.4 or molecular sieves 4A was added. The silanized disks were immersed in the 5-MTX solution, few drops of concentrated H.sub.2SO.sub.4 to catalyze the esterification were added, and the final solution was stirred for 1 h at RT. Finished this time, disks were rinsed gently with dry toluene, DMSO and water at pH 7 and dried with N.sub.2.
Example 5
Functionalization of Titanium Surfaces With 5-Methoxytryptophol by Drop Casting
(115) This example shows how titanium surfaces can be homogeneously coated with 5-methoxytryptophol by a drop casting procedure.
(116) 5.1. Reagents and Methods
(117) Machined titanium coins were cleaned and passivated as described in Example 1. Immediately after Ti passivation, a 5 μl drop of a 10 mM 5-methoxytryptophol solution in ethanol was added to each coin and the solution was left to air dry for 30 min. FTIR-ATR coupled to optical microscopy analysis of the surfaces were carried out as described in Example 1. FTIR spectra of pure, solid 5-methoxytryptophol was obtained with an ATR accessory.
(118) Results FTIR analysis of the coated surfaces showed the presence of the biomolecule homogenously distributed along the surface (
CONCLUSION
(119) Titanium metal surfaces can be homogeneously coated with 5-methoxytryptophol using drop casting methods.