NUCLEIC ACID, PHARMACEUTICAL COMPOSITION, CONJUGATE, PREPARATION METHOD, AND USE
20230193277 · 2023-06-22
Assignee
Inventors
- Hongyan ZHANG (Kunshan, Jiangsu, CN)
- Shan GAO (Kunshan, Jiangsu, CN)
- Daiwu KANG (Kunshan, Jiangsu, CN)
- Tao LIU (Kunshan, Jiangsu, CN)
Cpc classification
A61K47/18
HUMAN NECESSITIES
A61P7/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K47/26
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K47/26
HUMAN NECESSITIES
A61K47/24
HUMAN NECESSITIES
Abstract
Provided are an siRNA which inhibits plasma coagulation factor XI gene expression, a pharmaceutical composition containing the siRNA, a conjugate, a reagent kit, and a use of the siRNA, the pharmaceutical composition thereof and the conjugate in preparing a drug used for treating and/or preventing thrombotic diseases and ischemic strokes.
Claims
1. (Currency Amended) An siRNA, comprising a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are reverse complementary to form a double-stranded region; wherein the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides; and the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 3, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 4: TABLE-US-00072 (SEQ ID NO: 3) 5′-GGGUAUUCUUUCAAGCAAZ.sub.3-3′; (SEQ ID NO: 4) 5-Z.sub.4UUGCUUGAAAGAAUACCC-3′, wherein, Z.sub.3 is selected from A, U, G, or C, and Z.sub.4 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.3; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 63, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 64: TABLE-US-00073 (SEQ ID NO: 63) 5′-GGCAUAAACUAUAACAGCZ.sub.7-3′; (SEQ ID NO: 64) 5-Z.sub.8GCUGUUAUAGUUUAUGCC-3′, wherein, Z.sub.7 is selected from A, U, G, or C, and Z.sub.8 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.7; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 123, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 124: TABLE-US-00074 (SEQ ID NO: 123) 5′-GCUCAAGAAUGCCAAGAAZ.sub.11-3′; (SEQ ID NO: 124) 5-Z.sub.12UUCUUGGCAUUCUUGAGC-3′, wherein, Z.sub.11 is selected from A, U, G, or C, and Z.sub.12 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.11; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 183, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 184: TABLE-US-00075 (SEQ ID NO: 183) 5′-GCAACAAAGACAUUUAUGZ.sub.15-3′; (SEQ ID NO: 184) 5-Z.sub.16CAUAAAUGUCUUUGUUGC-3′, wherein, Z.sub.15 is selected from A, U, G, or C, and Z.sub.16 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.15; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 243, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 244: TABLE-US-00076 (SEQ ID NO: 243) 5′-GAAUCUCAAAGAAAUCUUZ.sub.19-3′; (SEQ ID NO: 244) 5-Z.sub.20AAGAUUUCUUUGAGAUUC-3′, wherein, Z.sub.19 is selected from A, U, G, or C, and Z.sub.20 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.19; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 303, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 304: TABLE-US-00077 (SEQ ID NO: 303) 5′-GUACGUGGACUGGAUUCUZ.sub.23-3′; (SEQ ID NO: 304) 5-Z.sub.24AGAAUCCAGUCCACGUAC-3′, wherein, Z.sub.23 is selected from A, U, G, or C, and Z.sub.24 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.23; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 363, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 364: TABLE-US-00078 (SEQ ID NO: 363) 5′-AUUUCUGGGUAUUCUUUCZ.sub.27-3′; (SEQ ID NO: 364) 5′-Z.sub.28GAAAGAAUACCCAGAAAU-3′, wherein, Z.sub.27 is selected from A, U, G, or C, and Z.sub.28 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.27; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 423, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 424: TABLE-US-00079 (SEQ ID NO: 423) 5′-CAUGAAGGGCAUAAACUAZ.sub.31-3′; (SEQ ID NO: 424) 5-Z.sub.32UAGUUUAUGCCCUUCAUG-3′, wherein, Z.sub.31 is selected from A, U, G, or C, and Z.sub.32 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.31; or the nucleotide sequence I comprises the nucleotide sequence as shown by SEQ ID NO: 483, and the nucleotide sequence II comprises the nucleotide sequence as shown by SEQ ID NO: 484: TABLE-US-00080 (SEQ ID NO: 483) 5′-GGAUUCUGGAGAAAACUCZ.sub.35-3′; (SEQ ID NO: 484) 5-Z.sub.36GAGUUUUCUCCAGAAUCC-3′, wherein, Z.sub.35 is selected from A, U, G, or C, and Z.sub.36 is the first nucleotide at the 5′ terminal of the antisense strand and complementary to Z.sub.35.
