Method for mass humanization of rabbit antibodies

Abstract

The present invention relates to a method for producing a population of 20 or more nucleic acids, each encoding at least one protein comprising at least one immunoglobulin variable domain having a rabbit-derived CDR3 amino acid sequence embedded in essentially human framework sequences, as well as to a population of nucleic acids and a population of proteins relates thereto and uses thereof.

Claims

1. A method for producing a population of 20 or more different nucleic acids, each encoding at least one protein comprising at least one immunoglobulin variable domain comprising a rabbit CDR3 amino acid sequence embedded in human framework sequences, wherein the nucleic acid sequences encoding the rabbit CDR3 amino acid sequences are diversified among the population, wherein the method comprises the following steps: (a) providing, simultaneously, at least 10 nucleic acids each encoding a rabbit complementarity determining region 3 (CDR3) amino acid sequence, and (b) generating the population of 20 or more different nucleic acids, each encoding at least one protein comprising at least one immunoglobulin variable domain comprising a rabbit CDR3 amino acid sequence embedded in human framework sequences, wherein the human framework sequences consist of a first human framework region (human FR1), a second human framework region (human FR2), a third human framework region (human FR3), and a fourth human framework region (human FR4), such that the human FR1 and human FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the human FR2 and human FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the human FR3 and human FR4 regions are interspaced by a rabbit CDR3 amino acid sequence, wherein each nucleic acid sequence encoding the CDR1 or the CDR2 amino acid sequence of the variable domain is independently based i) on a nucleic acid sequence encoding a human CDR1 or a human CDR2, respectively, wherein at least one of the nucleic acid sequences encoding the CDR1 or the CDR2 amino acid sequence has been modified to encode at least one amino acid present in a rabbit CDR1 or a rabbit CDR2 amino acid sequence, respectively, or ii) on a nucleic acid sequence encoding a rabbit CDR1 or a rabbit CDR2, respectively, wherein at least one of the nucleic acid sequences encoding the CDR1 or the CDR2 amino acid sequence has been modified to encode at least one amino acid present in a human CDR1 or a human CDR2 amino acid sequence, respectively, wherein at least 80% of the nucleic acids of the population encode different CDR1 and different CDR2 amino acid sequences, and wherein the human FR1, human FR2, human FR3 and human FR4 regions are human framework regions selected to provide a scaffold conducive for rabbit CDR3 amino acid sequences, wherein (1) the scaffold yields a correctly folded antibody for at least 30% of grafted rabbit CDR3 amino acid sequences; and/or (2) the scaffold exhibits at least 30% framework homology to a rabbit framework wherein at least 10 of the nucleic acids of the population encode different CDR3 amino acid sequences, and wherein the two C-terminal amino acids of human FR2 are optionally non-human, and the two C-terminal amino acids of human FR3 are optionally non-human.

2. The method of claim 1, wherein step (b) comprises: (i) providing a population of Acceptor Framework nucleic acid sequences, wherein each Acceptor Framework nucleic acid sequence comprises nucleic acid sequences encoding a set of framework regions comprising the human FR1, the human FR2, the human FR3, and the human FR4, wherein the human FR1 and human FR2 regions are interspaced by CDR1, the human FR2 and human FR3 regions are interspaced by CDR2, and the nucleic acid sequences encoding human FR3 and human FR4 regions are linked directly or are interspaced by a stuffer nucleic acid sequence, and (ii) combining at least 10 nucleic acid sequences each encoding the rabbit CDR3 amino acid sequence with an Acceptor Framework nucleic acid sequence, so that each of the human FR3 and human FR4 regions are interspaced by the rabbit CDR3 amino acid sequence, and wherein the two C-terminal amino acids of human FR2 are optionally non-human, and the two C-terminal amino acids of human FR3 are optionally non-human.

3. The method of claim 1, wherein the rabbit CDR3 amino acid sequences are obtained from a rabbit B cell and wherein the rabbit from which the rabbit B cell is obtained was immunized against an antigen of interest.

4. The method of claim 1, wherein at least one of the rabbit CDR3 amino acid sequences is obtained by: (a) determining the sequence of the rabbit CDR3 regions of the antibodies in a sample obtained from a rabbit immunized against an antigen of interest, (b) determining the frequency of all rabbit CDR3 amino acid sequences in the sample and generating lineage trees or grouping CDR3 amino acid sequences based on sequence similarities, (c) optionally excluding rabbit CDR3 amino acid sequence groups or sequences present in a sample from the rabbit prior to immunization, (d) ranking candidate lineages or candidate groups by expansion, isotype, somatic hypermutation, tree complexity, group size and/or convergence, (e) selecting an individual rabbit CDR3 amino acid sequence representative of at least one lineage or group, and (f) generating a nucleic acid encoding a peptide comprising the individual rabbit CDR3 amino acid sequence.

5. The method of claim 4, wherein the selecting an individual rabbit CDR3 amino acid sequence representative of at least one lineage or group is selecting an individual rabbit CDR3 amino acid sequence representative of a plurality of lineages or groups or all lineages or groups.

6. The method of claim 1, wherein (a) the sequence (i) of the two C-terminal amino acids of the human FR3 region are non-human, and/or (ii) of the two C-terminal amino acids of the human FR2 region is X1-X2, wherein X1 is selected from I and V, and wherein X2 is selected from A, G, and S, or (b) the human FR2 region is fully human, and/or the human FR3 region is fully human, and/or (c) at least 50% of the nucleic acids of the population encode different CDR3 amino acid sequences.

7. The method of claim 6, wherein the sequence of the two C-terminal amino acids of the human FR3 region is a rabbit sequence.

8. The method of claim 2, wherein (x) the at least 10 nucleic acids each encoding the rabbit CDR3 amino acid sequence further comprise at least one recognition site for at least one restriction enzyme, and (xi) the nucleic acid sequences of the Acceptor Framework nucleic acid sequence encoding human FR3 and human FR4 regions are interspaced by the stuffer nucleic acid sequence, wherein the stuffer nucleic acid sequence comprises at least one restriction enzyme recognition site for at least one restriction enzyme.

9. The method of claim 8, wherein the nucleic acids of (x) and (xi) further comprise a recognition site for a restriction enzyme, which is capable of cutting at both sides of the recognition site.

10. The method of claim 8, wherein step (ii) comprises: (ii1) digesting the at least 10 nucleic acids of (x) using a restriction enzyme that binds to the restriction enzyme recognition site of (x); (ii2) digesting the stuffer nucleic acid sequence from the Acceptor Framework of (xi) using a restriction enzyme that binds to the restriction enzyme recognition site; and (ii3) ligating the digested nucleic acid sequences of steps (ii1) and (ii2), such that the nucleic acid sequence encoding the human FR3 and human FR4 region of a nucleic acid is interspaced by a nucleic acid sequence encoding the rabbit CDR3 amino acid sequence, and that sequences each encoding a protein comprising at least one immunoglobulin variable domain are obtained.

