OLIGONUCLEOTIDES FOR SPLICE MODULATION OF CARD9
20230193269 · 2023-06-22
Inventors
- Peter Hagedorn (Horsholm, DK)
- Lars Joenson (Horsholm, DK)
- Anja Moehart HOEG (Horsholm, DK)
- Jonas VIKESSA (Horsholm, DK)
- Fergus BYRNE (Ridgefield, CT, US)
- Jay FINE (Ridgefield, CT, US)
- Mouhamadou MBOW (Ridgefield, CT, US)
- Joe Adam WAHLE (Ridgefield, CT, US)
- Elliott Sanford KLEIN (Ridgefield, CT, US)
- Kristina Mary SAI (Ridgefield, CT, US)
- Fei SHEN (Ridgefield, CT, US)
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to splice modulating oligonucleotides (oligomers) that are complementary to the CARD9 pre-mRNA, for inhibiting the inclusion of a CARD9 exon 11 in CARD9 mRNA. The oligonucleotides of the invention are useful in the treatment of inflammatory diseases such as IBD.
Claims
1. An antisense oligonucleotide for modulating the splicing of a mammalian CARD9 pre-mRNA transcript, wherein the oligonucleotide has a length of 10 to 40 nucleotides and comprises a contiguous nucleotide sequence of at least 10 nucleotides of at least 90% complementarity to SEQ ID NO 1.
2. The antisense oligonucleotide of claim 1, wherein the oligonucleotide has a length of 10-25 nucleotides.
3. (canceled)
4. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, such as fully complementary to any one of SEQ ID NOs: 6-9.
5-7. (canceled)
8. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence comprises a nucleotide sequence which is complementary to, such as fully complementary to SEQ ID NO 559, 560, 561, 562, 563, 564 or 565.
9. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to a sequence selected from the group consisting of SEQ ID NOs: 11-284.
10. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide is capable of enhancing the expression of Δ11CARD9 and/or reducing the expression of WTCARD9.
11-12. (canceled)
13. The antisense oligonucleotide of claim 1 , wherein the oligonucleotide is, or comprises an antisense oligonucleotide mixmer or totalmer.
14. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof is 10 - 20 nucleotides in length.
15. The antisense oligonucleotide of claim 1, wherein the contiguous nucleotide sequence of the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 285-558.
16. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide comprises an oligonucleotide provided herein, such as a compound selected from the group consisting of compound ID NO #285_1 -#558_1.
17. A conjugate comprising the antisense oligonucleotide according of claim 1, and at least one conjugate moiety covalently attached to the oligonucleotide.
18. A pharmaceutically acceptable salt of the antisense oligonucleotide to of claim 1, or the conjugate of claim 17.
19. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 or the conjugate of claim 17 and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
20. An in vivo or in vitro method for modulating the splicing of a CARD9 pre-mRNA in a mammalian target cell expressing CARD9, the method comprising administering an antisense oligonucleotide of claim 1, in an effective amount to the cell.
21. The method according to claim 20, wherein the administration of the antisense oligonucleotide results in enhanced expression of a CARD9Δ11 variant.
22. The method of claims 20 , wherein the antisense oligonucleotide results in reduced expression of WTCARD9.
23. (canceled)
24. The method of claim 20, wherein the CARD9 is a human CARD9.
25. A method for treating or preventing an inflammatory disease comprising administering a therapeutically or prophylactically effective amount of an antisense oligonucleotide of claims 1 to a subject suffering from or susceptible to the inflammatory disease, such as inflammatory bowel disease (such as Crohn’s disease and ulcerative colitis); or a disease selected from the group consisting of pancreatitis, IgA nephropathy, primary sclerosing cholangitis, cardiovascular disease, cancer and diabetes.
26-27. (canceled)
28. Use of the antisense oligonucleotide of claim 1 for the preparation of a medicament for treatment or prevention of an inflammatory disease, such as inflammatory bowel disease (such as Crohn’s disease and ulcerative colitis); or a disease selected from the group consisting of pancreatitis, IgA nephropathy, primary sclerosing cholangitis, cardiovascular disease, cancer and diabetes.
Description
BRIEF DESCRIPTION OF FIGURES
[0069]
DEFINITIONS
Oligonucleotide
[0070] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotides of the invention are man-made, and are chemically synthesized, and are typically purified or isolated. The oligonucleotides of the invention may comprise one or more modified nucleosides such as 2′ sugar modified nucleosides. The oligonucleotides of the invention may comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.
Antisense Oligonucleotides
[0071] The term “antisense oligonucleotide” as used herein is defined as an oligonucleotide capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. Antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. The antisense oligonucleotides of the present invention may be single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than approximately 50% across of the full length of the oligonucleotide.
[0072] In some embodiments, the single stranded antisense oligonucleotides of the invention may not contain RNA nucleosides.
[0073] Advantageously, the antisense oligonucleotides of the invention comprise one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides. Furthermore, in some antisense oligonucleotides of the invention, it may be advantageous that the nucleosides which are not modified are DNA nucleosides.
Contiguous Nucleotide Sequence
[0074] The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments all the nucleosides of the oligonucleotide constitute the contiguous nucleotide sequence. The contiguous nucleotide sequence is the sequence of nucleotides in the oligonucleotide of the invention which are complementary to, and in some instances fully complementary to, the target nucleic acid or target sequence.
[0075] In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence, such as a F-G-F′ gapmer region or a splice modulating region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group (e.g. a conjugate group) to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the contiguous nucleotide sequence of the oligonucleotide cannot be longer than the oligonucleotide as such and that the oligonucleotide cannot be shorter than the contiguous nucleotide sequence.
Nucleotides and Nucleosides
[0076] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.
Modified Nucleoside
[0077] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. Advantageously, one or more of the modified nucleosides of the antisense oligonucleotides of the invention comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing. Exemplary modified nucleosides which may be used in the compounds of the invention include LNA, 2′-O-MOE and morpholino nucleoside analogues.
Modified Internucleoside Linkage
[0078] The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couple two nucleosides together. The oligonucleotides of the invention may therefore comprise one or more modified internucleoside linkages such as one or more phosphorothioate internucleoside linkage.
[0079] In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
[0080] Advantageously, all the internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
[0081] It is recognized that, as disclosed in EP 2 742 135, antisense oligonucleotides may comprise other internucleoside linkages (other than phosphodiester and phosphorothioate), for example an alkyl phosphonate/methyl phosphonate internucleoside linkage, which according to EP 2 742 135 may for example be tolerated in an otherwise DNA phosphorothioate the gap region.
Nucleobase
[0082] The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but which are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.
[0083] In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2′thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
[0084] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.
Modified Oligonucleotide
[0085] The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages. The term “chimeric oligonucleotide” is a term that has been used in the literature to describe oligonucleotides comprising sugar modified nucleosides and DNA nucleosides. In some embodiments, it may be advantageous for the antisense oligonucleotide of the invention to be a chimeric oligonucleotide.
Complementarity
[0086] The term “complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) -thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).
[0087] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pairs) between the two sequences (when aligned with the target sequence 5′-3′ and the oligonucleotide sequence from 3′-5′), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5′-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
[0088] The term “fully complementary”, refers to 100% complementarity.
Identity
[0089] The term “Identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif). The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity = (Matches x 100)/Length of aligned region (e.g. the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
Hybridization
[0090] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T.sub.m) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T.sub.m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (K.sub.d) of the reaction by ΔG°=-RTln(K.sub.d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. ΔG° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ΔG° is less than zero. ΔG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for ΔG° measurements. ΔG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In some embodiments, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ΔG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated ΔG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or-16 to -27 kcal such as -18 to -25 kcal.
