Methods for genomic integration for <i>Kluyveromyces </i>host cells
11685934 · 2023-06-27
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
International classification
C12N15/90
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention provides high efficiency targeted and marker-less single or simultaneous multiple integrations using nucleases and a stable plasmid in Kluyveromyces host cells.
Claims
1. A method of modifying a target site in a Kluyveromyces host cell genome, the method comprising: (a) contacting the host cell, which has reduced non-homologous end joining (NHEJ) activity, wherein the NHEJ activity is reduced by integrating a nucleic acid at YKU70 or YKU80 loci. with: (i) a first linear nucleic acid capable of homologous recombination with itself or with one or more additional linear nucleic acids contacted with the host cell, whereby homologous recombination in the host cell results in formation of a circular extrachromosomal nucleic acid comprising a coding sequence for a selectable marker and a stability element comprising a centromere sequence (CEN) sequence at least 95% identical to SEQ ID NO: 2 and an autonomously replicating sequence (ARS) consensus sequence at least 90% identical to SEQ ID NO: 3; (ii) a nuclease capable of cleaving the target site, wherein the nuclease is an RNA guided endonuclease or a meganuclease; and (iii) a donor DNA molecule capable of homologous recombination at the cleaved target site, whereby homologous recombination in the host cell results in integration of the donor linear nucleic acid at the target site; and (b) selecting a transformed host cell expressing the selectable marker.
2. The method of claim 1 , wherein the stability element is at least 95% identical to SEQ ID NO: 1.
3. The method of claim 1, wherein the host cell is K marxianus.
4. The method of claim 1, wherein the nuclease is an RNA-guided DNA endonuclease.
5. The method of claim 1, wherein the nucleic acid integrated at YKU70 or YKU80 loci encodes the RNA guided endonuclease.
6. The method of claim 1, wherein the stability element comprises SEQ ID NO: 1.
7. The method of claim 1, wherein CEN sequence comprises SEQ ID NO: 2 and the ARS consensus sequence comprises SEQ ID NO: 3.
Description
6. BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
7. DETAILED DESCRIPTION OF THE EMBODIMENTS
(8) The present invention provides methods of modifying one or more target sites in a Kluyveromyces host cell genome. The methods of the invention use DNA molecules comprising a stability element of the invention that allows the DNA molecules to remain stable in the host cell for multiple generations.
(9) 7.1 Gap Repair
(10) In some embodiments, modification of the target sites comprises methods which use CRISPR/Cas systems and in vivo assembly of marker and/or gRNA vectors via gap repair, as described in WO2015/095804, which is incorporated herein by reference.
(11) In these methods, the Kluyveromyces host cell, which has reduced non-homologous end joining (NHEJ) activity, is contacted with a linear nucleic acid comprising a stability element of the invention. The linear nucleic acid molecule is capable of homologous recombination with itself or with one or more additional linear nucleic acids contacted with the host cell, whereby homologous recombination in the host cell results in formation of a circular extrachromosomal nucleic acid comprising a coding sequence for a selectable marker and the stability element. The cell also comprises a nuclease capable of cleaving the target site and, optionally, a donor DNA molecule capable of homologous recombination at the cleaved target site, whereby homologous recombination in the host cell results in integration of the donor linear nucleic acid at the target site. Transformed cells are identified by the presence of the selectable marker on the circular extrachromosomal nucleic acid.
(12) The donor DNA molecule is typically heterologous to the host cell and is flanked by nucleotide sequences that are homologous to genomic sequences flanking the target site. In some embodiments, the donor DNA molecule comprises a homologous sequence at the 5′ terminus that is about 70%, 75%, 80%, 85%, 90%, 95% or 100% homologous to a 5′ region of a selected genomic target site In some embodiments, the donor DNA molecule comprises a homologous sequence at the 3′ terminus that is about 70%, 75%, 80%, 85%, 90%, 95% or 100% homologous to a 3′ region of a selected genomic target site. In some cases, each of the homologous sequences flanking the donor DNA molecule comprises from about 50 to about 1500 nucleotides.
(13) The donor DNA molecule may comprise any nucleic acid of interest. For example, the donor DNA molecule may comprise a gene of interest that can be knocked in to a host genome. In other embodiments, the donor DNA molecule functions as a knockout construct that is capable of specifically disrupting a target gene upon integration of the construct into the target site of the host cell genome, thereby rendering the disrupted gene non-functional. Examples of nucleic acids of interest include, but are not limited to, a protein-coding sequence, a promoter, an enhancer, terminator, transcriptional activator, transcriptional repressor, transcriptional activator binding site, transcriptional repressor binding site, intron, exon, poly-A tail, multiple cloning site, nuclear localization signal, mRNA stabilization signal, integration loci, epitope tag coding sequence, degradation signal, or any other naturally occurring or synthetic DNA molecule. In specific embodiments, the nucleic acid of interest does not comprise a nucleic acid encoding a selectable marker.
(14) NHEJ activity in the host cell may be disrupted in a number of ways. Typically, a gene locus that is involved in NHEJ activity of the cell is disrupted. For example, the YKU70 gene locus may be disrupted, such that NHEJ activity is reduced in the cell. In some cases, the YKU70 gene locus is disrupted by inserting or integrating a nucleic acid encoding an RNA-guided endonuclease in the YKU70 gene locus. The reduction in NHEJ activity can be a reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percent reduction in between these percentages, as compared to a Kluyveromyces cell that does not have a disruption in a gene controlling NHEJ in the cell.
(15) In some embodiments, the RNA-guided DNA endonuclease is provided by introducing a nucleic acid encoding the endonuclease into the host cell. For example, a plasmid or vector comprising a stability element of the invention and a nucleic acid encoding the RNA-guided DNA endonuclease can be introduced into the cell. In some embodiments, the plasmid can further comprise a nucleic acid sequence encoding a selectable marker for maintenance of the plasmid in the host cell. In some embodiments the nucleic acid encoding the endonuclease further comprises a promoter sequence. In some embodiments, the nucleic acid encoding the RNA-guided DNA endonuclease is integrated into genome of the host cell. In certain embodiments, the RNA-guided DNA endonuclease, for example, Cas9, is integrated into the YKU70 gene of the Kluyveromyces host cell, thereby reducing NHEJ activity in the yeast cell. In some embodiments, the nucleic acid encoding the RNA-guided DNA endonuclease is under the control of a constitutive promoter. In some embodiments, the RNA-guided DNA endonuclease can be introduced into the host cell prior to, simultaneously with, or after introduction of the first and second linear nucleic acids. In other embodiments, the RNA-guided DNA endonuclease can be introduced into the host cell prior to, simultaneously with, or after introduction of the first linear nucleic acids, the second linear nucleic acid and the donor DNA molecule.