11. The method of claim 8, wherein the restriction enzyme is a Type IIb restriction endonuclease.

12. The method of claim 11, wherein the Type IIb restriction endonuclease is BarI.

13. The method of claim 1, wherein (a) the rabbit CDR3 amino acid sequences encode heavy chain CDR3 (CDR H3) sequences, and/or (b) the rabbit CDR3 amino acid sequences encode light chain CDR3 (CDR L3) sequences, and/or (c) the human or rabbit CDR1 regions and the human or rabbit CDR2 regions, on which the CDR1 and CDR2 amino acid sequences are based, are selected from human germline CDR1 regions, human germline CDR2 regions, rabbit germline CDR1 regions, rabbit germline CDR2 regions, human somatic hypermutation CDR1 regions, human somatic hypermutation CDR2 regions, rabbit somatic hypermutation CDR1 regions, rabbit somatic hypermutation CDR2 regions, rabbit gene conversion CDR1 regions, and rabbit gene conversion CDR2 regions, and/or (d) the human FR1, human FR2, human FR3 and human FR4 regions which are human framework regions selected to provide a scaffold conducive for rabbit CDR3 amino acid sequences are obtainable by: (i) providing (1) a collection of sequences of naturally occurring human antibodies each comprising a set of human FR1, human FR2, human FR3 and human FR4 regions; and (2) a collection of sequences of naturally occurring rabbit antibodies each comprising a set of rabbit FR1, rabbit FR2, rabbit FR3 and rabbit FR4 regions, and (ii) identifying a plurality of sets of human FR1, human FR2, human FR3 and human FR4 regions which provide a scaffold conducive for rabbit CDR3 amino acid sequences by (1) determining the parameters framework homology, CDR homology, CDR lengths, CDR canonical structure, and spatial orientation of CDR loops, and (2) selecting sets of human FR1, human FR2, human FR3 and human FR4 regions based on the parameters, and/or (e) the two C-terminal amino acids of a heavy chain human FR2 are optionally non-human, and/or (f) the two C-terminal amino acids of a heavy chain human FR3 are optionally non-human, and/or (g) the human framework sequences independently comprise a set of human FR1, human FR2, human FR3 and human FR4 regions selected from human VH3-23, human VH3-53, human Vkl-27, and/or Vk3-20 framework regions, wherein the two C-terminal amino acids of human FR2 are optionally-non-human, and the two C-terminal amino acids of human FR3 are optionally-non-human.

14. The method of claim 13, wherein (a) the heavy chain CDR3 (CDR H3) sequences comprise a length of between 1 to 50 amino acids; and/or (b) the light chain CDR3 (CDR L3) sequences comprise a length of between 3 to 20 amino acids.

15. The method of claim 1, wherein each of the at least one proteins encoded by the population of 20 or more different nucleic acids further comprises 1, 2, or 3 amino acids C-terminal to the human FR3 and N-terminal to the rabbit CDR3.

16. The method of claim 1, wherein each of the at least one proteins encoded by the population of 20 or more different nucleic acids further comprises 1, 2, or 3 amino acids C-terminal to the rabbit CDR3 and N-terminal to the human FR4.

17. The method of claim 1, wherein each of the at least one proteins encoded by the population of 20 or more different nucleic acids further comprises 1, 2, or 3 amino acids C-terminal to the human FR3 and N-terminal to the rabbit CDR3, and wherein each of the at least one proteins encoded by the population of 20 or more different nucleic acids further comprises 1, 2, or 3 amino acids C-terminal to the rabbit CDR3 and N-terminal to the human FR4.

Description

FIGURES

(1) FIG. 1 shows the PCR results of Example 5 for capturing the Rabbit CDR3 repertoire via Nested PCR. A) Primary PCR. B) Secondary PCR.

(2) FIG. 2 shows in A) to C) the gel purification of the 6 bands P3_23, B3_23, S3_23, P3_53, B3_53 and S3_53 according to the consecutive steps of Example 6.

(3) FIG. 3 shows results of Example 7. A) NcoI/NotI digest performed with a DNA sample from each of the 12 retrieved sub libraries. The control digest was performed using 500 ng DNA, NcoI-HF (NEB) and NotI-HF(NEB) in 20 μl OUTSMART restriction enzyme buffer (NEB) for 1.5 hours at 37° C. B) distribution of lengths of the VL-CDR3 (right column) and of the VH-CDR3 (left column).

(4) FIG. 4 shows results of Example 8. A) Phage recovery after subsequent selection rounds 1 (left column), 2 (middle column) and 3 (right column). B) Phage recovery results after selection round 2. Output of a selection with antigen (right column) is compared to a mock selection round without antigen (left column).

(5) FIG. 5 shows ELISA Results of clones obtained in selection round 2 from PBMC, bone marrow and spleen cells as source of B cells. For each clone, absorbance measured for binding in the presence of the antigen HEL is shown in the left column, and binding in the absence of the antigen HEL is shown in the right column, respectively. Following was observed after sequencing of ELISA hits obtained after selection round 2 and 3: 285 sequences; all in VH3-23 or VH3-53 and Vk1-27 or Vk3-20 framework; mutations in CDR1/2 of VH and VL; 176 unique VH CDR3/VL CDR3 combinations; 140 unique VH CDR3; 161 unique VL CDR3. It was further observed that all acceptor frameworks of the invention were active, and are preferably required for majority immune coverage after immunization.

(6) FIG. 6A) shows Immunization Protocol of Rabbit R24752 with Hen Egg Lysozyme (HEL). B) shows ELISA with serum obtained at day 0, 7, 14 and 21 on lysozyme (HEL) and Bovine serum albumin (BSA).

(7) FIG. 7 shows the organization of Human and Rabbit variable antibody domains. A) Human Variable Antibody Domains. B) Rabbit Variable Antibody Domains.

(8) FIG. 8A) shows an example of a PCR amplification of a Rabbit VH variable region. The nucleotide sequences for both the coding and noncoding DNA strands are disclosed (SEQ ID NOs: 41 and 127, respectively). B) shows an example of a PCR amplification of a Rabbit VL variable region. The nucleotide sequences for both the coding and noncoding DNA strands are disclosed (SEQ ID NOs: 42 and 128, respectively).

(9) FIG. 9 shows an example of human and rabbit Framework 3 and Framework 4 sequences surrounding the CDR3 region of VH and VL domains.

(10) FIG. 10A) shows an example of PCR amplification of a Rabbit VH-CDR3 domain. The nucleotide sequences for both the coding and noncoding DNA strands are disclosed (SEQ ID NOs: 41 and 127, respectively). B) shows an example of PCR amplification of a Rabbit VL-CDR3 domain. The nucleotide sequences for both the coding and noncoding DNA strands are disclosed (SEQ ID NOs: 42 and 128, respectively).

(11) FIG. 11A) shows PCR of a library of Rabbit VH-CDR3 via Rabbit VH-FR3 and VH-FR-4 specific primers. B) shows PCR of a library of Rabbit VL-CDR3 via Rabbit VL-FR3 and VL-FR-4 specific primers.

(12) FIG. 12 shows Ban recognition site in Acceptor Framework. The nucleotide sequences for both the coding and noncoding DNA strands are disclosed (SEQ ID NOs: 46 and 129, respectively).

(13) FIG. 13A) shows sticky ends after BarI digestion of the PCR product containing a library of Rabbit VH-CDR3. B) shows sticky ends after BarI digestion of the VH acceptor library. C) shows sticky ends after BarI digestion of the PCR product containing a library of Rabbit VL-CDR3. D) shows sticky ends after BarI digestion of the VL acceptor library.

(14) FIG. 14 shows step 1 of a preferred method of the invention for generating an scFv library cloned in a phage display vector. Step 1: Cloning of Rabbit VH-CDR3 regions between Human VH-FR3 and Human VH-FR4 regions in an acceptor vector.

