NEW USES OF A MUTATED LACTONASE, AND COMPOSITIONS

Abstract

Disclosed is a mutated lactonase belonging to the phosphotriesterase-like lactonase family, which increases the susceptibility of bacteria to antimicrobial agents as compared to the use of antimicrobial agents alone.

Claims

1. A method for increasing susceptibility of bacteria to antimicrobial agents, comprising exposing the bacteria to a mutated lactonase belonging to the phosphotriesterase-like lactonase family, wherein at least the amino acid tryptophan at the beginning of loop 8 is substituted by the amino acid isoleucine.

2. The method of claim 1, wherein the antimicrobial agent is selected from the group consisting of antibiotics or a mixture of antibiotics, disinfectants or a mixture of disinfectants, biocides or a mixture of biocides and bacteriophages possibly naturally present in the environment or not, or a cocktail of such bacteriophages.

3. The method of claim 2, wherein said antibiotic is selected from the group consisting of: Amikacin, Amoxicillin, Amoxicillin/clavulanate, Ampicillin, Amprolium, Apramycin, Aspoxicillin, Aureomycin, Avilamycin, Azithromycin, Bacitracin, Bambermycin, Baquiloprim, Benzylpenicillin, Bicozamycin, Carbadox, Cefacetrile, Cefalexin, Cefalonium, Cefalotin, Cefapyrin, Cefazolin, Cefdinir, Cefquinome, Ceftiofur, Ceftriaxone, Cefuroxime, Chloramphenicol, Chlortetracycline, Ciprofloxacin, Clarithromycin, Clindamycin, Cloxacillin, Colistin, Dalbavancin, Danofloxacin, Decoquinate, Diclazuril, Dicloxacillin, Difloxacin, Doripenem, Doxycycline, Enramycin, Enrofloxacin, Ertapenem, Erythromycin, Florfenicol, Flumequine, Fosfomycin, Framycetin, Fusidic acid, Gentamicin, Gentamicin Sulfate, Gramicidin, Halofuginone hydrobromide, Hetacillin, Imipenem, Imipenem/cilastatin, Josamycin, Kanamycin, Kitasamycin, Laidlomycin, Lasalocid , Levofloxacin, Lincomycin, Lincomycin hydrochloride, Maduramycin, Marbofloxacin, Mecillinam, Meropeneme, Miloxacin, Minocycline, Mirosamycin, Monensin, Moxifloxacin, Nafcillin, Nalidixic acid, Narasin, Neomycin, Neomycin/oxytetracycline, Neosporin, Nicarbazine, Norfloxacin, Novobiocin, Ofloxacin, Orbifloxacin, Oritavancin, Oxacillin, oxolinic acid, Oxytetracycline, Paromomycin, penethamate hydroxide, Penicillin, Penicillin G Potassium, Penicillin procaine, Penicillin V potassium, Phenethicillin, Phenoxymethylpenicillin, Pirlimycin, Polymyxin, Polymyxin B, Polysporin (bacitracin/polymyxin), Pristinamycin, Rifampin, Rifaximin, Roxarsone, Salinomycin, Semduramicin, Spectinomycin, Spiramycin, Streptomycin, Sulfachlorpyridazine, Sulfadiazine, Sulfadimerazine, Sulfadimethoxazole, Sulfadimethoxine, Sulfadimethoxine and ormetoprim 5:3, Sulfadimidine, Sulfadoxine, Sulfafurazole, Sulfaguanidine, Sulfamethazine, Sulfamethoxazole/trimethoprim, Sulfamethoxine, Sulfamethoxypyridazine, Sulfamonomethoxine, Sulfanilamide, Sulfaquinoxaline, Sulfasalazine, Sulfisoxazole, Surfactin, Telavancin, Terdec amyc in, Tetracycline, Thiamphenicol, Tiamulin, Ticarcillin, Tilmicosin, Tobicillin, Tobramycin, Trimethoprim, Trimethoprim/Sulfonamide, Tulathromycin, Tylo sin, Valnemulin, Vancomycin, Virginiamycin.

4. The method of claim 2, wherein said disinfecting agent comprises an alcohol, chlorine, aldehyde, oxidising agent, iodine, ozone, phenolic compound, quaternary ammonium compound or a mixture of two or more of these.

5. The method of claim 2, wherein the biocide is selected from the group consisting of: biocidally active peroxides, mono- and polyhydric alcohols, aldehydes, acids, ozone, naphtha compounds and compounds containing an alkali metal, transition metal, group III or group IV metal, sulphur, nitrogen or halogen atom and mixtures of two or more of these.

