POLYPEPTIDE COMPLEX AS POLYPEPTIDE OR PROTEIN DRUG CARRIER, METHOD OF USING THE POLYPEPTIDE COMPLEX, AND FUSION PROTEIN COMPLEX THEREOF

Abstract

The present invention provides a polypeptide complex on the basis of Titin-Telethonin beta-pleated sheet structure as a polypeptide or protein drug carrier, a method of using the polypeptide complex, and a fusion protein complex thereof. The polypeptide complex is capable of maintaining the activity of polypeptide or protein drugs and prolonging the half-life period simultaneously.

Claims

1. A polypeptide complex as a polypeptide or protein drug carrier, comprising: (i) a polypeptide A, which is a polypeptide comprising two Ig domains at an N terminus of a titin molecule, or a homologue, an analogue or a derivative thereof; and (ii) a polypeptide B, which is a polypeptide comprising a beta-pleated sheet region at an N terminus of a Telethonin molecule, or a homologue, an analogue or a derivative thereof, wherein the polypeptide B binds two polypeptides A together to form a beta-pleated sheet structure.

2. The polypeptide complex according to claim 1, wherein in the polypeptide complex, the polypeptide A is a fragment comprising an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6, or a conservative variant, a biologically active fragment or a derivative thereof; and the polypeptide B is a fragment comprising an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2, or a conservative variant, a biologically active fragment or a derivative thereof, and the polypeptide B binds two polypeptides A together to form a beta-pleated sheet structure.

3. The polypeptide complex according to claim 1, wherein in the polypeptide complex, the polypeptide A is a polypeptide fragment comprising a sequence that is at least 60% identical to an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6; and the polypeptide B is a polypeptide fragment comprising a sequence that is at least 60% identical to an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2.

4. The polypeptide complex according to claim 1, wherein in the polypeptide complex, the polypeptide A comprises one of the polypeptides obtained by contiguous or non-contiguous deletion, substitution or insertion of any number of 0 to 36 amino acid residues in an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6; and the polypeptide B comprises one of the polypeptides obtained by contiguous or non-contiguous deletion, substitution or insertion of any number of 0 to 36 amino acid residues in an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2.

5. The polypeptide complex according to claim 1, wherein the polypeptide A and/or the polypeptide B further comprises or is further linked with a protein purification tag sequence, a protein spacer or linker, an enzymatic cleavage site, a regulatory sequence, and/or other non-sequence covalent connections.

6. The polypeptide complex according to claim 1, wherein in the polypeptide complex, the polypeptide A comprises an amino acid sequence as shown at positions 31-221, positions 30-221, positions 29-221, positions 28-221, positions 27-221, positions 26-221, positions 25-221, positions 24-221, or positions 1-221 of SEQ ID NO: 6; and the polypeptide B comprises an amino acid sequence as shown at positions 30-116, positions 29-116, positions 28-116, positions 27-116, positions 26-116, positions 25-116, positions 24-116, or positions 1-116 of SEQ ID NO: 2 or SEQ ID NO: 4.

7. The polypeptide complex according to claim 1, wherein the polypeptide complex comprises a nucleic acid sequence A encoding the polypeptide A and a nucleic acid sequence B encoding the polypeptide B, wherein the nucleic acid sequence A encoding the polypeptide A and the nucleic acid sequence B encoding the polypeptide B are respectively a nucleic acid sequence designed according to codon preference in an organism in which an expression vector is to be constructed.

8. A method of using the polypeptide complex as the polypeptide or protein drug carrier according to claim 1, comprising: inserting or ligating an encoding sequence of one or more polypeptide or protein drugs into one or more suitable sites in an encoding sequence of a polypeptide A and/or a polypeptide B, to obtain a fusion gene; and expressing the fusion gene in an expression system, to obtain a fusion protein of the polypeptide A and/or the polypeptide B containing the polypeptide or protein drug, and then contacting the fusion protein with a partner thereof, to form a fusion polypeptide complex with a therapeutic effect, wherein the partner is the polypeptide A or the polypeptide B which forms a beta-pleated sheet structure with the fusion protein, or another fusion protein of the polypeptide A or the polypeptide B linked with the polypeptide or protein drug.

9. The method according to claim 8, wherein the sites are N terminus, C terminus and two internal loop regions of the polypeptide B, and respective N terminus, C terminus and loop regions of two polypeptides A.

10. A fusion protein complex with a therapeutic effect, comprising a fusion protein formed by a polypeptide or protein drug with a polypeptide A and/or a polypeptide B, and the fusion protein forms a beta-pleated sheet structure with the polypeptide A, the polypeptide B, or an additional fusion protein, wherein the polypeptide A is a polypeptide comprising two Ig domains (Z1Z2) at an N terminus of a titin molecule, or a homologue, an analogue or a derivative thereof; and the polypeptide B is a polypeptide comprising a beta-pleated sheet region at an N terminus of a Telethonin molecule, or a homologue, an analogue or a derivative thereof.

11. The fusion protein complex according to claim 10, wherein in the fusion protein, the polypeptide or protein drug is located at one or more sites of the polypeptide A and/or polypeptide B, including N terminus (NT), C terminus (CT) and two internal loop regions of the polypeptide B, and respective N terminus, C terminus and four loop regions of two polypeptides A.

12. The fusion protein complex according to claim 10, wherein the polypeptide A is a fragment comprising an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6, or a conservative variant, a biologically active fragment or a derivative thereof; and the polypeptide B is a fragment comprising an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2, or a conservative variant, a biologically active fragment or a derivative thereof.

13. The fusion protein complex according to claim 10, wherein the polypeptide A is a polypeptide fragment comprising a sequence that is at least 60% identical to an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6; and the polypeptide B is a polypeptide fragment comprising a sequence that is at least 60% identical to an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2.

14. The fusion protein complex according to claim 10, wherein the fusion protein comprises a fusion protein formed by GLP-1, GLP-1(8G), SST or PYY with the polypeptide A and/or the polypeptide B, and the fusion protein forms a beta-pleated sheet structure with the polypeptide A, the polypeptide B, or an additional fusion protein formed by GLP-1, GLP-1(8G), SST or PYY with the polypeptide A and/or the polypeptide B, wherein the polypeptide A is a polypeptide comprising two Ig domains at the N terminus of the titin molecule, or a homologue, an analogue or a derivative thereof; and the polypeptide B is a polypeptide comprising a beta-pleated sheet region at the N terminus of the Telethonin molecule, or a homologue, an analogue or a derivative thereof.

15. The fusion protein complex according to claim 14, wherein the fusion protein complex is a complex comprising a beta-pleated sheet structure formed by linking a fragment comprising an amino acid sequence as shown at positions 25-161 of SEQ ID NO: 8 or SEQ ID NO: 14, a conservative variant, a biologically active fragment or a derivative thereof, and two fragments comprising an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6, or a conservative variant, a biologically active fragment or a derivative thereof.

16. The fusion protein complex according to claim 14, wherein the fusion protein complex is a complex comprising a beta-pleated sheet structure formed by linking two fragments comprising an amino acid sequence as shown at positions 25-260 of SEQ ID NO: 18, a conservative variant, a biologically active fragment or a derivative thereof, and one fragment comprising an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2 or SEQ ID NO: 4, a conservative variant, a biologically active fragment or a derivative thereof.

17. The fusion protein complex according to claim 14, wherein the fusion protein complex is a complex comprising a beta-pleated sheet structure formed by linking a fragment comprising an amino acid sequence as shown at positions 25-132 of SEQ ID NO: 28, or a conservative variant, a biologically active fragment or a derivative thereof, and two fragments comprising an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6, or a conservative variant, a biologically active fragment or a derivative thereof.

18. The fusion protein complex according to claim 14, wherein the fusion protein complex is a complex comprising a beta-pleated sheet structure formed by linking two fragments comprising an amino acid sequence as shown at positions 25-237 of SEQ ID NO: 30, or a conservative variant, a biologically active fragment or a derivative thereof, and one fragment comprising an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2 or SEQ ID NO: 4, a conservative variant, a biologically active fragment or a derivative thereof.

19. The fusion protein complex according to claim 14, wherein the fusion protein complex is a complex comprising a beta-pleated sheet structure formed by linking a fragment comprising an amino acid sequence as shown at positions 25-153 of SEQ ID NO: 32, or a conservative variant, a biologically active fragment or a derivative thereof, and two fragments comprising an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6, or a conservative variant, a biologically active fragment or a derivative thereof.

20. A fusion protein with a therapeutic effect, comprising a first polypeptide A, a polypeptide B, and a second polypeptide A linked directly or indirectly in sequence, and also one or more polypeptide or protein drugs inserted in or attached to one or more sites in any of the first polypeptide A and the second polypeptide A and/or the polypeptide B, the first polypeptide A and the second polypeptide A and the polypeptide B forms a beta-pleated sheet structure by a flexible linker, wherein the first polypeptide A and the second polypeptide A are polypeptides comprising two Ig domains (Z1Z2) at an N terminus of a titin molecule, or a homologue, an analogue or a derivative thereof; and the polypeptide B is a polypeptide comprising a beta-pleated sheet region at an N terminus of a Telethonin molecule, or a homologue, an analogue or a derivative thereof.