(15) FIG. 15 shows step 4 of a preferred method of the invention for generating an scFv library cloned in a phage display vector. Step 4: Assembly of Rabbit VL-CDR3 regions into an acceptor vector containing synthesized Human FR1, FR2 and FR3 domains and a library of CDR1 and CDR2 sequences.

(16) FIG. 16 shows step 7 of a preferred method of the invention for generating an scFv library cloned in a phage display vector. Step 7: Assembly of a VH variable region library containing Human Framework regions FR1, FR2 and FR3 separated by a library of CDR1 and CDR2 sequences and a library of Rabbit CDR3 sequences via overlap PCR.

(17) FIG. 17 shows step 8 of a preferred method of the invention for generating an scFv library cloned in a phage display vector. PCR of the VH variable region library from step 7 containing Human Framework regions FR1, FR2, FR3 and FR4 separated by a library of CDR1, CDR2 and a library of Rabbit CDR3 sequences

(18) FIG. 18 shows step 9 of a preferred method of the invention for generating an scFv library cloned in a phage display vector. Step 9: PCR amplification of a VL variable region library containing the C-terminal part of a Human VH-FR4 domain, a linker sequence, Human VL Framework domain regions FR1, FR2, FR3 and FR4 separated by a library of CDR1 and CDR2 sequences and a library of Rabbit VL-CDR3.

(19) FIG. 19 shows step 10 of a preferred method of the invention for generating an scFv library cloned in a phage display vector. Step 10: PCR assembly via overlap PCR of DNA fragments derived from steps 8 and 9 via their common human VH-FR4 sequence.

(20) FIG. 20 shows oligonucleotides suitable for cloning rabbit-derived CDR3 sequences into an Acceptor Framework by without the use of a restriction enzyme recognition site within the oligonucleotide and/or by overlap PCR

(21) FIG. 21 shows the cloning strategy suitable for cloning rabbit-derived CDR3 sequences into an Acceptor Framework by without the use of a restriction enzyme recognition site within the oligonucleotide and/or by overlap PCR

(22) FIG. 22 shows the superposition of a rabbit antibody and an Acceptor Framework

(23) FIG. 23 shows responding lineages in the antibody sequence repertoire of an immunized rabbit

(24) FIG. 24 shows alignments of CDR-H3 sequences of group A (A) and group B (B). Point mutations within sequences of one VH CDR3 group are most likely the result of in vivo affinity maturation. VH CDR3 sequences of group B occurred exclusively in VH3-53 and would have been lost in libraries which use VH3-23 as acceptor framework.

(25) FIG. 25 shows one representative of identified CDR3 groups and the number of sequences belonging to the respective group. 21 separated groups were present; 2 groups are highly prominent. DDYGD (SEQ ID NO: 43) motive selected throughout different groups. Some of the VL CDR3 occurred in combination with different VH CDR3, indicating VL CDR3 driven selections.

(26) FIG. 26 shows the number of amino acid deviations from the human germline encoded sequence in CDR1 and CDR2 of VH and VL. H1 shows the highest mutation rate. Other regions are more conserved. It was further observed that the mutation pattern in CDR-H2 depends on the Acceptor framework, and that different VH CDR3 groups show different mutation patterns.

(27) FIG. 27 shows the CDR-H3 sequences and affinities of selected group B sequences. It can be seen that multiple affinity maturation variants of the same antibody are humanized.

(28) FIG. 28 shows the SHM distributions. It can be seen that rabbit antibody repertoires appear roughly 83% identical to closest human reference.

(29) FIG. 29 shows the distribution of heavy chain scaffolds in the rabbit antibody repertoire. It can be seen that rabbit antibody repertoires use one dominant heavy chain scaffold.

(30) FIG. 30 shows the distribution of light chain scaffolds in the rabbit antibody repertoire. It can be seen that rabbit antibody repertoires use two dominant light chain scaffolds.

(31) FIG. 31 shows that rabbit CDRs explore a subset of canonical classes in human. First row: rabbit VH; second row: human VH; third row: rabbit VK; fourth row: human VK.

(32) FIG. 32 shows that rabbit has unusually diverse CDR-3L sequences that makes rabbit uniquely suited for mass humanization. A) distribution of length and composition of CDR-3H sequences in rabbit and human; B) distribution of length and composition of CDR-3L sequences in rabbit and human.

(33) FIG. 33 shows V gene diversity in rabbit and human. Rabbit represents a subset of the V-gene diversity space of the human repertoire.

(34) FIG. 34 shows the CDR3L and CDR3H clones frequency and distribution in a post-immunized rabbit. A post-immunized rabbit enriches approximately 200 unique CDR3Hs but >400 CDR3Ls.

(35) FIG. 35 shows that the mass humanization landscapes represent the intermediate average of all possible humanizations

(36) FIG. 36 shows that each CDR-3H-defined rabbit clone can undergo tens of thousands of successful humanizations.

EXAMPLES

(37) The generation of humanized antibodies according to Examples 1 to 11 below was performed by the following steps representing a preferred embodiment of the present invention: a) Immunization of Rabbits b) Lymphocyte Preparation from different organs (Blood, Bone Marrow and spleen) c) RNA Isolation d) Separate PCR of Rabbit VH and VL variable regions e) Separate Nested PCR of Rabbit VH and VL CDR3 f) Cloning and Assembly of Rabbit VH and VL CDR3 to yield Human variable VH and VL fragments g) Cloning of obtained scFv into a phage display vector h) Selection for specificity on antigen i) Characterization of individual antibodies

(38) List of oligonucleotides used in the Examples:

