USE OF METHYLATION SITES IN Y CHROMOSOME AS PROSTATE CANCER DIAGNOSIS MARKER

20170362663 · 2017-12-21

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a use of methylation sites as a disease diagnosis marker, in particular relating to a use of methylation sites in a Y chromosome as a prostate cancer diagnosis marker. More particularly, the method and criterion for screening methylation sites in chromosomes associated with a disease are established in the present invention, and using prostate cancer as an example, six methylation sites in the Y chromosome associated with the prostate cancer diagnosis are screened out. Methylation sites in the Y chromosome screened can be used for early and rapid diagnosis of the disease as a prostate cancer diagnosis marker.

    Claims

    1. A method and reagent for detecting a methylation level of a methylation site in a Y chromosome in a sample obtained from a subject, wherein the methylation site is one or more selected from the group consisting of cg03052502, cg04462340, cg05163709, cg05544622, cg14466580 and cg27539833, the presence of said methylation being useful for diagnosis for prostate cancer, assessment of a risk for prostate cancer, evaluation of a therapeutic effect on prostate cancer, and screening of a therapeutic drug for prostate cancer;

    2. The use of claim 1, wherein the sample to be tested is selected from the group consisting of tissue, urine and prostatic fluid said urine optionally being obtained following prostate massage.

    3. The use of claim 2, wherein the sample to be tested is selected from the group consisting of urine and prostatic fluid.

    4. The use of claim 3, wherein the methylation site in a Y chromosome is selected from the group consisting of cg05163709 and cg27539833.

    5. The method for detecting a methylation level of a methylation site in a Y chromosome of a sample obtained from a subject as claimed in claim 1, wherein said methylation detection method is selected from the group consisting of pyrosequencing, bisulfite sequencing, quantitative and/or qualitative methylation-specific polymerase chain reaction, southern blotting, restriction landmark genomic scanning, single nucleotide primer extension, CpG island microarray, single nucleotide primer extension (SNUPE), combined sodium bisulfite restriction endonuclease analysis and mass spectrometry.

    6. The method of claim 1, wherein the reagent is an oligonucleotide primer which is used for amplifying a nucleotide sequence comprising methylation site in a Y chromosome.

    7. A kit comprising a reagent for detecting a methylation level of a methylation site in a Y chromosome of a sample obtained from a subject, the kit being useful for one or more application(s) selected from the group consisting of: diagnosis for prostate cancer, assessment of a risk for prostate cancer, evaluation of a therapeutic effect on prostate cancer, and screening of a therapeutic drug for prostate cancer; wherein the methylation site in a Y chromosome is one or more selected from the group consisting of cg03052502, cg04462340, cg05163709, cg05544622, cg14466580 and cg27539833.

    8. The kit of claim 7, wherein the sample to be tested is selected from the group consisting of tissue, urine and prostatic fluid, said urine optionally being obtained following prostate massage.

    9. The kit of claim 8, wherein the sample to be tested is selected from the group consisting of urine and prostatic fluid.

    10. The kit of claim 9, wherein the methylation site in a Y chromosome is selected from the group consisting of cg05163709 and cg27539833.

    11. The kit of claim 7, comprising reagents suitable for detecting methylation in said Y chromosome site, said reagents suitable for a method selected from the group consisting of pyrosequencing, bisulfite sequencing, quantitative and/or qualitative methylation-specific polymerase chain reaction, southern blotting, restriction landmark genomic scanning, single nucleotide primer extension, CpG island microarray, single nucleotide primer extension (SNUPE), combined sodium bisulfite restriction endonuclease analysis and mass spectrometry.

    12. The kit of claim 7, wherein the reagent is an oligonucleotide primer which is used for amplifying a nucleotide sequence comprising a methylation site in a Y chromosome.