The Target
[0091] The term “target” as used herein is used to refer to the mammalian caspase recruitment domain family member 9, referred to herein as CARD9, and also known in the art as CANDF2; hCARD9. CARD9, GENE ID No 64170, is encoded on human Chromosome 9: 136363956..136373681 reverse strand (GRCh38.p12, NC_000009.12) exemplified herein as SEQ ID NO 1. An example of human CARD9 protein is provided herein as SEQ ID NO 3. In the context of the present invention a CARD9 protein which comprises the amino acid sequence encoded by CARD9 exon 11 is referred to as a WT CARD9.
Target Nucleic Acid
[0092] According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian CARD9, e.g. human CARD9, and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as an CARD9 target nucleic acid. For in vitro and in vivo use, a preferred target nucleic acid is the pre-mRNA encoding CARD9, as illustrated by SEQ ID NO 1 or naturally occurring variant thereof.
Wtcard9
[0093] WTCARD9 refers to the wild-type CARD9, defined herein as a CARD9 protein which comprises the amino acid sequence encoded by exon 11 of CARD9. Accordingly, the WTCARD9 protein shall be a protein which is encoded by a CARD9 mRNA which comprises exon 11. In some embodiments, the WTCARD9 protein is encoded by a CARD9 mRNA which comprises Exons 1 to 13 (as provided in the Exon table above).
Card9δ11
[0094] A CARD9Δ11 is a CARD9 protein (a CARD9Δ11 variant) which lacks one or more amino acids encoded by CARD 9 Exon 11, in some cases it lacks all or essentially all of the amino acids encoded by CARD9 exon 11. For illustration, exon 11 of SEQ ID NO 1, encodes the amino acids shown in SEQ ID NO 10. A Δ11 CARD9 is not a WTCARD9. The terms A11CARD9 and CARD9Δ11 are used interchangeably herein. In some embodiments, the CARD9Δ11 protein is encoded by a CARD9 mRNA lacking exon 11.
[0095] The change in ratio of different transcript products (e.g. WTCARD9 vs. A11CARD9) may be measured by comparing mRNA levels, or levels of the corresponding protein products. Anti-CARD9 antibodies which may be used for assaying the protein levels of CARD9 and CARD9Δ11 using monoclonal or polyclonal antibodies raised against CARD9 (e.g. available from Abcams: Ab55950 or Ab133560 raised against the C-terminus of CARD9, or the polyclonal antibodies AF5248-SP and NBP1-76679 sold by RD Systems and Novus, respectively). By way of example the CARD9Δ11 shown in SEQ ID NO 5 has a mass that is approximately 3 kDa less than the WT CARD9 (62 kDa, SEQ ID NO 3) and the two isoform using the western blot analysis system, Protein Simple or conventional western blot analysis.
Target Sequences
[0096] The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid with a nucleobase sequence that is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, target sequence or target region. In some embodiments the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention.
[0097] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence selected from the group consisting of SEQ ID NO 6, 7 - 9, 11 - 284, or 559 - 565.
[0098] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 6.
[0099] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 7.
[0100] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 8.
[0101] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 9.
[0102] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 559.
[0103] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 560.
[0104] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 561.
[0105] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 562.
[0106] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 563.
[0107] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 564.
[0108] In some embodiments, the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof, is complementary to a target sequence having a sequence shown in SEQ ID NO 565.
Target Cell
[0109] The term a “target cell” as used herein refers to a cell which is expressing the target nucleic acid. In some embodiments the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell. In some embodiments the target cell is a transgenic animal cell which is expressing the human CARD9 target nucleic acid.
[0110] For experimental evaluation a target cell may be used which expresses a nucleic acid which comprises a target sequence. For in vitro evaluation, and for assaying the ability of an oligonucleotide to modulate the splicing of CARD9 pre-mRNA, for example, the target cell may be THP-1 cells.
[0111] In some embodiments the target cell is a myeloid cell or a myeloid lineage cell. In some embodiments the target cell is a macrophage. In some embodiments the target cell is an intestinal cell.
[0112] Typically, the target cell expresses the CARD9 pre-mRNA , which is processed in the cell to the mature CARD9 mRNA, resulting in the expression of the CARD9 protein (WTCARD9). Advantageously, the compounds of the invention modulate the splicing of the CARD9 pre-mRNA to produce a mature CARD9 mRNA which lacks CARD9 exon 11 (or a portion of exon 11), resulting in the expression of a CARD9Δ11 variant.
[0113] In some embodiments the target nucleic acid is SEQ ID NO 1, or a naturally occurring variant thereof.
Naturally Occurring Variant
[0114] The term “naturally occurring variant” refers to variants of CARD9 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.
[0115] In some embodiments, the naturally occurring variants have at least 95%, or in some embodiments at least 98%, or in some embodiments at least 99% homology to a mammalian CARD9 target nucleic acid, such as SEQ ID NO 1. In some embodiments the naturally occurring variants have at least 99% homology to the human CARD9 target nucleic acid of SEQ ID NO: 1.
Inhibition of Expression of WTCARD9
[0116] In some embodiments, the oligonucleotides of the invention, when present in a target cell, inhibit, i.e. decrease expression of WTCARD9. The term “Inhibition of expression” as used herein is to be understood as an overall term for an oligonucleotide’s ability to inhibit, i.e. to decrease the amount or the activity of WTCARD9 in a target cell. In some embodiments, the decrease in amount or activity is at least 10%, 20%, 30%, 40% or 50% compared to that of control cells. Inhibition of activity may be measured by determined by measuring the level of WTCARD9 mRNA, or by measuring the level or activity of WTCARD9 in a cell. Inhibition of expression may therefore be determined in vitro or in vivo. It will be understood that splice modulation may result in an inhibition of expression of WTCARD9 in the cell.
[0117] Typically, inhibition of expression is determined by determining the level of the target nucleic acid present in or the activity of the encoded protein product, following the administration of an effective amount of the antisense oligonucleotide to the target cell and comparing that level to a reference level obtained from a target cell without administration of the antisense oligonucleotide (control experiment), or a known reference level (e.g. the level of expression prior to administration of the effective amount of the antisense oligonucleotide, or a predetermined or otherwise known expression level)..
Enhancing Expression of CARD9Δ11 / CARD9Δ11 Enhancer
[0118] In some embodiments, the compounds of the invention, when present in a target cell, may enhance the expression of a CARD9Δ11 mRNA or CARD9Δ11 protein, via modulation of the splicing of exon 11 in the CARD9 pre-mRNA. Modulation of exon11 splicing may be determined by measuring the amount of CARD9Δ11 mRNA or CARD9Δ11 protein in oligo treated cells and in untreated control cells. Thus, the amount of CARD9Δ11 mRNA or CARD9Δ11 protein in the target cell shall be increased as compared to the amount in a control cell. In some embodiments, the increase of the amount of CARD9Δ11 mRNA or CARD9Δ11 protein is at least 10%, 20%, 30%, 40% or 50% compared to the amount of control cells. In some embodiments, the increase of the amount of CARD9Δ11 mRNA or CARD9Δ11 protein is at least 100% as compared to the amount of control cells. In some embodiments, the increase of the amount of CARD9Δ11 mRNA or CARD9Δ11 protein is at least 150% as compared to the amount of control cells. In some embodiments, the increase of the amount of CARD9Δ11 mRNA or CARD9Δ11 protein is at least 200% as compared to the amount of control cells. In some embodiments, the increase of the amount of CARD9Δ11 mRNA or CARD9Δ11 protein is at least 250% as compared to the amount of control cells.
[0119] Accordingly, the oligonucleotides of the present invention are A11CARD9 enhancers, i.e. oligonucleotides which result in an increased expression of Δ11CARD9 mRNA or protein after administration of an effective amount of the oligonucleotide to a target cell.
