RECOMBINANT ONCOLYTIC NEWCASTLE DISEASE VIRUSES WITH INCREASED ACTIVITY

Abstract

The invention relates to transgene expressing Newcastle Disease Viruses (NDV), which have been demonstrated to possess significant oncolytic activity against mammalian cancers. The invention provides novel oncolytic viruses through the use of genetic engineering, including the transfer of foreign genes or parts thereof, such as genes encoding Ipilimumab, interleukin-12 or NS1. The present invention also provides nucleic acids encoding a reverse genetically engineered (rg-)NDV comprising one or more of these foreign genes and having a mutation in the HN gene, said mutation allowing replication of said rgNDV in a cancer cell to a higher level than replication of an otherwise identical rgNDV not having said mutation in the HN gene.

Claims

1. A recombinant Newcastle Disease Virus (NDV), carrying as a foreign gene at least one gene selected from the group consisting of: a gene encoding an antibody directed to the surface protein CTLA-4 or an antigen-binding part thereof directed to the surface protein CTLA-4 (anti-CTLA-4), such as Ipilimumab, an antigen-binding part of Ipilimumab, a functional analog of Ipilimumab or a functional analog of an antigen-binding part of Ipilimumab, a gene encoding a protein which improves the cellular immune response and improves the ability of T cells to enter tumor cells, or a part thereof which improves the cellular immune response and improves the ability of T cells to enter tumor cells, such as interleukin-12 (IL-12), a part of interleukin-12, a functional analog of interleukin-12 or a functional analog of a part of interleukin-12, a gene encoding a protein with the ability to modulate the virus replication cycle, or a part thereof with the ability to modulate the virus replication cycle, such as the non-structural protein NS1 of influenza A virus, a part of the non-structural protein NS1 of influenza A virus, a functional analog of the non-structural protein NS1 of influenza A virus or a functional analog of a part of the non-structural protein NS1 of influenza A virus, and any combination of these genes, parts or funcational analogs thereof, wherein said recombinant NDV having a mutation in the HN gene leading to a change in the amino acid sequence of the respective gene product and providing the NDV with an increased replication capability in a human cancer cell as compared to an otherwise identical NDV not having the said mutation in the HN gene, preferably allowing replication of said NDV in a human cancer cell in an at least 2-fold higher level.

2. The recombinant NDV according to claim 1, wherein the NDV comprises a mutated HN gene and the encoded hemagglutinin-neuramidase with an amino acid substitution at amino acid position 277 to an amino acid with a hydrophobic side chain other than phenylalanine, and wherein phenylalanine (F) is substituted to leucine (L) at amino acid position 277 of the HN gene.

3. The recombinant NDV according to claim 2, wherein the NDV further comprises a mutation in the M gene and the thus encoded matrix protein, wherein the mutated M gene encodes a matrix protein with an amino acid substitution at amino acid position 165 to an amino acid with an aromatic side chain, and wherein glycine (G) is substituted to tryptophane (W) at amino acid position 165 of the M gene.

4. The recombinant NDV according to claim 1, wherein the NDV for carrying the at least one foreign gene is derived from NDV strain MTH-68/H (SEQ ID No. 1).

5. The recombinant NDV according to claim 1, wherein the recombinant NDV is encoded by and/or comprises at least one of the nucleic acids according to SEQ ID No. 2 to 5 or parts thereof, or the recombinant NDV is encoded by and/or comprises a nucleic acid having a sequence identity of at least 75% to one of SEQ ID No. 2 to 5.

6. The recombinant NDV according to claim 1 for use in medicine.

7. The recombinant NDV according to claim 1 for use in a method of treating cancer in a subject considered in need thereof, in particular for the treatment of one or more indications selected from the group consisting of brain tumors, like glioblastoma, bone tumors, like osteosarcoma and/or Ewing's sarcoma, soft tissue tumors, like rhabdomyosarcoma, gynecological tumors, like breast cancer, ovary cancer and/or cervix cancer, gastrointestinal tumors, like esophageal tumors, stomach tumors, colon tumors, pancreas tumors, prostate tumors, lung tumors, ear, nose, throat tumors, tongue tumors, and skin tumors, like melanoma.

