COMPOSITION, KIT, AND METHOD FOR DETECTING AND TYPING CORONAVIRUSES

Abstract

Provided in the present invention is a composition capable of detecting and typing novel coronavirus 2019-nCoV, coronavirus 229E, coronavirus NL63, coronavirus OC43, coronavirus HKU1, coronavirus MERSr-CoV, and coronavirus SARSr-CoV. At the same time, further provided is a kit comprising the composition and a method for detecting and typing coronaviruses. The composition of the present invention in combination with a fluorescent probe method and a melting curve method can perform simultaneous detection and typing of seven coronaviruses in one tube.

Claims

1. A composition capable of detecting and typing coronaviruses, the composition comprising: a first group: a novel coronavirus 2019-nCoV forward primer as shown in SEQ ID NO: 1, a novel coronavirus 2019-nCoV reverse primer as shown in SEQ ID NO: 2, and a novel coronavirus 2019-nCoV probe as shown in SEQ ID NO: 3; a coronavirus NL63 forward primer as shown in SEQ ID NO: 4, a coronavirus NL63 reverse primer as shown in SEQ ID NO: 5, and a coronavirus NL63 probe as shown in SEQ ID NO: 6; a coronavirus HKU1 forward primer as shown in SEQ ID NO: 7, a coronavirus HKU1 reverse primer as shown in SEQ ID NO: 8, and a coronavirus HKU1 probe as shown in SEQ ID NO: 9; and a second group: a coronavirus 229E forward primer as shown in SEQ ID NO: 10 and a coronavirus 229E reverse primer as shown in SEQ ID NO: 11; a coronavirus OC43 forward primer as shown in SEQ ID NO: 12 and a coronavirus OC43 reverse primer as shown in SEQ ID NO: 13; a coronavirus MERSr-CoV forward primer as shown in SEQ ID NO: 14 and a coronavirus MERSr-CoV reverse primer as shown in SEQ ID NO: 15; and a coronavirus SARSr-CoV forward primer as shown in SEQ ID NO: 16 and a coronavirus SARSr-CoV reverse primer as shown in SEQ ID NO: 17, wherein fluorescent groups in the first group are different from one another, and fluorescent groups in the second group are different from one another.

2. The composition according to claim 1, wherein the composition further comprises an internal standard forward primer as shown in SEQ ID NO: 18, an internal standard reverse primer as shown in SEQ ID NO: 19, and an internal standard probe as shown in SEQ ID NO: 20.

3. The composition according to claim 1, wherein the fluorescent reporter group is selected from a group consisting of FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3, and JOE.

4. The composition according to claim 1, wherein the fluorescent reporter group of the novel coronavirus 2019-nCoV probe as shown in SEQ ID NO: 3 is FAM; the fluorescent reporter group of the coronavirus NL63 probe as shown in SEQ ID NO: 6 is HEX; and the fluorescent reporter group of the coronavirus HKU1 probe as shown in SEQ ID NO: 9 is ROX.

5. The composition according to claim 1, wherein the fluorescent reporter group of the coronavirus 229E forward primer as shown in SEQ ID NO: 10 is FAM; the fluorescent reporter group of the coronavirus OC43 forward primer as shown in SEQ ID NO: 12 is HEX; the fluorescent reporter group of the coronavirus MERSr-CoV forward primer as shown in SEQ ID NO: 14 is ROX; and the fluorescent reporter group for the coronavirus SARSr-CoV as shown in SEQ ID NO: 16 is CY5.

6. The composition according to claim 1, wherein the coronavirus is selected from a group consisting of novel coronavirus 2019-nCoV, coronavirus 229E, coronavirus NL63, coronavirus OC43, coronavirus HKU1, coronavirus MERSr-CoV, and coronavirus SARSr-CoV.

7. The composition according to claim 1, wherein the amount of the primer in the composition is 50-150 nM.

8. The composition according to claim 1, wherein the amount of the probe in the composition is 25-75 nM.

9. The composition according to claim 1, wherein the components of the composition are in the same package.

10. A kit for detecting and typing coronaviruses, wherein the kit comprising the composition according to claim 1.

11. The kit according to claim 10, wherein the kit further comprises at least one of a nucleic acid release reagent, a dNTP, a reverse transcriptase, a DNA polymerase, and a PCR buffer.