21. The fusion protein according to claim 20, wherein the polypeptide or protein drug is located at one or more sites in any of the first polypeptide A and the second polypeptide A and/or polypeptide B, including N terminus (NT), C terminus (CT) and two internal loop regions of the polypeptide B, and respective N terminus, C terminus and loop regions of the first polypeptide A and the second polypeptide A.

22. The fusion protein according to claim 20, wherein the first polypeptide A and/or the second polypeptide A is a fragment comprising an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6, or a conservative variant, a biologically active fragment or a derivative thereof; and the polypeptide B is a fragment comprising an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2, or a conservative variant, a biologically active fragment or a derivative thereof.

23. The fusion protein according to claim 20, wherein the first polypeptide A and/or the second polypeptide A is a polypeptide fragment comprising a sequence that is at least 60% identical to an amino acid sequence as shown at positions 31-221 of SEQ ID NO: 6; and the polypeptide B is a polypeptide fragment comprising a sequence that is at least 60% identical to an amino acid sequence as shown at positions 30-116 of SEQ ID NO: 2.

24. The fusion protein according to claim 20, wherein the fusion protein comprises a first polypeptide A, a polypeptide B, and a second polypeptide A linked directly or indirectly in sequence, and also one or more polypeptide or protein drugs including GLP-1, GLP-1(8G), SST or PYY inserted in or attached to one or more sites in any of the first polypeptide A and the second polypeptide A and/or the polypeptide B, the first polypeptide A and the second polypeptide A and the polypeptide B forms a beta-pleated sheet structure by a flexible linker, wherein the first polypeptide A and the second polypeptide A are a polypeptide comprising two Ig domains (Z1Z2) at the N terminus of the titin molecule, or a homologue, an analogue or a derivative thereof; and the polypeptide B is a polypeptide comprising a beta-pleated sheet region at the N terminus of the Telethonin molecule, or a homologue, an analogue or a derivative thereof.

25. The fusion protein according to claim 24, wherein the fusion protein is a fragment comprising an amino acid sequence as shown at positions 25-601 of SEQ ID NO: 20, a conservative variant, a biologically active fragment or a derivative thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0072] FIG. 1 is a schematic diagram showing the crystal structure and sites at/into which a drug is to be attached or inserted of a polypeptide complex in the present invention. In FIG. 1, Z1.sub.A and Z2.sub.A respectively represent two Ig domains on one polypeptide chain in the polypeptide complex, and Z1.sub.B and Z2.sub.B respectively represents two Ig domains on the other polypeptide chain in the polypeptide complex.

[0073] FIG. 2A and FIG. 2B are SDS and Native-PAGE of Z1Z2/GLTe (FIG. 2A) and Z1Z2/TeN (FIG. 2B) after purification in Example 1.

[0074] FIG. 3 shows production of Camp by RINm5F cells under stimulation of various concentrations of GLP-1 and ZIZ2/GLTe in Example 1.

[0075] FIG. 4A to FIG. 4G show activity assay results in Example 1. FIG. 4A shows the control effect of a single intraperitoneal injection of 25 nmol/kg Z1Z2/GLTe, Z1Z2/TeN and GLP-1 on blood glucose; FIG. 4B shows the area under the curve (AUC) of FIG. 4A; FIG. 4C shows the changes of insulin content in rat plasma of after a single intraperitoneal injection of 25 nmol Z1Z2/GLTe and GLP-1; FIG. 4D shows OGTT done 24 h after a single intraperitoneal injection of 25 nmol Z1Z2/GLTe; FIG. 4E shows the AUC of test of FIG. 4D; FIG. 4F shows the control effect of various concentrations of Z1Z2/GLTe on blood glucose; and FIG. 4G shows the AUC of test of FIG. 4F. (By comparison of various treatment groups with the PBS group, * represents p<0.05, ** represents p<0.01, and *** represents p<0.001.)

[0076] FIG. 5A and FIG. 5B are curves of active GLP-1 content in rat plasma vs time after intraperitoneal injection (FIG. 5A) and intravenous injection (FIG. 5B) of Z1Z2/GLTe and GLP-1 to rats in Example 1.

[0077] FIG. 6 is a curve showing the long-term control effect on fasting blood glucose in diabetic mice in Example 1.

[0078] FIG. 7A and FIG. 7B show activity assay results in Example 2. FIG. 7A shows results of OGTT test with various concentrations (1, 5, and 25 nmol/kg) of Z1Z2/GLTe-G; and FIG. 7B shows test results of insulin secretion stimulated by various concentrations (1, 5, and 25 nmol/kg) of Z1Z2/GLTe-G. (** represents p<0.01, and *** represents p<0.001.)

[0079] FIG. 8 shows the changes of plasma GLP-1 content after intravenous injection of Z1Z2/GLTe-G to rats in in-vivo stability assay in Example 2.

[0080] FIG. 9 shows SDS and Native-PAGE of GLZ/TeN complex after purification in Example 3.

[0081] FIG. 10A to FIG. 10C show activity assay results in Example 3. FIG. 10A shows the control effect of intraperitoneal injection of 10 nmol/kg GLZ/TeN and Z1Z2/GLTe-G on blood glucose; FIG. 10B shows the area under curve (AUC) of test of FIG. 10A; and FIG. 10C shows the changes of insulin content in rat plasma after a single intraperitoneal injection of 10 nmol/kg GLZ/TeN and Z1Z2/GLTe-G. (By comparison of various treatment groups with the PBS group, * represents p<0.05, ** represents p<0.01, and *** represents p<0.001.)

[0082] FIG. 11 shows the changes of GLZ/TeN complex concentration in rat plasma after intravenous injection (i.v) and subcutaneous injection (s.c) in Example 3.

[0083] FIG. 12A to FIG. 12C show the effect of a single intraperitoneal injection of GLZ/TeN on the food intake and blood glucose level in C57BL/6 mice in Example 3. FIG. 12A shows the inhibition of a single intraperitoneal injection of 20 nmol/kg GLZ/TeN and Z1Z2/GLTe-G on the food intake in mice; FIG. 12B shows the control effect on the blood glucose level in mice; and FIG. 12C shows the AUC of test of FIG. 12B. (By comparison of various treatment groups with the PBS group, * represents p<0.05, ** represents p<0.01, and *** represents p<0.001; and by comparison of the GLZ/TeN with the Z1Z2/GLTe-G group, ## represents p<0.01.)

[0084] FIG. 13A to FIG. 13C show the effect of GLZ/TeN on blood glucose in HFD and STZ-induced diabetic model mice in Example 3. FIG. 13A shows the changes of body weight of C57BL/6 mice; FIG. 13B shows the results of OGTT test; and FIG. 13C shows the control of GLZ/TeN on blood glucose in model mice of type 2 diabetes. (By comparison of various treatment groups with the control group, ** represents p<0.01, and *** represents p<0.001.)

[0085] FIG. 14 shows SDS-PAGE analysis of GLRecom protein purified in Example 4, in which 1-before induction; 2-whole cells after induction; 3-supernatant after induction; 4 and 5-Ni.sup.2+-NTA purification; 6-secondary Ni.sup.2+-NTA purification after cleavage with TEV protease; and 7-purification by Q column.

[0086] FIG. 15A to FIG. 15C show activity assay results in Example 4. FIG. 15A shows the control effect on blood glucose; FIG. 15B shows the AUC of test of FIG. 15A; and FIG. 15C shows the changes of insulin level. (By comparison of various treatment groups with the PBS group, ** represents p<0.01, and *** represents p<0.001.)

[0087] FIG. 16 shows the changes of GLRecom concentration in rat plasma after intravenous injection in Example 4.

[0088] FIG. 17 shows SDS and Native-PAGE of Z1Z2/SSTe after purification in Example 5.

[0089] FIG. 18 shows the changes of growth hormone content in rats in activity assay in Example 5.

[0090] FIG. 19 shows the changes of plasma SST content after intravenous injection of Z1Z2/SSTe to rats in half-life period assay in Example 5.

[0091] FIG. 20 shows the effect of ZSST/TeN complex on the growth hormone content in rats in Example 6.

[0092] FIG. 21 shows the changes of ZSST/TeN complex concentration in rat plasma after intravenous injection in Example 6.

[0093] FIG. 22 shows the effect of Z1Z2/TePY complex on the food intake in mice in Example 7. (By comparison of the Z1Z2/TePY group with the PBS group, * represents p<0.05, ** represents p<0.01)

[0094] FIG. 23 shows the changes of Z1Z2/TePY complex concentration in rat plasma after intravenous injection in Example 7.

DESCRIPTION OF THE EMBODIMENTS

[0095] The present invention will now be further described by way of specific examples. It is to be understood that these examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental methods not specifically specified in the following examples are generally carried out according to conventional conditions, or conditions that can be inferred by the person skilled in the art, or in accordance with the conditions suggested by the manufacturer. The reagents and instruments involved in the following examples are generally commercially available products, or products that can be obtained by other publicly available means.