(16) In some embodiments, the first linear nucleic acid comprises two internal homologous sequences that are capable of homologously recombining with each other, whereby homologous recombination of the internal homologous sequences results in formation of the circular extrachromosomal nucleic acid comprising a stability element of the invention and expressing the selectable marker. Once circularized, the extrachromosomal nucleic acid includes a coding sequence for a selectable marker, and suitable regulatory sequences such as a promoter and/or a terminator that enables expression of the marker in the host cell. Providing the selectable marker on a circular, extrachromosomal nucleic acid, allows markerless integration of one or more donor DNA molecules into a host cell genome, while avoiding the integration of extraneous sequences (i.e., a selectable marker) into the genome and any deleterious effects associated with prolonged marker expression.
(17) In some embodiments, the methods of the invention provide for markerless recovery of a transformed host cell comprising a successfully integrated donor nucleic acid. Such a cell occurs within a frequency of about one every 1000, 900, 800, 700, 600, 500, 400, 300, 200 or 100 contacted host cells, or clonal populations thereof, screened. In particular embodiments, markerless recovery of a transformed host cell comprising a successfully integrated donor nucleic acid occurs within a frequency of about one every 90, 80, 70, 60, 50, 40, 30, 20, or 10 contacted host cells, or clonal populations thereof, screened. In more particular embodiments, markerless recovery of a transformed cell comprising a successfully integrated donor nucleic acid occurs within a frequency of about one every 9, 8, 7, 6, 5, 4, 3, or 2 contacted host cells, or clonal populations thereof, screened.
(18) A variety of methods are available to identify those cells having an altered genome at or near the target site without the use of a selectable marker. In some embodiments, such methods seek to detect any change in the target site, and include but are not limited to PCR methods, sequencing methods, nuclease digestion, e.g., restriction mapping, Southern blots, and any combination thereof. Phenotypic readouts, for example, a predicted gain or loss of function, can also be used as a proxy for effecting the intended genomic modification(s).
(19) In some embodiments, the first linear nucleic acid comprising a selectable marker is capable of recombining with a second linear nucleic acid encoding, for example, one or more gRNAs. After introduction of the first and second linear nucleic acids, the first and second linear nucleic acids undergo homologous recombination to form a circular, episomal or extrachromosomal nucleic acid comprising the coding sequence for the selectable marker and the one or more gRNAs.
(20) Subsequent to formation of the extrachromosomal nucleic acid comprising the coding sequence for the selectable marker and the gRNA, the gRNA is transcribed from the extrachromosomal nucleic acid and guides the RNA-guided DNA endonuclease expressed in the host cell to a target site in the genome of the host cell, where the endonuclease creates a break at the target site.
(21) In typical embodiments, the methods of the invention are used to integrate a plurality (i.e., two or more) donor DNA molecules into a plurality of target sites of the host cell genome. In these embodiments, the Kluyveromyces host cell is contacted with a first linear nucleic acid and two or more second linear nucleic acid molecules, wherein each second linear nucleic acid molecule comprises a nucleic acid encoding a different gRNA which targets a different site in the host cell genome. Each different second linear nucleic acid can recombine with the first linear nucleic acid to form two or more different, circular, extrachromosomal nucleic acids in the host cell. It is understood that the term “first linear nucleic acid” and “second linear nucleic acid” includes multiple copies of the same nucleic acid molecule. For example, the host cell can be contacted with two or more second linear nucleic acid molecules, wherein each second linear nucleic acid molecule comprises a nucleic acid encoding a different gRNA to target two, three, four, five, six, seven or more different sites in the host cell genome. In some embodiments, once the gRNA guides the RNA-guided endonuclease to two or more target sites, the endonuclease creates a break at the two or more target sites and two or more donor DNA molecules are integrated into the host cell genome via homologous recombination.
(22) In some embodiments, the first linear nucleic acid comprising a selectable marker is a gapped vector comprising a pair of homologous flanking sequences that recombine with a pair of homologous sequences flanking the gRNA cassette in the second linear nucleic acid to form a larger circular vector where the gap has been repaired by inserting the second linear nucleic acid into the gapped vector. In some embodiments each homologous flanking sequence of the pair of homologous flanking sequences in the first nucleic acid contains a recombination region comprising a nucleotide sequence of sufficient length and sequence identity that allows for homologous recombination with the pair of homologous flanking sequences in the second linear nucleic acid, but not with other regions of the first or second linear nucleic acid participating in the in vivo assembly, nor with any genomic regions of the host cell. For in vivo assembly of marker/gRNA vectors via gap repair and for selection of cells capable of homologous recombination and gap repair, see, for example, Horwitz et al. (Cell Systems 1:88-96 (2015)) and WO2015/095804, both of which are incorporated herein in their entireties by this reference.
(23) In some embodiments, the gRNA is introduced into the cell on circular extrachromosomal nucleic acid (i.e., a plasmid) that is not formed through homologous recombination of linear nucleic acid molecules. In these embodiments, the plasmid comprises a stability element of the invention. These embodiments are used, for example, when integration of a single donor DNA molecule is desired.
(24) Using the methods provided herein, one or more target sites in a host cell genome can be modified with surprisingly high efficiency compared to conventional CRISPR/Cas systems. The efficiency of alteration in a population of cells can be at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% or higher, or any percentage in between these percentages.
(25) As used throughout, a guide RNA (gRNA) sequence is a sequence that interacts with an RNA-guided DNA endonuclease and specifically binds to or hybridizes to a target nucleic acid within the genome of a cell, such that the gRNA and the targeted nuclease co-localize to the target nucleic acid in the genome of the cell. Each gRNA includes a DNA targeting sequence of about 10 to 50 nucleotides in length that specifically binds to or hybridizes to a target DNA sequence in the genome. For example, the DNA targeting sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. Each gRNA contains a gRNA scaffold sequence that binds to the RNA-guided DNA endonuclease that does not comprise the DNA targeting sequence. In some embodiments, the gRNA comprises a crRNA sequence and a transactivating crRNA (tracrRNA) sequence. In some embodiments, the gRNA does not comprise a tracrRNA sequence.