    13. A method for detecting a methylation level of a methylation site in a Y chromosome of a sample obtained from a subject; wherein the methylation site is one or more selected from the group consisting of cg03052502, cg04462340, cg05163709, cg05544622, cg14466580 and cg27539833, the presence of said methylation being useful for diagnosis for prostate cancer, assessment of a risk for prostate cancer, evaluation of a therapeutic effect on prostate cancer, and screening of a drug for prostate cancer, the method

    14. The method of claim 13, wherein when the methylation level of one or more sites selected from one or more of cg03052502, cg04462340, cg05544622, cg14466580 and cg27539833 is decreased as compared to a normal sample or a normal reference value, the subject has prostate cancer or is at a high risk for prostate cancer; and when the methylation level of the methylation site of cg05163709 is increased as compared to a normal sample or a normal reference value, the subject has prostate cancer or is at a high risk for prostate cancer.

    15. The method of claim 13 for screening a drug for efficacy for treatment of prostate cancer, wherein an increase in the methylation level of the methylation site selected from one or more of cg03052502, cg04462340, cg05544622, cg14466580 and cg27539833 as compared to levels observed prior to administration of said drug, indicates that said drug has efficacy for the treatment of prostate cancer and wherein a decrease of the methylation level of the methylation site of cg05163709 as compared to levels observed prior to administration of said a drug indicates that said drug has efficacy for the treatment of prostate cancer.

    16. The method of claim 13, wherein the sample to be tested is selected from the group consisting of tissue, urine and prostatic fluid.

    17. The method of claim 13, wherein the sample to be tested is selected from the group consisting of urine, urine obtained after prostate massage and prostatic fluid.

    18. The method of claim 13, wherein the methylation site in a Y chromosome is selected from the group consisting of cg05163709 and cg27539833.

    19. The method of claim 13, wherein said methylation level is determined via a method selected from the group consisting of pyrosequencing, bisulfite sequencing, quantitative and/or qualitative methylation-specific polymerase chain reaction, southern blotting, restriction landmark genomic scanning, single nucleotide primer extension, CpG island microarray, single nucleotide primer extension (SNUPE), combined sodium bisulfite restriction endonuclease analysis and mass spectrometry.

    20. The method of claim 13, wherein the method for detecting a methylation level of a methylation site in a Y chromosome comprises a step of using an oligonucleotide primer which is used for amplifying a nucleotide sequence comprising a methylation site in a Y chromosome.

    21. A biomarker for diagnosis for prostate cancer, assessment of a risk for prostate cancer, evaluation of a therapeutic effect of a reagent on prostate cancer, and screening of a drug for prostate cancer, said biomarker comprising methylation in a Y chromosome at one or more sites selected from the group consisting of cg03052502, cg04462340, cg05163709, cg05544622, cg14466580 and cg27539833.

    22. (canceled)

    23. A method for screening a methylation site in a chromosome associated with a disease, the method comprises: 1) obtaining the patient's disease sample and normal sample; 2) determining the information of methylation of the chromosome in the disease sample and the normal sample; 3) screening a methylation conserved site according to the information of methylation of the chromosome in the normal sample; 4) screening the methylation site in the disease sample having obvious differences from that in the normal sample according to the information of methylation of the chromosome in the disease sample and the normal sample; 5) combining the results from steps 3) and 4) to obtain the methylation conserved site having obvious differences which is the methylation site in the chromosome associated with the disease.

    24. The method of claim 23, wherein the disease is cancer.

    25. The method of claim 23, wherein the disease is prostate cancer and the chromosome is a euchromosome,a Y chromosome or an X chromosome.

    26. The method of claim 23, wherein the sample is derived from tissue comprising cancer cells, blood, urine, feces or tissue fluid, wherein said tissue fluid is optionally prostatic fluid.

    27. The method of claim 23, wherein the methylation conserved site refers to a methylation site having a methylation level with a standard deviation SD value of less than or equal to 0.25 in the normal sample.