(39) TABLE-US-00003 Primer Sequence in 5′-3′ direction 3-23 sense TCGAGGAACAGCCTGCGCGCCGAGGACACGGCCG TATATTACTGTGCCGCGGCGAAGGACGTCTACGGG CGCCTGGGGCCAGGGGACACTAGTCACCGTCTCAA GCG (SEQ ID No: 1) 3-53 sense TCGAGCAAATGAACAGCCTGCGCGCCGAGGACACG GCCGTGTATTACTGTGCCGCGGCGAAGGACGTCTA CGGGCGCCTGGGGCCAGGGGACACTAGTCACCGT CTCAAGCG (SEQ ID No: 2) Xho VH3-23 AAAAAACTCGAGGAACAGCCTGCG stuf For (SEQ ID No: 3) Xho VH3-53 AAAAAACTCGAGCAAATGAACAGCCTG stuf For (SEQ ID No: 4) Nhe VH stuf TTTTTTGCTAGCGCTTGAGACGGTGACT Rev (SEQ ID No: 5) K-RP TGTTTTACTGTTCTCGATGCC (SEQ ID No: 6) IgG-RP GACTGACGGAGCCTTAGGTTGCC (SEQ ID No: 7) Rab VH1 FP CAGWCRGTGAAGGAGTCCGAGGG (SEQ ID No: 8) Rab VH2 FP CAGTCGBTGGRGGARTYCRGGGG (SEQ ID No: 9) Rab VH3 FP CAGVAGCAGCTGRWGGARTCCRS (SEQ ID No: 10) Rab VH4 FP CAGGAGCAGCWGRAGGAGTCCGG (SEQ ID No: 11) Rab Vk1 FP GCYCAAGKGCYRACCCAGACTSM (SEQ ID No: 12) Rab Vk2 FP GACVYTRTGCTGACCCAGACTSC (SEQ ID No: 13) Rab Vk3 FP GCAGCCGTGMTGACCCAGACWCC (SEQ ID No: 14) Rab Vk4 FP KATGKYRTGATGACCCAGACTSC (SEQ ID No: 15) Rab Vk5 FP GCSCWDGTGMTGACCCAGACTCC (SEQ ID No: 16) Rab Vk6 FP GCCATCRAWATGACCCAGACTCC (SEQ ID No: 17) Rab VH CDR3 TGACCAGTCTGACAGCCGAAGACACGGTACCCTAT BarI For TTCTGTG (SEQ ID No: 18) Rab VH CDR3 CTTAGGTTGCCCTGARGAGAGTATGACSACTTCSCC BarI Rev 1 TGGGCCCCA (SEQ ID No: 19) Rab VH CDR3 CTTAGGTTGCCCTGARGAGAGTATGACSACTTCSCC BarI Rev 2 CTGGCCCCA (SEQ ID No: 20) Rab VH CDR3 CTTAGGTTGCCCTGARGAGAGTATGACSACTTCSCC BarI Rev 3 TGTGCCCCA (SEQ ID No: 21) Rab VLk CDR3 CTCACCATCAGCGGTGTGCAGTGGAAGGATGCTTA BarI For CACTTACTACTGT (SEQ ID No: 22) Rab CDR3 VLK AACTGGATCACGTTTGATTGTAACCTTGCTTCCAGC BarI Rev 1 TCCAAAAGTCAAA (SEQ ID No: 23) Rab CDR3 VLK AACTGGATCACATTTGATTGTAACATTGCTTCCAGC BarI Rev 2 TCCAAAAGCCCAA (SEQ ID No: 24) Rab CDR3 VLK AACTGGATCACCTTCGACGGTAACCTTGCTTCCTCC BarI Rev 3 GCCAAAAGTATTAT (SEQ ID No: 25) Rab CDR3 VLK AACTGGATCACGTTTGATTGTAAGTTTGCTTCCTGG BarI Rev 4 GCCAAAAGTGGAT (SEQ ID No: 26) Rab CDR3 VLK AACTGGATCACGTTTGATCGTAAGCTTGCTTCCCTC BarI Rev 5 GCCAAAAGTGATT (SEQ ID No: 27) Rab CDR3 VLK AACTGGATCACATAGGATCGTAAGCTCGCTTCCTCC BarI Rev 6 GCCAAAAGCAGTT (SEQ ID No: 28) Rab CDR3 VLK AACTGGATCACGTTTGATCGTAAGCTTGCTTCCTTC BarI Rev 7 KCCAAAAGTGATC (SEQ ID No: 29) Rab CDR3 VLK AACTGGATCACCTTTGACSGTAACCTCGCTTCCTCC BarI Rev 8 GCCAAAAGCATTA (SEQ ID No: 30) Rab CDR3 VLK AACTGGATCACRTTTGATCGTAACCATGCTTCCTGA BarI Rev 9 GCCAAAAGYAAGT (SEQ ID No: 31) Rab CDR3 VLK AACTGGATCACGTTTGATCGTAACCTTGCTTCCCGC BarI Rev 10 ACCAAAAGTATTA (SEQ ID No: 32) Rab CDR3 VLK AACTGGATCACGTTTGATTGTAAGTTTGCTTCCTGG BarI Rev 11 GCCAAAAGTGGAT (SEQ ID No: 33) Rab CDR3 VLK AACTGGATCACGTTTGATCGTAAGCTTGCTTCCCTC BarI Rev 12 GCCAAAAGTGGTT (SEQ ID No: 34) Rab CDR3 VLK AACTGGATCACRTTTGATCGTAACCATGCTTCCTGA BarI Rev 13 GCCAAAAGCAAGT (SEQ ID No: 35) B-Nco app8 AAGAAGAAGGTGTTCAATTGGACAAGAGAGAGGCC For A (SEQ ID No: 36) FR3 VH3_23 TAATATACGGCCGTGTCCTCGGCGCGCAGGCTGTT as C (SEQ ID No: 37) VH FR3-23 GAACAGCCTGCGCGCCGAGGACAC For (SEQ ID No: 38) pEX14 Rev GAAAGGCCCAGTCTTTCGACTGAGCC (SEQ ID No: 39) B-NotRev CAGCTTTTGTTCCTAGTGATGGTGATGGTG (SEQ ID No: 40)

Example 1: Generation of VH and VL FR1-CDR1-FR2-CDR2-FR3-(BarI Stuffer)-FR4 Acceptor Libraries

(40) 2 VH and 2 VL libraries, each containing a variability of >10.sup.9 unique sequences, comprised within the CDR1 and CDR2 regions and a BarI recognition site containing stuffer fragment located between FR-3 and FR-4 were synthesized by GeneArt and cloned into bacterial shuttle vectors (Table 1 and Table 2).

(41) TABLE-US-00004 TABLE 1 14AF4B5C- 14AF4B4C-VH3_23 VH3_53 Vector Backbone PUC PUC Resistance gene Bla Bla Germline sequence variable VH-3_23 VH-3_53 fragment Human VH-FR1 + + Designed VH-CDR1 + + Human VH-FR2 + + Designed VH-CDR2 + + Human VH-FR3 + + BarI recognition site containing + + stuffer fragment Human VH-FR4 + + Theoretical diversity  2 × 10.sup.18 4.1 × 10.sup.16  Diversity in synthesized library >1 ×10.sup.11 >1 ×10.sup.11 Diversity in cloned library >1 ×10.sup.9  >1 ×10.sup.9 

(42) TABLE-US-00005 TABLE 2 14AF4B7C- 14AF4B6C VK-1_27 VK-3_20 Vector Backbone pBR322 pBR322 Resistance gene Bla Bla Synthesized DNA Fragment containing Human VH-FR4 fragment + + Linker (Gly.sub.2Ser).sub.6 (Gly.sub.2Ser).sub.6 (SEQ ID NO: 130) (SEQ ID NO: 130) Germline sequence variable VK-1_27 VK-3_20 fragment Human VL-FR1 + + Designed VL-CDR1 + + Human VL-FR2 + + Designed VL-CDR2 + + Human VL-FR3 + + BarI recognition site containing + + stuffer fragment Human VL-FR4 + + Theoretical diversity 4.3 × 10.sup.14  1.5 × 10.sup.16  Diversity in synthesized library >1 ×10.sup.11 >1 ×10.sup.11 Diversity in cloned library >1 ×10.sup.9  >1 ×10.sup.9 

Example 2: Generation of VH Shuttle Vectors

(43) TABLE-US-00006 TABLE 3 Vector name pVH-3_23 stuffer pVH-3_53 stuffer Vector Backbone pBR322 pBR322 Resistance gene Bla Bla Germline VH sequence VH-3_23 VH-3_53 Human FR3 + + BarI recognition site + + containing stuffer fragment Human FR4 + +

(44) To construct the VH shuttle vectors (Table 3), single stranded DNA fragments (3-23 sense and 3-53 sense) containing human FR3 and FR4 regions interspaced with a BarI recognition site were PCR amplified (Table 4) with Pwo Taq MasterMix (NEB) and the indicated primers. The obtained PCR products were purified (PCR purification kit; Qiagen) and digested for 2 hours at 37° C. with the restriction enzymes XhoI (NEB) and NheI-HF (NEB) in a 50 μl reaction in OUTSMART restriction enzyme buffer (NEB). In addition, a pBR322 derived vector was digested for 2 hours at 37° C. with the restriction enzymes XhoI (NEB) and NheI-HF (NEB) in a 50 μl reaction in OUTSMART restriction enzyme buffer (NEB) and dephosphorylated for 40 minutes after the addition of 6.6 μl 10× rAPid buffer and 10 U of rAPid alkaline phosphatase (Roche). The XhoI/NheI digested PCR fragments were ligated into the XhoI/NheI digested and dephosphorylated vector with T4 DNA ligase (NEB), transformed into XL1-Blue bacteria (Agilent) via electroporation and plated on selective LB-agar/Ampicillin (100 μg/ml) plates. The sequence of the plasmids in the obtained colonies was verified via sequencing.