(26) Generally, the DNA targeting sequence is designed to complement (e.g., perfectly complement) or substantially complement the target DNA sequence. In some cases, the DNA targeting sequence can incorporate wobble or degenerate bases to bind multiple genetic elements. In some cases, the 19 nucleotides at the 3′ or 5′ end of the binding region are perfectly complementary to the target genetic element or elements. In some cases, the binding region can be altered to increase stability. For example, non-natural nucleotides, can be incorporated to increase RNA resistance to degradation. In some cases, the binding region can be altered or designed to avoid or reduce secondary structure formation in the binding region. In some cases, the binding region can be designed to optimize G-C content. In some cases, G-C content is preferably between about 40% and about 60% (e.g., 40%, 45%, 50%, 55%, 60%).
(27) Any RNA-guided DNA endonuclease can be used in the methods provided herein. In some embodiments, the RNA-guided DNA endonuclease is an active Cas9 endonuclease such that when bound to a target nucleic acid as part of a complex with a gRNA, a double strand break is introduced into the target nucleic acid. In some embodiments, the double strand break is repaired by HDR to insert a donor DNA molecule into the genome of the host cell. Various Cas9 endonucleases can be used in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3′ of the region targeted by the gRNA can be utilized. As another example, Cas9 proteins with orthogonal PAM motif requirements can be used to target sequences that do not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to, those described in Esvelt et al. (Nature Methods 10: 1116-1121 (2013)).
(28) In some cases, the Cas9 protein is a nickase, such that when bound to target nucleic acid as part of a complex with a gRNA, a single strand break or nick is introduced into the target nucleic acid. A pair of Cas9 nickases, each bound to a different gRNA, can be targeted to two proximal sites of a target genomic region and thus introduce a pair of proximal single stranded breaks into the target genomic region. Nickase pairs can provide enhanced specificity because off-target effects are likely to result in single nicks, which are generally repaired without lesion by base-excision repair mechanisms. Exemplary Cas9 nickases include Cas9 nucleases having a D10A or H840A mutation (See, for example, Ran et al. “Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity,” Cell 154(6): 1380-1389 (2013)).
(29) 7.2 Site-Specific Nucleases
(30) In some embodiments, modification of the target sites comprises methods which use extrachromosomal DNA molecules, which comprise a stability element of the invention and one or more nucleic acid sequence encoding a nuclease, as described in WO 2012/149470, which is incorporated herein by reference.
(31) In these methods, a donor DNA molecule is introduced into a Kluyveromyces host cell, wherein the donor DNA comprises a nucleic acid of interest flanked by a first homology region and a second homology region. The first and second homology regions share homology with 5′ and 3′ regions, respectively, of the genomic target site. An extrachromosomal DNA comprising a stability element of the invention and a nucleic acid sequence encoding site-specific nuclease is also introduced to the host cell. The nuclease is capable of recognizing and cleaving a unique recognition sequence (also called a landing pad) within the target site. Upon induction of a double-stranded break within the target site by the site-specific nuclease, endogenous homologous recombination machinery integrates the nucleic acid of interest at the cleaved target site at a higher frequency as compared to a target site not comprising a double-stranded break. This increased frequency of integration obviates the need to co-integrate a selectable marker in order to select transformants having undergone a recombination event.
(32) A variety of methods are available to identify those cells having an altered genome at or near the target site without the use of a selectable marker. In some embodiments, such methods seek to detect any change in the target site, and include but are not limited to PCR methods, sequencing methods, nuclease digestion, e.g., restriction mapping, Southern blots, and any combination thereof.
(33) The methods of the invention can be used for simultaneous genomic integration of a plurality of exogenous nucleic acids of interest using a plurality of site-specific nucleases. These methods, for example, allow for the simultaneous integration of a plurality of genes in a single enzymatic pathway.
(34) As in the case for gap repair embodiments described above, the donor DNA molecule may comprise any nucleic acid of interest. For example, the donor DNA molecule may comprise a gene of interest that can be knocked in to a host genome. In other embodiments, the donor DNA molecule functions as a knockout construct that is capable of specifically disrupting a target gene upon integration of the construct into the target site of the host cell genome, thereby rendering the disrupted gene non-functional. Examples of nucleic acids of interest include, but are not limited to, a protein-coding sequence, a promoter, an enhancer, terminator, transcriptional activator, transcriptional repressor, transcriptional activator binding site, transcriptional repressor binding site, intron, exon, poly-A tail, multiple cloning site, nuclear localization signal, mRNA stabilization signal, integration loci, epitope tag coding sequence, degradation signal, or any other naturally occurring or synthetic DNA molecule. In specific embodiments, the nucleic acid of interest does not comprise a nucleic acid encoding a selectable marker.
(35) As noted above, a double-strand break at a selected target site is induced by site specific endonucleases, for example, site-specific recombinases, transposases, topoisomerases, and zinc finger nucleases, and include modified derivatives, variants, and fragments thereof. The nuclease cleaves the target site at a recognition sequence, that is specifically recognized and/or bound by a double-strand break inducing agent. The length of the recognition sequence can vary, and includes, for example, sequences that are at least 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 or more nucleotides in length.
(36) In some embodiments, the recognition sequence is palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand. In some embodiments, the nick/cleavage site is within the recognition sequence. In other embodiments, the nick/cleavage site is outside of the recognition sequence. In some embodiments, cleavage produces blunt end termini. In other embodiments, cleavage produces single-stranded overhangs, i.e., “sticky ends,” which can be either 5′ overhangs, or 3′ overhangs.
(37) The recognition sequence within the selected target site can be endogenous or exogenous to the host cell genome. When the recognition site is exogenous to the host cell genome, it may be introduced into the host cell genome by any means known to those of skill in the art. For example, the recognition sequence can be introduced using the gap-repair methods described above. The recognition sequence is typically recognized by a naturally-occurring double-strand break inducing agent. Alternatively, a recognition site could be recognized and/or bound by a modified or engineered double-strand break inducing agent designed or selected to specifically recognize the recognition sequence to produce a double-strand break. In some embodiments, the modified double-strand break inducing agent is derived from a native, naturally-occurring double-strand break inducing agent. In other embodiments, the modified double-strand break inducing agent is artificially created or synthesized. Methods for selecting such modified or engineered double-strand break inducing agents are known in the art. For example, amino acid sequence variants of the protein(s) can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations include, for example, Kunkel, (1985) Proc Natl Acad Sci USA 82:488-92; Kunkel, et al., (1987) Meth Enzymol 154:367-82; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance regarding amino acid substitutions not likely to affect biological activity of the protein is found, for example, in the model of Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure (Natl Biomed Res Found, Washington, D.C.). Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be preferable. Conservative deletions, insertions, and amino acid substitutions are not expected to produce radical changes in the characteristics of the protein, and the effect of any substitution, deletion, insertion, or combination thereof can be evaluated by routine screening assays. Assays for double strand break inducing activity are known and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.