2.-6. (canceled)
7. The siRNA according to claim 1, wherein the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 63, SEQ ID NO: 123, SEQ ID NO: 183, SEQ ID NO: 243, SEQ ID NO: 303, SEQ ID NO: 363, SEQ ID NO: 423 or SEQ ID NO: 483; and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequenced represented by SEQ ID NO: 4, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 184, SEQ ID NO: 244, SEQ ID NO: 304, SEQ ID NO: 364, SEQ ID NO: 424 or SEQ ID NO: 48; the nucleotide sequence III and the nucleotide sequence IV have the same length and are reverse complementary to each other.
8. The siRNA according to claim 7, wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 1 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UCU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UUCU; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 61 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is G; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AG; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AAG; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GAAG; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 121 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AGU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GAGU; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 181 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CUU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GCUU; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 241 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is A; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AA; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AAA; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CAAA; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 301 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is A; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GA; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CGA; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UCGA; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 361 wth no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is G; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CG; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GCG; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AGOG; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 421 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is A; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GA; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AGA; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UAGA; or the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 481 with no more than 3 nucleotide differences therebetween; and the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is ACU; or the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GACU.
9. The siRNA according to claim 1, wherein the antisense strand further comprises a nucleotide sequence V; the nucleotide sequence V has a length of 1 to 3 nucleotides and is linked to 3′ terminal of the antisense strand, thereby forming a 3′ overhang of the antisense strand.
10. The siRNA according to claim 9, wherein the nucleotide sequence V has a length of 2 nucleotidesi the nucleotide sequence V is 2 consecutive thymine deoxyribonucleotides or 2 consecutive uracil ribonucleotides; or the nucleotide sequence V is complementary to the nucleotides at the corresponding positions of the target mRNA.
11. (canceled)
12. The siRNA according to claim 1, wherein the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 5, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 6: TABLE-US-00081 (SEQ ID NO: 5) 5′-GGGUAUUCUUUCAAGCAAZ.sub.3-3′; (SEQ ID NO: 6) 5′-Z.sub.4UUGCUUGAAAGAAUACCCAG-3; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 7, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 8: TABLE-US-00082 (SEQ ID NO: 7) 5′-CUGGGUAUUCUUUCAAGCAAZ.sub.3-3′; (SEQ ID NO: 8) 5′-Z.sub.4UUGCUUGAAAGAAUACCCAGAA-3′; wherein, Z.sub.4 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.3 is selected from A, U, G or C, and Z.sub.4 is a nucleotide complementary to Z.sub.3; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 65, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 66: TABLE-US-00083 (SEQ ID NO: 65) 5′-GGCAUAAACUAUAACAGCZ.sub.7-3′; (SEQ ID NO: 66) 5′-Z.sub.8GCUGUUAUAGUUUAUGCCCU-3′; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 67, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 68: TABLE-US-00084 (SEQ ID NO: 67) 5′-AGGGCAUAAACUAUAACAGCZ.sub.7-3′; (SEQ ID NO: 68) 5′-Z.sub.8GCUGUUAUAGUUUAUGCCCUUC-3′, wherein, Z.sub.8 