(45) TABLE-US-00007 TABLE 4 Template DNA Forward Primer Reverse Primer 3-23 sense Xho VH3-23 stuf For Nhe VH stuf Rev 3-53 sense Xho VH3-53 stuf For Nhe VH stuf Rev

Example 3: Immunization of Rabbits and ELISA

(46) New Zealand white rabbits, 12 weeks of age, were immunized with lysozyme (as an exemplary antigen). Antigen (0.3 mg per rabbit) was emulsified with non-toxic highly effective adjuvant containing 92.8% mineral oil, 3.48% TWEEN 80 surfactant, 3.48% Span 80, 0.23% lipo-polysaccharide (BioGenes) and administrated by intramuscular injection. The animals received up to four booster injections each at 1-week intervals. An exemplary immunization protocol is to showed in Table 5:

(47) TABLE-US-00008 TABLE 5 Antigen Immunization Day (μg/Rabbit) Adjuvant Initial 0 300 Adjuvant First boost 14 100 Adjuvant Second boost 21 100 Adjuvant Third boost 28 100 Adjuvant Final boost 37 100 PBS

(48) Blood samples were taken via marginal ear vein and tested by ELISA for antigen specific immune response. The animals which showed a high immune titer were finally boosted and after 5 days, spleen, femurs and blood were extracted.

(49) An enzyme-linked immunosorbent assay (ELISA) was used to measure antigen specific antibody levels in animal sera. Microtiter plates (442404, Thermo-scientific) were coated with 10 μg/ml lysozyme in coating buffer (0.5 M carbonate-bicarbonate buffer, pH 9.6) and incubated at 4° C. overnight. Then, the plates were washed with washing solution (PBS, 0.05% TWEEN 20 surfactant) and blocked with 1% BSA in PBS for 1 hour at room temperature. After washing, 100 μl of diluted sera was added and incubated for 2 hour at room temperature. A negative control was performed with PBS. The plates were washed with washing solution and detected by goat anti-rabbit HRP-conjugated antibody (Ab6721, Abcam) diluted 1:20000 in blocking buffer. After washing, each well was incubated with 100 μl of TMB (50-76-00, KPL) substrate in the dark at room temperature for 15 minutes. Then, the reaction was stopped by adding 50 μl of 0.5 M H2504. The optical density (OD) of the each well was measured at 450/540 nm on a plate reader (TECAN, infinite M1000).

(50) Single-cell suspension from spleen and bone marrow were obtained by sieving the corresponding tissues through a cell strainer. The cells were washed 2 times with DPBS and suspended in 10 ml PBS. Mononuclear cells (MNC) from different organs (spleen, bone marrow and Blood) were purified on Histopaque-1007 (10771, Sigma-Aldrich). Briefly, 2 times in PBS diluted 10 ml blood or the 10 ml single-cell suspension obtained from spleen and bone marrow were layered over 20 ml of Histopaque-1077 and centrifuged at 400 g, 60 min at 25° C. MNC containing interphase above the barrier between Histopaque-1077 and serum were collected and centrifuged at 960×g, 5 min at 4° C.

Example 4: RNA Isolation and cDNA Synthesis

(51) Total RNA was isolated from 10.sup.6-10.sup.7MNC derived from blood, bone marrow or spleen with a SV Total RNA Isolation System kit (Promega) according to the manufacturer's protocol. Elution of the RNA was performed with 100 μL Nuclease-free water.

(52) Primers IgG-RP and K-RP (Table 6) were diluted to 2 μM in DEPC treated water (SIGMA). Approximately 10-1000 ng RNA was melted for 5 minutes at 65° C. and cooled on ice. Subsequently, cDNA was prepared by addition of SuperScript III First-Strand Synthesis SuperMix/RNaseOut (Life Technologies) reaction mix and incubation for 1 hour at 50° C. Finally, the reverse transcriptase was inactivated by heating the reaction mixture to 85° C. for 5 minutes.

(53) TABLE-US-00009 TABLE 6 RNA source PBMC Bone Marrow Spleen Kappa cDNA primer K-RP K-RP K-RP IgG cDNA primer IgG-RP IgG-RP IgG-RP

Example 5: Capturing of the Rabbit CDR3 Repertoire Via Nested PCR and Subsequent Cloning

(54) TABLE-US-00010 TABLE 7 Primer combination for Primary PCR PCR fragment VL Forward primer VL Reverse Primer Rabbit VH1 RabVH1 FP IgG-RP Rabbit VH2 RabVH2 FP IgG-RP Rabbit VH3 RabVH3 FP IgG-RP Rabbit VH4 RabVH4 FP IgG-RP VH-Forward primer VH Reverse Primer Rabbit VK1 Rab Vk1 FP K-RP Rabbit VK2 Rab Vk2 FP K-RP Rabbit VK3 Rab Vk3 FP K-RP Rabbit VK4 Rab Vk4 FP K-RP Rabbit VK5 Rab Vk5 FP K-RP Rabbit VK6 Rab Vk6 FP K-RP

(55) TABLE-US-00011 TABLE 8 Primer combination for Secondary PCR PCR fragment VH-CDR3 Forward primer VH-CDR3 Reverse primer Rabbit Rab VH CDR3 BarI For Rab VH CDR3 BarI Rev 1 VH-CDR3_1 Rabbit Rab VH CDR3 BarI For Rab VH CDR3 BarI Rev 2 VH-CDR3_2 Rabbit Rab VH CDR3 BarI For Rab VH CDR3 BarI Rev 3 VH-CDR3_3 VL-CDR3 Forward primer VL-CDR3 Reverse primer Rabbit VL-CDR3_1 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 1 Rabbit VL-CDR3_2 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 2 Rabbit VL-CDR3_3 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 3 Rabbit VL-CDR3_4 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 4 Rabbit VL-CDR3_5 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 5 Rabbit VL-CDR3_6 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 6 Rabbit VL-CDR3_7 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 7 Rabbit VL-CDR3_8 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 8 Rabbit VL-CDR3_9 Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 9 Rabbit VL- Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 10 CDR3_10 Rabbit VL- Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 11 CDR3_11 Rabbit VL- Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 12 CDR3_12 Rabbit VL- Rab VLk CDR3 BarI For Rab CDR3 VLK BarI Rev 13 CDR3_13

(56) For the primary PCR, the Rabbit VH and VL regions were PCR amplified from 2.5-250 ng of cDNA with 10 μM primers (Table 7) using Phusion DNA polymerase (NEB), Phusion buffer (NEB) and 10 mM dNTPs (Sigma) in a 50 μl reaction. The obtained VH and VL variable region PCR fragments (±300-400 base pairs) were purified with a NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). For amplification of the VH and VL CDR3 regions with flanking BarI restriction sites, a secondary PCR was performed on pooled purified VH and VL fragments with 10 μM biotinylated primers (Table 8), Phusion DNA polymerase (NEB), Phusion buffer (NEB) and 10 mM dNTPs (Sigma) in 50 μl reactions. The obtained VH-CDR3 (90-150 base pairs) and VL-CDR3 fragments (90-140 base pairs) were purified with a NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel) but eluted with Qiagen elution buffer.