(38) Endonucleases useful in the present invention include homing endonucleases, which like restriction endonucleases, bind and cut at a specific recognition sequence. However the recognition sites for homing endonucleases are typically longer, for example, about 18 bp or more. Homing endonucleases, also known as meganucleases, are well known to those of skill in the art and have been classified into the following families based on conserved sequence motifs: an LAGLIDADG homing endonuclease, an HNH homing endonuclease, a His-Cys box homing endonuclease, a GIY-YIG homing endonuclease, and a cyanobacterial homing endonuclease. Examples of homing endonuclease useful in the present invention include , but are not limited to: H-Drel, I-Seel, I-SceII, I-SceIII, I-SceIV, I-SceV, I-See VI, ISceVII, I-Ceul, I-CeuAIIP, I-Crel, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-Tlil, I-Ppol, Pi-Pspl, F-Scel, F-SceII, F-Suvl, F-Cphl, F-Tevl, F-TevII, I-Amal, I-Anil, I-Chul, ICmoel, I-CpaI, I-CpaII, I-Csml, I-Cvul, I-CvuAIP, I-Ddil, I-DdiII, I-Dirl, I-Dmol, I-Hmul, IHmuII, I-HsNIP, I-LlaI, I-Msol, I-Naal, I-Nanl, I-NclIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, IPakl, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-Porl, I-PorIIP, I-PbpIP, ISpBetaIP, I-Seal, I-SexIP, I-SneIP, I-Spoml, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, ISsp68031, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-Tevl, I-TevII, I-TevIII, IUarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MgaI, PI-Mtul, PI-MtuHIP PIMtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-Seel, PI-Tful, PI-TfuII, PI-ThyI, PI-Tlil, or PI-TliII, or any variant or derivative thereof.
(39) In some embodiments the nuclease is a TAL-effector DNA binding domain-nuclease fusion protein (TALEN). TAL effectors of plant pathogenic bacteria in the genus Xanthomonas play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes. The TAL-effector DNA binding domain may be engineered to bind to a desired target sequence, and fused to a nuclease domain, e.g., from a type II restriction endonuclease, typically a nonspecific cleavage domain from a type II restriction endonuclease such as FokI, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AlwI. Thus, in preferred embodiments, the TALEN comprises a TAL effector domain comprising a plurality of TAL effector repeat sequences that, in combination, bind to a specific nucleotide sequence in the target DNA sequence, such that the TALEN cleaves the target DNA within or adjacent to the specific nucleotide sequence. TALENS useful for the methods provided herein include those described in WO10/079430 and U.S. Patent Application Publication No. 2011/0145940.
(40) In some embodiments the nuclease is a site-specific recombinase. A site-specific recombinase, also referred to as a recombinase, is a polypeptide that catalyzes conservative site-specific recombination between its compatible recombination sites, and includes native polypeptides as well as derivatives, variants and/or fragments that retain activity, and native polynucleotides, derivatives, variants, and/or fragments that encode a recombinase that retains activity. In some embodiments, the recombinase is a serine recombinase or a tyrosine recombinase. In some embodiments, the recombinase is from the Integrase or Resolvase families. In some embodiments, the recombinase is an integrase selected from the group consisting of FLP, Cre, lambda integrase, and R.
(41) In some embodiments the nuclease is a transposase. Transposases are polypeptides that mediate transposition of a transposon from one location in the genome to another. Transposases typically induce double strand breaks to excise the transposon, recognize subterminal repeats, and bring together the ends of the excised transposon, in some systems other proteins are also required to bring together the ends during transposition. Examples of transposons and transposases include, but are not limited to, the Ac/Ds, Dt/rdt, Mu-Ml/Mn, and Spm(En)/dSpm elements from maize, the Tam elements from snapdragon, the Mu transposon from bacteriophage, bacterial transposons (Tn) and insertion sequences (IS), Ty elements of yeast (retrotransposon), Ta 1 elements from Arabidopsis (retrotransposon), the P element transposon from Drosophila, the Copia, Mariner and Minos elements from Drosophila, the Hermes elements from the housefly, the PiggyBack elements from Trichplusia ni, Tc1 elements from C. elegans, and IAP elements from mice (retrotransposon).
(42) In some embodiments the nuclease is a zinc-finger nuclease (ZFN). ZFNs are engineered double-strand break inducing agents comprised of a zinc finger DNA binding domain and a double strand break inducing agent domain. Engineered ZFNs consist of two zinc finger arrays (ZFAs), each of which is fused to a single subunit of a non-specific endonuclease, such as the nuclease domain from the FokI enzyme, which becomes active upon dimerization.
(43) 7.3 Cell Culture
(44) The Kluyveromyces host cells are cultured using methods well known to those of skill in the art. If a selectable maker is used, the cells are cultured for a period of time sufficient for expression of the selectable marker from the circularized extrachromosomal vector. In some embodiments where the selectable marker is a drug resistance marker, the culturing is carried out for a period of time sufficient to produce an amount of the marker protein that can support the survival of cells expressing the marker in selectable media. In certain embodiments, these conditions also select against the survival of cells not expressing the selectable marker. Selective pressure can be applied to cells using a variety of compounds or treatments that would be known to one of skill in the art. For example, selective pressure can be applied by exposing host cells to conditions that are suboptimal for or deleterious to growth, progression of the cell cycle or viability, such that cells that are tolerant or resistant to these conditions are selected for compared to cells that are not tolerant or resistant to these conditions. Conditions that can be used to exert or apply selective pressure include, but are not limited to, antibiotics, drugs, mutagens, compounds that slow or halt cell growth or the synthesis of biological building blocks, compounds that disrupt RNA, DNA or protein synthesis, deprivation or limitation of nutrients, amino acids, carbohydrates or compounds required for cell growth and viability from cell growth or culture media, treatments such as growth or maintenance of cells under conditions that are suboptimal for cell growth, for instance at suboptimal temperatures, atmospheric conditions (e.g., % carbon dioxide, oxygen or nitrogen or humidity) or in deprived media conditions. The level of selective pressure that is used can be determined by one of skill in the art. This can be done, for example, by performing a kill curve experiment, where control cells and cells that comprise resistance markers or genes are tested with increasing levels, doses, concentrations or treatments of the selective pressure and the ranges that selected against the negative cells only or preferentially over a desired range of time (e.g., from 1 to 24 hours, 1 to 3 days, 3 to 5 days, 4 to 7 days, 5 to 14 days, 1 to 3 weeks, 2 to 6 weeks). The exact levels, concentrations, doses, or treatments of selective pressure that can be used depends on the cells that are used, the desired properties themselves, the markers, factors or genes that confer resistance or tolerance to the selective pressure as well as the levels of the desired properties that are desired in the cells that are selected and one of skill in the art would readily appreciate how to determine appropriate ranges based on these considerations.