Example 1: Attachment of GLP-1 to N Terminus of Polypeptide B in Polypeptide Complex

[0096] GLP-1 (Glucagon-like peptide 1) is a glucose-dependent insulinotropic peptide having two active forms, GLP-1 (7-36) amide and GLP-1 (7-37). GLP-1 binds to the GLP-1 receptor which is a G protein-coupled receptors (GPCR) in vivo, promotes insulin secretion from pancreatic islet beta cells, inhibits glucagon secretion, and controls blood sugar, and is effective in the treatment of type 2 diabetes mellitus. However, GLP-1 is degraded by dipeptidyl peptidase IV (DPP-IV) in vivo, and the half-life period is only about 2 min. When GLP-1 is used in clinic, high-dose frequent injections are required, which severely limits the use of GLP-1 as a drug in the clinic.

[0097] Experimental Section:

[0098] 1. Construction of Vector

[0099] A gene sequence encoding Z1Z2 (for example, positions 73-663 of SEQ ID NO: 5, referred to as Z sequence hereinafter) and a gene sequence encoding the N terminus of Telethonin (TeN) (for example, positions 73-348 of SEQ ID NO: 1, referred to as T sequence hereinafter) were cloned via a NcoI/KpnI cleavage site into a modified pET24d vector (by introducing a 6×His tag and a TEV protease cleavage site to pET24d), and Cys in the T sequence was mutated to Ser (Zou P J et al, J Biol Chem. 24 Jan. 2003, 278(4): 2636-2644), to obtain pET-Z1Z2 (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 5) and pET-TeN (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 3) plasmids.

[0100] GLP-1 (7-37) was attached via a linker (GGGGSGGGGSGGGGS) to the N terminus of the T sequence by PCR. The full-length pET-TeN plasmid was amplified by using the primers TeN-F and TeN-R.

[0101] TeN-F: SEQ ID NO: 9, wherein positions 1-48 is codons for the linker;

[0102] TeN-R: SEQ ID NO: 10.

[0103] The full-length GLP-1 gene was amplified by overlap extension, in which the primers were respectively GLP-1-F and GLP-1-R.

[0104] GLP-1-F: SEQ ID NO: 11, wherein 5′-terminal phosphorylation;

[0105] GLP-1-R: SEQ ID NO: 12, wherein 5′-terminal phosphorylation.

[0106] The full-length pET-TeN having (GGGGS).sub.3 was amplified by using TeN-F and TeN-R first, and then the pET-TeN and GLP-1 gene having 5′ phosphate were ligated by a T4 DNA ligase, and transformed. Monoclones were picked up, and the plasmid was extracted and then sequenced. The plasmid sequenced to be appropriate was designated as pET-24d-GLTe, and the sequence excluding the original pET24d vector was as SEQ ID NO: 7, the coding amino acid sequence thereof was as SEQ ID NO: 8. In SEQ ID NO: 8, a TEV protease cleavage site is between positions 25 and 26, positions 3-8 is a 6×His tag, positions 25-55 is the amino acid sequence of GLP-1, and positions 56-70 is a linker.

[0107] 2. Expression

[0108] pET-Z1Z2, pET-TeN, and pET-24d-GLTe were transformed into competent E. coli BL21(DE3) cells. Single colonies were picked into a LB medium containing 60 μg/ml kanamycin, incubated overnight in a shaker at 37° C., sub-inoculated in an amount of 1%, and continuously incubated at 37° C. until the OD600 of the bacterial suspension was about 0.4-0.6. At this time, IPTG was added to a final concentration of 1.0 mmol/L, and the expression was induced at 30° C. for 12 h. After expression, the bacteria were collected by centrifugation for 10 min at 4° C. and 5000 g.

[0109] After collection, the bacteria were re-suspended in an equilibrium buffer (25 mM Tris/HCl, 300 mM NaCl, 10 mM imidazole, pH 8.0), and then homogenized by using a high-pressure cell homogenizer (Guangzhou Juneng Biotechnology Co., Ltd.), followed by centrifugation at 14000 rpm for 30 min.

[0110] For Z1Z2, the supernatant was pipetted onto a Ni.sup.2+-NTA column (equilibrated with an equilibrium buffer); the protein was washed with a washing buffer (25 mM Tris/HCl, 300 mM NaCl, 30 mM imidazole, pH 8.0) and then eluted using a eluting buffer (25 mM Tris/HCl, 300 mM NaCl, 400 mM imidazole, pH 8.0) by using the AKTA purifier 10. The eluate was collected.

[0111] For TeN and GLTe, the supernatant was discarded. The bacteria were re-suspended in an equilibrium buffer containing 8 M urea, and centrifuged at 14000 rpm for 30 min. Then the supernatant was pipetted onto a Ni.sup.2+-NTA column equilibrated with an equilibrium buffer containing 8 M urea. The protein was washed with a washing buffer (8 M urea, 25 mM Tris/HCl, 300 mM NaCl, 30 mM imidazole, pH 8.0) and then eluted using an eluting buffer (8 M urea, 25 mM Tris/HCl, 300 mM NaCl, 400 mM imidazole, pH 8.0) by using the AKTA purifier 10. The eluate was collected.

[0112] 3. Purification

[0113] Equal volume of TeN and GLTe were respectively added dropwise to Z1Z2 with shaking, such that the final concentration of urea was 4 M. Then, the mixed solution was dialyzed for 4 h against a dialysis solution I (25 mM Tris/HCl, 300 mM, pH 8.0), and then dialyzed overnight against a dialysis solution II (25 mM Tris/HCl, pH 8.0). A Z1Z2/TeN complex and a Z1Z2/GLTe complex were finally produced respectively.

[0114] The TEV protease and a TEV protease buffer (50 mM Tris/HCl pH 8.0, 0.5 mM EDTA, 1 mM DTT) were added at a volume ratio of 1/50 to the Z1Z2/TeN complex and the Z1Z2/GLTe complex, and reacted at room temperature for 2 h.

[0115] The Z1Z2/TeN complex and the Z1Z2/GLTe complex cleaved by the TEV protease run through the Ni.sup.2+-NTA column, and the Z1Z2/TeN complex and the Z1Z2/GLTe complex that were no cleaved completely or some impurity proteins were rebound to Ni.sup.2+. Those flowing through were the Z1Z2/TeN complex and the Z1Z2/GLTe complex without His-tag.

[0116] Z1Z2/TeN and Z1Z2/GLTe were further purified by using HiTrap™ Q ion exchange column. Z1Z2/TeN and Z1Z2/GLTe were respectively bound to the Q ion exchange column, and then linearly eluted by using AKTA Purified 0, to respectively obtain high-purity Z1Z2/TeN complex and Z1Z2/GLTe complex.

[0117] 4. Removal of Endotoxins

[0118] The protein expressed by E. coli contained a large amount of endotoxins, which had serious influence on subsequent cell and animal experiments, and needed to be removed. The Z1Z2/TeN complex and the Z1Z2/GLTe complex purified by the Q ion exchange column were added to an endotoxin removal column (ToxinEraser™ Endotoxin Removal kit, Genscript, Nanjing, China) to remove the endotoxins, and the endotoxin content were assayed by using an endotoxin assay kit (ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit, Genscript). The final endotoxin content in the Z1Z2/TeN complex and the Z1Z2/GLTe complex was less than 2 EU/ml.

[0119] 5. GLP-1 Receptor (GLP-1R) Activation Test

[0120] Rat insulinoma cells RINm5F were cultured in a RPMI 1640 medium (Life Technology) containing 10% FBS (Life Technology) in an incubator at 37° C. and 5% CO2. 5000 RINm5F cells were inoculated a 96-well plate, incubated overnight, and then washed twice with a serum-free RPMI 1640 medium. The RINm5F cells were incubated for 20 min respectively with various concentrations of Z1Z2/GLTe complex and GLP-1 (diluted in a serum-free medium, and added with 100 μM IBMX), and then lyzed. The cAMP content in the cells was assayed following the instruction for cAMP-Glo™ Assay kit (Promega).

[0121] 6. Activity Assay

[0122] To determine the control effect of Z1Z2/GLTe on glucose, an oral glucose tolerance test (OGTT) was carried out. Rats of about 250 g were randomized to 4 groups (n=5), including a Z1Z2/TeN group, a Z1Z2/GLTe group, a GLP-1 group and a PBS group. The rats in the first three groups were given 25 nmol/kg by intraperitoneal injection, the rats in the PBS group were given the same volume of PBS, and the blood glucose was measured by a blood glucose meter. After 30 min, 2 g glucose/kg body weight was given by oral gavage, which was assumed to occur at 0 min, and then the blood glucose level was measured respectively at 10, 30, 60, 90, and 120 min. The area under curve (AUC) was calculated using Graphpad Prism 6.0 software. During the process, blood was taken from the tail vein respectively at 0, 10, and 30 min, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected, and the insulin content was measured by using the Rat/Mouse Insulin Elisa kit (Millipore).