[0120] A Δ11CARD9 enhancer may be identified by measuring the increased expression of Δ11CARD9 mRNA or Δ11CARD9 protein as compared to control cells, or by measuring a increased ratio of expression of Δ11CARD9 as compared to WTCARD9 at the mRNA or protein level. As illustrated in the examples this may be determined by comparing the ratio of expression of Δ11CARD9 / WTCARD9 mRNA in cells treated with Δ11CARD9 enhancers to the ratio of expression of Δ11CARD9 / WTCARD9 mRNA in untreated cells, (untreated control response = 1). The comparison may be carried by calculating a ratio between the ratio in treated cells and the ratio untreated cells. E.g., the ratio may be calculated as follows:
[0121] (CARD9Δ11.sup.T/CARD9WT.sup.T)/(CARD9Δ11.sup.C/CARD9WT.sup.C) wherein [0122] CARD9Δ11.sup.T is the level of CARD9Δ11 mRNA measured in oligo treated cells [0123] CARD9WT.sup.T is the level of CARD9WT mRNA measured in oligo treated cells [0124] CARD9Δ11.sup.C is the level of CARD9Δ11 mRNA measured in untreated cells (control) [0125] CARD9WT.sup.C is the level of CARD9WT mRNA measured in untreated cells (control)
[0126] A response > 1 is therefore indicative of an effective Δ11CARD9 enhancer. Advantageously, the Δ11CARD9 enhancer is capable of eliciting a response of > about 1.5, or > about 2, or > about 2.5..
[0127] For example, the increase of expression of Δ11CARD9 mRNA or protein may be determined in THP-1 cells (e.g. as illustrated in the examples).Thus, the oligo treated cells and the untreated control cells may be cultivated as described in the Examples section in order to assess whether there is an increase in CARD9Δ11 mRNA or CARD9Δ11 protein, or not.
[0128] In some embodiments, the compounds of the invention are capable of both i) increasing the amount of CARD9Δ11 mRNA or CARD9Δ11 protein in the target cell and ii) decreasing the amount of WTCARD9 mRNA and WTCARD9 protein in a target cell.
Control Cell
[0129] The choice of suitable control cells is a routine part of an experimental setup. For example, the control cell may be a cell which corresponds to the target cell, but which does not comprise the oligonucleotide of the invention, i.e. a cell which has not been contacted with the oligonucleotide of the invention. For example, the control cell may be an untreated THP-1 cell. It is to be understood that the control cells are cultivated under equal conditions as the target cells that comprise the oligonucleotides as described herein.
Splice Modulation
[0130] Splice modulation can be used to correct cryptic splicing, modulate alternative splicing, restore the open reading frame, and induce protein knockdown. In the context of the present invention, a preferred modulation is to modulate alternative splicing to generate a CARD9Δ11 mRNA and thereby enhance expression of CARD9Δ11 protein.
[0131] Splice modulation may be assayed by RNA sequencing (RNA-Seq), which allows for a quantitative assessment of the different splice products of a pre-mRNA. In some embodiments of the invention, the antisense oligonucleotides modulate the splicing of the CARD9 pre-mRNA so as to reduce the level of mature CARD9 mRNA which comprises an exon 11 (WTCARD9 mRNA), and to increase the expression of the level of mature CARD9 mRNA which lacks exon1 1 (Δ11CARD9 mRNA).
High Affinity Modified Nucleosides
[0132] A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T.sup.m). A high affinity modified nucleoside of the present invention may result in an increase in melting temperature between +0.5 to +12° C., in some instances between +1.5 to +10° C. and in others between +3 to +8° C. per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include, for example, many 2′ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).
Sugar Modifications
[0133] The oligomers of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
[0134] Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
[0135] Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011/017521) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.
[0136] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2′-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example, be introduced at the 2′, 3′, 4′ or 5′ positions.
2′ Sugar Modified Nucleosides
[0137] A 2′ sugar modified nucleoside is a nucleoside which has a substituent other than H or —OH at the 2′ position (2′ substituted nucleoside) or comprises a 2′ linked biradical capable of forming a bridge between the 2′ carbon and a second carbon in the ribose ring, such as LNA (2′ - 4′ biradical bridged) nucleosides.
[0138] Indeed, much focus has been spent on developing 2′ sugar substituted nucleosides, and numerous 2′ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2′ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2′ substituted modified nucleosides are 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-0-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-Fluoro-RNA, and 2′-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2′ substituted modified nucleosides.
##STR00001##
##STR00002##
##STR00003##
##STR00004##
##STR00005##
##STR00006##
[0139] In relation to the present invention 2′ substituted sugar modified nucleosides does not include 2′ bridged nucleosides like LNA.
Locked Nucleic Acid Nucleosides (LNA Nucleoside)
[0140] A “LNA nucleoside” is a 2′ - modified nucleoside which comprises a biradical linking the C2′ and C4′ of the ribose sugar ring of said nucleoside (also referred to as a “2′- 4′ bridge”), which restricts or locks the conformation of the ribose ring. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.
[0141] Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO 00/66604, WO 98/039352 , WO 2004/046160, WO 00/047599, WO 2007/134181, WO 2010/077578, WO 2010/036698, WO 2007/090071, WO 2009/006478, WO 2011/156202, WO 2008/154401, WO 2009/067647, WO 2008/150729, Morita et al., Bioorganic & Med.Chem. Lett. 12, 73-76,
[0142] Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.
[0143] Further non limiting, exemplary LNA nucleosides are disclosed in Scheme 1.
##STR00007##
[0144] Particular LNA nucleosides are beta-D-oxy-LNA, 6′-methyl-beta-D-oxy LNA such as (S)-6′-methyl-beta-D-oxy-LNA (ScET) and ENA.
[0145] In some embodiments, LNA is beta-D-oxy-LNA.
Morpholino Oligonucleotides
[0146] In some embodiments, the oligonucleotide of the invention comprises or consists of morpholino nucleosides (i.e. is a Morpholino oligomer and as a phosphorodiamidate Morpholino oligomer (PMO)). Splice modulating morpholino oligonucleotides have been approved for clinical use -see for example eteplirsen, a 30nt morpholino oligonucleotide targeting a frame shift mutation in DMD, used to treat Duchenne muscular dystrophy. Morpholino oligonucleotides have nucleobases attached to six membered morpholine rings rather ribose, such as methylenemorpholine rings linked through phosphorodiamidate groups, for example as illustrated by the following illustration of 4 consecutive morpholino nucleotides:
##STR00008##
[0147] In some embodiments, morpholino oligonucleotides of the invention may be, for example 20 - 40 morpholino nucleotides in length, such as morpholino 25 - 35 nucleotides in length.
RNase H Activity and Recruitment
[0148] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, at least 10%, or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613 (hereby incorporated by reference). DNA oligonucleotides are known to effectively recruit RNaseH, as are gapmer oligonucleotides which comprise a region of DNA nucleosides (typically at least 5 or 6 contiguous DNA nucleosides), flanked 5′ and 3′ by regions comprising 2′ sugar modified nucleosides, typically high affinity 2′ sugar modified nucleosides, such as 2-O-MOE and/or LNA. For effective modulation of splicing, degradation of the pre-mRNA is not desirable, and as such it is preferable to avoid the RNaseH degradation of the target. Therefore, the splice modulating oligonucleotides of the invention is preferably not gapmer oligonucleotide. RNaseH recruitment may be avoided by limiting the number of contiguous DNA nucleotides in the oligonucleotide -therefore for effective splice modulation mimxers and totalmers designs may therefore be used.