(45) The culturing can be performed in a suitable culture medium in a suitable container, including but not limited to a cell culture plate, a flask, or a fermentor. In some embodiments, the culture medium is an aqueous medium comprising assimilable carbon, nitrogen and phosphate sources. Such a medium can also include appropriate salts, minerals, metals and other nutrients. In some embodiments, in addition to the selection agent, the suitable medium is supplemented with one or more additional agents, such as, for example, an inducer (e.g., when one or more nucleotide sequences encoding a gene product are under the control of an inducible promoter), a repressor (e.g., when one or more nucleotide sequences encoding a gene product are under the control of a repressible promoter). Materials and methods for the maintenance and growth of cell cultures are well known to those skilled in the art of microbiology or fermentation science (see, for example, Bailey et al., Biochemical Engineering Fundamentals, second edition, McGraw Hill, New York, 1986). Consideration must be given to appropriate culture medium, pH, temperature, and requirements for aerobic, microaerobic, or anaerobic conditions, depending on the specific requirements of the host cell, the fermentation, and the process. In some embodiments, the culturing is carried out for a period of time sufficient for the transformed population to undergo a plurality of doublings until a desired cell density is reached. In some embodiments, the culturing is carried out for a period of time sufficient for the host cell population to reach a cell density (OD600) of between 0.01 and 400 in the fermentation vessel or container in which the culturing is being carried out. In other embodiments, the culturing is carried for a period of at least 12, 24, 36, 48, 60, 72, 84, 96 or more than 96 hours. In some embodiments, the culturing is carried out for a period of between 3 and 20 days. In some embodiments, the culturing is carried out for a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 days.
(46) In some embodiments of the methods described herein, the methods further comprise the step of eliminating the circularized extrachromosomal vector from the host cell, for example, once a selected host cell has been identified as comprising the desired genomic integration(s). Plasmid-based systems generally require selective pressure on the plasmids to maintain the foreign DNA in the cell. In some embodiments, elimination of a plasmid encoding the selective marker from a selected cell can be achieved by allowing the selected cells to undergo sufficient mitotic divisions such that the plasmid is effectively diluted from the population. Alternatively, plasmid-free cells can be selected by selecting for the absence of the plasmid, e.g., by selecting against a counter-selectable marker (such as, for example, URA3) or by plating identical colonies on both selective media and non-selective media and then selecting a colony that does not grow on the selective media but does grow on the non-selective media.
(47) 7.4 Host Cells
(48) The methods of the invention can be used to modify one or more target sites in a Kluyveromyces host cell genome. The host cell can be any member of the genus Kluyveromyces, including, for example, K. marxianus, K. lactis, K. aestuarii K. africanus, K. bacillisporus K. blattae, K. dobzhanskii, K. hubeiensis, K. lodderae, K. nonfermentans, K. piceae, K. sinensis, K. thermotolerans, K. waltii, K. wickerhamii, and K. yarrowii.
(49) 7.5 Methods of Producing a Product of Interest
(50) As noted above, the donor DNA can be used integrate any desired nucleic acid sequence into the genome of the Kluyveromyces host cell. Thus, the methods of the invention comprise culturing a host cell comprising one or more integrated donor DNA molecules of interest encoding one or more proteins of interest under conditions suitable for production of the protein and recovering the protein produced by the host cell. Methods for preparing purified proteins from cell cultures are well known to those of skill in the art. In some embodiments, the protein of interest is a protein selected from the group consisting of an antibody, an enzyme, a hormone, a growth factor, an anticoagulant, blood factors, an engineered protein, an interferon, an interleukin, a thrombolytic, a viral protein or a bacterial protein.
(51) In some embodiments, one or more secretion signal sequences (e.g., two, three, four, five, six, seven, eight, nine, or ten secretion signal sequences) may be inserted in the donor DNA molecules. The secretion signal sequence encodes a secretion signal peptide that is recognized by the molecular machinery of the host cell, which then secretes the protein from the cell. The choice of a secretion signal peptide may depend on the type of the host cell.
(52) In some embodiments, the nucleic acid sequence(s) encoding the polypeptide of interest may be codon optimized according to codon frequencies of the host cell. Using the codon with the highest occurrence frequency in the host cell may reduce unwanted mutations and improve translation efficiency. The donor DNA molecules may also include appropriate expression control elements known in the art, including promoters, enhancers, selection markers, and transcription terminators well known to those of skill in the art. Methods for expressing therapeutic proteins are known in the art. See, for example, Paulina Balbas, Argelia Lorence (eds.) Recombinant Gene Expression: Reviews and Protocols (Methods in Molecular Biology), Humana Press; 2nd ed. 2004 edition (Jul. 20, 2004); Vladimir Voynov and Justin A. Caravella (eds.) Therapeutic Proteins: Methods and Protocols (Methods in Molecular Biology) Humana Press; 2nd ed. 2012 edition (Jun. 28, 2012).
(53) The methods and compositions described herein are also useful in introducing multiple modifications in the genome of the host cell and thus provide particular advantages for constructing recombinant organisms comprising optimized biosynthetic pathways, for example, towards the conversion of biomass into biofuels, pharmaceuticals or biomaterials. Functional non-native biological pathways have been successfully constructed in microbial hosts for the production of a number of valuable products, including precursors to the antimalarial drug artemisinin, fatty acid derived fuels and chemicals (e.g., fatty esters, fatty alcohols and waxes), methyl halide derived fuels and chemicals, polyketide synthases that make cholesterol lowering drugs, and polyketides.
(54) Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to one or more molecules including in the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.