[0123] To further determine the relation between the Z1Z2/GLTe concentration and the control effect on blood glucose, the OGTT test was carried out with various concentrations of Z1Z2/GLTe. SD rats of about 250 g were randomized into 4 groups (n=5), including a 1 nmol/kg group, a 5 nmol/kg group, a 25 nmol/kg group, and a PBS group. Z1Z2/GLTe of the above concentration dosages and PBS were respectively administered to the rats by intraperitoneal injection. After 30 min, 2 g glucose/kg body weight was given by oral gavage, which was assumed to occur at 0 min, and then the blood glucose level was measured respectively at 10, 30, 60, 90, and 120 min by using a blood glucose meter; and the AUC was calculated.

[0124] To determine the duration that the Z1Z2/GLTe could exert a control effect on the blood glucose, OGTT was conducted on SD rats 24 hours after intraperitoneal injection. Rats having normal food intake were randomized into two groups (n=5), including a PBS group and a Z1Z2/GLTe group. In the Z1Z2/GLTe group, 25 nmol/kg Z1Z2/GLTe was administered to rats by intraperitoneal injection, and equal volume of PBS was injected to the rats in the other group. The animals were allowed to free access to food for 12 h, and then fasted for 12 h. Then, OGTT was carried out.

[0125] 7. In-Vivo Stability Test

[0126] The Z1Z2/GLTe and GLP-1 were administered to SD rats by intraperitoneal (4 nmol) and intravenous injection (1 nmol) respectively. Blood was sampled from the tail respectively at 0, 0.5, 1, 1.5, 2, 4, 6, and 10 h, and dripped into an Ep tube pretreated with EDTA-Na.sub.2. A DPP-4 inhibitor was immediately added (in 30 s) after the blood was sampled. The active GLP-1 concentration in the sample was detected by using the Active GLP-1 Elisa kit (Millipore).

[0127] 8. Control on Blood Glucose and Food Intake in Diabetic Mice

[0128] Streptozotocin (STZ) was administered to KM mice by intraperitoneal injection for consecutive 5 days at a dosage of 45 mg/kg body weight, and then normally fed for 10 days. Then, the rats were fasted overnight (12-16 h), and the blood glucose level was measured. If the fasting blood glucose level >11.1 mM, a diabetic model could be determined. The test included 3 groups, including a normal group (that is, a non-diabetic model group); a diabetic mice control group (injected with PBS), and a diabetic mice test group (injected with Z1Z2/GLTe), each group having 6 animals. The animals were bred in 3 cages. The animals in the test group were given 25 nmol Z1Z2/GLTe/kg body weight by intraperitoneal injection at 9 o'clock AM every day, and the control group and the normal group were given PBS by intraperitoneal injection. The animals were fasted overnight (12-16 h) every 4 days, and the fasting blood glucose level were measured at day 4.

[0129] Result and Analysis

[0130] 1. Z1Z2/GLTe Expression and Purification

[0131] It can be seen from FIG. 2A and FIG. 2B that after a series of purifications, Z1Z2/GLTe is manifested as two highly pure bands on the SDS-PAGE electropheretogram, which are Z1Z2 (top) and GLTe (bottom) respectively; and manifested as a highly pure band on the Native-PAGE electropheretogram, which is Z1Z2/GLTe complex. This suggests that a high-purity Z1Z2/GLTe complex is obtained for use in subsequent tests.

[0132] After the Z1Z2/GLTe complex is treated by an endotoxin removal pre-packed column, the endotoxin content is controlled at 2 EU/ml or below, and the subsequent cell and animal tests can be carried out.

[0133] 2. GLP-1R Activation Test

[0134] GLP-1R is a G-protein coupled receptor expressed on cell surface, and GLP-1 can bind to GLP-1R expressed on cell surface, thereby activating a downstream signalling pathway to produce cAMP. The binding to the receptor can be reflected by the amount of cAMP produced. The result suggests that can both the Z1Z2/GLTe and GLP-1 can bind to GLP-1R, and stimulate the cAMP production in a concentration-dependent manner. The EC50 value of Z1Z2/GLTe and GLP-1 is 0.35±0.05 nM and 0.24±0.03 nM respectively (FIG. 3). This suggests that Z1Z2/GLTe can bind to GLP-1R and potently activate GLP-1R, thus being an agonist of GLP-1R.

[0135] 3. Activity Assay

[0136] GLP-1 can promote the insulin secretion by pancreatic islet beta cells in vivo, inhibit the glucagon secretion, and control the blood glucose level. The result shows that Z1Z2/GLTe can significantly reduce the blood glucose level in rats. After oral administration of glucose, the blood glucose level rises sharply. GLP-1 and Z1Z2/GLTe can significantly reduce the blood glucose level. However, GLP-1 is effective only in a period of time of 30 min, while Z1Z2/GLTe can effectively control the blood glucose level over 120 min (FIGS. 4A and 4B). With respect to the insulin production, both Z1Z2/GLTe and GLP-1 can significantly increase the blood insulin content, so the blood glucose level can be effectively reduced (FIG. 4C).

[0137] The ability of Z1Z2/GLTe to control the blood glucose level is concentration dependent, and increases with the increase of the concentration. When Z1Z2/GLTe is injected at a dosage of 1 nmol/kg, the blood glucose level can be greatly reduced; and when Z1Z2/GLTe is injected at a dosage of 25 nmol/kg, the ability to inhibit the rise of blood glucose is the highest (FIGS. 4F and 4G).

[0138] 24 hrs after the intraperitoneal injection of Z1Z2/GLTe, OGTT is carried out. Z1Z2/GLTe is still found to be able to control the blood glucose in 60 min, suggesting that Z1Z2/GLTe still persists in the blood at a concentration that is still effective after 24 hrs (FIGS. 4D and 4E).

[0139] 4. In-Vivo Stability Test

[0140] The experimental data show that whether administered by intraperitoneal injection (FIG. 5A) or by intravenous injection (FIG. 5B), Z1Z2/GLTe can significantly prolong the half-life period of GLP-1. 2 h after the intraperitoneal injection of Z1Z2/GLTe, the plasma concentration reaches the maximum, and GLP-1 reaches the maximum concentration at 0.5 h. Then, GLP-1 declines quickly and reaches the lower limit of detection at 1 h, and 200 pM or above of Z1Z2/GLTe can still be detected 24 h after the intraperitoneal injection. This suggests that by Z1Z2/GLTe, the stability of GLP-1 is considerably increased, and the half-life period is prolonged, that is, the duration of action is increased. After the intravenous injection, the Z1Z2/GLTe concentration decreases slowly, and the GLP-1 concentration decreases quickly and reaches the lower limit of detection at 0.5 h. After the intravenous injection, the half-life period of GLP-1 is 1-2 min (Kim B J et al, J Pharmacol Exp Ther, 2012, 334(3): 682-692). However, the half-life period of Z1Z2/GLTe is 67±3.3 min in this experiment, so the half-life period of GLP-1 is greatly prolonged.

[0141] 5. Long-Term Control of Z1Z2/GLTe on Blood Glucose in Diabetic Mice

[0142] Z1Z2/GLTe has a longer half-life period than the native GLP-1 while its activity is not attenuated, and is thus able to control the blood glucose for a longer period of time than GLP-1. It can be seen from the test of control on blood glucose in diabetic mice (FIG. 6) that the fasting blood glucose level in diabetic mice can be effectively controlled by daily intraperitoneal injection of Z1Z2/GLTe at a dosage of 25 nmol/kg. The fasting blood glucose level can be effectively chronically controlled in a lower range by a single injection per day. After the injection is stopped (at day 28), the blood glucose in the Z1Z2/GLTe group rises again.

Example 2: Attachment of GLP-1(8G) to N Terminus of Polypeptide B in Polypeptide Complex

[0143] GLP-1 (7-37) is susceptible to deactivation due to the cleavage by DPP-4 in the blood because the first two amino acids in its amino acid sequence are HAs. Therefore, the enzymatic cleavage of GLP-1 (7-37) by DPP-4 can be effectively inhibited by mutating the amino acid at position 8 to Gly in the amino acid sequence of GLP-1 (7-37), thereby further prolonging the half-life period.

[0144] Experimental Section

[0145] 1. Construction of Vector

[0146] Site-directed mutation of the vector pET-24d-GLTe in Example 1 was carried out by using the primer pair below, to mutate the amino acid Ala at position 8 to Gly in the amino acid sequence of GLP-1(7-37).

TABLE-US-00001 8A-G-F:  (SEQ ID NO: 15) AATCTTTATTTTCAGCATGGCGAAGGCACCTTTACC (the underlined portion is the mutated site) 8A-G-R:  (SEQ ID NO: 16) GCCATGCTGAAAATAAAGATTCTCAGTAGTGGGGATGTC

[0147] The plasmid successfully sequenced was designated as pET-24d-GLTe-G, and the sequence excluding the original pET24d vector was as SEQ ID NO: 13, the coding amino acid sequence thereof was as SEQ ID NO: 14. In SEQ ID NO: 14, a TEV protease cleavage site is between positions 25 and 26, positions 3-8 is a 6×His tag, positions 25-55 is the amino acid sequence of GLP-1, positions 56-70 is a linker, and position 26 is mutated amino acid.