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.7 is selected from A, U, G or C, and Z.sub.8 is a nucleotide complementary to Z.sub.7; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 125, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 126: TABLE-US-00085 (SEQ ID NO: 125) 5′-GCUCAAGAAUGCCAAGAAZ.sub.11-3′; (SEQ ID NO: 126) 5′-Z.sub.12UUCUUGGCAUUCUUGAGCAC-3′, or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 127, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 128: TABLE-US-00086 (SEQ ID NO: 127) 5′-GUGCUCAAGAAUGCCAAGAAZ.sub.11-3′; (SEQ ID NO: 128) 5′-Z.sub.12UUCUUGGCAUUCUUGAGCACUC-3′, wherein, Z.sub.12 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.11 is selected from A, U, G or C, and Z.sub.12 is a nucleotide complementary to or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 185, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 186: TABLE-US-00087 (SEQ ID NO: 185) 5′-GCAACAAAGACAUUUAUGZ.sub.15-3′; (SEQ ID NO: 186) 5′-Z.sub.16CAUAAAUGUCUUUGUUGCAA-3′, or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 187, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 188: TABLE-US-00088 (SEQ ID NO: 187) 5′-UUGCAACAAAGACAUUUAUGZ.sub.15-3′; (SEQ ID NO: 188) 5′-Z.sub.16CAUAAAUGUCUUUGUUGCAAGC-3′, wherein, Z.sub.16 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.15 is selected from A, U, G or C, and Z.sub.16 is a nucleotide complementary to Z.sub.15; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 245, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 246: TABLE-US-00089 (SEQ ID NO: 245) 5′-GAAUCUCAAAGAAAUCUUZ.sub.19-3′; (SEQ ID NO: 246) 5′-Z.sub.20AAGAUUUCUUUGAGAUUCUU-3′, or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 247, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 248: TABLE-US-00090 (SEQ ID NO: 247) 5′-AAGAAUCUCAAAGAAAUCUUZ.sub.19-3′; (SEQ ID NO: 248) 5′-Z.sub.20AAGAUUUCUUUGAGAUUCUUUG-3′, wherein, Z.sub.20 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.19 is selected from A, U, G or C, and Z.sub.20 is a nucleotide complementary to Z.sub.19; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 305, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 306: TABLE-US-00091 (SEQ ID NO: 305) 5′-GUACGUGGACUGGAUUCUZ.sub.23-3′; (SEQ ID NO: 306) 5′-Z.sub.24AGAAUCCAGUCCACGUACUC-3′, or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 307, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 308: TABLE-US-00092 (SEQ ID NO: 307) 5′-GAGUACGUGGACUGGAUUCUZ.sub.23-3′; (SEQ ID NO: 308) 5′-Z.sub.24AGAAUCCAGUCCACGUACUCGA-3′, wherein, Z.sub.24 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.23 is selected from A, U, G or C, and Z.sub.24 is a nucleotide complementary to Z.sub.23. or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 365, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 366: TABLE-US-00093 (SEQ ID NO: 365) 5′-AUUUCUGGGUAUUCUUUCZ.sub.27-3′; (SEQ ID NO: 366) 5′-Z.sub.28GAAAGAAUACCCAGAAAUCG-3′; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 367, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 368: TABLE-US-00094 (SEQ ID NO: 367) 5′-CGAUUUCUGGGUAUUCUUUCZ.sub.27-3′; (SEQ ID NO: 368) 5′-Z.sub.28GAAAGAAUACCCAGAAAUCGCU-3′; wherein, Z.sub.28 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.27 is selected from A, U, G or C, and Z.sub.28 is a nucleotide complementary to Z.sub.27. or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 425, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 426: TABLE-US-00095 (SEQ ID NO: 425) 5′-CAUGAAGGGCAUAAACUAZ.sub.31-3′; (SEQ ID NO: 426) 5′-Z.sub.32UAGUUUAUGCCCUUCAUGUC-3′, or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 427, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 428: TABLE-US-00096 (SEQ ID NO: 427) 5′-GACAUGAAGGGCAUAAACUAZ.sub.31-3′; (SEQ ID NO: 428) 5′-Z.sub.32UAGUUUAUGCCCUUCAUGUCUA-3′, wherein, Z.sub.32 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.31 is selected from A, U, G or C, and Z.sub.32 is a nucleotide complementary to Z.sub.31; or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 485, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 486: TABLE-US-00097 (SEQ ID NO: 485) 5′-GGAUUCUGGAGAAAACUCZ.sub.35-3′; (SEQ ID NO: 486) 5′-Z.sub.36GAGUUUUCUCCAGAAUCCAG-3′, or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 487, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 488: TABLE-US-00098 (SEQ ID NO: 487) 5′-CUGGAUUCUGGAGAAAACUCZ.sub.35-3′; (SEQ ID NO: 488) 5′-Z.sub.36GAGUUUUCUCCAGAAUCCAGUC-3′, wherein, Z.sub.36 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.35 is selected from A, U, G or C, and Z.sub.36 is a nucleotide complementary to Z.sub.35.