8. The recombinant NDV for use according to claim 7, wherein said subject is a mammalian animal or a human subject.

9. A nucleic acid encoding a recombinant NDV, the nucleic acid comprising a transgenic construct, wherein said transgenic construct encodes: an antibody directed to the surface protein CTLA-4 or an antigen-binding part thereof directed to the surface protein CTLA-4 (anti-CTLA-4), such as Ipilimumab, an antigen-binding part of Ipilimumab, a functional analog of Ipilimumab or a functional analog of a part of Ipilimumab, a gene encoding a protein which improves the cellular immune response and improves the ability of T cells to enter tumor cells, or a part thereof which improves the cellular immune response and improves the ability of T cells to enter tumor cells, such as interleukin-12 (IL-12), a part of interleukin-12, a functional analog of interleukin-12 or a functional analog of a part of interleukin-12, a gene encoding a protein with the ability to modulate the virus replication cycle, or a part thereof with the ability to modulate the virus replication cycle, such as the non-structural protein NS1 of influenza A virus, a part of the non-structural protein NS1 of influenza A virus, a functional analog of the non-structural protein NS1 of influenza A virus or a functional analog of a part of the non-structural protein NS1 of influenza A virus, and/or any combination of these genes, parts or functional analogs thereof, wherein the nucleic acid in addition having a mutation in the HN gene, said mutation allowing replication of the NDV in a cancer cell to a higher level than replication of an otherwise identical NDV not having the said mutation in the HN gene.

10. The nucleic acid according to claim 9, wherein the sequence encoding the recombinant NDV comprises a mutated HN gene encoding hemagglutinin-neuramidase with an amino acid substitution at position 277 to an amino acid with a hydrophobic side chain other than phenylalanine, and wherein the mutated HN gene encodes HN.sup.F277L.

11. The nucleic acid according to claim 9, wherein the sequence encoding the recombinant NDV further comprises a mutation in the M gene, wherein the encoded mutated M gene encodes a matrix protein with an amino acid substitution at position 165 to an amino acid with an aromatic side chain, and wherein the mutated M gene encodes M.sup.G165W.

12. The nucleic acid according to claim 9, wherein the sequence encoding the NDV for carrying the transgenic construct is derived from NDV strain MTH-68/H (SEQ ID No. 1).

13. The nucleic acid according to claim 9, wherein the nucleic acid consists of or comprises at least one of the nucleic acids according to SEQ ID No. 2 to 5 or parts thereof, or the nucleic acid consists of or comprises at least one of the nucleic acids having a sequence identity of at least 75% to one of SEQ ID No. 2 to 5.

14. The nucleic acid according to claim 9, wherein the nucleic acid is derived from a recombinant NDV according to claim 1.

15. A method for preparing a rgNDV, having improved replication in a cancer cell over a parent NDV, said method comprising the steps: a. providing a nucleic acid construct encoding a HN gene with a mutation, wherein the mutation in the HN gene leads to a change in the expression of the hemagglutinin-neuraminidase, wherein the amino acid, particularly phenylalanine (F), in position 277 is substituted, wherein the amino acid in position 277 is substituted to an amino acid with a hydrophobic side chain, and wherein the amino acid in position 277 is substituted to leucine (L) at position 277 of the HN gene, b. providing a nucleic acid encoding a rgNDV further comprises a transgenic construct encoding: an antibody directed to the surface protein CTLA-4 or an antigen-binding part thereof directed to the surface protein CTLA-4 (anti-CTLA-4), such as Ipilimumab, an antigen-binding part of Ipilimumab, a functional analog of Ipilimumab or a functional analog of a part of Ipilimumab, a protein which improves the cellular immune response and improves the ability of T cells to enter tumor cells or a part thereof which improves the cellular immune response and improves the ability of T cells to enter tumor cells, such as interleukin-12 (IL-12), a part of interleukin-12, a functional analog of interleukin-12 or a functional analog of a part of interleukin-12, a protein with the ability to modulate the virus replication cycle or a part thereof with the ability to modulate the virus replication cycle, such as the non-structural protein NS1 of influenza A virus, a part of the non-structural protein NS1 of influenza A virus, a functional analog of the non-structural protein NS1 of influenza A virus or a functional analog of a part of the non-structural protein NS1 of influenza A, and any combination of these proteins, c. incorporating said nucleic acid construct with said mutation in a nucleic acid encoding a rgNDV comprising the transgenic construct to achieve a nucleic acid according to claim 9, d. using said nucleic acid obtained in step c. encoding a recombinant and mutated rgNDV to produce infectious rgNDV, e. comparing the replication characteristics in cancer cells of the rgNDV of step d. with the replication characteristics of said parent NDV, and f. selecting said rgNDV for further use when it shows improved replication characteristics over said parent NDV.