[0148] 2. Expression, Purification, and Removal of Endotoxins

[0149] Following the same process steps as those in Example 1, a high-purity Z1Z2/GLTe-G complex with an endotoxin content of less than 2 EU/ml was obtained. Other complexes such as Z1Z2/TeN complex could be directly obtained from the vector in Example 1, an expression product thereof, or a product removed of endotoxins.

[0150] 3. Activity Assay

[0151] To further determine whether the Z1Z2/GLTe-G can effectively control the blood glucose level and the relation between various concentrations and the control effect on blood glucose level, the OGTT test was carried out with various concentrations of Z1Z2/GLTe-G. SD rats of about 250 g were randomized into 4 groups (n=5), including a 1 nmol/kg group, a 5 nmol/kg group, a 25 nmol/kg group, and a PBS group. Z1Z2/GLTe-G of the above concentration dosages and PBS were respectively administered to the rats by intraperitoneal injection. After 30 min, 2 g glucose/kg body weight was given by oral gavage, which was assumed to occur at 0 min, and then the blood glucose level was measured respectively at 10, 30, 60, 90, and 120 min by using a blood glucose meter.

[0152] In the OGTT test of each group, blood was taken from the tail vein of rats at a time ranging from 10 to 30 min, and added dropwise to an Ep tube containing EDTA-Na2. The plasma was removed, and the insulin content was determined by using the Insulin Elisa kit (Millipore).

[0153] 4. In-Vivo Stability Test

[0154] 1 nmol Z1Z2/GLTe-G was intravenously injected to rats via the tail veil of the rats, and this was assumed to occur at 0 h. Then, blood was taken respectively at 1, 2, 4, 8, and 24 h, and added dropwise to an Ep tube pretreated with EDTA-Na2. The active GLP-1 concentration in the sample was detected by using the GLP-1 (Total) Elisa kit (Millipore).

[0155] Result and Analysis

[0156] 1. Activity Assay

[0157] The OGTT test is carried out with various concentrations of Z1Z2/GLTe-G complex, and the Z1Z2/GLTe-G complex is found to reduce the blood glucose in a dose-dependent manner (FIG. 7A). The Z1Z2/GLTe-G complex can reduce the blood glucose even at 1 nmol/kg, and has the most remarkable blood glucose reducing effect at 25 nmol/kg. This fully indicates that when the amino acid A at position 8 is mutated to G in the sequence of GLP-1, the activity of GLP-1 is not affected, and the blood glucose reducing effect can still be exerted.

[0158] The insulin secretion test also shows that the insulin secretion increases with the increase of the concentration (FIG. 7B). Therefore, the Z1Z2/GLTe-G complex can effectively stimulate the insulin secretion by the pancreatic islet cells, thereby exerting a blood glucose reducing effect.

[0159] 2. In-Vivo Stability Test

[0160] The Z1Z2/GLTe-G complex is intravenously injected into the SD rats, and the blood is sampled from the tail periodically. The plasma Z1Z2/GLTe-G was determined by using the GLP-1(Total) Elisa Kit (Millipore) (FIG. 8). The Z1Z2/GLTe-G is found to decline slowly, and calculated to have a half-life period of about 4 h, which is 4 times of that (67 min) before mutation, and about 200 times of that (1-2 min) of the native GLP-1. Therefore, the half-life period is greatly prolonged, and this lays a foundation for better use in clinical practice.

Example 3: Attachment of GLP-1(8G) to N Terminus of Polypeptide a in Polypeptide Complex

[0161] Experimental Section:

[0162] 1. Construction of Vector

[0163] An encoding sequence of GLP-1(8G) was ligated to an N terminus of a Z1Z2 encoding gene sequence by full-gene synthesis, and then constructed into a modified pET24d vector, which was thus designated as pET-24d-GLZ (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 17, the coding amino acid sequence thereof is SEQ ID NO: 18, for example. In SEQ ID NO: 18, a TEV protease cleavage site is between positions 24 and 25, positions 3-8 is a 6×His tag, positions 25-55 is the amino acid sequence of GLP-1(8G), positions 56-66 is a linker, and position 26 is mutated amino acid). The linker between GLP-1(8G) and Z1Z2 was SEAAAKEAAAK.

TABLE-US-00002 agc ctg ctg att gcc gaa gca tat ccg gaa gat  Ser Leu Leu Ile Ala Glu Ala Tyr Pro Glu Asp  tct gga acg tat agt gtg aat gcg aca aat agc  Ser Gly Thr Tyr Ser Val Asn Ala Thr Asn Ser  gtg ggt cgc gca acg agt acc gcc gaa ctg tta  Val Gly Arg Ala Thr Ser Thr Ala Glu Leu Leu  gtt cag ggt taa (SEQ ID NO: 17) Val Gln Gly (SEQ ID NO: 18)

[0164] 2. Expression, Purification, and Removal of Endotoxins

[0165] Following the same process steps as those in Example 1, a high-purity GLZ/TeN complex with an endotoxin content of less than 2 EU/ml was obtained. Other complexes such as Z1Z2/GLTe-G complex could be directly obtained as described in the examples above.

[0166] 3. Activity Assay

[0167] To determine whether the GLZ/TeN complex is effective in reducing the blood glucose, and the activity as compared with the Z1Z2/GLTe-G complex, an OGTT test was conducted.

[0168] SD rats of about 250 g were randomized into 3 groups (n=5), including a PBS group, a Z1Z2/GLTe-G group, and a GLZ/TeN group. The animals in the Z1Z2/GLTe-G group and the GLZ/TeN group were given the Z1Z2/GLTe-G and GLZ/TeN complex respectively by intraperitoneal injection at a dosage of 10 nmol/kg body weight, and the animals in the PBS group were given the same volume of PBS.

[0169] The blood glucose level was measured by a blood glucose meter, and this was assumed to occur at −30 min. After 30 min, 2 g glucose/kg body weight was given by oral gavage, and this was assumed to occur at 0 min. Then, the blood glucose was measured respectively at 10, 30, 60, 90, and 120 min. The area under curve (AUC) was calculated using Graphpad Prism 6.0 software.

[0170] During the process, blood was taken from the tail vein at a time ranging from 10 to 30 min, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected, and the insulin content was measured by using the Rat/Mouse Insulin Elisa kit (Millipore).

[0171] 4. In-Vivo Stability Test

[0172] 1 nmol GLZ/TeN was administered to the SD rats (about 250 g) by intravenous (i.v) injection at the tail and by subcutaneous injection (s.c), and this was assumed to occur at 0 h. Blood was sampled from the tail vein of the rats respectively at 0.05, 0.5, 2, 4, 8, 11, 24, and 48 h, and dripped into an Ep tube pretreated with EDTA-Na.sub.2. The protease inhibitor protinin was immediately added (in 30 s) after the blood was sampled. The GLP-1(8G) concentration in the sample was determined by using the GLP-1(Total)Elisa kit (Millipore).

[0173] 5. Effect of Single Injection of Drug on Food Intake and Blood Glucose Level

[0174] C57BL/6 mice of about 25 g were randomized into 3 groups (n=5), including a PBS group, a GLZ/TeN group, and a Z1Z2/GLTe-G group, with one mouse each cage. The mice in each group were fasted from 7 o'clock PM of the first day to 9 o'clock AM of the next day. The empty body weight of the mice in each group was weighed, and the mouse food was pre-weighed and grouped. The animals in the GLZ/TeN group and the Z1Z2/GLTe-G group were respectively given the GLZ/TeN and Z1Z2/GLTe-G complex by intraperitoneal injection at a dosage of 20 nmol/kg body weight, the animals in the PBS group were given the same volume of PBS, and these were assumed to occur at 0 h. After the drug was injected, the pre-weighed mouse food was given, and the weight of the mouse food and the blood glucose level were determined at 0, 2, 5, 8, 24, 36, and 48 h.

[0175] 6. Effect on Blood Glucose Level in Diabetic Mice

[0176] The C57BL/6 mice were assigned to two groups, including a control group of 6 rats, and a test group of 15 rats. The animals in the control group were fed on standard diet, and the animals in the test group were fed on a high-sucrose high-fat diet (HFD) (containing 1% cholesterol, 20% sucrose, 12% lard, 10% egg yolk powder and 2% sodium cholate) commercially available from Beijing Academy of Military Medical Sciences. The animals in the control group and the test group were fed on different diets for 2 months, during which the animals were weighed once every 15 days. After being fasted for 12 hrs, the animals in the control group (6 rats) and the test group were respectively given 2 g/kg glucose by oral gavage, and an OGTT test were conducted, to determine the blood glucose level at various times, and detect the presence of insulin resistance. Once the insulin resistance occurred, STZ was injected for consecutive 5 days at a small dosage to induce an animal model of type 2 diabetes. The animals were bred for another 7 days, and then the blood glucose level was determined. Where the fasting blood glucose level >11.1 mM, it was considered that the model was established successfully. 12 mice that were successfully modelled were randomly selected from the test group and divided into two groups, including a GLZ/TeN group, and a PBS group. GLZ/TeN complex at 20 nmol/kg or the same dose of PBS were given once a day by intraperitoneal injection. The blood glucose level was determined.