    28. The method of claim 23, wherein the methylation site having a difference is at a site at which the change in the methylation level is 0.2 or more and the p value and the q value are both less than or equal to 0.01 when the disease sample is compared with the normal sample; and the change is an increase or a decrease.

    29-30. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0059] FIG. 1 shows the thermal map of the methylation level of 75 conserved sites screened out from the paracancerous tissue.

    [0060] FIG. 2 shows the 37 methylation sites having significant changes screened out through the comparison of the cancer tissue with the paracancerous tissue.

    [0061] FIG. 3 and FIG. 4 show the 75 methylation sites conserved in the paracancerous tissue (FIG. 3), wherein 6 methylation sites have significant changes in the cancerous tissue (FIG. 4).

    [0062] FIG. 5 shows the methylation level of the final 6 sites screened out (the Figure above), and the proportion of the occurrence of significant change of each site in 66 cancerous tissues (the Figure below, the black mark represents the significant change).

    [0063] FIG. 6 shows the DNA methylation level of sites cg05163709 and cg27539833 in the positive and negative prostate puncture biopsies through the detection for a urine sample.

    [0064] FIG. 7 shows the comparison of diagnostic efficiency between the methylation of sites cg05163709 and cg27539833 as a diagnosis marker and the PSA.

    DETAILED DESCRIPTION

    [0065] Although the embodiments of the present disclosure will be described in detail with reference to the following examples, it will be understood by those skilled in the art that the following examples are merely intended to be illustrative of the present disclosure and are not to be construed as limiting the scope of the present disclosure. The Examples in which the specific conditions are not specified are carried out according to the conventional conditions or conditions suggested by the manufacturer. The used reagents or instruments of which the manufacturers are not indicated, are all commercially available conventional products.

    EXAMPLE 1

    Collection and Identification of Cancerous Tissues and Paracancerous Tissues of Prostate Cancer

    [0066] The tissues were collected from prostate cancer patients undergoing cancer cutting operation, the cancerous tissues and paracancerous tissues were distinguished through tissue immune biopsy by an experienced physician, and collected correspondingly (the samples were provided by Shanghai Changhai Hospital).

    EXAMPLE 2

    Screening of Conserved Methylation Sites

    [0067] Paracancerous tissues from 66 cases of patients with prostate cancer were collected and taken, and DNAs were extracted therefrom and amplified (QIAamp DNA Mini Kit (Cat. No. 51306)). Whole genome methylation levels of 66 samples were measured using the DNA methylation chip Illumina 450K (Infinium HumanMethylation450 BeadChip array), the initial data obtained by scanning were processed through the GenomeStudio software according to Illumina's official Methylation Analysis Algorithms to generate the data containing the methylation level at each site for each sample, i.e., Raw data, then the methylation levels of sites after filtration, i.e., Norm data, were given upon the correction and normalization of deviation caused by different types of fluorescence and probe, and site filtration, and the methylation level of each site was represented with β value (0-1). The methylation information in a Y chromosome therein was taken, subjected to analysis and comparision, and 75 methylation conserved sites (SD value≦0.25) were screened out according to the SD values of the methylation levels (β value) between samples. The results were shown in FIG. 1.

    EXAMPLE 3

    Screening of Methylation Sites Having Obvious Differences

    [0068] 37 DNA methylation sites having significant changes in the cancerous tissues were screened out, i.e., the site with a Δβ≧0.2 (i.e., the difference value of β value between the cancerous tissues and paracancerous tissues≧0.2) and a p value≦0.01 according to the comparison of DNA methylation levels (β value) in a Y chromosome between 66 pairs of cancerous tissues and paracancerous tissues using the Illumina Methylation Analyzer (IMA) software package, see FIG. 2.

    EXAMPLE 4

    Screening of Conserved Sites Having Significant Changes

    [0069] According to the results in Example 2 and Example 3, the intersections of both (i.e., the methylation sites which were conserved in the paracancerous tissues and had significant changes in the cancerous tissues) were screened out, there were a total of 6 sites of cg03052502, cg04462340, cg05163709, cg05544622, cg14466580 and cg27539833 (see FIG. 3 and FIG. 4), and the specific information of these 6 sites was as shown in Table 1.