(57) 0.5-1 μg of the obtained VH- and VL-CDR3 PCR products were digested in a 50 μl reaction with 5-10 U BarI (SibEnzyme) in SEBuffer 2K for 3 hours at 37° C. To remove the flanking regions from the Rabbit VH and VL CDR3 DNA fragments, the BarI digested samples were incubated in the presence of 1M NaCl with 40 μl of Streptavidin beads (Dynabeads M-280 Invitrogen), 2× prewashed with 200 μl of Tris buffered saline (TBS); pH 7.5) at room temperature. After agitating at 800 rpm for 20-30 minutes the beads were pelleted by a magnet and the supernatant retrieved.

(58) The VH shuttle vectors for VH-CDR3 and the acceptor vectors for VL-CDR3 (10 μg) were digested with BarI in a 50 μl reaction with 10-20 U BarI (SibEnzyme) in SEBuffer 2K for 3 hours at 37° C. 10 μl of 10×rAPid buffer (Roche) was added and the vector fragments were dephosphorylated with 10 U rAPID for 40 minutes (Roche). After inactivation for 5 minutes at 75° C. and purification with a PCR cleanup kit (Qiagen) the purified DNA was used for ligation with the BarI digested VH-CDR3 and VL-CDR3 fragments with T4 DNA ligase (Roche) in ligation buffer (Roche) for 18 hours at 4° C. The DNA in the ligation mix was purified with Oligo Clean & Concentrator kit (ZymoResearch), eluted in 16 μl H.sub.2O and used for electroporation of XL1-Blue bacteria. After 1 hour of incubation in SOC medium, the bacteria were plated on selective LB-Ampicillin (100 μg/ml) agarose plates and incubated overnight at 37° C. The obtained colony numbers are described in Table 9.

(59) TABLE-US-00012 TABLE 9 Library complexity in Acceptor vectors PBMC (P) Bone Marrow (B) Spleen (S) VH-CDR3 1.3 × 10.sup.6 2.7 × 10.sup.5 6.9 × 10.sup.5 VL-CDR3 7.8 × 10.sup.5 4.8 × 10.sup.5 5.7 × 10.sup.5

(60) The VH libraries containing the synthetic variation in CDR1 and CDR2 and the libraries containing rescued Rabbit VH-CDR3 repertoire were first PCR amplified separately (Table 10). The human VHFR1-VHFR3 library (±325 base pairs), including the variegated VH-CDR1 and VH-CDR2 regions, was amplified from the GeneArt VH libraries with a primer preceding the VH-FR1 region and a reverse primer which is complementary to the human FR3 region. The Rabbit VH-CDR3 repertoire was PCR-amplified (±160-180 base pairs) from DNA, obtained from the PBMC, bone marrow and spleen derived libraries, with a primer annealing in the human FR3 region and a primer annealing in the plasmid sequence 3′ from the FR4 region.

(61) TABLE-US-00013 TABLE 10 Natural diversity in Rabbit VH-CDR3, which is located between Human FR3 Synthetic Variation in and Human FR4 in the VH shuttle CDR1 and CDR2 libraries Libraries Bone pVH-3_23 pVH3_53 PBMC (P) Marrow (B) Spleen (S) Forward Primer B-Nco B-Nco app8 VH FR3-23 VH FR3-23 VH FR3-23 app8 For For For For For Reverse Primer FR3 FR3 pEX14 Rev pEX14 Rev pEX14 Rev VH3_23 VH3_23 as as

(62) The DNA from the two libraries was assembled via PCR based on the overlap within the human FR3 regions which is present in both fragments. First 10 PCR cycles were performed without primers using an annealing temperature/extension temperature of 68° C. for 45 seconds, followed by 20 cycles with the outer primers B-Ncoapp8For and pEX14Rev and an extension time of 50 seconds at 68° C. The obtained 6 bands (P3_23, B3_23, S3_23, P3_53, B3_53 and S3_53) were gel purified with a gel purification kit (Macherey-Nagel) followed by a second purification with a PCR purification kit (Macherey-Nagel).

(63) Amplification of VL variable fragments from the six libraries with oligonucleotides SpeHuVHFR4For and B-NotRev was performed in a 50 μl reaction using ca. 100 ng of the GeneArt VL derived library, in which the Rabbit derived VL-CDR3 was inserted, as DNA template. The PCR conditions with Phusion DNA polymerase (NEB) were as follows: 30 seconds denaturation at 95° C., followed by 20 cycles of 20 seconds denaturation at 95° C., 20 seconds annealing at 60° C. and a 20 seconds extension at 72° C. The 20 cycles were followed by an additional 3 minutes extension at 72° C. The six obtained fragments (P1-27, P3-20, B1-27, B3-20, S1-27 and S3-20) were gel purified with a gel purification kit (Macherey-Nagel).

Example 6: Generation of scFv Library

(64) Because the VH and VL libraries share a VH-FR4 framework region, this common DNA element was used to assemble the fragment into complete scFv encoding libraries (Table 11) via overlap PCR.

(65) TABLE-US-00014 TABLE 11 PBMC (P) Bone Marrow (B) Spleen (S) VH P3_23 P3_53 B3_23 B3_53 S3_23 S3_53 VK P1- P3- P1- P3- B1- B3- B1- B3- S1- S3- S1- S3- 27 20 27 20 27 20 27 20 27 20 27 20 scFv 1 2 3 4 5 6 7 8 9 10 11 12 Li- brary

(66) VH (120 ng) and VK (140 ng) DNA fragments were added to a PCR mix containing 10 mM dNTPs (Invitrogen), Phusion DNA polymerase (NEB) in Phusion HF buffer(NEB) in a final volume of 50 μl. After an initial denaturation for 30 seconds at 95° C., 25 PCR cycles were performed without primers using a melting temperature of 95° C. for 20 seconds, an annealing temperature of 65° C. for 60 seconds and an extension at 68° C. for 60 seconds, followed by 15 PCR cycles with the biotinylated outer primers B-Ncoapp8For and B-NotRev applying a melting temperature of 95° C. for 20 seconds and an extension time of 50 seconds at 68° C. The 15 cycles were followed by an additional 3 minutes extension at 68° C.

(67) The obtained scFv library encoding DNA fragments were purified with a PCR purification kit (Macherey-Nagel) and digested for 1 hour at 37° C. with NcoI-HF(NEB) and NotI-HF(NEB) in OUTSMART restriction enzyme buffer(NEB). After inactivation of the enzymes at 80° C. for 20 min, 16 μl of 5M NaCl was added and, to remove the biotinylated digested ends, the mixture was applied to streptavidin beads and incubated for 45 minutes at 25° C. Subsequently, the beads were pelleted with a magnet and the DNA was extracted from the supernatant with a PCR purification kit (Macherey-Nagel).

(68) Phagemid vector was digested NcoI-HF(NEB) and NotI-HF(NEB) in OUTSMART restriction enzyme buffer(NEB) for 2 hours at 37° C. Then, 10 μl of 10×rAPid buffer (Roche) was added and the vector fragments were dephosphorylated with 10 U rAPID for 40 minutes (Roche). After inactivation for 5 minutes at 75° C. and purification with a PCR cleanup kit (QIAGEN) the purified scFv library encoding DNA was used for the ligation.