12. The kit according to claim 10, wherein the amount of the primer in the composition is 50 to 150 nM.

13. The kit according to claim 10, wherein the amount of the probe in the composition is 25 to 75 nM.

14. The kit according to claim 11, wherein the concentration of the reverse transcriptase is 5 U/μL to 15 U/μL.

15. The kit according to claim 11, wherein and the concentration of the DNA polymerase is 5 U/μL to 15 U/μL.

16. A method for detecting and typing coronaviruses, wherein the method comprising the steps of: 1) releasing a nucleic acid of a testing sample; 2) performing, by using the composition according to claim 1, a fluorescent quantitative PCR on the nucleic acid obtained in step 1); and 3) obtaining and analyzing the results.

17. The method according to claim 16, wherein the sample is selected from a group consisting of a throat swab, sputum, a bronchoalveolar lavage fluid, and blood.

18. The method according to claim 16, wherein reaction conditions of the fluorescent quantitative PCR are: TABLE-US-00008 Number Step Temperature Time of cycles Reverse transcription 50° C. 25-35 minutes 1 Pre-denaturation 94° C.  2-10 minutes 1 Denaturation 94° C. 10-20 seconds 45-50 Annealing 60° C. 20-40 seconds Melting curve analysis 50° C. to 95° C. Fluorescence is 1 collected every 0.5° C. rise.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0043] FIG. 1: A is an amplification curve diagram of the composition in Table 1 of the present invention for detecting coronavirus 2019-nCoV; B is an amplification curve diagram of the composition in Table 2 of the present invention for detecting coronavirus 2019-nCoV; C is an amplification curve diagram of the composition in Table 3 of the present invention for detecting coronavirus 2019-nCoV;

[0044] FIG. 2: A is an amplification curve diagram of the composition in Table 1 of the present invention for detecting coronavirus NL63; B is an amplification curve diagram of the composition in Table 2 of the present invention for detecting coronavirus NL63; C is an amplification curve diagram of the composition in Table 3 of the present invention for detecting coronavirus NL63;

[0045] FIG. 3: A is an amplification curve diagram of the composition in Table 1 of the present invention for detecting coronavirus HKU1; B is an amplification curve diagram of the composition in Table 2 of the present invention for detecting coronavirus HKU1; C is an amplification curve diagram of the composition in Table 3 of the present invention for detecting coronavirus HKU1;

[0046] FIG. 4: A is a melting curve diagram of the composition in Table 1 for detecting coronavirus 229E; B is a melting curve diagram of the composition in Table 2 of the present invention for detecting coronavirus 229E; C is a melting curve diagram of the composition in Table 3 of the present invention for detecting coronavirus 229E;

[0047] FIG. 5: A is a melting curve diagram of the composition in Table 1 of the present invention for detecting coronavirus OC43; B is a melting curve diagram of the composition in Table 2 of the present invention for detecting coronavirus OC43; C is a melting curve diagram of the composition in Table 3 of the present invention for detecting coronavirus OC43;

[0048] FIG. 6: A is a melting curve diagram of the composition in Table 1 of the present invention for detecting coronavirus MERSr-CoV; B is a melting curve diagram of the composition in Table 2 of the present invention for detecting coronavirus MERSr-CoV; C is a melting curve diagram of the composition in Table 3 of the present invention for detecting coronavirus MERSr-CoV;

[0049] FIG. 7: A is a melting curve diagram of the composition in Table 1 of the present invention for detecting coronavirus SARSr-CoV; B is a melting curve diagram of the composition in Table 2 of the present invention for detecting coronavirus SARSr-CoV; C is a melting curve diagram of the composition in Table 3 of the present invention for detecting coronavirus SARSr-CoV;

[0050] FIG. 8: A is an amplification curve diagram of the composition in Table 1 of the present invention for detecting an internal standard; B is an amplification curve diagram of the composition in Table 2 of the present invention for detecting an internal standard; C is an amplification curve diagram of the composition in Table 3 of the present invention for detecting an internal standard.

DETAILED DESCRIPTION OF EMBODIMENTS

[0051] The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented therefrom. It should be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the present invention, rather than to limit the present invention.