    TABLE-US-00003 TABLE 1 Specific information of methylation sites having significant changes in cancerous tissue UCSC_ UCSC_ Adjust Beta- Mean_PC REFGENE_ REFGENE_ Target ID P-Value Pval Difference a Mean_NA NAME GROUP MAPINFO cg03052502 4.68E−20 4.82E−19 −0.22197 0.750654 0.972621 FAM197Y2 TSS1500 9193029 cg04462340 2.30E−23 3.65E−22 −0.20581 0.718943 0.924757 13911503 cg05163709 9.96E−28 5.42E−26 0.284045 0.345909 0.061864 PRKY TSS1500 7141248 cg05544622 2.47E−19 1.96E−18 −0.20167 0.734588 0.936261 TSPY1;  TSS1500; 9303646 TSPY4 Body cg14466580 1.50E−20 1.73E−19 −0.28341 0.663387 0.946797 10037020 cg27539833 9.32E−23 1.27E−21 −0.25101 0.67675 0.927762 TGIF2LY 3'UTR 3447947

    [0070] These 6 sites were compared and detected in each pair of cancerous tissue-paracancerous tissue to calculate the proportion of the cancerous tissue which indeed had a significant change in the methylation (see FIG. 5). These 6 intersection sites were the conserved sites having significant changes in the methylation level in the cancerous tissues and can be used as markers for the diagnosis for prostate cancer.

    EXAMPLE 5

    Detection of Methylation Levels of Sites cg05163709 and cg27539833 in the Urine Sample

    [0071] The urine samples were obtained from patients with prostate cancer and normal subjects through the prostate massage, and DNAs were extracted therefrom. The methylation levels of sites cg05163709 and cg27539833 were obtained with pyrosequencing, the changes in methylation levels of these two sites in the urine samples were compared and analyzed between the negative and positive specimens from prostate puncture biopsies, as shown in FIG. 7.

    [0072] The sequence of each primer is as follows:

    TABLE-US-00004 cg05163709: F: (SEQ ID NO: 1) GGAAAGGGGTGATTAAATATTTAGTTA; R: (SEQ ID NO: 2) 5′-BIOTIN-CAACCTAATAAAAAACTATACAAACACAT; S-primer: (SEQ ID NO: 3) ATAAGTATGTTTAATTATTGTTTAG. Cg27539833 F: (SEQ ID NO: 4) GGAATAGTTTAGTTAAAGAAAAAGGTTAAGAT; R: (SEQ ID NO: 5) 5′-BIOTIN-AATTTACCACAATACACAAAAAACTAACTACTTA; S-primer: (SEQ ID NO: 6) AGATTTTAGTAGTTTTTTGTCGTTA.

    EXAMPLE 6

    The Superior Diagnostic Efficiency of the Methylation of Site cg05163709 as a Diagnosis Marker Over PSA

    [0073] According to the experimental results of Example 5, the diagnostic efficiencies of the methylation of sites cg05163709 and cg27539833 as diagnosis markers were analyzed by the receiver operating curve (ROC), and it was found that although the area under the curve ROC (AUC) of site cg27539833 (0.729) had no obvious advantage as compared with that of PSA (0.753), the AUC of site cg05163709 (0.944) was significantly superior to that of PSA (0.753), therefore it had higher sensitivity (93.9%) and specificity (83.3%) as a diagnosis marker of prostate cancer.

    [0074] While the specific embodiments of the present disclosure have been described in detail, those skilled in the art will appreciate that according to all teachings that have been disclosed, various modifications and substitutions can be made to those details, all of which are within the protection scope of the present disclosure. The full scope of the present disclosure is given by the appended claims and any equivalents thereof.