[0177] Result and Analysis

[0178] 1. Expression, Purification, and Removal of Endotoxins

[0179] The pET-24d-GLZ and pET-TeN plasmids are respectively transformed into and expressed in E. coli BL21(DE3), to form a GLZ/TeN complex, from which a high-purity GLZ/TeN complex is obtained after a series of purifications.

[0180] A sample is taken and analyzed on SDS-PAGE and Native-PAGE. It is found that the protein in the sample is manifested as one high-purity band on Native-PAGE, and as two high-purity bands on SDS-PAGE, indicating that the sample is a GLZ/TeN complex (FIG. 9). Finally, high-purity GLZ/TeN protein complex is obtained after endotoxin removal, which can be used in subsequent animal tests.

[0181] 2. Activity Assay

[0182] Whether the GLZ/TeN complex is more potent than Z1Z2/GLTe-G can be directly determined through the OGTT test. The OGTT test result shows that when intraperitoneally injected at a concentration of 10 nmol/kg, the activity of GLZ/TeN is obviously higher than that of Z1Z2/GLTe-G. After glucose is administered to the SD rats by oral gavage, the blood glucose level is obviously reduced in the animals in the GLZ/TeN and Z1Z2/GLTe-G group, and GLZ/TeN is more highly active than Z1Z2/GLTe-G, and can more potently reduce the blood glucose level. At 30 min, the maximum blood glucose level is 8.3 and 5.7 mM respectively (FIG. 10A). It can be seen from the AUC data that both the GLZ/TeN and Z1Z2/GLTe-G complex can greatly reduce the AUC (FIG. 10B), and GLZ/TeN has a more potent inhibitory effect than Z1Z2/GLTe-G.

[0183] During the OGTT test, blood is sampled from the tail vein, and the changes of plasma insulin content are determined by using an insulin ELISA kit. The result shows that after the intraperitoneal injection of both GLZ/TeN and Z1Z2/GLTe-G, the insulin secretion is stimulated notably (FIG. 10C).

[0184] 3. In-Vivo Stability Test

[0185] After the GLZ/TeN complex is subcutaneously (s.c) and intravenously (i.v) injected into the SD rats, the plasma GLP-1 content is determined by using a GLP-1 ELISA kit. It is found that the content declines slowly, the half-life period is calculated to be 19.8±3.2 h after subcutaneous injection, and the half-life period is calculated to be 18.7±2.3 h after intravenous injection (FIG. 11). The half-life period of GLZ/TeN after intravenous injection is 4 times of that of the Z1Z2/GLTe-G complex (4 h), and is further increased. This may be because the GLZ/TeN complex comprises two GLP-1 molecules, and the molecular weight is further increased, so the renal filtration is slowed down; and the GLZ/TeN complex binds to GLP-1R at a higher affinity, such that the half-life period is longer.

[0186] 4. Effect on Food Intake and Blood Glucose Level

[0187] After a single intraperitoneal injection of the drug according to the body weight, the result shows that both the Z1Z2/GLTe-G and GLZ/TeN complex can significantly inhibit the food intake of the mice in 8 hrs, and the inhibition disappears after 24 hrs. There is no significant difference between the Z1Z2/GLTe-G group and the GLZ/TeN group (FIG. 12A).

[0188] It is found through the test of blood glucose level that both the Z1Z2/GLTe-G and GLZ/TeN complex can greatly reduce the blood glucose level in mice. However, with the elapse of time, the complex is degraded and the concentration is gradually reduced, then the blood glucose level in the mice gradually rises, and goes back to the control level at 48 h. In the Z1Z2/GLTe-G group, the blood glucose level is greatly reduced in 2-8 hrs; and the blood glucose level is still reduced at 24 hrs, but there is no significant difference compared with the control. In the GLZ/TeN group, the blood glucose level can be greatly reduced in 36 hrs, and then goes back to the control level at 48 h. The blood glucose level in the GLZ/TeN group in 2-5 hrs is much lower than that in the Z1Z2/GLTe-G group (FIG. 12B). The AUC data more intuitively shows that GLZ/TeN is more potent in reducing the blood glucose level in mice than the Z1Z2/GLTe-G complex (FIG. 12C).

[0189] 5. Effect on Blood Glucose Level in Diabetic Mice

[0190] It can be seen from the body weight of the animals fed on the HFD diet for consecutive 2 months (FIG. 13A) that the body weight of the mice in the 2 months is obviously higher than that of the animals in the control group that are fed on standard diet.

[0191] To determine the occurrence of insulin resistance in the test group, an OGTT test is conducted on the control group and the test group (FIG. 13B). The result shows that obvious insulin resistance occurs in the test group (HFD), and the blood glucose level at 15-30 min in the HFD mice is obviously higher than that in the mice fed on the standard diet, because insulin resistance occurs in the mice fed on the HFD diet, which causes the blood glucose reducing effect to decrease significantly.

[0192] After the occurrence of insulin resistance, an animal model of type 2 diabetes is successfully induced. It is found that the GLZ/TeN complex can greatly reduce the non-fasting blood glucose level in the model mice of type 2 diabetes to the non-fasting blood glucose level in the normal mice, that is, about 6-9 mM (FIG. 13C).

Example 4: One-Step Recombination of Vector for Polypeptide Complex-GLP-1(8G)

[0193] Experimental Section:

[0194] 1. Construction of Vector

[0195] An encoding sequence of GLP-1(8G) was ligated via an encoding sequence of (G.sub.4S).sub.3 linker to an N terminus of a Z1Z2 encoding sequence by full-gene synthesis, and then constructed into a modified pET24d vector, which was thus designated as pET-24d-GLZ-syn. A new expression vector was constructed by designing primers and using pET-24d-GLZ-syn, pET-TeN, and pET-Z1Z2 as a template, which can have Z1Z2 bearing GLP-1(8G) at the N terminus thereof, beta-pleated sheet region at the N terminus of Telethonin molecule, and Z1Z2 connected via the linker, and is expressed in one step to form a large fusion protein.

[0196] PCR was conducted by using pET-24d-GLZ-Syn as a vector, and Rec-Ti-F1/Rec-Ti-R1 as primers. PCR was conducted by using pET-24d-Telethonin as a vector, and Rec-Te-F/Rec-Te-R as primers. PCR was conducted by using pET-24d-Z1Z2 as a vector, and Rec-Ti-F2/Rec-Ti-R2 as primers. After gel extraction, each 50 ng (each 1 μl) of the products recovered by gel extraction was added to a 50 reaction system (5*Transtart Fastpfu Buffer, 10 μl; 2.5 mM dNTP, 5 μl; Transtart Fastpfu DNA polymerase, 1 μl; ddH20, 27 μl), and primers Rec-Ti-F1/Rec-Ti-R2 (10 μM, each 2 μl) were added for PCR. After gel extraction, the products were enzymatically cleaved and then ligated, transferred to a modified pET24d vector, transformed, and sequenced. The plasmid sequenced to be appropriate was designated as pET-24d-GLRecom (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 19, the coding amino acid sequence thereof is SEQ ID NO: 20. In SEQ ID NO: 20, a TEV protease cleavage site is between positions 25 and 26, positions 3-8 is a 6×His tag, positions 25-55 is the amino acid sequence of GLP-1 (8G), positions 56-70, 267-291, 382-406 are respectively linkers, and position 26 is mutated amino acid). The nucleotide sequence of each primer is as shown in Table 1 below.

TABLE-US-00003 TABLE 1  Primer Sequence SEQ ID NO Rec-Ti-F1 CAGCTCTAGAAATAATTTTGTTTAA SEQ ID NO: 21 Rec-Ti-R1 CGGGGTACCCGGAGCAGAACCAGAACCA SEQ ID NO: 22 GAACCTTGAACCAGTAATTCAGC Rec-Te-F TCTGCTCCGGGTACCCCGGGTGGTGGTGG SEQ ID NO: 23 TTCTGGTGGTGGTGGTTCTGGTGGTGGTG GTTCTATGGCTACCTCAGAGCTG Rec-Te-R GGTCGGAGAACCAGCCGGACCAGAAGCA SEQ ID NO: 24 CCCGGCAGTACCCGCTGG Rec-Ti-F2 CCGGCTGGTTCTCCGACCGGTTCTGGTCC SEQ ID NO: 25 GGGTTCTGCTGGTTCTGGTCCGGGTTCTG CTGGTATGGCCACTCAAGCACC Rec-Ti-R2 ATTCGGATCCGGTACCTTAA SEQ ID NO: 26 Note: the underlined bases are XbaI and BamHI cleavage sites.