6. The method of claim 2, wherein the bacteriophage belongs to the family Myoviridae, Siphoviridae, Podoviridae, Corticoviridae, Cystoviridae, Inoviridae, Leviviridae, Microviridae, Plasmaviridae and Tectiviridae or a cocktail thereof.

7. The method of claim 1, wherein the effective dose of antimicrobial agent is decreased by at least a factor of 2 compared to the effective dose of antimicrobial agent alone.

8. Composition comprising as active principle a mutated lactonase belonging to the phosphotriesterase-like lactonase family in which at least the amino acid tryptophan located at the beginning of loop 8 is substituted by the amino acid isoleucine, and at least one antimicrobial agent.

9. The composition of claim 8, wherein said anti-microbial agent is used at a concentration of 10 μM to 100 mM.

10. The composition according to claim 8, wherein said mutated lactonase is used at a concentration of 0.1 mg/L to 10 g/L.

11. A method for removing bacteria from a material contaminated or susceptible to contamination by said bacteria, comprising applying to the material the composition of claim 8, wherein said material contaminated with said bacteria or liable to be so is selected from: medical devices: medical equipment: submerged surfaces; and industrial installations.

12. A plant protection product suitable for the prevention and/or treatment of plant infections, the plant protection product comprising the composition of claim 8.

13. A food supplement for humans or animals or an animal nutrition product comprising the composition of claim 8.

14. A solution, oil, suspension, emulsion, nanoparticle, liposome, granule or functionalized surface comprising the composition of claim 8 formulated with at least suitable excipient.

15. A method for in animal health, the prevention and/or treatment of bacterial infections, the treatment of dysbiosis, the prevention of biofilms present in breeding tanks and aquariums, or in human health, the prevention and/or treatment of bacterial infections, nosocomial diseases, wounds, burns, eye infections, diabetic foot, for the prevention and/or treatment of dysbiosis, or for the prevention and/or treatment of dental plaque the method comprising administering a therapeutically effective dose, to a patient in need thereof, of a composition comprising as active principle a mutated lactonase belonging to the phosphotriesterase-like lactonase family in which at least the amino acid tryptophan located at the beginning of loop 8 is substituted by the amino acid isoleucine and at least one antimicrobial agent.

16. The method of claim 1, wherein said mutated lactonase has the sequence SEQ ID NO: 1 in which at least the amino acid tryptophan W at position 263 is substituted by the amino acid isoleucine I.

17. The method of claim 16, wherein said sensitivity of bacteria to antimicrobial agents is increased by at least a factor of 2.

18. The composition of claim 8, wherein said mutated lactonase has the sequence SEQ ID NO: 1 in which at least the amino acid W at position 263 is substituted by the amino acid isoleucine I.

19. The composition according to claim 8, wherein said mutated lactonase is used at a concentration of 1 μg/cm.sup.2 to 1 mg/cm.sup.2.

20. A method for removing bacteria from a material contaminated or susceptible to contamination by said bacteria, comprising applying to the material the composition of claim 9, wherein said material contaminated with said bacteria or liable to be so is selected from: medical devices; medical equipment; submerged surfaces; and industrial installations.

Description

[0148] Left: Enumeration of P. aeruginosa bacteria recovered from biofilms in the absence of NaOCl bleach treatment, in the presence of SsoPox-W263I lactonase (solid bar) or an inactive variant of the SsoPox 5A8 enzyme (hatched bar).

[0149] Right: Enumeration of P. aeruginosa bacteria recovered from biofilms after treatment with 0.7mM NaOCl bleach in the presence of SsoPox-W263I lactonase (solid bar) or an inactive variant of the SsoPox 5A8 enzyme (hatched bar).

[0150] A 2 log decrease is observed when bleach (0.7 mM) and SsoPox-W263I lactonase are used simultaneously demonstrating the synergistic effect of the combination.

[0151] Material and Method

[0152] a) Sensitivity Tests

[0153] The doses of antimicrobial agents required to eliminate bacterial biofilms are determined using the “MBEC (Minimal Biofilm Eradication Concentration) Assay TM” technique developed by Innovotech (Alberta, Canada) according to the supplier's data.

[0154] Bacterial biofilms are formed by bacterial growth in a medium and conditions adapted to the bacteria studied in the presence or absence of the lactonase SsoPox-W263I of sequence SEQ ID NO: 2.