13. The siRNA according to claim 1, wherein the siRNA is any one of siFXla1, siFXla2, siFXlb1, siFXlb2, siFXlc1, siFXlc2, siFXld1, siFXld2, siFXle1, siFXle2, siFXlf1, siFXlf2, siFXlg1, siFXlg2, siFXlh1, siFXlh2, siFXli1, and siFXli2.
14. (canceled)
15. The siRNA according to claim 1, wherein each nucleotide in the sense strand and the antisense strand is independently a fluoro modified nucleotide or a non-fluoro modified nucleotide; wherein the fluoro modified nucleotides are located in the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 63, SEQ ID NO: 123, SEQ ID NO: 183, SEQ ID NO: 243, SEQ ID NO: 303, SEQ ID NO: 363, SEQ ID NO: 423 or SEQ ID NO: 483 and the nucleotide sequence represented by SEQ ID NO: 4, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 184, SEQ ID NO: 244, SEQ ID NO: 304, SEQ ID NO: 364, SEQ ID NO: 424 or SEQ ID NO: 484; and in the direction from 5′ terminal to 3′ terminal, at least the nucleotides at positions 7, 8 and 9 of the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 63, SEQ ID NO: 123, SEQ ID NO: 183, SEQ ID NO: 243, SEQ ID NO: 303, SEQ ID NO: 363, SEQ ID NO: 423 or SEQ ID NO: 483 are fluoro modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, at least the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence represented by SEQ ID NO: 4, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 184, SEQ ID NO: 244, SEQ ID NO: 304, SEQ ID NO: 364, SEQ ID NO: 424 or SEQ ID NO: 484 are fluoro modified nucleotides.
16-19. (canceled)
20. The siRNA according to claim 15, wherein each non-fluoro modified nucleotide is a methoxy modified nucleotide; and the methoxy modified nucleotide refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group with a methoxy group.
21. The siRNA according to claim 20, wherein, in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 63, SEQ ID NO: 123, SEQ ID NO: 183, SEQ ID NO: 243, SEQ ID NO: 303, SEQ ID NO: 363, SEQ ID NO: 423 or SEQ ID NO: 483 in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of the nucleotide sequence represented by SEQ ID NO: 4, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 184, SEQ ID NO: 244, SEQ ID NO: 304, SEQ ID NO: 364, SEQ ID NO: 424 or SEQ ID NO: 484 in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides; or in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 63, SEQ ID NO: 123, SEQ ID NO: 183, SEQ ID NO: 243, SEQ ID NO: 303, SEQ ID NO: 363, SEQ ID NO: 423 or SEQ ID NO: 483 in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence represented by SEQ ID NO: 4, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 184, SEQ ID NO: 244, SEQ ID NO: 304, SEQ ID NO: 364, SEQ ID NO: 424 or SEQ ID NO: 484 in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides; or in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 63, SEQ ID NO: 123, SEQ ID NO: 183, SEQ ID NO: 243, SEQ ID NO: 303, SEQ ID NO: 363, SEQ ID NO: 423 or SEQ ID NO: 483 in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence represented by SEQ ID NO: 4, SEQ ID NO: 64, SEQ ID NO: 124, SEQ ID NO: 184, SEQ ID NO: 244, SEQ ID NO: 304, SEQ ID NO: 364, SEQ ID NO: 424 or SEQ ID NO: 484 in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides.