Example 7: Generation of the Assembled scFv Antibody Phagemid Libraries in E. coli

(69) For the ligation 500 ng NcoI/NotI digested and dephosphorylated phagemid vector was mixed with ±300 ng of NcoI/NotI digested scFv encoding DNA (ratio vector:insert=1:3) and ligated with T4 DNA ligase (Roche) in ligase buffer (Roche) for 18 hours at 4° C. Prior to the transformation, the ligated DNA was purified with a ZymoResearch kit and eluted in 15 μl H.sub.2O. The transformation was performed by adding 2 μl of the purified DNA to 40 μl of electrocompetent XL1-Blue cells (Agilent) and electroporation. After 1 hour of incubation in SOC medium at 37° C., the bacteria were plated on selective LB-Ampicillin (100 μg/ml) agarose plates and incubated overnight at 37° C. The total of obtained colony numbers is described for each organ in Table 12.

(70) TABLE-US-00015 TABLE 12 Library size Bone Marrow 2.7 × 10.sup.8 PBMC 2.4 × 10.sup.8 Spleen 2.4 × 10.sup.8

(71) To show that the majority of the obtained scFv library contained an insert of the expected size (±850 base pairs), an NcoI/NotI digest was performed with a DNA sample from each of the 12 retrieved sub libraries. The control digest was performed using 500 ng DNA, NcoI-HF (NEB) and NotI-HF(NEB) in 20 μl OUTSMART restriction enzyme buffer (NEB) for 1.5 hours at 37° C.

(72) Further quality control was performed by analyzing the scFv encoding DNA in the libraries via sequencing of 96 individual clones. Both the two VH and VL libraries were found to be evenly distributed and to have an intact open reading frame (Table 13). In addition, the length of the VL-CDR3 was distributed between 7 and 13 amino acids and for the VH-CDR3 between 5 and 21 amino acids.

(73) TABLE-US-00016 TABLE 13 Frequency of VH/VL families VH-3_23 33 VH-3_53 48 VK1-27 34 VK3-20 38

(74) To assess the variation within the CDR3 regions, the VH- and VL-CDR3 sequences of ±100 clones were analyzed and most of the CDR3 were found to be unique (Table 14).

(75) TABLE-US-00017 TABLE 14 Number of clones Occurrence VH-CDR3 VL-CDR3 1 x 76 111 2 x 4 5 3 x 2 0 4 x 0 1 5 x 1 0

Example 8: Phage Rescue and Selection of Specific Libraries

(76) For phage production, the cultures were inoculated from glycerol stocks of the 3 libraries (P, B, and S) in 250 ml LB-GAT to an OD.sub.600 of 0.05 in a 2 L flask 200 rpm at 37° C. At OD.sub.600 of 0.5-0.7, the bacteria were infected with M13K07-helperphage (moi of 10) and incubated for 30 minutes at 37° C. without agitation, followed by incubation for 30 minutes at 37° C. with 200 rpm. The medium was changed via centrifugation at 3000 rpm in a HERAEUS Megafuge 1.0 for 15 minutes, the supernatant discarded, and the pellet resuspended in 200 ml LB.sub.AK (ampicillin 100 μg/ml, Kanamycin 50 μg/ml) medium and incubate over night at 30° C. with 200 rpm.

(77) The bacterial debris was removed via centrifugation (Sorvall SLA3000) for 20 minutes at 6000 rpm. After addition of 0.15 vol of PEG/NaCl to the supernatant, followed by incubation on ice for 1.5 hour, the phages were pelleted for 1 hour at 10.000 rpm at 4° C. (Sorvall SLA3000). The supernatant was removed and the phage pellets were resuspended in 40 ml phage dilution buffer and transferred into a 50 ml falcon tube. After gently agitation for 30 min at 4° C., the PEG precipitation was repeated with the addition of 0.15 vol of PEG/NaCl and incubation on ice for 30 min. The phages were precipitated by centrifugation for 30 min 4000 rpm at 4° C. (Sorvall F13S-14x50cy) and the supernatant discarded. The pelleted phages were gently resuspended in phage dilution buffer, centrifuged at 15.000 g for 30 min at 4° C. (Sorvall F13S-14x50cy), the supernatant was transferred into a new tube, and, after addition of 50% glycerol to the supernatant to obtain a final 20% concentration, the phage were stored at −80° C.

(78) Phage titers were determined via infection of XL1-Blue with serial dilutions of the obtained phage and subsequent plating on LB-GAT plates. Selection of specific phage from each of the three scFv phagemid libraries (P, B and S) was performed after 3 subsequent depletion steps: 2×a 1 hour depletion of 5×10.sup.11 rescued phage on 250 μl of blocked StreptavidinDynabeads (M-280 Life Technologies) in 2 ml PBS containing 4% Biotin Free-milk (LabScientific) at RT, followed by an overnight depletion at 4° C.

(79) For the first round of selection, the StreptavidinDynabeads were removed with a magnet and the supernatant was incubated with biotinylated lysozyme (100 nM) in 2 ml PBS containing 4% Biotin Free-milk at room temperature. After a 3 hour incubation, the phage-lysozyme mix was added to unused blocked StreptavidinDynabeads and rotated at room temperature for 45 min. The beads were then washed: 10 times with 1 mL PBS, containing 0.1% biotin free-milk and 0.1% TWEEN 20 surfactant, via a repeated short spin, capture of the beads with a magnet followed by removal of the supernatant. For elution, 1 mL of Phage Elution Buffer (0.1 M Gly, pH 2.2+Neutral Red) was added to the washed beads and rotated at room temperature. After 10 min the beads were removed with a magnet and the supernatant containing the eluted phage added to fresh tubes containing 150 μL 2 M TRIS (pH 8) and 150 μL LB.

(80) The neutralized eluted phages were added to 10 mL of actively growing XL1 (OD.sub.600=0.5-0.7), incubated for 30 min at 37° C. without shaking and for 15 min at 37° C. at 150 rpm. The bacteria were pelleted at 4000×g at 4° C. for 10 minutes, the supernatant removed and the pellet was resuspended in 1 mL of LB-GAT medium. Dilutions: 10.sup.−2, 10.sup.−3, and 10.sup.−4 were prepared in LB-GAT and plated on small LB-GAT plates to analyze the phage recovery while the remainder was plated on large LB-GAT plates. After overnight growth, the bacteria were harvested with 6 mL LB-GAT media and after the addition of 50% glycerol to a final 20% concentration, stored as glycerol stock at −80° C. The plates with the serial dilutions indicated that 1×10.sup.5-1×10.sup.6 colonies were obtained from each library

(81) Phage derived from round-I were rescued as described before and applied in the second round of selection, starting with a single depletion step by incubating 2×10.sup.11 rescued phage on 250 μl of blocked StreptavidinDynabeads (M-280 Life Technologies) in 2 ml PBS containing 4% Biotin Free-milk (LabScientific) for 1 hour at RT. The StreptavidinDynabeads were removed with a magnet and the supernatants were incubated with or without Biotinylated lysozyme (100 nM) in 2 ml PBS containing 4% Biotin Free-milk at room temperature. After 3 hour incubation, the phage mixes were added to unused blocked StreptavidinDynabeads and rotated at room temperature for 45 min. The beads were washed, phage eluted, rescued, plated and the bacteria were harvested as described above. The plates with the serial dilutions indicated that 1×10.sup.6-1×10.sup.7 colonies were obtained from the libraries incubated with the biotinylated antigen whereas only 1×10.sup.4-1×10.sup.5 colonies were obtained if the antigen was omitted.