Mixmers and Totalmers
[0149] For splice modulation it is often advantageous to use antisense oligonucleotides which do not recruit RNAaseH. As RNaseH activity requires a contiguous sequence of DNA nucleotides, RNaseH activity of antisense oligonucleotide may be achieved by designing antisense oligonucleotides which do not comprise a region of more than 3 or more than 4 contiguous DNA nucleosides. This may be achieved by using antisense oligonucleotides or contiguous nucleoside regions thereof with a mixmer design, which comprise sugar modified nucleosides, such as 2′ sugar modified nucleosides, and short regions of DNA nucleosides, such as 1, 2 or 3 DNA nucleosides. Mixmers are exemplified herein by every second design, wherein the nucleosides alternative between 1 LNA and 1 DNA nucleoside, e.g. LDLDLDLDLDLDLDLL, with 5′ and 3′ terminal LNA nucleosides, and every third design, such as LDDLDDLDDLDDLDDL, where every third nucleoside is a LNA nucleoside.
[0150] A totalmer is an antisense oligonucleotide or a contiguous nucleotide sequence thereof which does not comprise DNA or RNA nucleosides, and may for example comprise only 2′-O-MOE nucleosides, such as a fully MOE phosphorothioate, e.g. MMMMMMMMMMMMMMMMMMMM, where M = 2′-O-MOE, which are reported to be effective splice modulators for therapeutic use. Alternatively, a mixmer may comprise a mixture of modified nucleosides, such as MLMLMLMLMLMLMLMLMLML, wherein L = LNA and M = 2′-O-MOE nucleosides.
[0151] Advantageously, the internucleoside nucleosides in mixmers and totalmers may be phosphorothioate, or a majority of nucleoside linkages in mixmers may be phosphorothioate. Mixmers and totalmers may comprise other internucleoside linkages, such as phosphodiester or phosphorodithioate, by way of example.
Region D′ or D″ in an Oligonucleotide
[0152] The oligonucleotide of the invention may in some embodiments comprise or consist of the contiguous nucleotide sequence of the oligonucleotide which is complementary to the target nucleic acid, such as a mixmer or toalmer region, and further 5′ and/or 3′ nucleosides. The further 5′ and/or 3′ nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5′ and/or 3′ nucleosides may be referred to as region D′ and D″ herein.
[0153] The addition of region D′ or D″ may be used for the purpose of joining the contiguous nucleotide sequence, such as the mixmer or totoalmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a biocleavable linker. Alternatively, it may be used to provide exonucleoase protection or for ease of synthesis or manufacture.
[0154] Region D′ or D″ may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F′ region is not a sugar-modified nucleotide, such as a DNA or RNA or base modified versions of these. The D′ or D′ region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5′ and/or 3′ end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. Nucleotide based biocleavable linkers suitable for use as region D′ or D″ are disclosed in WO2014/076195, which include by way of example a phosphodiester linked DNA dinucleotide. The use of biocleavable linkers in poly-oligonucleotide constructs is disclosed in WO2015/113922, where they are used to link multiple antisense constructs within a single oligonucleotide.
[0155] In one embodiment the oligonucleotide of the invention comprises a region D′ and/or D″ in addition to the contiguous nucleotide sequence which constitutes a mixmer or a totalmer.
[0156] In some embodiments the internucleoside linkage positioned between region D′ or D″ and the mixmer or totalmer region is a phosphodiester linkage.
Conjugate
[0157] The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may be covalentaly linked to the antisense oligonucleotide, optionally via a linker group, such as region D′ or D″.
[0158] Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.
[0159] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates (e.g. GalNAc), cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.
Linkers
[0160] A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (Region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).
[0161] In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and/or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).
[0162] Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to S1 nuclease cleavage. In some embodiments the nuclease susceptible linker comprises between 1 and 5 nucleosides, such as DNA nucleoside(s) comprising at least two consecutive phosphodiester linkages,. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014/076195.
[0163] Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In some embodiments the linker (region Y) is a C6 amino alkyl group.
Treatment
[0164] The term ‘treatment’ as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.
DETAILED DESCRIPTION OF THE INVENTION
The Oligonucleotides of the Invention
[0165] The invention provides for an antisense oligonucleotide of 10 to 40, such as 10 to 30 nucleotides in length, for modulating the splicing of a mammalian CARD9 pre-mRNA transcript, wherein said oligonucleotide comprises a contiguous nucleotide sequence of at least 10 nucleotides in length with at least 90% complementarity, and in some instances 100% complementarity, to SEQ ID NO 1.
[0166] The invention provides for an antisense oligonucleotide of 10 to 40, such as 10 to 30 nucleotides in length, for modulating the splicing of a mammalian CARD9 pre-mRNA transcript, wherein said oligonucleotide comprises a contiguous nucleotide sequence of at least 10 nucleotides in length with at least 90% complementarity, and in some instances 100% complementarity, to SEQ ID NO 2.
[0167] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 6.
[0168] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 7.
[0169] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 8.
[0170] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 9.
[0171] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 559.
[0172] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 560.
[0173] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 561.
[0174] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 562.
[0175] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 563.
[0176] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 564.
[0177] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to, and in some instances, fully complementary to SEQ ID NO 565.
[0178] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof, is complementary to a sequence selected from the group consisting of SEQ ID NO 11 - 284.
[0179] In some embodiments, the antisense oligonucleotide is capable of enhancing the expression of CARD9Δ11.
[0180] In some embodiments, the antisense oligonucleotide is capable of reducing the expression of WTCARD9.
[0181] In some embodiments, the antisense oligonucleotide is or comprises an antisense oligonucleotide mixmer or totalmer.
[0182] In some embodiments, the antisense oligonucleotide is a morpholino oligonucleotide.
[0183] In some embodiments, the antisense oligonucleotide is a 2′-O-MOE oligonucleotide, i.e. comprises one or more 2′-O-MOE nucleosides.
[0184] In some embodiments, the antisense oligonucleotide is an LNA oligonucleotide, i.e. comprises one or more LNA nucleosides.
[0185] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof is 10 - 25 or 10 - 20 nucleotides in length.
[0186] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide of the present invention comprises one or more nucleotide sequences which is complementary to, such as fully complementary to a sequence selected from the group consisting of CGGCGGG, AGCCCGA, CAGCCCU, CACCAGG, AGCAGGU, CCCAUGU, GGCUGCCU, GUUUUGCG, AACCCCCA, UGCAGC, UGCACC and UGCGGA. It will be understood that these 6 - 9nt sequences are present within an advantageous region (target site sequence) of SEQ ID NO 6 (nucleotide 200 - 280 of SEQ ID NO 6) and that several of these sequence overlap within this target site sequence. In some embodiments, the antisense oligonucleotide of the invention may therefore comprise a contiguous nucleotide sequence of 10 - 40 nucleotides in length which is complementary to, such as fully complementary to nucleotides 200 - 280 of SEQ ID NO 6. In some embodiments, the antisense oligonucleotide of the invention may therefore comprise a contiguous nucleotide sequence of 12 - 25 nucleotides in length which is complementary to, such as fully complementary to nucleotides 200 - 280 of SEQ ID NO 6. It will be recognised that a region of the contiguous nucleotide sequence may comprise the complement of more than one of the sequences selected from the group consisting of CGGCGGG, AGCCCGA, CAGCCCU, CACCAGG, AGCAGGU, CCCAUGU, GGCUGCCU, GUUUUGCG, AACCCCCA, UGCAGC, UGCACC and UGCGGA. In some embodiments, the oligonucleotides of the invention may comprise the full complement of at least 2 or at least 3 of the sequences selected from the group consisting of CGGCGGG, AGCCCGA, CAGCCCU, CACCAGG, AGCAGGU, CCCAUGU, GGCUGCCU, GUUUUGCG, AACCCCCA, UGCAGC, UGCACC and UGCGGA.
[0187] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide consists or comprises of a sequence selected from SEQ ID NO 285-558.