22. The siRNA according to claim 1, wherein the siRNA is any one of siFXla1-M1, siFXla1-M2, siFXla1-M3, siFXla2-M1, siFXla2-M2, siFXla2-M3, siFXlb1-M1, siFXlb1-M2, siFXlb1-M3, siFXlb2-M1, siFXlb2-M2, siFXlb2-M3, siFXlc1-M1, siFXlc1-M2, siFXlc1-M3, siFXlc2-M1, siFXlc2-M2, siFXlc2-M3, siFXld1-M1, siFXld1-M2, siFXld1-M3, siFXld2-M1, siFXld2-M2, siFXld2-M3, siFXle1-M1, siFXle1-M2, siFXle1-M3, siFXle2-M1, siFXle2-M2, siFXle2-M3, siFXlf1-M1, siFXlf1-M2, siFXlf1-M3, siFXlf2-M1, siFXlf2-M2, siFXlf2-M3, siFXlg1-M1, siFXlg1-M2, siFXlg1-M3, siFXlg2-M1, siFXlg2-M2, siFXlg2-M3, siFXlh1-M1, siFXlh1-M2, siFXlh1-M3, siFXlh2-M1, siFXlh2-M2, siFXlh2-M3, siFXli1-M1, siFXli1-M2, siFXli1-M3, siFXli2-M1, siFXli2-M2, and siFXIi2-M3; or the siRNA is any one of siFXla1-M1S, siFXla1-M2S, siFXla1-M3S, siFXla2-M1S, siFXla2-M2S, siFXla2-M3S, siFXlb1-M1S, siFXlb1-M2S, siFXlb1-M3S, siFXlb2-M1S, siFXlb2-M2S, siFXlb2-M3S, siFXIc1-M1S, siFXlc1-M2S, siFXlc1-M3S, siFXIc2-M1S, siFXlc2-M2S, siFXlc2-M3S, siFXId1-M1S, siFX1d1-M2S, siFX1d1-M3S, siFXId2-M1S, siFX1d2-M2S, siFX1d2-M3S, siFX1e1-M1S, siFX1e1-M2S, siFX1e1-M3S, siFXle2-M1S, siFX1e2-M2S, siFX1e2-M3S, siFX1f1-M1S, siFX1f1-M2S, siFX1f1-M3S, siFXlf2-M1S, siFX1f2-M2S, siFX1f2-M3S, siFXIg1-M1S, siFX1g1-M2S, siFX1g1-M3S, siFXIg2-M1S, siFX1g2-M2S, siFX1g2-M3S, siFXIh1-M1S, siFXIh1-M2S, siFXIh1-M3S, siFXlh2-M1S, siFXIh2-M2S, siFXIh2-M3S, FXIi1-M1S, siFXIi1-M2S, siFXIi1-M3S, siFXli2-M1S, siFXIi2-M2S, and siFXIi2-M3S: or the siRNA is any one of siFXIa1-M1P1, siFXIa1-M2P1, siFXIa1-M3P1, siFXla2-M1P1, siFXla2-M2P1, siFXla2-M3P1, siFXIa1-M1SP1, siFXIa1-M2SP1, siFXIa1-M3SP1, siFXla2-M1SP1, siFXla2-M2SP1, siFXla2-M3SP1, siFXIb1-M1P1, siFXlb1-M2P1, siFXlb1-M3P1, siFXIb2-M1P1, siFXlb2-M2P1, siFXlb2-M3P1, siFXIb1-M1SP1, siFXlb1-M2SP1, siFXlb1-M3SP1, siFXIb2-M1SP1, siFXIb2-M2SP1, siFXIb2-M3SP1, siFXIc1-M1P1, siFXIc1-M2P1, siFXIc1-M3P1, siFXIc2-M1P1, siFXlc2-M2P1, siFXlc2-M3P1, siFXlc1-M1SP1, siFXlc1-M2SP1, siFXlc1-M3SP1, siFXlc2-M1SP1, siFXlc2-M2SP1, siFXlc2-M3SP1, siFXld1-M1P1, siFXld1-M2P1, siFXld1-M3P1, siFXld2-M1P1, siFXld2-M2P1, siFXld2-M3P1, siFXld1-M1SP1, siFXld1-M2SP1, siFXId1-M3SP1, siFXId2-M1SP1, siFXId2-M2SP1, siFXId2-M3SP1, siFX1e1-M1P1, siFX1e1-M2P1, siFX1e1-M3P1, siFX1e2-M1P1, siFX1e2-M2P1, siFX1e2-M3P1, siFX1e1-M1SP1, siFXle1-M2SP1, siFXle1-M3SP1, siFXle2-M1SP1, siFXle2-M2SP1, siFXle2-M3SP1, siFX1f1-M1P1, siFX1f1-M2P1, siFX1f1-M3P1, siFXIf2-M1P1, siFXIf2-M2P1, siFXIf2-M3P1, siFX1f1-M1SP1, siFXlf1-M2SP1, siFXlf1-M3SP1, siFXlf2-M1SP1, siFXlf2-M2SP1, siFXlf2-M3SP1, siFX1q1-M1P1, siFX1q1-M2P1, siFX1q1-M3P1, siFX1q2-M1P1, siFX1q2-M2P1, siFX1q2-M3P1, siFXIg1-M1SP1, siFX1q1-M2SP1, siFX1q1-M3SP1, siFX1q2-M1SP1, siFX1q2-M2SP1, siFXIg2-M3SP1, siFXIh1-M1P1, siFXlh1-M2P1, siFXlh1-M3P1, siFXlh2-M1P1, siFXlh2-M2P1, siFXlh2-M3P1, siFXlh1-M1SP1, siFXIh1-M2SP1, siFXIh1-M3SP1, siFXIh2-M1SP1, siFXlh2-M2SP1, siFXlh2-M3SP1, siFXli1-M1P1, siFXli1-M2P1, siFXli1-M3P1, siFXli2-M1P1, siFXli2-M2P1, siFXli2-M3P1, siFXli1-M1SP1, siFXli1-M2SP1, siFXli1-M3SP1, siFXli2-M1SP1, siFXli2-M2SP1, and siFXli2-M3SP1.