16. The method according to claim 15, wherein the nucleic acid encoding the rgNDV of step b carries a mutation in the F gene, wherein said mutation is capable of improving oncolytic potential of said rgNDV, and wherein said mutation in the F gene comprises or is a mutation which encodes a fusion protein having an amino acid substitution in position 289, particularly a L289A substitution.

17. The method according to claim 15, wherein the nucleic acid encoding a rgNDV of step b further carries a mutation in the RNA-editing sequence of the P gene that abolishes and/or decreases the expression of the V protein.

18. A pharmaceutical formulation comprising particles of the recombinant NDV according to claim 1 and/or a nucleic acid according to claim 9, for use in oncological treatment of a subject considered in need thereof, in particular for the treatment of one or more indications selected from the group consisting of brain tumors, bone tumors, like osteosarcoma and/or Ewing's sarcoma, soft tissue tumors, like rhabdomyosarcoma, gynecological tumors, like breast cancer, ovary cancer and/or cervix cancer, gastrointestinal tumors, like esophageal tumors, stomach tumors, colon tumors, pancreas tumors, prostate tumors, lung tumors, ear, nose, throat tumors, tongue tumors, and skin tumors, like melanoma.

Description

FIGURES

[0132] FIG. 1 is a schematic presentation of the NDV reverse genetics system. The upper part shows the composition of the full-length cDNA plasmid which contains the full-length NDV cDNA (encoding the nucleocapsid protein (NP), the phosphoprotein (P), the matrix protein (M), the fusion protein (F), the hemagglutinin-neuraminidase (HN), and the RNA-dependent RNA polymerase (L)) cloned behind the bacteriophage T7 RNA Polymerase promoter (T7P; yellow triangle) and followed by a ribozyme sequence (Rz) and T7 transcription termination signal (T7T).

[0133] A suitable host cell (shaded round-cornered box) is infected with a recombinant Fowlpox virus that expresses T7 DNA-dependent RNA polymerase (Fowlpox-T7) and subsequently co-transfected with the full-length cDNA plasmid and three helper plasmids containing the genes encoding the NDV NP, P and L proteins, respectively. Transcription of the full-length cDNA results in the generation of the NDV antigenome RNA which is encapsidated by NP protein then transcribed and replicated by the RNA-leading to the generation of infectious NDV.

[0134] FIG. 2A is a schematic presentation of the genome of a rgNDV-Mut HN(F277L)/M(G165W)-Ipilimumab (17,436 bp) according to the present invention. The figure shows the position of the gene Ipilimumab which is inserted as extra transcription unit into the rgNDV-Mut HN(F277L)/M(G165W) genome between the P and M genes.

[0135] FIG. 2B is a further schematic presentation of the genomes of rgNDV-mutants according to one embodiment of the present invention. The figure shows the position of the respective foreign gene (Ipilimumab, IL-12 or NS1), which is inserted as extra transcription unit into the rgNDV-mutant genome between the P gene and the M gene.