8. EXAMPLE 1
(55) 8.1 Materials and Methods
(56) 8.1.1. Preparation of K. marxianus Host Strain for CRISPR-Cas
(57) A wild-type K. marxianus strain was used. A S. cerevisiae codon-optimized version of the Streptococcus pyogenes Cas9 gene was fused to an SV40 nuclear localization sequence designed and cloned into an integration cassette under the expression of the S. cerevisiae TEF1 promoter with a CYC1 terminator (Horwitz et al., 2015, Cell Systems (1): 88-96; DiCarlo et al. 2013, Nucleic Acids Res 2013 41(7) 4336-43); see sequence listing). The construct, marked with an hphA (hygromycin resistance) cassette, was stably integrated at the YYKU70 locus of wild-type K. marxianus strain. The integration construct has a nucleic acid sequence of SEQ ID NO: 23. Correct integration at YYKU70 locus was verified by colony PCR reactions.
(58) 8.1.2. Construction of Stable Plasmids for Kluyveromyces
(59) New stable plasmids for replicating and/or expressing a gRNA or nucleases were prepared. The new stable plasmids contain K. marxianus specific stability element comprising a centromere sequence (CEN) and an autonomously replicating consensus sequence (ARS). Plasmid pAM028 contains the CEN/ARS sequences shown in SEQ ID NO:1. Plasmid pAM029 contains the CEN/ARS sequence shown in SEQ ID NO: 4. The “Old pKD1 element plasmid” shown in
(60) Using homologous recombination, the stability element (comprising ARS/CEN sequence shown in SEQ ID NO:1) was cloned into a linearized vector containing a promoter driving RNA expression, terminator, chimeric gRNA sequence, origin of replication, bacterial and yeast antibiotic selection markers. The plasmid is referred to as K. marxianus gRNA entry vector (sequence shown in SEQ ID NO: 21). Once this plasmid was created and verified, it was used to generate a stable plasmid for meganuclease expression (sequence shown in SEQ ID NO: 22). A linear version of this plasmid was generated by PCR with the K. marxianus CEN/ARS, origin of replication, bacterial and yeast antibiotic selection markers. A PCR product containing the f-CphI open reading frame, promoter and terminator was also amplified and cloned into the linear fragment described above.
(61) 8.1.3. Guide-RNA Expression Cassettes
(62) Cas9 protein is targeted to cut sites by association with a generic structural RNA and a specific targeting RNA. The standard “chimeric” configuration was adopted, in which the targeting and structural RNAs are fused to create a single gRNA. Expression of the gRNA construct was driven by the SNR52 polymerase III promoter, with a SUP4 terminator. The gRNA cassette was cloned into low copy, stable vector using the K. marxianus chromosome V CEN/ARS elements by gap repair directly into a Cas9-expressing host strain (Orr-Weaver et al., 1983). The low copy, stable vector for gRNA entry has a sequence shown in SEQ ID NO: 21. In order to gap repair the gRNA cassette/s directly into the expression vector in the host strain, we first generated full-length gRNA cassettes with 500 bp flanking homology to the linearized vector. In certain embodiments, we co-transformed host cells with single or multiple DNA fragments (for multiplexing) containing gRNA cassettes bearing flanking homology to the linear plasmid.
(63) 8.1.4. Selection of Target Sites and Generation of Donor DNA
(64) Candidate CRISPR target sites inside the targeted open reading frames (ORFs) were identified based on the presence of a PAM sequence N(19)NGG. The following genomic loci were selected as target sites: NDT80, YKU80, GAS2, GAL80, and LEU2. The gRNA sequences for these target sites are shown as SEQ ID NOs: 15-20. Donor DNA constructs with 500 bp of flanking homology were generated using standardized linkers for assembly as described in U.S. Pat. No. 8,110,360, which is hereby incorporated by reference in its entirety. See also, Horwitz et al. 2015.
(65) 8.1.5. K. marxianus Transformation Protocol and Genomic Integrations of Markerless DNA
(66) The K. marxianus transformation protocol we developed was a variant of the Gietz et al. 2007 (Nat Protoc 2:31-34) adapted for these strains. After 1-2 days growth on agar plates, single colonies were picked and used to inoculate 3 ml of liquid rich media (e.g., YPD). This liquid culture was growth overnight with shaking and then diluted into fresh media the next morning to an OD of 0.05-0.2. The diluted culture was grown with shaking incubation until an OD of 0.6-0.9, undergoing a minimum of two doublings. 5 ml of culture was harvested for each transformation, centrifuged to precipitate cells (7000×g, 2 minutes) and then resuspended in an equal volume of sterile water. Centrifugation was repeated, and cells were resuspended in 100 mM lithium acetate. Centrifugation was repeated one last time, and cells were resuspended in 100 mM lithium acetate at a volume 250-fold lower than the original volume (e.g., 20 μl for an original volume of 5 ml). To each transformation, 240 μl of 50% PEG solution, 36 μl of 1.5M lithium acetate, 10 μl of boiled salmon sperm DNA, 54 μl transformation DNA mixed with water and 20 μl cell mixture were added. The transformation mixture was briefly vortexed to distribute cells and reagents evenly, followed by incubation at 30° C. for 30 minutes then 42° for 40 minutes. After heat shock, the transformation mixture was centrifuged again at lower speed (3000×g, 2 minutes), followed by aspiration of the PEG suspension and resuspension of the cell pellet in 2 ml liquid rich media. This culture was then incubated with shaking overnight followed by plating onto selective media. Each marker-less integrations were confirmed using a colony PCR.
(67) 8.2 Results and Discussion
(68) 8.2.1. Establishment of High-Efficiency, High Throughput Integrations in Kluyveromyces Using CRISPR-Cas
(69) The molecular biology tools available for Kluyveromyces marxianus (KM) genetic engineering were not as robust as those used in Saccharomyces cerevisiae (SC). Currently, only one report of CRISPR use in K. marxianus for knockouts reliant upon random mutation has been published in the literature. (See Löbs et al. CRISPR-Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus. 2017. Biotechnology for Biofuels). A high-throughput method would require higher rates of marker-less knockout/integration if markerless, multiplex engineering in K. marxianus would be achieved. As used herein, the term “markerless” refers to integration of a donor DNA into a target site within a host cell genome without accompanying integration of a selectable marker. In some embodiments, the term also refers to the recovery of such a host cell without utilizing a selection scheme that relies on integration of selectable marker into the host cell genome. For example, in certain embodiments, a selection marker that is episomal or extrachromasomal may be utilized to select for cells comprising a plasmid encoding a nuclease capable of cleaving a genomic target site. Such use would be considered “markerless” so long as the selectable marker is not integrated into the host cell genome.