23.-24. (canceled)
25. The siRNA according to claim 1, wherein in the siRNA, at least one phosphate group is a phosphorothioate group, and the phosphorothioate linkage is located in at least one of the group consisting of the following positions: the position between the first and second nucleotides at 5′ terminal of the sense strand; the position between the second and third nucleotides at 5′ terminal of the sense strand; the position between the first and second nucleotides at 3′ terminal of the sense strand; the position between the second and third nucleotides at 3′ terminal of the sense strand; the position between the first and second nucleotides at 5′ terminal of the antisense strand; the position between the second and third nucleotides at 5′ terminal of the antisense strand; the position between the first and second nucleotides at 3′ terminal of the antisense strand; and the position between the second and third nucleotides at 3′ terminal of the antisense strand.
26.-27. (canceled)
28. A pharmaceutical composition, wherein the pharmaceutical composition comprises the siRNA according to claim 1, and a pharmaceutically acceptable carrier; wherein the weight ratio of the siRNA to the pharmaceutically acceptable carrier is 1: (1-500).
29.-34. (canceled)
35. An siRNA conjugate, comprising the siRNA according to claim 1, and a conjugation group conjugatively linked to the siRNA.
36.-41. (canceled)
42. The siRNA conjugate according to claim 35, wherein the siRNA conjugate has a structure as shown by Formula (308): ##STR00059## wherein, n1 is an integer of 1-3, and n3 is an integer of 0-4; m1, m2, and m3 independently of one another are an integer of 2-10; R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 independently of one another are H, or selected from the group consisting of C.sub.1-C.sub.10 alkyl, C.sub.1-C.sub.10 haloalkyl, and C.sub.1-C.sub.10 alkoxy, R.sub.3 is a group having a structure as shown by Formula (A59): ##STR00060## wherein E.sub.1 is OH, SH or BH.sub.2; and Nu is the siRNA; R.sub.2 is a linear alkylene of 1 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with any one or more groups selected from the group consisting of: C(O), NH, O, S, CH═N, S(O).sub.2, C.sub.2-C.sub.10 alkenylene, C.sub.2-C.sub.10 alkynylene, C.sub.6-C.sub.10 arylene, C.sub.3-C.sub.18 heterocyclylene, and C.sub.5-C.sub.10 heteroarylene, and wherein R.sub.2 optionally has any one or more substituents selected from the group consisting of: C.sub.1-C.sub.10 alkyl, C.sub.6-C.sub.10 aryl, C.sub.5-C.sub.10 heteroaryl, C.sub.1-C.sub.10 haloalkyl, —OC.sub.1-C.sub.10 alkyl, —OC.sub.1-C.sub.10 