(82) Phage derived from the second round were rescued as described before. Selections on lysozyme were performed initially as described for selection round-II with incubation of 2×10.sup.11 phage and a concentration of 25 nM biotinylated lysozyme and washing as described before. However, after the last washing step the beads were split into two fractions:

(83) A) Eluted and processed as described above

(84) B) Resuspended and incubated with 1 mL of non-biotinylated lysozyme (1 μM) and rotated at RT for 1 hour and then eluted and processed as described above

(85) For both methods, A) panning in solution and B) Off-rate selection, the phage recovery was between 1×10.sup.7 and 5×10.sup.7.

(86) TABLE-US-00018 TABLE 15 Abbre- R1 R2 R3 Library viation 5E+11 phage 2E+11 phage 1E+11 phage PBMC P 100 nM 100 nM biot-HEL 25 nM biot-HEL biot-HEL BM B 100 nM 100 nM biot-HEL 25 nM biot-HEL biot-HEL Spleen S 100 nM 100 nM biot-HEL 25 nM biot-HEL biot-HEL

Example 9: ELISA of Individual scFv

(87) Individual colonies, grown on LB-GAT plates, were used for picking into 2 ml masterblocks (Greiner #780271) with 1.25 ml LB.sub.GAT media and incubated at 37° C./210 rpm. The next day, 70 μl of the overnight culture was inoculated into a new masterblock with 1.25 ml LB.sub.GAT media and cultivated at 37° C. with 200 rpm. After 6 hours, the masterblock was centrifugated at 3800 rpm for 20 minutes at 4° C. (Megafuge 1.0R). The medium was discarded and the pellet resuspended in 1.25 ml LB containing ampicillin (100 ug/ml), Tetracycline (30 μg/ml) and IPTG (1 mM) and incubated overnight at 21° C. with 200 rpm. The following day, the plates were centrifugated at 3800 rpm for 20 minutes at 4° C. (Megafuge 1.0R) and the media discarded. To extract the scFv, the pellets were resuspended in 400 μl DPBS and 5 cycles of freeze/thawing were applied. After the fifth cycle, 12.8 μl of DNasel mix (150 μg/mL DNasel, 20 mM MgCl.sub.2, 2 mM MnCl.sub.2 in DPBS) was added to each well and incubated at room temperature with 200 rpm. After a 30 minutes incubation the plates were centrifuged (Megafuge 1.0R) to remove the bacterial debris at 3800 rpm for 20 min at 4° C. and the supernatants transferred to a 0.5 ml plate (Nunc #267334) for storage at −80° C.

(88) For the ELISA, MaxiSorb plates (Nunc) were coated overnight at 4° C. with 50 μl per well of neutravidin (Pierce) at 5 μg/mL in DPBS (Life Technologies), washed 3 times with 300 μl PBS/0.05% TWEEN 20 surfactant and blocked with PBS/0.05% TWEEN 20 surfactant/1% BSA at 200 μl per well. After blocking for 1 hour at room temperature, the plates were washed 3 times with 300 μl PBST. Every first column was incubated at 50 μl per well with biotinylated lysozyme (GeneTex), diluted to 5 μg/ml in PBS/0.05% TWEEN 20 surfactant/1% BSA, and every second column with PBS/0.05% TWEEN 20 surfactant/1% BSA. After 1 hour incubation at room temperature, the plates were washed 3 times with 300 μl PBST per well and subsequently incubated with bacterial scFv extracts at 50 μl/well, such that each scFv was applied in a well with and into a neighbouring well without antigen. After the incubation with scFv, each well was washed 3 times with 300 μl PBST and incubated with 50 μl TMB substrate. After 7.5 minutes the colorimetric reaction was stopped by the addition of 50 μl 0.5M H.sub.2SO.sub.4 per well and the absorbance was measured at 450 nm.

(89) ELISA Results from clones obtained in selection round 2 are shown in FIG. 5.

Example 10: Sequencing of ELISA Hits

(90) Clones with detectable binding in ELISA were inoculated on LB.sub.A agar plates and sent for Sanger sequencing to an external service provider (GATC Biotech AG, Konstanz).

(91) All sequenced clones showed framework regions that correspond to the selected human acceptor frameworks and contained mutations in the CDR1 and CDR2 of the heavy and light chain.

(92) From 285 sequenced clones 176 unique VH CDR3/VL CDR3 combinations with 140 unique VH CDR3 and 161 unique VL CDR3 sequences were identified. Some of the VH CDR3 sequences were clearly related and appear to be the result of the in vivo affinity maturation in the immunized rabbit. As an example some individual sequences of VH CDR3 group A and B are shown in FIG. 24. 21 separated VH CDR3 groups were identified and one representative of each group is included in FIG. 25. A DDYGD (SEQ ID No: 43) motive appears to be favored during selections throughout different VH CDR3 lineages. This motive is present in the biggest VH CDR3 group and occurs in the majority of analyzed sequences.

(93) The VH CDR3 sequences of group A were found in VH3-23 as well as in VH3-53 framework, whereas the group B VH CDR3 sequences appeared exclusively in VH3-53 framework. This large group of affinity matured VH CDR3 sequences would most likely have been lost in libraries using VH3-23 as acceptor framework.

(94) CDR1/2 sequences were compared to the germline encoded sequence of the corresponding acceptor framework and mutations were counted. H1 shows the highest mutation rate, other regions are more conserved (FIG. 26).

(95) The alignment shown in FIG. 9 reveals different mutations that were observed for different VH CDR3 groups and also for different acceptor frameworks within one VH CDR3 group, demonstrating the complexity of the interplay between VH CDR3, acceptor frameworks and beneficial mutations in CDR1/2 that is best addressed with the described libraries.

Example 11: SPR Measurement

(96) The anti-His antibody provided in the anti his capture kit from GE Healthcare (order number 28-9950-56) was coupled to the flow cells of a CM5 chip via amine coupling chemistry. 11668.2 and 11288.1 RU were coupled to Fc1 and Fc2, respectively.

(97) The assay was run in a Biacore X100, according to the following protocol: ScFv were captured in a concentration of 5 μg/ml in Fc2 with a flow rate of 5 μl/min and a contact time of 60 sec. Capture levels ranged from 450 to 1.400 RU. In single cycle experiments with a contact time of 90 sec, a flow rate of 30 μl/min and dissociation time of 300 sec the binding of lysozyme (GeneTex, GTX82960) was measured in series of five two-fold dilutions, spanning a concentration range from 100 to 6.75 nM. Results were corrected by referencing with Fc1, without captured scFv and with a blank without lysozyme for every scFv. The curves were fitted with a 1:1 binding model to determine the Kd, koff and kon values.

(98) The best Kd values were measured for scFv from VH CDR3 group B. Differences in affinities within this group most likely reflect the influence of somatic mutations that happened during affinity maturation in the immunized rabbit (FIG. 27).

(99) Mass humanization of rabbit antibodies according to the present invention delivers multiple humanized antigen-specific hits. It represents a highly potent method to isolate humanized antibodies from rabbit immune repertoires.