[0136] FIG. 3 shows growth kinetics in HeLa cells. HeLa cells were infected at a multiplicity of infection (MOI) of 0.01 with the indicated viruses. At 0 h, 8 h, 24 h and 48 h after infection, the amount of infectious virus in the supernatant was determined by end-point titration on QM5 cells. MTH68: NDV strain MTH-68/H; MutHu: NDV-Mut HN(F277L)/M(G165W); rgMTH68: NDV strain MTH-68/H derived by reverse genetics from cloned full-length cDNA; rgMutHu: NDV strain NDV-Mut HN(F277L)/M(G165W) derived by reverse genetics from cloned full-length cDNA; rgMutHu(HNL277F): rgMutHu in which the amino acid mutation at position 277 in the HN gene was converted from L back to F; rgMutHu(MW165G): rgMutHu in which the amino acid mutation at position 165 in the M gene was converted from W back to G.

[0137] FIG. 4 shows a calibration curve of a human IgG ELISA used for determining and quantifying the expression of Ipilimumab from a recombinant NDV strain according to the present invention.

[0138] FIG. 5 shows the expression of non-structural protein 1 by rgMutHu-NS1. The expression of NS1 protein was verified by means of immunological staining using H1N1 NS1 antibody, pAb, Rabbit from GenScript (https://www.genscript.com/antibody/A01551-H1N1 NS1 Antibody pAb Rabbit.html) against influenza A (H1N1) NS1 protein. Briefly, rgMutHu-NS1 infected or uninfected cell monolayers were fixed and the NS1-specific antibody was used in an immune-peroxidase monolayer assay (IPMA). The red-brown colour indicates the presence of the NS1 protein. FIG. 5A shows non-infected cells, FIG. 5B shows cells infected with rgMutHu-NS1. The strain rgMutHu-NS1 is the NDV strain NDV-Mut HN(F277L)/M(G165W) derived by reverse genetics from cloned full-length cDNA carrying as foreign gene non-structural protein NS1.

EXAMPLES

Example 1. Nucleotide Sequence Analysis of Mutant NDV-Mut HN(F277L)/M(G165W)

[0139] We identified a spontaneous mutant of an oncolytic NDV strain MTH-68/H (Csatary et al., 1999, Anticancer Res. 19:635-638.; further called MTH68). The replication capacity of the mutant strain (designated NDV-Mut HN(F277L)/M(G165W) in a variety of human neoplastic cell lines, as well as autologous primary tumors, is greatly enhanced as compared to the original MTH-68/H strain (also referred to as MTH68 strain). We analyzed its nucleotide sequence and found that, compared to MTH68, NDV-HN(F277L)/M(G165W) has two nucleotide mutations, one leading to an amino acid substitution in the M protein (G165W) and the other in the HN protein (F277L).

Example 2. A Reverse Genetics System that Allows Genetic Modification of NDV-Strains

2.1 Reverse Genetics

[0140] In order to be able to genetically modify the genome of an RNA virus such as NDV, a manipulatable genetic system must be developed that uses a copy of the full viral RNA (vRNA) genome in the form of DNA. This full-length cDNA is amenable to genetic modification by using recombinant DNA techniques. The authentic or modified cDNA can be converted back into vRNA in cells, which in the presence of the viral replication proteins results in the production of a new modified infectious virus. Such ‘reverse genetics systems’ have been developed in the last few decades for different classes of RNA viruses. This system enables the rapid and facile introduction of mutations and deletions and the insertion of a transgene transcriptional unit, thereby enabling the changing of the biological properties of the virus.

[0141] Reverse genetics systems for several NDV strains, including lentogenic as well as velogenic strains, were developed by the Central Veterinary Institute (CVI), part of Wageningen University and Research, currently Wageningen Bioveterinary Research (WBVR) under the supervision of Dr. Ben Peeters (Peeters et al., 1999, J. Virol. 73:5001-9; de Leeuw et al., 2005, J. Gen. Virol. 86:1759-69; Dortmans et al., 2009, J. Gen. Virol. 90:2746-50). In order to generate a reverse genetics system for providing the NDV nucleic acids and strains according to the present invention, a similar approach was used. Details of the procedure can be found in the above cited papers and in the paragraphs below. Briefly, the system consists of 4 components, i.e., a transcription plasmid containing the full-length (either authentic or genetically modified) cDNA of the virus, which is used to generate the vRNA, and 3 expression plasmids (‘helper plasmids’) containing the NP, P and L genes of NDV respectively, which are used to generate the vRNA-replication complex (consisting of NP, P and L proteins). Transcription of the cDNA (i.e. conversion of the cDNA into vRNA) and expression of the NP, P and L genes by the helper plasmids is driven by a T7 promoter. The corresponding T7 DNA-dependent RNA polymerase (T7-RNAPol) is provided by a helper-virus (Fowlpox-T7).