alkylphenyl, —C.sub.1-C.sub.10 alkyl-OH, —OC.sub.1-C.sub.10 haloalkyl, —SC.sub.1-C.sub.10 alkyl, —SC.sub.1-C.sub.10 alkylphenyl, —C.sub.1-C.sub.10 alkyl-SH, —SC.sub.1-C.sub.10 haloalkyl, halo, —OH, —SH, —NH.sub.2, —C.sub.1-C.sub.10 alkyl-NH.sub.2, —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —NH(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkylphenyl), —NH(C.sub.1-C.sub.10 alkylphenyl), cyano, nitro, —CO.sub.2H, —C(O)O(C.sub.1-C.sub.10 alkyl), —CON(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —CONH(C.sub.1-C.sub.10 alkyl), —CONH.sub.2, —NHC(O)(C.sub.1-C.sub.10 alkyl), —NHC(O)(phenyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(phenyl), —C(O)C.sub.1-C.sub.10 alkyl, —C(O)C.sub.1-C.sub.10 alkylphenyl, —C(O)C.sub.1-C.sub.10 haloalkyl, —OC(O)C.sub.1-C.sub.10 alkyl, —SO.sub.2(C.sub.1-C.sub.10 alkyl), —SO.sub.2(phenyl), —SO.sub.2(C.sub.1-C.sub.10 haloalkyl), —SO.sub.2NH.sub.2, —SO.sub.2NH(C.sub.1-C.sub.10 alkyl), —SO.sub.2NH(phenyl), —NHSO.sub.2(C.sub.1-C.sub.10 alkyl), —NHSO.sub.2(phenyl), and —NHSO.sub.2(C.sub.1-C.sub.10 haloalkyl); each L.sub.1 is a linear alkylene of 1 to 70 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with any one or more groups selected from the group consisting of: C(O), NH, O, S, CH═N, S(O).sub.2, C.sub.2-C.sub.10 alkenylene, C.sub.2-C.sub.10 alkynylene, C.sub.6-C.sub.10 arylene, C.sub.3-C.sub.18 heterocyclylene, and C.sub.5-C.sub.10 heteroarylene, and wherein L.sub.1 optionally has any one or more substituents selected from the group consisting of: C.sub.1-C.sub.10 alkyl, C.sub.6-C.sub.10 aryl, C.sub.5-C.sub.10 heteroaryl, C.sub.1-C.sub.10 haloalkyl, —OC.sub.1-C.sub.10 alkyl, —OC.sub.1-C.sub.10 alkylphenyl, —C.sub.1-C.sub.10 alkyl-OH, —OC.sub.1-C.sub.10 haloalkyl, —SC.sub.1-C.sub.10 alkyl, —SC.sub.1-C.sub.10 alkylphenyl, —C.sub.1-C.sub.10 alkyl-SH, —SC.sub.1-C.sub.10 haloalkyl, halo, —OH, —SH, —NH.sub.2, —C.sub.1-C.sub.10 alkyl-NH.sub.2, —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —NH(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkylphenyl), —NH(C.sub.1-C.sub.10 alkylphenyl), cyano, nitro, —CO.sub.2H, —C(O)O(C.sub.1-C.sub.10 alkyl), —CON(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —CONH(C.sub.1-C.sub.10 alkyl), —CONH.sub.2, —NHC(O)(C.sub.1-C.sub.10 alkyl), —NHC(O)(phenyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(phenyl), —C(O)C.sub.1-C.sub.10 alkyl, —C(O)C.sub.1-C.sub.10 alkylphenyl, —C(O)C.sub.1-C.sub.10 haloalkyl, —OC(O)C.sub.1-C.sub.10 alkyl, —SO.sub.2(C.sub.1-C.sub.10 alkyl), —SO.sub.2(phenyl), —SO.sub.2(C.sub.1-C.sub.10 haloalkyl), —SO.sub.2NH.sub.2, —SO.sub.2NH(C.sub.1-C.sub.10 alkyl), —SO.sub.2NH(phenyl), —NHSO.sub.2(C.sub.1-C.sub.10 alkyl), —NHSO.sub.2(phenyl), and —NHSO.sub.2(C.sub.1-C.sub.10 haloalkyl); represents the site where the group is covalently linked; M.sub.1 represents the targeting group.