[0155] Bacteria are pre-cultured for 6 hours in oxygenated flasks under the conditions indicated in Table 1 and then MBEC plates are plated by diluting the pre-culture to 1:1000 in the presence or absence of SsoPox-W263I lactonase at 0.5 mg/mL. After 24 hours of growth, the bacterial biofilms formed on the spikes of the MBEC plate cover are rinsed by immersion for 5 minutes in a buffer solution (Table 1). The biofilms are then immersed in a buffer solution containing antimicrobial agents (disinfectants, bactericidal or bacteriostatic antibiotics, bacteriophages, biocides) for a period of time representative of the mechanism of action of the antimicrobial agent studied (1.5 h for antiseptics, 3 h for antibiotics, 4 h for phages). After immersion in the antimicrobial agents, the bacterial biofilms were rinsed for 5 minutes in a buffer solution and then incubated for 1 hour in a nutrient medium adapted to the bacteria studied and containing detergents to detach the biofilms (Table 1). After 1 hour of incubation, the bacteria detached from the biofilm and thus present in the wells of the MBEC plate are serially diluted and plated on suitable nutrient agar to perform bacterial counts and determine the number of bacteria that survived the combined treatment of the mutated SsoPox-W263I enzyme and the antimicrobial agent (FIG. 1). The MBEC is the minimum concentration of antimicrobial agent to eradicate the bacteria in the biofilm.

TABLE-US-00002 TABLE 2 Experimental conditions for the determination of MBEC. Pre- Nutrient culture medium Buffer Recovery Bacteria Strain conditions MBEC Temperature Agitation solution environment Pseudomonas UCBPP- LB - MOPS 37° C. Orbital - MOPS Recovery aeruginosa PA14 37° C. glutamate 110 RPM LB Chromobacterium ATCC- LB - LB 25° C. Orbital - PBS Recovery violaceum 12472 37° C. 110 RPM LB LB (10 g/L peptone, 5 g/L yeast extract, 10 g/L NaCl); 10x MOPS buffer (500 mM MOPS, 40 mM Tricine, 500 mM NaCl, 10 mM K2HSO4, 500 mM MgCl2, 100 mM CaCl2, 3 mM (NH4)6Mo7O24, 400 mM H3BO3, 30 mM Co(OAc)2, 10 mM CuSO4, 80 mM MnSO4, 10 mM ZnSO4 [pH 7.0] , sterilised by 0.22 μm filtration); MOPS glutamate medium (MOPS 1x, 15 mM NH4Cl, 5 μM Fe2SO4, 4 mM K2HPO4, 25 mM glutamate); PBS (8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4, 0.24 g/L KH2PO4); Recovery LB (LB, 20 g/L saponin, 10 g/L Tween-80)

[0156] b) Gene Expression of the CRISPR-Cas System

[0157] Bacteria were grown in MOPS medium for P. aeruginosa and LB for C. violaceum, in the presence of the mutated lactonase SsoPox-W263I (0.5 mg/mi) or its inactive variant 5A8 (0.5 mg/mi). After 16 hours of culture (stationary phase), the bacteria were recovered by centrifugation.

[0158] RNAs were extracted and purified with the PureLink® RNA mini kit (ThermoFisher) according to the supplier's recommendations and then treated with the TURBO DNA-free™ kit (ThermoFisher) to remove genomic DNA contamination. Samples were checked for quality by 1.5% agarose gel migration and the amount of nucleic acid was measured with a NanoDrop 2000 spectrophotometer (Thermo Scientific) at OD260 nm. Complementary DNAs (cDNAs) were synthesised using the TaqMan® Reverse Transcription Reagents kit (ThermoFisher) according to the manufacturer's recommendations. RT-PCR was then performed using the LuminoCt® SYBR® Green qPCR ReadyMix™ kit and a CFX thermocycler (Bio-Rad) and specific primer pairs. PCR amplification was performed with the following method: Denaturation for 5 minutes at 94° C., followed by 29 cycles of [1 minute at 94° C., 1 minute at 55° C., 30 seconds at 72° C.] for amplification, then a final elongation step for 7 minutes at 72° C. Sample fluorescence is measured at the end of each cycle and denaturation curves were analysed with CFX Manager™ software (Bio-Rad). Gene expression was normalised by expression of a 5S RNA housekeeping gene.