[0197] The sequence of SEQ ID NO: 19 could be directly obtained by full-gene synthesis, and constructed into a modified pET24d vector, to obtain the pET-24d-GLRecom plasmid above. In this way, the steps for constructing the vector are simplified.

[0198] 2. Expression, Purification, and Removal of Endotoxins

[0199] The pET-24d-GLRecom plasmid was transferred into E. coli BL21(DE3) strain, and induced by 1 mM ITG to express for 24 h in a shaker at 16° C. The GLRecom protein was expressed into the supernatant, then cleaved by TEV protease, and purified twice by a Ni column, and then by a Q column, to obtain a high-purity GLRecom protein. Then, the endotoxins were removed following the same process steps as that in Example 1, to obtain a high-purity GLRecom protein with an endotoxin content of less than 2 EU/ml.

[0200] 3. Activity Assay

[0201] To determine whether GLRecom is effective in reducing the blood glucose, and the activity as compared with Z1Z2/GLTe-G, an OGTT test was conducted.

[0202] C57BL/6 mice of about 25 g were randomized into 3 groups (n=5), including a PBS group, a Z1Z2/GLTe-G group, and a GLRecom group. The animals in the Z1Z2/GLTe-G group and the GLRecom group were given the Z1Z2/GLTe-G and GLRecom respectively by intraperitoneal injection at a dosage of 10 nmol/kg body weight, and the animals in the PBS group were given the same volume of PBS. The blood glucose level was measured by a blood glucose meter, and this was assumed to occur at −30 min. After 30 min, 2 g glucose/kg body weight was given by oral gavage, and this was assumed to occur at 0 min. Then, the blood glucose was measured respectively at 10, 30, 60, 90, and 120 min. The AUC was calculated by using the Graphpad Prism 6.0 software.

[0203] During the process, blood was taken from the tail vein at a time ranging from 10 to 30 min, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected, and the insulin content was measured by using the Rat/Mouse Insulin Elisa kit (Millipore).

[0204] 4. In-Vivo Stability Test

[0205] 2.8 nmol GLRecom was administered to the SD rats (about 250 g) by intravenous (i.v) injection at the tail, and this was assumed to occur at 0 h. Blood was sampled from the tail vein of the rats respectively at 0.05, 0.5, 2, 5, 10, 24, and 48 h, and dripped into a centrifugation tube pretreated with EDTA-Na.sub.2. The protease inhibitor protinin was immediately added (in 30 s) after the blood was sampled. The GLP-1(8G) concentration in the sample was determined by using the GLP-1(Total)Elisa kit (Millipore).

[0206] Result and Analysis

[0207] 1. Expression, Purification, and Removal of Endotoxins

[0208] In the GLRecom protein, a linker SGSGSAPGTPGGGGSGGGGSGGGGS was designed between the first Z1Z2 molecule bearing GLP-1(8G) and the beta-pleated sheet region of Telethonin, and a linker GASGPAGSPTGSGPGSAGSGPGSAG was designed between the beta-pleated sheet region of Telethonin and the second Z1Z2 molecule, to form a recombinant protein. This can facilitate the expression and reduce the purification step, thereby reducing the time and cost required for purification. After a series of purifications of the GLRecom protein, a protein with a molecular weight of 60.0 kDa was obtained (FIG. 14), which was expressed in the supernatant, and easy in operation. Therefore, a high-purity protein is easily obtained.

[0209] 2. Activity Assay

[0210] Both the GLRecom and Z1Z2/GLTe-G complex contain one GLP-1 molecule, in which Ala at the N terminus of the GLP-1 molecule is substituted with Gly. The OGTT result shows that both the GLRecom and Z1Z2/GLTe-G complex have a significant blood glucose reducing effect. After 2 g/kg glucose is administered, the blood glucose level in the mice in the PBS group rises rapidly, and a significant decrease exists in the GLRecom and Z1Z2/GLTe-G complex groups, compared with the PBS group. At 120 min, the blood glucose level was still significantly reduced in the GLRecom and Z1Z2/GLTe-G complex group (FIG. 15A). The AUC data more intuitively shows that the blood glucose level in the mice in the GLRecom and Z1Z2/GLTe-G complex group is significantly reduced, and the oral glucose tolerance in the mice is enhanced (FIG. 15B). There is no difference between the GLRecom and Z1Z2/GLTe-G complex in reducing the blood glucose level, possibly because only one GLP-1 molecule is contained in the structures of both of them.

[0211] Insulin secretion test shows that both the GLRecom and Z1Z2/GLTe-G complex can significantly enhance the level of insulin secretion in mice after injection of drugs, and there is no significant difference between the GLRecom and Z1Z2/GLTe-G complex in stimulating the insulin secretion (FIG. 15C).

[0212] 3. In-Vivo Stability Test

[0213] The GLRecom protein has a long half-life period in the blood, the concentration declines slowly (FIG. 16), and the long half-life period is calculated to be 13.4±0.8 h, which is more than 3 times of that of the Z1Z2/GLTe-G complex (4 h). This may be attributed to the fact that GLRecom has a larger molecular weight (60.0 kDa), and the molecular weight of Z1Z2/GLTe-G is 56.7 kDa; or to that in the GLRecom protein, the intermolecular linkers form a highly flexible loop, which increase the volume of GLRecom compared with the compact Z1Z2/GLTe-G. Therefore, the degradation by the protease and the filtration by the kidney of GLRecom can be further arrested or reduced, thereby prolonging the half-life period.

Example 5: Attachment of SST to Loop Region in Polypeptide B in Polypeptide Complex

[0214] Somatostatin (SST) is a cyclic polypeptide widely distributed in the central nervous system, peripheral nervous system and gastrointestinal tract, which can significantly inhibit the secretion and release of growth hormone, and also the secretion of pancreatic hormone, and gastrin. SST regulates the secretion of insulin and glucagon. Two active forms of SST exist, that is, SST14 and SST28. SST binds to a SST receptor that is a GPCR, thus activating the downstream pathway. SST is mainly used for the treatment of acromegaly, esophageal varices bleeding caused by portal hypertension, acute pancreatitis and its complications, pancreatic intestinal fistula and so on. However, the in-vivo half-life period of SST is only 2-3 min (Afargan M et al, Endocrinology, 2001, 142(1):477-486), which greatly limit its use in clinic.

[0215] Experimental Section:

[0216] 1. Construction of Vector

[0217] A pET-24d-SSTe vector comprising a gene sequence having the SST gene inserted into the Loop (LT1) of a TeN mutant was obtained by full gene synthesis (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 27, the coding amino acid sequence thereof is as SEQ ID NO: 28. In SEQ ID NO: 28, a TEV protease cleavage site is between positions 25 and 26, positions 3-8 is a 6×His tag, positions 43-56 is the amino acid sequence of GLP-1, positions 57-58 is a linker)

[0218] 2. Expression, Purification, and Removal of Endotoxins

[0219] Following the same process steps as those in Example 1, a high-purity Z1Z2/SSTe complex with an endotoxin content of less than 2 EU/ml was obtained.

[0220] 3. Activity Assay

[0221] SD rats of about 250 g was fasted for 12-16 h, and then randomized into 3 groups, including two test groups in which the animals were administered SST and Z1Z2/SSTe complex by intraperitoneal injection at a dosage of 200 nmol/kg body weight; and one group in which the animals were administered equal volume of PBS. Blood was sampled from the tail at 0, 30, 60, and 120 min, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected. The concentration of the growth hormone in the supernatant was detected by using the Growth hormone ELISA kit (Millipore).

[0222] 4. In-Vivo Stability Test

[0223] 0.28 mg Z1Z2/SSTe was intravenously injected to the rats at the tail vein. Blood was sampled from the tail vein at 0, 0.5, 1, 2, 4, 8, and 24 h, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected. The SST from Z1Z2/SSTe contained in the supernatant was detected by using the Somatostatin (SST) EIA kit (Phoenix pharmaceuticals).

[0224] Result and Analysis

[0225] 1. Expression, Purification, and Removal of Endotoxins

[0226] It can be seen from FIG. 17 that after a series of purifications, Z1Z2/SSTe is manifested as two highly pure bands on the SDS-PAGE electropheretogram, and manifested as a highly pure band on the Native-PAGE electropheretogram, which is Z1Z2/SSTe complex. This suggests that a high-purity Z1Z2/Z1Z2/SSTe complex is obtained for use in subsequent tests.

[0227] After being treated with an endotoxin removal resin, the endotoxin content in the Z1Z2/SSTe complex is controlled at 2 EU/ml or below. The Z1Z2/SSTe complex can be used in subsequent tests.

[0228] 2. Activity Assay

[0229] SST inhibits the secretion of growth hormone in vivo, so the activity of the Z1Z2/SSTe complex can be verified by measuring the somatotropin content in rats. After being injected into the rats, the Z1Z2/SSTe complex significantly inhibits the level of growth hormone in the rats. After being injected into the rats, both SST and Z1Z2/SSTe can initially significantly inhibit the secretion of growth hormone in vivo. However, the half-life period of SST is shorter (2-3 min); and with the degradation of SST, the inhibition is gradually weakened, and finally goes back to the control level at 2 h. By contrast, Z1Z2/SSTe can significantly inhibit the growth hormone level within 120 min, indicating that it has a longer half-life period (FIG. 18). This suggests that Z1Z2/SSTe has a biological activity similar to that of the native SST, and can act to inhibit the growth hormone for a longer period of time.