(70) The first step toward obtaining higher transformation efficiencies was construction of a more stable plasmid. Previously, a plasmid containing a pKD1-element from K. lactis was used in K. marxianus, and transformants were obtained, but the plasmid was unstable (
(71) The second step towards high genomic integration efficiency was achieved by reducing or eliminating genomic double-strand break repair via NHEJ. NHEJ relies on the YKU complex (a heterodimer of YKU70 and YKU80 proteins) and DNA ligase. By deleting YKU70, the level of NHEJ was greatly reduced. “Gap repair” of plasmids by homologous recombination was achieved. (see
(72) Together, a stable plasmid and elimination of NHEJ led to the first high-efficiency markerless integration in K. marxianus using CRISPR-Cas. In this example, three components were used for efficiently targeted integrations or deletions using CRISPR-Cas: expressed Cas9 protein, gRNA specific for the targeted locus, and donor DNA for repair of the induced double-strand break. A construct for Cas9 expression was previously integrated into a K. marxianus strain, disrupting the YKU70 locus. A chimeric gRNA was expressed from a Nat-marked K. marxianus plasmid using the Saccharomyces cerevisiae pSNR52 promoter and SUP4 terminator. (See Horwitz et al., 2015, Cell Systems, (1)88-96). Donor DNA was supplied as linear MssI-digested fragment with 500 bp of GAL80 upstream and downstream homology flanking a GFP expression construct. When Donor DNA was not supplied, no colonies were recovered. When donor DNA was supplied, many colonies grew. (Data not shown). This phenotype is indicative of double-strand breaks induced by gRNA expression at a single location (GAL80) repaired by homologous recombination with the supplied donor DNA construct. cPCR of 24 colonies of marker-less integration at GAL80 show that 22 out of 24 colonies correctly integrated donor DNA at the target sites. In other words, 92% of the colonies tested by cPCR successfully integrated the GFP sequence in place of the GAL80 open reading frame (ORF).
(73) 8.2.2. CRISPR-Mediated Multiplex, Markerless, Simultaneous Genomic Integration in K. marxianus Host Cells
(74) Several gRNAs for new loci were identified that gave high efficiency, marker-less integration in K. marxianus with CRISPR-Cas system: NDT80, YKU80, GAS2, LEU2, and GAL80. 96-well transformations were performed using the same basic protocol described above. PCR-generated linear gRNA cassettes were co-transformed with PCR-generated linear selectable marker-marked K. marxianus vector. 24 colonies of each type of 1 and 2-locus integration and 32 colonies of each type of 3-locus integrations were verified by colony PCR (cPCR). Rates of successful integration at all attempted loci were 94% at one locus, 34% at two loci and 7% at three loci. 368 colonies were screened by colony PCR. Among these colonies screened, a small proportion of cases (about 5%), no PCR fragment bands were observed on a gel, and these colonies were not included in the calculation of integration efficiencies.
(75) TABLE-US-00001 TABLE 1 Integration Integration Targeted Loci Description of Integration Type Efficiency GAL80 marker-less integration with Single 100% simultaneous gene deletion KU80 marker-less integration with Single 88% simultaneous gene deletion NDT80 marker-less integration with Single 96% simultaneous gene deletion GAS2 marker-less integration with Single 96% simultaneous gene deletion GAL80, marker-less integration with Double 61% NDT80 simultaneous gene deletion GAL80, GAS2 marker-less integration with Double 52% simultaneous gene deletion NDT80, GAS2 marker-less integration with Double 41% simultaneous gene deletion GAL80, KU80 marker-less integration with Double 22% simultaneous gene deletion NDT80, KU80 marker-less integration with Double 38% simultaneous gene deletion KU80, GAS2 marker-less integration with Double 21% simultaneous gene deletion GAL80, marker-less integration with Triple 7% NDT80, KU80 simultaneous gene deletion GAL80, marker-less integration with Triple 0% NDT80, GAS2 simultaneous gene deletion GAL80, marker-less integration with Triple 6% KU80, GAS2 simultaneous gene deletion NDT80, marker-less integration with Triple 13% KU80, GAS2 simultaneous gene deletion
(76) 8.2.3. High-Efficiency Multiplex Integrations in Kluyveromyces Using Meganuclease
(77) CRISPR-Cas system can provide a highly efficient method for multiplex insertion or deletion of genes. However, each locus requires a unique gRNA, increasing the number of components required for each transformation as the number of target loci increases. F-CphI is a meganuclease that cuts a specific 24 bp recognition sequence (“landing pad”). This sequence can be inserted at multiple locations in the genome. Transformation and selection for a single plasmid expressing F-CphI then leads to double-strand breaks at all recognition sites, followed by repair of these breaks by donor DNA containing homologous ends.
(78) A K. marxianus plasmid expressing F-CphI was constructed and tested in several K. marxianus strains. This plasmid was shown to facilitate the excision of antibiotic resistance cassettes flanked by cut sites with sequence repeats and the integration of genes at one, two and three loci in pre-constructed strains. In all cases, the desired genotype was obtained with high efficiency, and colony numbers reduced as more loci were engineered simultaneously. For excision of antibiotic resistance cassettes, 100% of tested colonies successfully removed the cassette. Similarly, 100% of tested single landing-pad colonies integrated the desired DNA, 96% of double landing-pad colonies, and 20% of triple landing-pad colonies. Triple landing-pad strains produced very few colonies (<15/transformation), and were much more variable in integration efficiency (16-100% depending on the transformation).
(79) TABLE-US-00002 TABLE 2 Targeted Integration Integration Loci Description of Integration Type Efficiency KU80 marker-less integration into f-CphI Single 99% landing pad KU80, marker-less integration into f-CphI Double 56% GAS2 landing pad KU80, marker-less integration into f-CphI Triple 8% GAS2, landing pad GAL80
(80) 8.2.4. Compatibility of SC Codon-Optimized Genes and Promoters in Kluyveromyces
(81) Compatibility of SC codon-optimized genes and promoters were tested in K. marxianus. K. marxianus was transformed with a SC codon-optimized nucleic acid encoding fluorescent proteins operably linked by the SC pGAL1/10 bidirectional promoter. Two K. marxianus strains were made, one with the SC pGAL1/10 promoter driving GFP and RFP expression, and one with the K. marxianus pGAL1/10 promoter driving GFP and RFP expression. These constructs were integrated at the GAL80 locus (deleting the GAL80 ORF), and fluorescence was measured in a Tecan plate reader during log-phase growth. Both GFP and RFP were present at similar levels, indicating that in this case, Saccharomyces cerevisiae codon optimization and pGAL1/10 promoter expression were functional. (Data not shown).