[0142] In order to rescue virus, the 4 plasmids are co-transfected into Fowlpox-T7 infected cells (FIG. 1). Three to five days after transfection, the supernatant is inoculated into specific-pathogen-free embryonated chicken eggs (ECE) and incubated for 3 days. Infectious virus that is produced by transfected cells will replicate in the ECE and progeny virus can be harvested from the allantois fluid.

[0143] In order to develop a reverse genetics system for NDV the following steps were followed: [0144] Generation of sub-genomic NDV and foreign gene cDNA's by RT-PCR [0145] Assembly of full-length cDNA in a transcription vector [0146] Cloning of each of the NP, P and L genes into an expression vector [0147] Verify nucleotide sequence of full-length cDNA and helper-plasmids [0148] Repair nucleotide differences resulting from the cloning procedure, if necessary [0149] Rescue of infectious virus from cDNA using co-transfection (FIG. 1)
2.2 Construction of Full-Length NDV-Mut HN(F277L)/M(G165W) cDNA and Helper Plasmids

[0150] NDV-Mut HN(F277L)/M(G165W) (passage 28 HeLa cells) was used for the isolation of vRNA using standard procedures. The vRNA was used to generate first-strand cDNA by means of Reverse Transcriptase followed by PCR to generate 4 sub-genomic cDNA fragments (designated C1, C2, C3 and C8). The full-length cDNA of NDV-MutHu was assembled from these fragments and cloned in the transcription vector pOLTV5 (Peeters et al., 1999, J. Virol. 73:5001-5009) by a combination of In-Fusion® cloning and classical cloning using restriction enzymes. An overview of the procedure is shown in FIG. 2, and further details can be found in Appendix 1 of this reference. The NP, P and L-genes of NDV-MutHu were obtained by RT-PCR (Appendix 1) and cloned in the expression plasmid pCVI which was derived by deletion of a ClaI restriction fragment from pCI-neo (Promega).

2.3 Nucleotide Sequence Analysis

[0151] Nucleotide sequence analysis was used to verify that the sequence of pFL-NDV Mut HN(F277L)/M(G165W) was correct. A few nucleotides which differed from the Reference sequence were repaired. Silent mutations (i.e., not leading to an amino acid change) may be left unchanged.

2.4 Rescue of Infectious Virus from pFL-NDV Mut HN(F277L)/M(G165W)

[0152] In order to generate infectious virus, we used the co-transfection system described above (and illustrated in FIG. 1) to transfect QM5 cells (derived from Quail) using plasmid pFL-NDV_Mut HN(F277L)/M(G165W) and the helper plasmids pCVI-NP.sup.Mut HN(F277L)/M(G165W), pCVI-P.sup.Mut HN(F277L)/M(G165W) and pCVI-L.sup.Mut HN(F277L)/M(G165W). Rescue of infectious virus was successful as demonstrated by the presence of infectious virus in the allantoic fluid of ECE that were inoculated with the transfection supernatant (data not shown). The identity of the rescued virus was determined by RT-PCR followed by sequencing. The rescued virus was designated rgMut HN(F277L)/M(G165W). NDV-Mut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(G165W) have similar growth kinetics in HeLa cells.