TABLE-US-00003 TABLE 3 Sequences of primers used to assess gene expression in the CRISPR-Cas system Bacterial Target species gene Sequence P. cas1 Forward TCAAGGACTCGCTGATCCTG aeruginosa (SEQ ID NO: 3) Reverse GATCATGAAGTCCAGGGCCT (SEQ ID NO: 4) cas3 Forward GGTTGATCGTCAGCCATCAT (SEQ ID NO: 5) Reverse GGCCTTTTCTTTTGCGTCT (SEQ ID NO: 6) csy1 Forward TCTTCGAGCATGACTTCGGA (SEQ ID NO: 7) Reverse TGGCGAGGTTGTTATGGACT (SEQ ID NO: 8) csy2 Forward CGTCCGAAGAAGAAGCATCG (SEQ ID NO: 9) Reverse CGCAGCGGTGTTTCTCTATC (SEQ ID NO: 10) csy3 Forward AAGACCAAGGACCGTGACC (SEQ ID NO: 11) Reverse AGCCCTGATCGTTCACGTAG (SEQ ID NO: 12) csy4 Forward ACAGGATCGGCGTGAGCTT (SEQ ID NO: 13) Reverse CCGCAACCCTTCCAGCCA (SEQ ID NO: 14) 5S Forward GAACCACCTGATCCCTTCCC (SEQ ID NO: 15) Reverse TAGGAGCTTGACGATGACCT (SEQ ID NO: 16) C. cas1 Forward CAGGATGGCTGCGTCTTTG violaceum (SEQ ID NO: 17) Reverse AACTACCTGGCCTACGGC (SEQ ID NO: 18) cas3 Forward GGACAGGTAGGAGGCTTG (SEQ ID NO: 19) Reverse TACGCGAGCAAGTGACCC (SEQ ID NO: 20) csy1 Forward GGAATTCCGCCTCCGCCA (SEQ ID NO: 21) Reverse GCCGACAGCGATGAAGAC (SEQ ID NO: 22) csy2 Forward TCACCGGCCTGATGACGGC (SEQ ID NO: 23) Reverse GAAGCGCTGGATGTAGTCG (SEQ ID NO: 24) csy3 Forward GCGAGTACAGGCTTTCCAC (SEQ ID NO: 25) Reverse AAACCATCTGGCGGCACTC (SEQ ID NO: 26) csy4 Forward CGGAAGCATTGGCCGGTG (SEQ ID NO: 27) Reverse CGCGCGACAGGCTGATG (SEQ ID NO: 28) 5S Forward CTGGTGGCCATAGCGAGG (SEQ ID NO: 29) Reverse GTCTGGCGGTGTCCTACTT (SEQ ID NO: 30)

[0159] Results

[0160] a) Sensitivity Tests

[0161] FIG. 1 shows that without antiseptic treatment (left), the same number of bacteria are recovered from biofilms whether or not there has been treatment with SsoPox-W263I mutated lactonase. After treatment for 1.5 hours with 10 mM H2O2 antiseptic, no bacteria are recovered from the biofilm with the use of the SsoPox-W263I mutated lactonase whereas 104-105 bacterial cells are recovered without the lactonase. In the control sample (ctrl) made with an inactive variant of SsoPox-5A8 (V27G/P67Q/L72C/Y97S/Y99A/T177D/R223L/L226Q/L228M/W263H), 100 mM of antiseptic is required to completely eradicate the biofilm.

[0162] This means that the use of antiseptic and SsoPox-W263I mutated lactonase significantly reduces the number of bacteria recovered from the biofilm compared to the use of antiseptic alone or SsoPox-W263I mutated lactonase alone.

[0163] The results obtained in Table 3 show that the presence of the mutated lactonase SsoPox-W263I decreases by a factor of 10 the concentration of antibiotic and antiseptic (gentamicin, tobramycin and H2O2) required to eliminate the biofilms of P. aeruginosa. The same trend, with a factor of at least 20, is observed for a biofilm of the marine bacterium C. violaceum treated with a biocide used in antifouling paints for ships' hulls.

[0164] The preventive use of the mutated lactonase SsoPox-W263I, in addition to the biocide, therefore significantly reduces the use of biocidal products that have a negative impact on the environment and are known to facilitate the emergence of resistant bacteria in hospital or natural environments.

