HIGH-AFFINITY PEPTIDE FOR TUMOR NECROSIS FACTOR ALPHA AND APPLICATION THEREOF

Abstract

Peptide with high binding affinity for tumor necrosis factor alpha (TNF-α). The peptide has an amino acid sequence of SEQ.ID.NO.1, or the peptide is a tandem or branched peptide with a single repeat or multiple repeats of SEQ.ID.NO.1 and SEQ.ID.NO.3 and has an amino acid sequence of SEQ.ID.NO.4. The peptide can bind to TNF-α with high affinity and can antagonize TNF-α function. When being directly injected to an animal, the peptide can significantly reduce the degree of inflammation of an animal body and improve the resistance of the animal body on an inflammatory damage. The peptide can be used for developing TNF-α antagonist drugs for treating various acute and chronic inflammatory damage, such as inflammatory, autoimmune and stress damage caused by physical, chemical and biological factors. Thus, the peptide has an extremely wide application prospect. Moreover, the peptide has a small molecular weight and low immunogenicity, and is easy to synthesize, thereby avoiding the side effects and disadvantages of traditional monoclonal antibody drug antagonists.

Claims

1. A peptide with high affinity for TNF-α, wherein the peptide has an amino acid sequence of SEQ.ID.NO.1 or SEQ.ID.NO.3, or the peptide is a tandem or branched peptide with a single repeat or multiple repeats of SEQ.ID.NO.1 and SEQ.ID.NO.3 and has an amino acid sequence of SEQ.ID.NO.4.

2. A gene encoding a peptide with high affinity for TNF-α, wherein the peptide has an amino acid sequence of SEQ.ID.NO.1, and wherein the gene has a nucleotide sequence as set forth in SEQ.ID.NO.2.

3. A peptide modified by a biological material or a chemical group, comprising the peptide with high affinity for TNF-α as claimed in claim 1 as a core sequence, and being a structurally characteristic molecule linked with an antigen or a drug, or modified by PEG or covalently modified by other molecular groups on its C-terminal, N-terminal or side-chain group.

4. A modified peptide, comprising the peptide with high affinity for TNF-α as claimed in claim 1, wherein the modified peptide is labeled with a FITC fluorophore, an isotope, a chemiluminescent group or an enzyme reagent for TNF-α detection.

5. Use of the peptide with high affinity for TNF-α as claimed in claim 1 in the preparation of a TNF-α antagonist.

6. Use of the peptide with high affinity for TNF-α as claimed in claim 1 in the preparation of an agent for detection of TNF-α expression or a clinical testing agent.

7. Use of the gene encoding a peptide with high affinity for TNF-α as claimed in claim 2 in the preparation of a TNF-α antagonist or in a tracer detection.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0020] FIG. 1 shows the binding affinity of peptide 632 to TNF-α protein.

[0021] FIG. 2 shows the binding affinity of peptide 636 to TNF-α protein.

[0022] FIG. 3 shows the extent to which peptide 632 inhibits inflammation in Kunming mice model of inflammation.

DETAILED DESCRIPTION OF THE EMBODIMENTS

1. Acquisition and Modification of Peptide Sequence

[0023] Desired peptides having an affinity for TNF-α protein were artificially synthesized by a chemical method.

2. Synthesis and Purification of the Peptide

[0024] Lys (Dde)-Wang Resin was soaked in DCM for 10 min, and then DCM was drained. 25% piperidine (piperidine/DMF) with 3-fold volume was added into the resin, and then the piperidine was drained after bubbling with nitrogen for 20 min. DMF was added and blown for 1 min. After 6 cycles, DMF was drained, and the resin was detected to be blue by ninhydrin. The product is H-Lys (Dde)-Wang Resin. Three equivalents of Fmoc-Val-OH, HATU, DIEA in DMF were added to the resin. After blowing for 20 min with nitrogen, the DMF reaction solution was drained. DMF was added and blown for 1 min with nitrogen before draining. After 3 cycles, the resin was detected to be transparent by ninhydrin. The product is Fmoc-Val-Lys (Dde)-Wang Resin. The crude product was obtained by the same method. Purification was carried out on a Hanbang YCM C18 column using acetonitrile and Milli-Q water. In this way, a peptide with high specificity and high activity was obtained.