Example 3. Identify Whether One or Both of the Amino Acid Substitutions in Mut HN(F277L)/M(G165W) are Responsible for the Difference in Growth Kinetics Between Mut HN(F277L)/M(G165W) and the Parent Strain MTH68

3.1 Growth Kinetics in HeLa Cells

[0153] The rescued rg-viruses (Table 1) as well as the original Mut HN(F277L)/M(G165W) and MTH68 viruses were used to determine their growth-kinetics in HeLa cells. Briefly, 4×10.sup.6 HeLa cells were seeded in 25 cm.sup.2 cell culture flasks and grown overnight. The cells were infected using a MOI of 0.01 (i.e., 1 infectious virus particle per 100 cells), and at 8, 24 and 48 hours after infection the virus titer in the supernatant was determined by end-point titration on QM5 cells.

[0154] The data (FIG. 3) indicate that strains Mut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(G165W) yield at least 10-fold higher virus titers than MTH68. Furthermore, the data indicate that the mutation at amino acid position 277 in the HN gene is responsible for this effect. The M mutation does not seem to have an effect.

[0155] This can be best seen when looking at the virus titers 24 h after infection, or even better when comparing the increase in virus titer between 8 h and 24 h (the exponential growth phase). The virus titer shows an increase of 3.5 (log 10) for Mut HN(F277L)/M(G165W), rgMut HN(F277L)/M(G165W) and rgMut HN(F277L)/M(W165G), whereas this is 2.5 for MTH68, 2.7 for rgMut HN(L277F) and 3.0 for rgMTH68 (Table 3).

[0156] rgMut HN(F277L)/M(W165G) is a strain in which the mutation in the M gene has been restored in accordance with the NDV MTH-68/H.

TABLE-US-00003 TABLE 1 Virus titers (log10 TCID50/ml) Time after infection (h) Virus 0 h 8 h 24 h 48 h MTH68 4.8 4.5 7.0 7.0 Mut HN(F277L)/M(G165W) 5.0 4.3 7.8 8.3 rgMTH68 5.0 4.0 7.0 7.5 rgMut HN(L277F) 5.0 4.3 7.0 7.3 rgMut M(W165G) 4.8 4.3 7.8 7.5 rgMutHu 5.3 4.5 8.0 8.0

Example 4. Generation of Recombinant NDV-Strains with Enhanced Oncolytic and Immune Stimulating Properties Due to the Expression of Different Therapeutic Proteins

[0157] To this end, three different rgMut HN(F277L)/M(G165W) strains were generated, expressing the genes for:

1) Ipilimumab

2) Interleukin 12

[0158] 3) Non-structural protein NS 1 of influenza A virus

4.1 Generation of Recombinant Viruses

[0159] Recombinant NDV-Mut HN(F277L)/M(G165W) viruses (rgNDV-Mut HN(F277L)/M(G165W)) expressing Ipilimumab, interleukin-12 or NS1 were generated by means of the previously established reverse genetics system described above. The genes encoding the heavy- and light-chain of Ipilimumab or the gene encoding interleukin 12 or the gene encoding the non-structural protein NS1 of influenza A virus were inserted into the full-length cDNA of NDV-Mut HN(F277L)/M(G165W) between the P and the M genes. To this end the open reading frames of the foreign genes were fused via a 2A sequence. The genes were provided with the necessary NDV gene-start and gene-end sequences in order to allow transcription by the vRNA polymerase.

[0160] FIG. 2 shows the final constellation of the recombinant virus that was rescued from cloned full-length cDNA by means of the NDV reverse-genetics systems.

[0161] Infectious virus was rescued for all three constructs, and virus stocks were prepared by two passages in HeLa cells. The nucleotide sequences of the inserted genes in the different recombinant viruses were verified by means of nucleotide sequence analysis and found to be correct.

[0162] Expression of Ipilimumab was determined and quantified by using a human IgG ELISA (Invitrogen). The amount of Ipilimumab that is secreted into the medium of rgMut HN(F277L)/M(G165W)-Ipilimumab infected HeLa cells was determined by analyzing the culture supernatant of 3 different infections.

[0163] As can be seen from the OD450 values given in Table 2 below, the production reached approximately 6,400-7,000 ng/ml.