[0230] 3. In-Vivo Stability Test

[0231] After the Z1Z2/SSTe complex is intravenously injected, the plasma SST content is as shown in FIG. 19. The half-life period is calculated to be 6.62±0.43 h, which is about 200 times longer than that of the native SST (2-3 min). This suggests that the Z1Z2/SSTe complex allows the half-life period of SST to be greatly prolonged while the binding of SST to its receptor is not affected, such that SST can exert a therapeutic effect for a longer period of time.

Example 6: Attachment of SST to Loop Region in Polypeptide a in Polypeptide Complex

[0232] Experimental Section:

[0233] 1. Construction of Vector

[0234] A pET-24d-ZSST vector comprising a gene sequence having the SST gene inserted into a loop of the Z1Z2 molecule was obtained by full gene synthesis (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 29, the coding amino acid sequence thereof was as SEQ ID NO: 30. In SEQ ID NO: 30, a TEV protease cleavage site is between positions 24 and 25, positions 3-8 is a 6×His tag, positions 171-184 is the amino acid sequence of SST, and positions 185-186 is a linker)

[0235] 2. Expression, Purification, and Removal of Endotoxins

[0236] Following the same process steps as those in Example 1, a high-purity ZSST/TeN complex with an endotoxin content of less than 2 EU/ml was obtained.

[0237] 3. Activity Assay

[0238] SD rats of about 250 g was fasted for 12-16 h, and then randomized into 4 groups, including three test groups in which the animals were administered the SST and Z1Z2/SSTe, and ZSST/TeN complex by intraperitoneal injection at a dosage of 200 nmol/kg body weight; and one group in which the animals were administered equal volume of PBS. Blood was sampled from the tail at 0, 30, 60, and 120 min, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected. The concentration of the growth hormone in the supernatant was detected by using the Growth hormone ELISA kit (Millipore).

[0239] 4. In-Vivo Stability Test

[0240] 0.2 mg ZSST/TeN was intravenously injected to the rats at the tail vein. Blood was sampled from the tail vein at 0, 0.5, 1, 2, 4, 8, 24, and 48 h, added to a centrifuge tube containing EDTA-Na.sub.2, and centrifuged at 4000 rpm for 10 min. The supernatant was collected. The SST from ZSST/TeN contained in the supernatant was detected by using the Somatostatin (SST) EIA kit (Phoenix pharmaceuticals).

[0241] Result and Analysis

[0242] 1. Expression, Purification, and Removal of Endotoxin

[0243] Two highly pure bands are manifested on the SDS-PAGE electropheretogram, and one highly pure band is manifested on the Native-PAGE electropheretogram, indicating that a high-purity ZSST/TeN complex is obtained. After being treated with an endotoxin removal resin, the endotoxin content in the ZSST/TeN complex is controlled at 2 EU/ml or below. The ZSST/TeN complex can be used in subsequent tests.

[0244] 2. Activity Assay

[0245] After being intraperitoneally injected into the SD rats, the ZSST/TeN complex significantly inhibits the level of growth hormone (GH) in the rats. After being injected into the rats, both SST and Z1Z2/SSTe can inhibit the secretion of growth hormone in a short time. However, the half-life period of SST is shorter (2-3 min), and the inhibition is weak, and goes back to the control level after 2 h. Z1Z2/SSTe can significantly inhibit the growth hormone level in 4 h, and go back to the control level after 8 h, thus having a longer half-life period. By contrast, the ZSST/TeN complex can still significantly inhibit the secretion of growth hormone at 12 h, indicating that the ZSST/TeN complex has a much longer half-life period (FIG. 20). The ZSST/TeN complex has two SST molecules and thus a much longer half-life period, and also a more potent inhibition on the secretion of growth hormone.

[0246] 3. In-Vivo Stability Test

[0247] After the ZSST/TeN complex is intravenously injected to the SD rats, the plasma SST content is detected by using an ELISA kit (FIG. 21). The half-life period is calculated to be 14.3±1.7 h, which is several hundreds of times longer than that of the native SST (2-3 min), and is also longer than that of the Z1Z2/SSTe complex. This suggests that the ZSST/TeN complex allows the half-life period of SST to be greatly prolonged while the binding of SST to its receptor is not affected.

Example 7: Attachment of PYY to C Terminus of Polypeptide B in Polypeptide Complex

[0248] Peptide Tyrosin-tyrosin (PYY) is a 36-amino-acid polypeptide secreted by intestinal L-cells after food intake. Two forms of PYY exist in vivo, that is, PYY.sub.1-36, and PYY.sub.3-36 produced after cleavage by DPP-4 PYY.sub.3-36 functions to suppress the appetite, slow down the gastric emptying and reduce the body weight by interacting with the Y2 receptor in the hypothalamus and peripheral nervous system. It is found through the tests in animals and human that peripheral injection of PYY.sub.3-36 can obviously reduce the food intake. Therefore, PYY.sub.3-36 is regarded as a drug effectively in the treatment of obesity. However, the half-life period of PYY is short and only 8 min, due to the in-vivo degradation by proteases and renal filtration, thus limiting its clinical use.

[0249] A protein drug that has a longer half-life period and is useful in the clinical treatment of obesity is expected to be created by reconstructing PYY.sub.3-36 with the complex of the present invention. PYY.sub.3-36 was co-expressed (TePY) with the C-terminus of the beta-pleated sheet region of Telethonin by gene fusion, and then formed a complex (Z1Z2/TePY) with Z1Z2. The activity of the complex was detected.

[0250] Experimental Section:

[0251] 1. Construction of Vector

[0252] A pET-24d-TePY vector comprising a gene sequence having the PYY.sub.3-36 encoding sequence linked to the C terminus of an encoding sequence of the beta-pleated sheet region of Telethonin was obtained by full gene synthesis (where the sequence excluding the original pET24d vector is as shown in SEQ ID NO: 31, the coding amino acid sequence thereof is as SEQ ID NO: 32. In SEQ ID NO: 32, a TEV protease cleavage site is between positions 24 and 25, positions 3-8 is a 6×His tag, positions 120-153 is the amino acid sequence of PYY, and positions 117-119 is a linker).

[0253] 2. Expression, Purification, and Removal of Endotoxins

[0254] Following the same process steps as those in Example 1, a high-purity Z1Z2/TePY complex with an endotoxin content of less than 2 EU/ml was obtained.

[0255] 3. Activity Assay

[0256] To determine whether the Z1Z2/TePY complex has inhibition on food intake in vivo, food intake test was conducted on KM mice. KM mice of about 30 g were randomized into 2 groups, including a PBS group and a Z1Z2/TePY group. The animals were fasted for 15 h from 6 o'clock PM to 9 o'clock AM. The empty body weight of the mice in each group was weighed. The animals in the Z1Z2/TePY group were intraperitoneally injected with 200 nmol drug/kg body weight, and the animals in the PBS group were given the same volume of PBS. This was assumed to occur at 0 h. Food that was previously weighed was given immediately. The food was weighed periodically, and the food intake of the mice was expressed by food intake of the mice/body weight in each period.

[0257] 4. In-Vivo Stability Test

[0258] 9.0 nmol Z1Z2/TePY complex was administered to the SD rats (about 250 g) by intravenous (i.v) injection at the tail, and this was assumed to occur at 0 h. Blood was sampled from the tail vein of the rats respectively at 0.05, 0.5, 1, 2, 4, 7, 10, and 24 h, and dripped into a centrifugation tube pretreated with EDTA-Na.sub.2. The protease inhibitor protinin was immediately added (in 30 s) after the blood was sampled. The PYY concentration in the sample was determined by using the PYY.sub.3-36 EIA kit (Phoenix).

[0259] Result and Analysis

[0260] 1. Expression, Purification, and Removal of Endotoxin

[0261] The pET-24d-TePY is transformed into E. coli BL21(DE3), and induced by IPTG for expression. After purification by affinity chromatography on the Ni.sup.2+-NTA column, cleavage by TEV protease, secondary purification by affinity chromatography on the Ni.sup.2+-NTA column, purification by Q ion exchange column, endotoxin removal and other steps, a high-purity protein complex Z1Z2/TePY is finally obtained, which can be used in subsequent animal test.

[0262] 2. Activity Assay

[0263] 200 nmol/kg Z1Z2/TePY is intraperitoneally injected to the mice, and find to reduce the food intake considerably in 8 h (p<0.05), Then, the inhibition disappears after 8 h (FIG. 22).

[0264] 3. In-Vivo Stability Test

[0265] The concentration of the Z1Z2/TePY complex is detected to decline slowly in vivo, and the half-life period is calculated to be 6.4±0.8 h in case of intravenous injection, which is greatly prolonged compared with the native PYY (8 min) (FIG. 23).