TABLE-US-00004 TABLE 4 MBEC with or without the use of the SsoPox W263I mutated lactonase Type of SsoPox Bacteria Strain biocide Name of the biocide W263I MBEC Pseudomonas UCBPP- Antibiotic Gentamicin — 20 μg/mL aeruginosa PA14 0.5 mg/mL 2 μg/mL Pseudomonas UCBPP- Antibiotic Tobramycin — 10 μg/mL aeruginosa PA14 0.5 mg/mL 1 μg/mL Pseudomonas UCBPP- Antiseptic H2O2 — 100 mM aeruginosa PA14 0.5 mg/mL 10 mM Chromobacterium ATCC- Broad Preventol A4S — <200 μM violaceum 12472 spectrum (Dichlofluanide) 0.5 mg/mL >10 μM biocide

[0165] In addition, Pseudomonas aeruginosa bacteria are also treated with W263I mutated lactonase and a bacteriophage cocktail (Instesti cocktail; Microgen Russia) with satisfactory results.

[0166] P. aeruginosa PA14 is treated with the mutated enzyme SsoPox-W263I and the Intesti phage cocktail or with the Intesti phage cocktail and the inactive variant SsoPox-5A8. The Intesti phage cocktail consists of a mixture of sterile filtrates of phages directed against Shigella flexneri (serovariants 1, 2, 3, 4, 6), Shigellasi, Proteus vulgaris, Proteus mirabilis, Enterococcus, Staphylococcus, Pseudomonas aeruginosa and excipients such as 8-hydroxyquinoline sulfate monohydrate at 0.0001 g/ml (estimated content) and is marketed by Intesti-bacteriophage, Microgen, Russia

[0167] FIG. 2 shows that P. aeruginosa PA14 treated with the mutated enzyme SsoPox-W263I and the Intesti phage cocktail is more sensitive to the Intesti phage cocktail than the bacteria treated with the inactive variant SsoPox-5A8 and the Intesti phage cocktail. Indeed, the bacteria treated with the inactive SsoPox-5A8 enzyme and the phage cocktail is little impacted by the Intesti phage cocktail whereas less bacteria are counted after treatment with the mutated SsoPox-W263I enzyme.

[0168] b) Gene Expression of the CRISPR-Cas System

[0169] The CRISPR-Cas system is involved in the defence of bacteria against bacteriophages. To determine whether the SsoPox-W263I mutated enzyme affects the regulation of the CRISPR-Cas system, the expression levels of the CRISPR-Cas genes cas 1, cas3, csy 1, csy2, csy3 and csy4 were measured in P. aeruginosa PA14 and clinical isolates from diabetic foot infections (All, B11, B12 and B13). aeruginosa PA14 and clinical isolates of P. aeruginosa from diabetic foot infections (All, B10, C5, C11, D10, F3) as well as in the marine strain of Chromobacterium violaceum CV12472. Primers targeting these different genes were created from the genomes of P. aeruginosa PA14 and C. violaceum CV12472 (Table 2). Cultures were treated with the enzyme SsoPox-W263 or the inactive enzyme SsoPox-5A8 (V27 G/P67 Q/L72C/Y97 S/Y99A/T177D/R223L/L226Q/L228M/W263 H). Gene expression is completely abolished in P. aeruginosa PA14 after treatment with the SsoPox-W263I mutated enzyme. In B10 and Cll gene expression is decreased by a factor of 5.5 and 8 respectively. In All and D10 the expression of the csyl-4 genes was significantly reduced. In F3, on the other hand, the expression of the genes is increased by a factor of 1.7 on average. In C. violaceum the expression of the cas3 and csy2-4 genes was significantly reduced. These results show that the SsoPox-W263I enzyme impacts the regulation of the CRISPR-Cas system.

[0170] c) Demonstration of a synergistic effect between the W263I mutated lactonase and a biocide (NaOCl)

[0171] It is shown in FIG. 5, that without treatment with sodium hypochlorite (NaOCl) (left), the same number of bacteria are recovered from biofilms whether or not there was treatment with W263I mutated lactonase. After treatment with 0.7 mM sodium hypochlorite and W263I mutated lactonase, the number of bacteria recovered from biofilms was reduced by 2 Log compared to the use of sodium hypochlorite alone.

[0172] These results show that the use of sodium hypochlorite in combination with the W263I mutated lactonase significantly reduces the number of bacteria recovered from the biofilm compared to the use of sodium hypochlorite alone or W263I mutated lactonase alone, thus demonstrating a synergistic effect between sodium hypochlorite and W263I mutated lactonase.