[0188] In some embodiments, the antisense oligonucleotide consists or comprises of an oligonucleotide provided herein, such as a compound selected from the group consisting of compound ID NO #285_1 - #558_1 (see table in the Examples section).
[0189] In some advantageous embodiments the antisense oligonucleotide of the invention is in the form of a pharmaceutically acceptable salt, such as a sodium salt or a potassium salt.
[0190] The invention further provides for a pharmaceutically acceptable salt of the antisense oligonucleotide or conjugate according to the invention.
[0191] The invention further provides for a conjugate comprising the antisense oligonucleotide according to the invention, and at least one conjugate moiety covalently attached to said oligonucleotide.
[0192] The invention further provides for a pharmaceutical composition comprising the antisense oligonucleotide or the conjugate of the invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
[0193] The invention provides for a method for modulating the splicing of a CARD9 pre-mRNA in a cell which is expressing CARD9 (e.g. a target cell), said method comprising administering an antisense oligonucleotide or the conjugate or the pharmaceutical composition, of the invention in an effective amount to said cell. The method may be in vitro method or an in vivo method.
[0194] In some embodiments of the method of the invention, the administration of the antisense oligonucleotide results in enhanced expression of a CARD9Δ11 variant.
[0195] In some embodiments of the method of the invention, the administration of the antisense oligonucleotide results in reduced expression of WTCARD9.
[0196] In some embodiments, the administration of the antisense oligonucleotide results in reduced expression of WTCARD9 and enhanced expression of a CARD9Δ11 variant.
[0197] In some embodiments, the cell, such as the target cell is a mammalian cell. In some embodiments, the cell is a human cell.
[0198] In some embodiments the CARD9 target is a human CARD9. In some embodiments the CARD9 target nucleic acid is a human CARD9 pre-mRNA such as that illustrated as SEQ ID NO 1.
[0199] The invention provides for a method for treating or preventing an inflammatory disease comprising administering a therapeutically or prophylactically effective amount of the antisense oligonucleotide or the conjugate or the pharmaceutical composition, of the invention to a subject suffering from or susceptible to the inflammatory disease, such as inflammatory bowel disease.
[0200] The invention provides for an oligonucleotide or the conjugate or pharmaceutical composition of the invention for use as a medicament.
[0201] The invention provides for an antisense oligonucleotide or the conjugate or pharmaceutical composition of the invention for use in the treatment of an inflammatory disease, such as inflammatory bowel disease.
[0202] The invention provides for the use of an antisense oligonucleotide or the conjugate or pharmaceutical composition of the invention for use the preparation of a medicament for treatment or prevention of an inflammatory disease, such as inflammatory bowel disease.
[0203] In some embodiments, the oligonucleotide comprises a contiguous sequence of 10 to 30 nucleotides in length, which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence.
[0204] It is advantageous if the oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.
[0205] It is understood that the contiguous nucleobase sequences (motif sequence) can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid.
[0206] The pattern in which the modified nucleosides (such as high affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally termed oligonucleotide design.
[0207] The oligonucleotides of the invention are designed with modified nucleosides and DNA nucleosides. In some examples, high affinity modified nucleosides are used.
[0208] Suitable modifications are described in the “Definitions” section under “modified nucleoside”, “high affinity modified nucleosides”, “sugar modifications”, “2′ sugar modifications” and Locked nucleic acids (LNA)″.
[0209] In an embodiment, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2′ sugar modified nucleosides. Preferably the oligonucleotides of the invention comprise one or more 2′ sugar modified nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. In some embodiments, one or more of the modified nucleoside(s) may be a locked nucleic acid (LNA).
[0210] In a further embodiment the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the “Definitions” section under “Modified internucleoside linkage”. In some oligonucleotides of the invention, at least 75% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. In some embodiments all of the internucleotide linkages in the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate linkages.
[0211] In some embodiments the oligonucleotides of the invention are capable of inhibiting the expression of the WTCARD9 target in a cell which is expressing the CARD9 target (a target cell), for example either in vivo or in vitro.
[0212] The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the CARD9 target nucleic acid, such as SEQ ID NO 1, or target sequence (such as a sequence selected from the group consisting of SEQ ID NO 6, 7, 8, 9, 559, 560, 561, 562, 563, 564 or 565) or target site region thereof (such as a sequence selected from the group consisting of SEQ ID Nos 10 - 285), as measured across the length of the oligonucleotide, optionally with the exception of a mismatch, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D′ or D″).
[0213] Advantageously, the contiguous sequence of nucleobases of the oligonucleotide of the invention comprises a sequence motif as shown in a sequence selected from SEQ ID NO 285 - 558, or at least 10 contiguous nucleotides thereof.
[0214] Advantageously, the contiguous sequence of nucleobases of the oligonucleotide of the invention comprises a sequence motif as shown in a sequence selected from SEQ ID NO 285 - 558, or at least 12 contiguous nucleotides thereof.
[0215] Advantageously, the contiguous sequence of nucleobases of the oligonucleotide of the invention comprises a sequence motif as shown in a sequence selected from SEQ ID NO 285 - 558, or at least 14 contiguous nucleotides thereof.
[0216] In some embodiments, the contiguous sequence of nucleobases of the oligonucleotide of the invention comprises a sequence motif as shown in a sequence selected from SEQ ID NOs 290, 294, 295, 297, 300, 301, 306, 307, 308, 312, 317, 318, 319, 322, 329, 333, 337, 341, 352, 353, 358, 373, 374, 378, 379, 380, 387, 393, 394, 396, 399, 400, 405, 406, 407, 408, 409, 411, 413, 413, 414, 414, 414, 415, 415, 415, 416, 417, 417, 417, 418, 422, 424, 425, 426, 429, 430, 431, 433, 434, 435, 436, 439, 440, 441, 442, 443, 446, 447, 448, 449, 450, 452, 453, 454, 455, 456, 458, 459, 460, 461, 462, 464, 471, 472, 490, 519, 530, 533, 541, 542, 546, and 548, or at least 12 contiguous nucleotides thereof.
[0217] In some embodiments, the contiguous sequence of nucleobases of the oligonucleotide of the invention comprises a sequence motif as shown in a sequence selected from SEQ ID NOs 319, 322, 396, 405, 408, 413, 414, 414, 429, 431, 440, 442, 446, 448, 449, 450, 452, 453, 454, 455, 456, 459, 460, and 461 or at least 12 contiguous nucleotides thereof.
[0218] In some embodiments, the contiguous sequence of nucleobases of the oligonucleotide of the invention comprises a sequence motif as shown in a sequence selected from SEQ ID NOs 413, 414, 448, 449, 450, 454, 456, 459, and 460 or at least 12 contiguous nucleotides thereof.
[0219] In some embodiments, the oligonucleotide of the invention is selected from the group consisting of 290_1, 294_1, 295_1, 297_1, 300_1, 301_1, 306_1, 307_1, 308_1, 312 1, 317_1, 318 1, 319 1, 322 1, 329 1, 333 1, 337 1, 341 1, 352 1, 353 1, 358 1, 373 1, 374 1, 378 1, 379 1, 380 1, 387 1, 393 1, 394 1, 396 1, 399 1, 400 1, 405 1, 406 1, 407 1, 408 1, 409 1, 411 1, 413_1, 413_2, 414_1, 414_2, 414_3, 4151, 415_2, 415 3, 4161, 4171, 417_2, 417_3, 4181, 422 1, 424 1, 425 1, 426 1, 429 1, 430 1, 431 1, 433 1, 434 1, 435 1, 436 1, 439 1, 440 1, 441 1, 442 1, 443 1, 446 1, 447 1, 448 1, 449 1, 450 1, 452 1, 453 1, 454 1, 455 1, 456 1, 458 1, 459 1, 460 1, 461 1, 462 1, 464 1, 471 1, 472 1, 490 1, 519 1, 530 1, 533 1, 541 1, 542_1, 546_1, and 548 1.