TABLE-US-00004 TABLE 2 OD450 values of a human IgG ELISA Calibration samples rgMutHu rgMutHu-Ipilimumab IgG series series neg sample sample sample ng/ml 1 2 control 1 2 3 dilution 100.00 1.131 1.277 0.155 1.818 1.770 1.655 1:2 50.00 0.624 0.737 0.108 1.754 1.591 1.471 1:4 25.00 0.351 0.415 0.082 1.577 1.503 1.426 1:8 12.50 0.198 0.232 0.066 1.425 1.411 1.321 1:16 6.25 0.134 0.143 0.121 1.169 1.067 1.012 1:32 3.12 0.095 0.099 0.094 0.874 0.887 0.908 1:64 0.00 0.081 0.081 0.080 0.678 0.601 0.623 1:128 0.00 0.067 0.081 0.071 0.469 0.413 0.408 1:256

[0164] Faithfull expression of non-structural protein NS1 by rgMutHu-NS1 was verified by means of immunological staining of rgMutHu-NS1 infected monolayers using an antibody against against influenza A (H1N1) NS1 protein (FIG. 5). An expression of NS1 was only detectable in cells infected with rgMutHu-NS1 (FIG. 5B).

REFERENCES

[0165] Blach-Olszewska et al., (1977) Why HeLa cells do not produce interferon? Arch Immunol Ther Exp (Warsz) 25:683-91. [0166] Chng et al., (2015) Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells, mAbs, 7:2, 403-412; http://dx.doi.org/10.1080/19420862.2015.1008351. [0167] Enoch et al., (1986) Activation of the Human beta-Interferon Gene Requires an Interferon-Inducible Factor, Mol. Cell. Biol. 6:801-10. [0168] Haryadi et al., (2015) Optimization of Heavy Chain and Light Chain Signal Peptides for High Level Expression of Therapeutic Antibodies in CHO Cells. PLoS ONE 10(2): e0116878. doi:10.1371/journal.pone.0116878. [0169] Schirrmacher, (2015) Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opin. Biol. Ther. 15:17 57-71 [0170] Zamarin et al., (2014) Localized oncolytic virotherapy overcomes systemic tumor resistance to immune checkpoint blockade immunotherapy. Sci. Transl. Med. 6(226). [0171] Zamarin & Palese, (2017) Oncolytic Newcastle Disease Virus for cancer therapy: old challenges and new directions. Future Microbiol. 7: 347-67.

TABLE-US-00005 APPEMDIX 1 primers used for the generation of cDNA fragments and helper-plasmids cDNA fragments Fragment Size Primer Sequence (5′-3′) C1 3.6 kb Noss-09 ACGACTCACTATAGGaccaaacagagaatccgtgag (SEQ ID No. 8) Noss-121 CCGGGAAGATCCAGGgcactcttcttgcatgttac (SEQ ID No. 9) C2 3.7 kb Noss-122 GGGCCTGCCTCACTAtggtggtaacatgcaagaag (SEQ ID No. 10) Noss-123 TGCATGTTACCACCAatgtgtcattgtatcgcttg (SEQ ID No. 11) C3 5.7 kb Noss-125 CAAGAAGGGAGATACgtaatatacaagcgatacaatg (SEQ ID No. 12) Noss-126 TCGCTTGTATATTACttgttgtagcaaagagcacc (SEQ ID No. 13) C8 2.0 kb Noss-133 GGCCTGGATCTTCCCattatgctgtctgtatacggtgc (SEQ ID No. 14) Noss-10 ATGCCATGCCGACCCaccaaacaaagacttggtgaatg (SEQ ID No. 15) iPCR 2.5 kb Noss-17 CCTATAGTGAGTCGTATTAATTTC (StuI) (SEQ ID No. 16) pOLTV5 Noss-128 CCTGGATCTTCCCGGGTCGG (SEQ ID No. 17) iPCR 2.5 kb Noss-137 GGGTCGGCATGGCATCTCCACC pOLTV5 (SEQ ID No. 18) (SmaI) Noss-138 GGGAAGATCCAGGCCTATAGTG (SEQ ID No. 19)