EXAMPLE 1

Primers and Probes Used in the Present Invention

[0052] The primers and probes used in the present invention are shown in Tables 1-3 below:

TABLE-US-00003 TABLE 1 Novel coronavirus 2019-nCoV forward primer TGTAGCTTGTCACACCGTTT (SEQ ID NO: 1) Novel coronavirus 2019-nCoV reverse primer ATTAGCATAAGCAGTTGTGGCAT (SEQ ID NO: 2) Novel coronavirus 2019-nCoV probe ATAGTGAACCGCCACACATGACCAT (SEQ ID NO: 3) Coronavirus NL63 forward primer GTCTTGGTAATCGCAAACGTAAT (SEQ ID NO: 4) Coronavirus NL63 reverse primer AGAATCAGAACGAGTGCGAGAC (SEQ ID NO: 5) Coronavirus NL63 probe CTCTCTGTTGTTGAGTTTGAGGATCGCT (SEQ ID NO: 6) Coronavirus HKU1 forward primer TTGTTAGTAGTTTAGTTTTGGCTCG (SEQ ID NO: 7) Coronavirus HKU1 reverse primer CGCCACACATAACTATTTCACTC (SEQ ID NO: 8) Coronavirus HKU1 probe ATTCTATCGCCTTGCGAATGAATGT (SEQ ID NO: 9) Coronavirus 229E forward primer AATTTGCTGAGCTTGTGCC (SEQ ID NO: 10) Coronavirus 229E reverse primer TAACTCCTCAAGAAACTTACCCAA (SEQ ID NO: 11) Coronavirus OC43 forward primer AATCTACTGGGTCGCTAGCAA (SEQ ID NO: 12) Coronavirus OC43 reverse primer TAGTCGGAATAGCCTCATCGC (SEQ ID NO: 13) Coronavirus MERSr-CoV forward primer CAAAAGAAGAATCAACAGACCAAAT (SEQ ID NO: 14) Coronavirus MERSr-CoV reverse primer TCATTGGACCAGGCTGAACAC (SEQ ID NO: 15) Coronavirus SARSr-CoV forward primer CATGCTTAGGATAATGGCCTCTCT (SEQ ID NO: 16) Coronavirus SARSr-CoV reverse primer ACCTGTAGAAACGGTGTGACAAGTT (SEQ ID NO: 17) Internal standard forward primer TCCATCTCACTGCAATGTTTTGA (SEQ ID NO: 18) Internal standard reverse primer TGGAAAAACTGCAACAACATCAT (SEQ ID NO: 19) Internal standard probe AGCAACTTCTTCAAGGGCCCGGC (SEQ ID NO: 20)

TABLE-US-00004 TABLE 2 Novel coronavirus 2019-nCoV forward primer 3 GGCCGCAAATTGCACAAT (SEQ ID NO: 24) Novel coronavirus 2019-nCoV reverse primer 3 GTGTGACTTCCATGCCAATGC (SEQ ID NO: 25) Novel coronavirus 2019-nCoV probe 3 CCCCCAGCGCTTCAGCGTTCTT (SEQ ID NO: 26) Coronavirus NL63 forward primer 3 TTGAGTTTGAGGATCGCTCT (SEQ ID NO: 30) Coronavirus NL63 forward primer 3 GACTGTTGTCTTGAAGTGCTACG (SEQ ID NO: 31) Coronavirus NL63 probe 3 ACTCATCTCGTGCTAGCAGTCGTTCT (SEQ ID NO: 32) TCAACT Coronavirus HKU1 forward primer 3 CCCAACCCAAATTCACTGTGT (SEQ ID NO: 36) Coronavirus HKU1 reverse primer 3 GGTAATCCCAGAGAACCAGG (SEQ ID NO: 37) Coronavirus HKU1 probe 3 ACTCAACCACAAGGAAACCCTATCCC (SEQ ID NO: 38) ACAT Coronavirus 229E forward primer 2 CAACAACATCCTCTTCTTAACCCTAG (SEQ ID NO: 39) T Coronavirus 229E reverse primer 2 TTCATCACGCACTGGTTCAAC (SEQ ID NO: 40) Coronavirus OC43 forward primer 3 GCGATGAGGCTATTCCGACTAG (SEQ ID NO: 45) Coronavirus OC43 reverse primer 3 ACCTTCCTGAGCCTTCAATATAGTAA (SEQ ID NO: 46) CC Coronavirus MERSr-CoV forward primer 3 GGCACTGAGGACCCACGTT (SEQ ID NO: 49) Coronavirus MERSr-CoV reverse primer 3 AATTGCGACATACCCATAAAAGC (SEQ ID NO: 50) Coronavirus SARSr-CoV forward primer 2 TGGCCTCTCTTGTTCTTGCT (SEQ ID NO: 51) Coronavirus SARSr-CoV reverse primer 2 CTGATGATGTTCCACCTGGTT (SEQ ID NO: 52) Internal standard forward primer 2 GCCAAGTGTGAGGGCTG (SEQ ID NO: 55) Internal standard reverse primer 2 GGCTGATGAACTATAAAAGGGAAG (SEQ ID NO: 56) Internal standard probe 2 AATGCCCCAGTCTCTGTCAGCACTCC (SEQ ID NO: 57)