[0220] In some embodiments, the oligonucleotide of the invention is selected from the group consisting of 319_1, 322_1, 396_1, 405_1, 408_1, 413_2, 414_2, 414_3, 429_1, 431_1, 440_1, 442_1, 446 1, 448 1, 449 1, 450 1, 452 1, 453 1, 454 1, 455 1, 456 1, 459 1, 460 1, and 461_1.
[0221] In some embodiments, the oligonucleotide of the invention is selected from the group consisting of 413 2, 414 2, 448_1, 449_1, 450_1, 454_1, 456_1, 459_1, and 460_1.
Pharmaceutically Acceptable Salts
[0222] In a further aspect the invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide or a conjugate thereof, such as a pharmaceutically acceptable sodium salt or potassium salt.
Method of Manufacture
[0223] In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
Pharmaceutical Composition
[0224] In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300 .Math.M solution.
Applications
[0225] The oligonucleotides of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
[0226] In research, such oligonucleotides may be used to specifically modulate the synthesis of CARD9 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically, the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.
[0227] If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0228] The present invention provides an in vivo or in vitro method for modulating CARD9 expression, such as splice modulation, in a target cell which is expressing CARD9, said method comprising administering an oligonucleotide of the invention in an effective amount to said cell.
[0229] In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In some embodiments the target cell is a myeloid cell or a myeloid lineage cell. In some embodiments the target cell is a macrophage. In some embodiments the target cell is present in, isolated from, or derived from an intestinal tissue.
[0230] In diagnostics the oligonucleotides may be used to detect and quantitate CARD9 expression in cell and tissues by northern blotting, in-situ hybridisation or similar techniques.
[0231] For therapeutics, the oligonucleotides may be administered to an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of CARD9. Such diseases or disorders include inflammatory bowel disease (such as Crohn’s disease and ulcerative colitis), pancreatitis, IgA nephropathy, primary sclerosing cholangitis, cardiovascular disease, cancer and diabetes.
[0232] The invention provides methods for treating or preventing a disease or disorder, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease or disorder, such as diseases or disorders selected from the group consisting of inflammatory bowel disease (such as Crohn’s disease and ulcerative colitis), pancreatitis, IgA nephropathy, primary sclerosing cholangitis, cardiovascular disease, cancer and diabetes.
[0233] The methods of the invention are preferably employed for treatment or prophylaxis against diseases caused by abnormal levels and/or activity of CARD9.
[0234] In some embodiments the disease is an inflammatory disease.
[0235] In some embodiments, the disease is Inflammatory bowel disease. For example, the inflammatory bowel disease is Crohn’s disease. Alternatively, the inflammatory bowel disease is ulcerative colitis.
Administration
[0236] In some embodiments, the oligonucleotides or pharmaceutical compositions of the present invention may, for example be administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion. In some embodiments the oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment the oligonucleotide or oligonucleotide conjugate is administered subcutaneously.
[0237] In some embodiments, the oligonucleotides or pharmaceutical compositions of the present invention are administered orally or rectally. In some embodiments, the oligonucleotides or pharmaceutical compositions of the present invention are administered orally or rectally for the treatment of inflammatory bowel disease, such as Crohn’s disease or ulcerative colitis
Combination Therapies
[0238] In some embodiments the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above.
EXAMPLES
Example 1
[0239] Oligonucleotides #285_1 - #558_1 were synthesized and their ability to modulate the splicing of the CARD9 pre-mRNA to enhance the ratio of Δ11CARD9 mRNA as compared to WTCARD9 mRNA was evaluated. Specifically, it was evaluated whether the oligonucleotides enhance the level of Δ11CARD9 mRNA as compared to the level of Δ11CARD9 mRNA in untreated cells.
Materials and Methods
[0240] Cells: 50.000 THP-1 cells were seeded in 96 well plates and oligos (Table 1) added to obtain a gymnotic uptake. Final oligo concentration in the media was 25 .Math.M. Cells were incubated for 7 days at at 37° C. and 5% CO2. The target sequence that were covered by mixmers that is tiled be oligos targeting SEQ ID NO 6. As control, untreated THP-1 cells were used.
[0241] Droplet digital PCR was performed BioRads QX200 Droplet Digital PCR (ddPCRTM) system using the following primers and probes: [0242] Loading control for RNA input: [0243] Hs.PT.58v.45621572 - Predesigned HEX based assay targeting exon 8-9 of HTRP1.
[0244] For the CARD9Δ11 transcript:
TABLE-US-00003 Hs. CARD9Δ11 probe /56- FAM/CTCAGACAA/ZEN/AGGACGCAGGCCTG/3IABkFQ/ Primer 1 AGTTCTCAAAACTCTCTTTGAGGC Primer 2 GGAAGATGGCTCACCCAG
[0245] The response was calculated by the following formula:
[0246] (CARD9Δ11.sup.T/CARD9WT.sup.T)/(CARD9A11.sup.C/CARD9WT.sup.C) wherein [0247] CARD9Δ11.sup.T is the level of CARD9Δ11 mRNA measured in oligo treated cells [0248] CARD9WT.sup.T is the level of CARD9WT mRNA measured in oligo treated cells [0249] CARD9Δ11.sup.C is the level of CARD9Δ11 mRNA measured in untreated cells (control) [0250] CARD9WT.sup.C is the level of CARD9WT mRNA measured in untreated cells (control)
[0251] The response is shown in
Compound and Data Table
[0252] The motif of nucleobases in the oligonucleotides is shown as SEQ ID NO 285 - 558. The compounds are designated as a compound ID number (#), with the oligonucleotide structure (5′ -3′), wherein capital letters designate a beta-D-oxy LNA nucleoside, a lower case letter designates a DNA nucleoside, capital C designates 5-methyl cytosine beta-D-oxy LNA nucleoside, and a superscript m before a lower case c represent a 5-methyl cytosine DNA nucleoside (see e.g. SEQ ID NO 294), and all internucleoside linkages are phosphorothioate internucleoside linkages.