3. Affinity Assay of Peptide 632 to TNF-α and its Effect on the Inflammation Indexes in Animal Model

[0025] (1) Experimental Results of the Affinity of Peptide 632 to TNF-α Protein.

[0026] A 96-well ELISA plate was coated with 2 μg/ml TNF-α protein at 4° C. overnight. After blocking with BSA, different concentrations of peptide 632 labeled with FITC were added to each well and incubated for 2 h. After incubation, HRP-conjugated anti-FITC monoclonal antibody was added, incubated for 1 h, and then ABTS coloring solution was added. After color development for 1 h, the OD value at 410 nm was measured using a microplate reader, and GraphPad Prism 5 was used for plotting and analysis. The results demonstrate that peptide 632 has a high binding affinity for TNF-α protein, with a dissociation constant Kd of 138 nM.

[0027] (2) Effect of Peptide 632 on the Inflammation Indexes in an Animal Model of Inflammation.

[0028] The experimental animals were divided into three groups: blank group, a non-related peptide control group and an antagonist peptide (peptide 632) group. Male Kunming mice of 6 weeks old were injected subcutaneously with peptides at right abdomen for 3 consecutive days. 30 min after the last injection, mice of each group were smeared with p-xylene (0.03 ml/per mouse) on both sides of the right auricle to induce inflammation, and the left auricle was served as normal control. 1 h after the inflammation, animals were sacrificed, and the ears of mice were completely cut and marked to distinguish the left and right ears of the same mouse. Both sides of the mouse ear were coated with the same piece of paper. An ear swelling puncher with a diameter of 8 mm was used to cut the same parts of the left and right ears to obtain ear pieces. The ear pieces were weighed together with papers, and the results were recorded. Swelling degree of mouse ear=weighs of the ear piece being induced of inflammation−weighs of the ear piece without inflammation.

[0029] As shown in FIG. 1 and FIG. 2, peptide 632 has a high binding affinity for TNF-α protein. Animal experiments showed that the ear swelling degree of the experimental group injected with peptide 632 was significantly lower than those of the control group. The above results indicate that peptide 632 can achieve the effect of preventing inflammatory damage by antagonizing the activity of TNF-α.

4. Industrial Applicability

[0030] As an important inflammatory factor, TNF-α plays an important role in the occurrence and the development of inflammation. In immune diseases induced by inflammation, the increasing level of TNF-α induces a series of pathogenic reactions and expression of related cytokines, causing tissue damage. Antagonism of TNF-α has proven to be an effective treatment in various inflammatory diseases such as rheumatoid arthritis and psoriasis. However, current antagonists are focused on monoclonal antibodies and their derivatives. Monoclonal antibodies and their derivatives have strong side effects, especially they have high immunogenicity, which limits their use in drug. Therefore, the peptide with high binding affinity for TNF-α provided herein not only has a strong affinity for TNF-α, but also inhibits the biological activity of TNF-α. Thus, the peptide of the present invention can prevent related inflammatory damage and can be used as a potential TNF-α antagonist drug. In addition, the modified peptide 632 can be used as a detection reagent to detect the expression of TNF-α protein.

TABLE-US-00001 Sequence lists SEQ. ID. No. 1 (N terminate terminal): HYIDFRW SEQ. ID. NO. 2: CATTATATTGATTTTAGGTGG SEQ. ID. No. 3 (N terminate terminal): KASGSPSGFWPS SEQ. ID. No. 4 (N terminate terminal): HYIDFRWDMKASGSPSGFWPS