TABLE-US-00005 TABLE 3 Novel coronavirus 2019-nCoV forward primer 2 GCCCCAAGGTTTACCCAAT (SEQ ID NO: 21) Novel coronavirus 2019-nCoV reverse primer 2 AGGTCTTCCTTGCCATGTTG (SEQ ID NO: 22) Novel coronavirus 2019-nCoV probe 2 ACTGCGTCTTGGTTCACCGCTCTCA (SEQ ID NO: 23) Coronavirus NL63 forward primer 2 CTAGCAGTCGTTCTTCAACTCGT (SEQ ID NO: 27) Coronavirus NL63 reverse primer 2 GCCAAAGTAACAGCAGCAAC (SEQ ID NO: 28) Coronavirus NL63 probe 2 CGTAGCACTTCAAGACAACAGTCTCGC (SEQ ID NO: 29) ACT Coronavirus HKU1 forward primer 2 TGCCCACGAAGGTATCTTCTG (SEQ ID NO: 33) Coronavirus HKU1 reverse primer 2 GGATCCCTTGCCGAAAC (SEQ ID NO: 34) Coronavirus HKU1 probe 2 TCACCAAGCTGACACTTCTATTCCCTC (SEQ ID NO: 35) CG Coronavirus 229E forward primer 3 GTCACCCAAGTTGCATTTTTATTATC (SEQ ID NO: 41) Coronavirus 229E reverse primer 3 CCCAGACGACACCTTCAAC (SEQ ID NO: 42) Coronavirus OC43 forward primer 2 CTGGTACAGACACAACAGACGTT (SEQ ID NO: 43) Coronavirus OC43 reverse primer 2 ACCATCGTGGCAGCAGTT (SEQ ID NO: 44) Coronavirus MERSr-CoV forward primer 2 CAACTGGCTCCCAGGTGGT (SEQ ID NO: 47) Coronavirus MERSr-CoV reverse primer 2 TCCTTAACAGCCCGGAATGG (SEQ ID NO: 48) Coronavirus SARSr-CoV forward primer 3 AATGTGACAGAGCCATGCCT (SEQ ID NO: 53) Coronavirus SARSr-CoV reverse primer 3 CATAGCACTTGCTGTAACTTGTCAC (SEQ ID NO: 54) Internal standard forward primer 3 CTCGGATCCATCTCACTGC (SEQ ID NO: 58) Internal standard reverse primer 3 TTGGAAAAACTGCAACAACATCAT (SEQ ID NO: 59) Internal standard probe 3 CAACTTCTTCAAGGGCCCGGCT (SEQ ID NO: 60)

[0053] Among them, a fluorescent reporter group of the novel coronavirus 2019-nCoV probe was FAM; a fluorescent reporter group of the coronavirus NL63 probe was HEX; a fluorescent reporter group of the coronavirus HKU1 probe was ROX, and the 3′-end of the probes further had a BHQ1 or BHQ2 quencher group.