TABLE-US-00004 SEQ_ID_NO CMP_ID_NO (#) Oligo_structure Response 285 285_1 TcaTTgCTcCAgGA 0.67 286 286_1 GTtCAtTgcTCcAG 0.78 287 287_1 CTgTtcATtGCtCC 0.39 288 288_1 GCctGTtCatTgCT 0.95 289 289_1 TtgCCtGTtCAtTG 0.66 290 290_1 GCttGCctGTtcAT 1.27 291 291_1 TCgCTtgCcTgtTC 0.41 292 292_1 CCtcGcTtgCCtGT 0.47 293 293_1 GgCCtcGcTTgcCT 0.51 294 294_1 ATgGcCT.sup.mcgCTtGC 1.01 295 295_1 TTaTgGCctCGcTT 1.08 296 296_1 CCttATggCCtcGC 0.62 297 297_1 GgCCttATgGccTC 1.24 298 298_1 GAgGcCTtATggCC 0.73 299 299_1 CTgAggCCtTatGG 0.92 300 300_1 GaCTgAGgCCttAT 1.06 301 301_1 GAgaCTgAGgCcTT 1.17 302 302_1 ATgAgaCTgAGgCC 0.8 303 303_1 AgaTGaGAcTGaGG 0.91 304 304_1 GTaGAtGAgACtGA 0.97 305 305_1 CTgTAgATgAGaCT 0.46 306 306_1 TTcTGtAGaTGaGA 1.18 307 307_1 CTtTCtGTaGAtGA 1.3 308 308_1 TGcTTtCTgTAgAT 1.29 309 309_1 TCtgCTtTcTGtAG 0.58 310 310_1 ACtCTgCTttCtGT 0.49 311 311_1 AGaCtCTgCTttCT 0.7 312 312_1 GTaGAcTctGCtTT 1.06 313 313_1 GTgTaGActCTgCT 0.85 314 314_1 CaGTgTAgaCTcTG 0.71 315 315_1 TcCaGTgTaGAcTC 0.95 316 316_1 GgtCCaGTgTagAC 0.47 317 317_1 TgGgtCCaGTgtAG 1.06 318 318_1 CAtgGgtCCaGtGT 1.07 319 319_1 CacATgGGtCCaGT 1.76 320 320_1 CCcAcATggGTcCA 0.85 321 321_1 TccCCacATgGgTC 0.93 322 322_1 GAtCCccAcATgGG 1.72 323 323_1 GggATcCCcACaTG 0.87 324 324_1 GTgGgATccCCaCA 0.89 325 325_1 TgGTggGAtCccCA 0.84 326 326_1 CcTgGTgGgATcCC 0 327 327_1 GgcCTgGTgGgaTC 0 328 328_1 AaGgCCtgGTggGA 0.53 329 329_1 CCaaGgcCTgGtGG 1.27 330 330_1 TtcCAaGgCCtgGT 0.99 331 331_1 TcTTcCAaGGccTG 0.72 332 332_1 TgtCTtCCaaGgCC 0.58 333 333_1 GCtGTcTTccAaGG 1.04 334 334_1 GGgCTgtCTtCcAA 0.81 335 335_1 TgGggCTgtCTtCC 0.54 336 336_1 AgTgGggCTgTcTT 0.6 337 337_1 GcaGtgGggCTgTC 1.01 338 338_1 TtGcaGTgGGgcTG 0 339 339_1 CAttGcaGTgGgGC 0.8 340 340_1 GGcATtgCaGTgGG 0.5 341 341_1 CCgGcATtgCAgTG 1.01 342 342_1 CCccGgCatTGcAG 0.34 343 343_1 CtCCccGgcATtGC 0.63 344 344_1 CccTccCCggCaTT 0.86 345 345_1 AcCccTcCccGgCA 0.56 346 346_1 CcAcCccTcCccGG 0.78 347 347_1 CccCacCccTccCC 0.35 348 348_1 TgcCccAccCctCC 0.41 349 349_1 GcTgcCccACccCT 0.41 350 350_1 CgGcTgcCccAcCC 0.91 351 351_1 CAcGgCTgCCccAC 0.78 352 352_1 AGcAcGgcTGccCC 1.09 353 353_1 ATaGCacGgCTgCC 1.06 354 354_1 GTaTaGCacGGcTG 0.97 355 355_1 AcGTaTaGCaCgGC 0.59 356 356_1 CAcGTaTAgCAcGG 0.66 357 357_1 CCaCGtATaGCaCG 0.58 358 358_1 GCcACgTAtAGcAC 1.16 359 359_1 GgcCAcGTaTAgCA 0.43 360 360_1 GggCCacGTaTaGC 0.42 361 361_1 TGggCCaCGtAtAG 0.97 362 362_1 CTgGGcCAcGTaTA 0.78 363 363_1 GcTgGgCCaCGtAT 0.78 364 364_1 TgCTgGgcCAmcgTA 0.59 365 365_1 CTgCTgGGcCacGT 0.47 366 366_1 TcTgCTgGgCcaCG 0.42 367 367_1 ATcTgCTggGCcAC 0.78 368 368_1 CatCTgCTgGgcCA 0.81 369 369_1 CcATcTgCTgGgCC 0.72 370 370_1 CccATcTgCTggGC 0.56 371 371_1 GccCatCTgCTgGG 0.93 372 372_1 TgCCcATctGctGG 0.66 373 373_1 CTgCCcATcTgcTG 1.08 374 374_1 CCtgCccATcTgCT 1.03 375 375_1 AccTgCCcATctGC 0.6 376 376_1 GAccTgCCcATcTG 0.96 377 377_1 GgAcCTgcCCatCT 0.76 378 378_1 GggAccTgCCcaTC 1.32 379 379_1 TggGAcCTgCCcAT 1.06 380 380_1 GTggGAccTGccCA 1.12 381 381_1 TgTggGAccTgcCC 0.91 382 382_1 CTgTggGAccTgCC 0.62 383 383_1 CctGTgGgACctGC 0 384 384_1 GcCTgTggGAccTG 0.43 385 385_1 TgcCTgTggGAcCT 0.68 386 386_1 GTgcCTgTgGgaCC 0.87 387 387_1 CGtgCCtGTgGgAC 1.23 388 388_1 TcGTgCCtGTggGA 0.65 389 389_1 GTcGTgcCTgTgGG 0.62 390 390_1 AGtcGTgcCTgtGG 0.76 391 391_1 GaGTcGTgcCTgTG 0.77 392 392_1 AgaGTcGTgCCtGT 0.57 393 393_1 GAgaGTcGTgCcTG 1.09 394 394_1 GgAGaGTcGTgcCT 1.06 395 395_1 AGgaGaGTcGTgCC 0.68 396 396_1 AagGAgAGtCGtGC 1.75 397 397_1 AAaGGaGAgTCgTG 0.91 398 398_1 GAaAGgAGaGTcGT 0.96 399 399_1 GGaAAgGAgAGtCG 1.11 400 400_1 TGgAAaGGaGAgTC 1.14 401 401_1 CTgGAaAGgAGaGT 0.87 402 402_1 CCtGGaAAgGAgAG 0.9 403 403_1 GCcTgGAaaGGaGA 0.83 404 404_1 AGcCTgGAaAGgAG 0.74 405 405_1 CAgCCtgGAaAgGA 1.51 406 406_1 GCaGcCTgGAaaGG 1.45 407 407_1 GGcAGcCTgGAaAG 1.21 408 408_1 AGgCAgCCtgGaAA 1.63 409 409_1 AagGCaGCcTGgAA 1.27 410 410_1 CAaGgCAgcCTgGA 0.85 411 411_1 GcAAggCagCCtGG 1.34 412 412_1 GgCAagGcaGccTG 0.83 412 412_2 GgCAaGgcAGccTG 0.75 412 412_3 GgCAaGGcaGccTG 0.98 413 413_1 CGgcAaGgcAGcCT 1.17 413 413_2 CGgcAaGgCAgcCT 2.54 413 413_3 CGgCAaGgcAGcCT 0.78 414 414_1 CcGgcAaGgCagCC 1.47 414 414_2 CcGgcAagGCagCC 2.02 414 414_3 CCggCAaGgCagCC 1.97 415 415_1 GccGgCAagGcaGC 1.29 415 415_2 GccGgCaaGGcaGC 1.49 415 415_3 GccGgCAaGGcaGC 1.22 416 416_1 CGccGGcaAGgcAG 1.1 416 416_2 CGccGgCAaGGcAG 0.95 416 416_3 CgCCgGCaaGgcAG 0.95 417 417_1 