(82) The results shown in the Example section illustrate that Kluyveromyces is highly engineerable, allowing multiple genomic integration of heterologous nucleic acids simultaneously. Compared to CHO cells which have a doubling time of about 19-24 hours and a total genetic engineering cycling time (from one transformation to the next transformation) of about three months, Kluyveromyces has a cell population doubling time of about 2 hours and a total cycling time of about two weeks with the new stable plasmids provided in the present invention. The compositions and methods provided herein provide a large step forward in our ability to engineer Kluyveromyces for the production of new biomolecules.
9. EXAMPLE 2
(83) This example presents results of experiments using the stability elements in Table 3. The experiments were carried out generally as described above in Example 1, using the same strain used in Example 1 (referred to as Strain 1) and a second wild-type K. marxianus strain (referred to as Strain 2). The results show successful marker-less triple integrations with three CEN/ARS sequences (CEN/ARS_2, 3 and 5). Rates of triple integration with the CEN/ARS_2, 3 and 5 were 3%, 13% and 3% respectively (of n=30 colonies tested). Rates in Strain 1 are those directly comparable to those found in Example 1. Strain 2 had similar rates of triple integration but did not recapitulate the original data for CEN/ARS_1.
(84) TABLE-US-00003 TABLE 3 CEN/ARS Length Genome Location CEN/ARS_1 1259 bp Chr 5 Strain 1 SEQ ID NO: 1 CEN/ARS_2 1205 bp Chr 6 Strain 1 SEQ ID NO: 4 CEN/ARS_3 2234 bp Chr 3 Strain 1 SEQ ID NO: 7 CEN/ARS_4 1256 bp Chr 5 Strain 2 SEQ ID NO: 13 CEN/ARS_5 232 bp Chr 2 SEQ ID NO: 14 CEN/ARS_6 1157 bp Chr 4 Strain 1 SEQ ID NO: 10
9.1 Materials and Methods
(85) 9.1.1. Computational Search for Additional CEN/ARS Sequences
(86) We searched the K. marxianus genome for three sequence elements (CDE1, CDE2, ARS) within 4000 bp of each other. Each sequence was allowed mismatches, with total homology as low at 5 bp. The percentage of A/T nucleotides was required to be greater than or equal to 60%. We identified 4 chromosomal sequences with this method (CEN/ARS_1 (SEQ ID NO: 1), CEN/ARS_2 (SEQ ID NO: 4), CEN/ARS_3 (SEQ ID NO: 7), and CEN/ARS_6 (SEQ ID NO: 10)). CEN/ARS_5 is published in Cernak and Estrela, bioRxiv doi:10.1101/353680.
(87) 9.1.2. Strains, Gene Loci, gRNA and Donor DNA
(88) Wild-type Strains 1 and 2 were transformed with gRNA vectors containing CEN/ARS elements to confirm CEN/ARS activity in maintaining the plasmid. For CRISPR-Cas engineering, we used the Cas9-integrated strains to perform single, double and triple integrations.
(89) Three K. marxianus gene loci, GAS2, GAL80 and NDT80, were chosen to test the efficiency of CRISPR-Cas engineering. Their corresponding donor DNA fragments contain upstream and downstream sequences of each gene, resulting in gene knockout if successfully integrated. The gRNA sequences for each locus were as follows: GAS2 (SEQ ID NO: 16), GAL80 (SEQ ID NO: 20) and NDT80 (SEQ ID NO: 19).
(90) 9.1.3. Preparation of Nucleic Acids and Transformations
(91) Plasmid containing gRNA or donor DNA was extracted from E. coli culture by miniprep. Using miniprepped plasmid as template, high-fidelity PCR (Phusion polymerase, NEB) was carried out to amplify both gRNAs using primers SEQ ID NO: 24 and SEQ ID NO: 25 (Table 4), and donor DNA fragments were prepared as described in Section 8.1.4, above. Linear gRNA vector was generated by PCR (primers SEQ ID NO: 26 and SEQ ID NO: 27 in Table 4) followed by gel-extraction. Transformations were carried as described in Section 8.1.5, above.
(92) TABLE-US-00004 TABLE 4 SEQ ID NO gRNA sequence purpose SEQ ID NO: 24 CCTTATAAATCAAAAGAATAGACCGAGATAGG gRNA amplification SEQ ID NO: 25 TGTTGTGTGGAATTGTGAGCGG gRNA amplification SEQ ID NO: 26 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC Linear gRNA vector PCR SEQ ID NO: 27 CGATCATTTATCTTTCACTGCGGAG Linear gRNA vector PCR
9.2 Results
(93) 9.2.1. gRNA Vector Stability with New CEN/ARS Elements
(94) In order to test the stability of plasmids containing different CEN/ARS elements. We transformed both Strain 1 and Strain 2 with each CEN/ARS-carrying plasmid. One plasmid that carries a PKD-1 element, as described above, was also tested. Plasmids with CEN/ARS_1, CEN/ARS_2 and CEN/ARS_5 resulted in large, round colonies with smooth edge (
(95) 9.2.2. CRISPR-Cas Markerless Multiplex Transformation in K. marxianus
(96) Three loci, GAS2, NDT80 and GAL80, were chosen for CRISPR-Cas-mediated integration. The 96-well transformation set-up is shown in
(97) Colony PCR was performed to screen for successful integrations at each locus. For single and double integrations, 12 colonies were screened. 30 colonies were tested for triple integrations due to the low integration rate. Results for cPCR screening are shown in
(98) In summary, we have shown that using the new CEN/ARS elements, we are able to achieve simultaneous multiplex integration in K. marxianus.
(99) One or more features from any embodiments described herein or in the figures may be combined with one or more features of any other embodiment described herein in the figures without departing from the scope of the invention.
(100) All publications, patents and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
(101) TABLE-US-00005 Informal Sequence Listing: SEQ ID NO: 1 (CEN/ARS 1) Centromeric DNA elements (CDE) are underlined. Centromere sequence (CEN) is in bold. (SEQ ID NO: 2) ARS consensus sequence is double underlined. (SEQ ID NO: 3) 1 11 21 31 41 GGATCCGATC TCCTTTCATT TCTGATAAAA GTAAGGCTTC TCTATTTACC 51 TTTTAACCTA CATATTCATA GTTGGAAGTT ATCCTTCTAA GTACGTATAC 101 AATATTAATT CAACGTAAAA ACAAAACTTA CTGTAAATAT GTGTAAAAAA 151 AATCTATTAA ATTCATGGCA GTTTCAAGAA AAGAAAACTA TTATGGTCTG 201