[0054] A fluorescent reporter group of the coronavirus 229E forward primer was FAM; a fluorescent reporter group of the coronavirus OC43 forward primer was HEX; a fluorescent reporter group of the coronavirus MERSr-CoV forward primer was ROX; and a fluorescent reporter group of the coronavirus SARSr-CoV was CY5.

EXAMPLE 2

Method for Detecting and Typing Coronaviruses

[0055] A testing sample of the present invention was a throat swab, sputum, a bronchoalveolar lavage fluid, or blood. A magnetic bead method was used to extract a viral nucleic acid, and the following operations were performed in a sample processing room:

[0056] 2.1 An appropriate number of 1.5-mL sterilized centrifuge tubes were taken, and labeled as a negative control, a positive control, and a testing sample, respectively. 300 μL of an RNA extraction solution 1 was added to each tube.

[0057] 2.2 200 μL of the testing sample or the negative control or the positive control was added to each tube. The tube was covered with a cap, and shaken for 10 seconds for through mixing, and subjected to instant centrifugation.

[0058] 2.3 100 μL of an RNA extraction solution 2-mix was added to each tube (sucked up after sufficient mixing), and the tube was shaken for 10 seconds for through mixing, and left to stand for 10 minutes at room temperature.

[0059] 2.4 After instant centrifugation, the centrifuge tubes were placed on a separator, and the solution was slowly sucked out after 3 minutes (be careful not to touch a brown substance adhered to the tube wall).

[0060] 2.5 600 μL of an RNA extraction solution 3 and 200 μL of an RNA extraction solution 4 were added to each tube, and the tube was shaken for 5 seconds for through mixing and subjected to instant centrifugation, and then the centrifuge tube was placed on the separator again.

[0061] 2.6 After about 3 minutes, the supernatant separated into two layers. A pipette tip was inserted into the bottom of the centrifuge tube, the liquid was slowly sucked up from the bottom completely and discarded. The tube was left to stand for 1 minute and then the residual liquid at the bottom of the tube was completely sucked up and discarded.

[0062] 2.7 50 μL of PCR-mix was added to each tube, and a pipette tip was used to suck up the PCR-mix to elute the brown residue adhered to the wall of the centrifuge tube. The operation was repeated several times to elute the residue as completely as possible, and then all the eluted brown mixture was transferred to a 0.2-mL PCR reaction tube, and the tube was covered with a cap and transferred to an amplification detecting zone.

[0063] The real-time fluorescent PCR reaction system was configured as follows:

TABLE-US-00006 Component Volume/concentration in each reaction Mg.sup.2+ 4 mM dNTPs (100 mM) 0.25 mM MMLV (10 U/μL) 10 U Taq enzyme (5 U/μL) 5 U SEQ ID NOs: 1-16 100 nM SEQ ID NOs: 17-20 50 nM PCR buffer (1.5x) Make up to 50 μL

[0064] The PCR amplification program was set up as follows:

TABLE-US-00007 Number Step Temperature Time of cycles Reverse transcription 50° C. 30 minutes 1 Pre-denaturation 94° C.  5 minutes 1 Denaturation 94° C. 15 seconds 45 Annealing 60° C. 30 seconds Melting curve analysis 50° C. to 95° C. Fluorescence is 1 collected every 0.5° C. rise.

[0065] Result analysis:

[0066] 1) Target detection signals were FAM, HEX (or VIC), ROX, and CY5, and an internal reference detection signal was CY5.

[0067] 2)Baseline setting: The baseline was generally set to 3-15 cycles, which specifically may be adjusted according to actual situations. The adjustment principle was to select a region where a fluorescence signal is relatively stable before exponential amplification, a starting point (Start) avoiding signal fluctuation in an initial stage of fluorescence collection, and an ending point (End) being less by 1-2 cycles than the Ct of a sample showing earliest exponential amplification. Threshold setting: the setting principle was to make a threshold line just exceed the highest point of a normal negative control.