CcGccGgCAaGgCA 1.47 417 417_2 CCgCcGgcAaGgCA 1.05 417 417_3 CcGcCGgCAaGgCA 1.01 418 418_1 CccGCcGgcAAgGC 1.29 419 419_1 CccCgCcGgCAaGG 0.75 420 420_1 CccCmcgCCggCaAG 0.72 421 421_1 CcCcCcGcCGgcAA 0.71 422 422_1 TcCcCccGccGgCA 1.04 423 423_1 CtcCccCmcgCmcgGC 0.98 424 424_1 GctCccCccGccGG 1.04 425 425_1 GgcTccCccCgcCG 1.03 426 426_1 GggCtcCccCmcgCC 1.37 427 427_1 CggGctCccCccGC 0.72 428 428_1 TcGggCTccCccCG 0.88 429 429_1 TtcGggCTcCccCC 1.6 430 430_1 TTtcGggCtCccCC 1.23 431 431_1 GTttCgGgcTccCC 2 432 432_1 TgTTtcGGgcTcCC 0.95 433 433_1 CTgTttCGgGctCC 1.44 434 434_1 GctGTttCgGGcTC 1.29 435 435_1 GgCTgTTtcGGgCT 1.26 436 436_1 GggCTgTTtcGgGC 1.1 437 437_1 AGggCTgtTTmcgGG 0.99 438 438_1 AAgGGcTGtTTcGG 0.9 439 439_1 AaAGgGCtGTttCG 1.4 440 440_1 CAaAGgGCtGTtTC 1.63 441 441_1 GCaaAgGGcTGtTT 1.13 442 442_1 TgCAaAGgGCtgTT 1.86 443 443_1 CTgCaaAGgGCtGT 1.09 444 444_1 GCtgCAaaGGgcTG 0.19 445 445_1 AgCTgCAaaGGgCT 1 446 446_1 GAgCTgCAaaGgGC 2 447 447_1 AgaGCtGCaaAgGG 1.2 448 448_1 CAgaGCtGCaAaGG 2.45 449 449_1 GgtGcaGAgCTgCA 2.54 450 450_1 TccTgGtgCAgaGC 2.16 451 451_1 CTgCTccTgGTgCA 0.74 452 452_1 AAaCCtGctCCtGG 1.94 453 453_1 CgCAaAaCCtGcTC 1.74 454 454_1 GTtCCgCAaAAcCT 2.25 455 455_1 TgGGgGTtCCgcAA 1.89 456 456_1 TacATgGGgGTtCC 2.31 457 457_1 GCcTTacATgGgGG 0.96 458 458_1 GGaaGCcTTaCaTG 1.28 459 459_1 GGgGAaGcCTtaCA 2.64 460 460_1 CGgGGaAgCCttAC 2.23 461 461_1 CmcgGgGAagCCtTA 1.59 462 462_1 CCcGGgGAaGccTT 1.32 463 463_1 CccCGggGAaGcCT 0.9 464 464_1 ACccCGggGAagCC 1.27 465 465_1 CacCCcGggGAaGC 0.78 466 466_1 CCaCCccGgGgaAG 0.76 467 467_1 CCcAcCCmcgGggAA 0.71 468 468_1 CcCcAccCcGggGA 0.67 469 469_1 ACccCacCccGgGG 0.79 470 470_1 GAcCccAccCmcgGG 0.78 471 471_1 GgACccCacCccGG 1.24 472 472_1 AGgAcCccACccCG 1.02 473 473_1 GAggAccCcAccCC 0.75 474 474_1 GgaGgAccCCacCC 0.51 475 475_1 GggAGgAccCcaCC 0.68 476 476_1 TgGgAGgaCCccAC 0.95 477 477_1 CTggGAggACccCA 0.46 478 478_1 GgcTgGgaGgAcCC 0.58 479 479_1 AcGGctGGgAGgAC 0.81 480 480_1 CCacGGcTgGgaGG 0.09 481 481_1 GcCCacGgCTggGA 0.52 482 482_1 AGgCccAcGGctGG 0.65 483 483_1 TgAGgcCCacGgCT 0.7 484 484_1 CcTgaGGccCAcGG 0.47 485 485_1 AccCTgaGgCCcAC 0.83 486 486_1 TcAccCTgaGgcCC 0.58 487 487_1 GgtCacCctGagGC 0.69 488 488_1 TcGGtCAccCTgAG 0.79 489 489_1 GAtcGgTcaCCcTG 0.72 490 490_1 GTgATmcgGtCAcCC 1.11 491 491_1 CTgTGaTCgGTcAC 0.69 492 492_1 CCctGTgATcGgTC 0.76 493 493_1 CtCCctGTgATcGG 0.56 494 494_1 CTctCCctGTgaTC 0.5 495 495_1 CAcTctCCcTgtGA 0.79 496 496_1 GcCacTctCCctGT 0.84 497 497_1 GaGccACtCTccCT 0.71 498 498_1 GGgaGccAcTctCC 0.65 499 499_1 CAgGgaGcCActCT 0.73 500 500_1 GgcAGggAgcCaCT 0.74 501 501_1 AGggCagGgaGcCA 0.62 502 502_1 CcaGggCagGgaGC 0.8 503 503_1 GccCagGgcAGgGA 0 504 504_1 GTgCccAggGcaGG 0.92 505 505_1 GgGTgcCcaGggCA 0 506 506_1 GggGgtGccCagGG 0 507 507_1 CaGgGgGTgCccAG 0.77 508 508_1 CgCagGggGTgcCC 0.12 509 509_1 CCacCgCagGggGT 0.82 510 510_1 GggGCcAccGcaGG 0 511 511_1 TmcgGggCCacCgCA 0.56 512 512_1 CGtcGGggCCacCG 0.86 513 513_1 GTcGTcGggGCcAC 0.65 514 514_1 CTgTcGTmcgGggCC 0.13 515 515_1 TcaGCtGTcGTcGG 0.77 516 516_1 CCtcAGctGTmlcgTC 0.54 517 517_1 CTcCTcAGcTgtCG 0.73 518 518_1 CActCCtcAGctGT 0.92 519 519_1 GTcaCTccTCagCT 1.25 520 520_1 TgGTcaCTcCTcAG 0.54 521 521_1 TgTgGTcaCTccTC 0.65 522 522_1 CTtGTgGtcACtCC 0.54 523 523_1 ACcTTgTggTCaCT 0.46 524 524_1 AGacCTtGTgGtCA 0.99 525 525_1 AGaGAcCTtGTgGT 0.8 526 526_1 GCagAGacCTtgTG 0.99 527 527_1 GggCaGAgACctTG 0.74 528 528_1 GTgGgCAgaGacCT 0.81 529 529_1 CTgTgGgCaGAgAC 0.74 530 530_1 CActGTgGgCAgAG 1.1 531 531_1 AGcACtGTgGgcAG 0.84 532 532_1 CgAgCActGTggGC 0.85 533 533_1 CCcGAgCacTgtGG 1.44 534 534_1 ACcCCgaGcACtGT 0.55 535 535_1 GcAccCCgAGcaCT 0.48 536 536_1 CCgcAccCcGAgCA 0.68 537 537_1 CAccGCacCCmcgAG 0.79 538 538_1 GAcACcGcaCCcCG 0.62 539 539_1 CAgaCAccGCacCC 0.77 540 540_1 CCcaGAcaCCgcAC 0.87 541 541_1 AgcCCaGAcAccGC 1.03 542 542_1 GcaGccCAgAcaCC 1.38 543 543_1 TCgcAGccCAgaCA 0.24 544 544_1 CTtcGcAGcCCaGA 0.35 545 545_1 CAcTTcGCaGccCA 0.9 546 546_1 TcCacTTcGCagCC 1.12 547 547_1 GAtCCaCTtCgcAG 0.49 548 548_1 GGgATcCAcTtcGC 1.19 549 549_1 GGgGgATccACtTC 0.59 550 550_1 AaGgGgGAtCCaCT 0.59 551 551_1 GAaAGgGGgATcCA 0.43 552 552_1 AaGAaaGGgGGaTC 0.5 553 553_1 CCaAGaAAgGGgGA 0.63 554 554_1 GCcCaaGAaAGgGG 0.98 555 555_1 GTgCCcaAGaAaGG 0.47 556 556_1 CAgTGcCCaAGaAA 0.52 557 557_1 TgCaGTgCCcAaGA 0.8 558 558_1 GcTgCaGTgCCcAA 0.99
[0253] The data, as illustrated in