[0068] 3) It was first analyzed whether an amplification curve for the internal standard is detected in the CY5 channel and Ct≤39, and if so, it indicated that the current test was effective, and subsequent analysis continued to be carried out:

[0069] A) if a typical S-shaped amplification curve was detected in the FAM channel and Ct<39, it indicated that the novel coronavirus 2019-nCoV detection result was positive; if a characteristic peak of Tm (69.5±1.0° C.) was detected in the FAM channel, it indicated that the coronavirus 229E detection result was positive;

[0070] B) if a typical S-shaped amplification curve was detected in the HEX channel and Ct<40, it indicated that the coronavirus NL63 detection result was positive; if a characteristic peak of Tm (67.0±1.0° C.) was detected in the HEX channel, it indicated that the coronavirus OC43 was positive;

[0071] C) if a typical S-shaped amplification curve was detected in the ROX channel and Ct<40, it indicated that the coronavirus HKU1 detection result was positive; if a characteristic peak of Tm (70.5±1.0° C.) was detected in the ROX channel, it indicated that the coronavirus MERSr-CoV detection result was positive; and

[0072] D) if a characteristic peak of Tm (68.0±1.0° C.) was detected in the CY5 channel, it indicated that the coronavirus SARSr-CoV detection result was positive.

[0073] 4) If a Ct for the internal standard was not detected in the CY5 channel or Ct>39, it indicated that the concentration of the testing sample was excessively low or there was an interfering substance that inhibited the reaction, and the experiment needed to be re-prepared.

[0074] Embodiment 3. Detection Results of Detecting the Positive Control by the Composition of the Present Invention

[0075] The compositions in Tables 1 to 3 of the present invention were used to test each target-positive plasmid according to the method described in Example 2, so as to simulate a clinical sample. Multiple PCR tests were conducted on a Hongshi fluorescent quantitative PCR instrument. The results are as shown in FIGS. 1-8. As can be seen from the figures:

[0076] When the coronavirus 2019-nCoV was detected with the composition in Table 1, the Ct value was around 25; when the coronavirus 2019-nCoV was detected with the composition in Table 2, the Ct value was around 28; and when the coronavirus 2019-nCoV was detected with the composition in Table 3, the Ct value was around 32. The amplification curves of A, B, and C were all relatively steep.

[0077] When the coronavirus NL63 was detected with the composition in Table 1, the Ct value was around 30; when the coronavirus NL63 was detected with the composition in Table 2, the Ct value was around 29, but the curve of B was not as steep as that of A; and when the coronavirus NL63 was detected with the composition in Table 3, the Ct value was around 34, and there was basically no amplification curve.

[0078] When the coronavirus HKU1 was detected with the composition in Table 1, the Ct value was around 25; when the coronavirus HKU1 was detected with the composition in Table 2, the Ct value was around 30; and when the coronavirus HKU1 was detected with the composition in Table 3, the Ct value was around 34, and the amplification curves of A and B were both relatively steep, and C basically had no amplification curve.

[0079] When the coronavirus 229E was detected with the composition in Table 1, the characteristic peak was obvious; when the coronavirus 229E was detected with the composition in Table 2, the characteristic peak was relatively obvious; and when the coronavirus 229E was detected with the composition in Table 3, the characteristic peak was not obvious.

[0080] When the coronavirus OC43 was detected with the composition in Table 1, the characteristic peak was obvious; when the coronavirus OC43 was detected with the composition in Table 2, the characteristic peak was relatively obvious; and when the coronavirus OC43 was detected with the composition in Table 3, the characteristic peak was not obvious.

[0081] When the coronavirus MERSr-CoV was detected with the composition in Table 1, the characteristic peak was obvious; when the coronavirus MERSr-CoV was detected with the composition in Table 2, the characteristic peak was relatively obvious; and when the coronavirus MERSr-CoV was detected with the composition in Table 3, the characteristic peak was not obvious.

[0082] When the coronavirus SARSr-CoV was detected with the composition in Table 1, the characteristic peak was obvious; when the coronavirus SARSr-CoV was detected with the composition in Table 2, the characteristic peak was relatively obvious; and when the coronavirus SARSr-CoV was detected with the composition in Table 3, the characteristic peak was not obvious.

[0083] When the internal standard was detected with the composition in Table 1, the Ct value was around 27; when the internal standard was detected with the composition in Table 2, the Ct value was around 30; and when the internal standard was detected with the composition in Table 3, the Ct value was around 31, and the amplification curves of A and B were both relatively steep, while the amplification curve of C was not steep.