43. The siRNA conjugate according to claim 42, wherein each L.sub.1 is independently selected from the group consisting of the groups of Formulae (A1)-(A26) and any combination thereof: ##STR00061## ##STR00062## ##STR00063## wherein each j1 is independently an integer of 1-20; each j2 is independently an integer of 1-20; each R′ is independently a C.sub.1-C.sub.10 alkyl; each Ra is selected from the group consisting of the groups of Formulae (A27)-(A45) and any combination thereof: ##STR00064## ##STR00065## ##STR00066## each Rb is independently a C.sub.1-C.sub.10 alkyl; and represents the site where a group is covalently linked.
44. The siRNA conjugate according to claim 43, wherein L.sub.1 is selected from the group consisting of groups of Formulae (A1), (A4), (A5), (A6), (A8), (A10), (A11), and (A13) and connection combinations thereof; or L.sub.1 is a connection combinations of at least two of groups of Formulae (A1), (A4), (A8), (A10), and (A11).
45.-46. (canceled)
47. The siRNA conjugate according to any one of claims 42, wherein L.sub.1 has a length of 3 to 25 atoms; or L.sub.1 further has a length of 4 to 15 atoms.
48.-51. (canceled)
52. The siRNA conjugate according to claim 42, wherein each m1, m2 and m3 independently of one another are an integer of 2-5; or wherein m1=m2=m3.
53. (canceled)
54. The siRNA conjugate according to claim 42, wherein each of the targeting groups is independently a ligand that has affinity to the asialoglycoprotein receptors on the surface of mammalian hepatocytes; or each of the targeting groups is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-calactopyranose, β-D-galactopyranose, α-D-calactofuranose, β-D-calactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose.
55.-58. (canceled)
59. The siRNA conjugate according to claim 42, wherein the R.sub.2 group has both a site linking to the N atom on the nitrogenous backbone and a site linking to the P atom in R.sub.3; and in R.sub.2, the site linking to the N atom on the nitrogenous backbone forms an amide bond with the N atom, and the site linking to the P atom in R.sub.3 forms a phosphoester bond with the P atom; or. R.sub.2 is selected from B5, B6, B5′, or B6′: ##STR00067## wherein represents the site where the group is covalently linked; q2 is an integer of 1-10.
60.-62. (canceled)
63. The siRNA conjugate according to claim 42, wherein the siRNA conjugate has a structure as shown by Formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422): ##STR00068## ##STR00069## ##STR00070## ##STR00071## ##STR00072## ##STR00073## ##STR00074## ##STR00075##
64.-65. (canceled)
66. The siRNA conjugate according to claim 42, wherein the P atom in Formula (A59) is linked to 3′ terminal of the sense strand of the siRNA.
67-68. (canceled)
69. A method for treating and/or preventing a thrombotic diseases and/or ischemic stroke, comprising administering an effective amount of the siRNA according to claim 1 and/or the siRNA conjugate comprising the same to a subject suffering from thrombotic diseases and/or ischemic stroke.
70. A method for inhibiting the expression of Coagulation Factor XI gene, comprising contacting an effective amount of the siRNA according to claim 1 and/or the siRNA conjugate comprising the same with the cells.
71. (canceled)
Description
DETAILED DESCRIPTION OF THE INVENTION
[0048] The following is the detailed description of the specific embodiments of the present disclosure. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present disclosure and are not intended to limit the present disclosure.
[0049] In the present disclosure, FXI mRNA refers to the mRNA having the sequence as shown in Genbank Accession No. NM000128.3. Further, unless otherwise specified, the term “target gene” used in the present disclosure refers to a gene transcribing the above FXI mRNA; and the term “target mRNA” refers to the above FXI mRNA.
[0050] Definitions
[0051] In the context of the present disclosure, unless otherwise specified, C, G, U, and A represent the base composition of a nucleotide; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; s represents the two nucleotides adjacent to both sides of the letter s are linked by a thiophosphate linkage; P1 represents that the nucleotide adjacent to the right side of P1 is a 5′-phosphate nucleotide or a 5′-phosphate analogue modified nucleotide; VP represents that the nucleotide adjacent to the right side of VP is a vinyl phosphate (5′-(E)-vinylphosphonate, E-VP) modified nucleotide; Ps represents that the nucleotide adjacent to the right side of Ps is a thiophosphate modified nucleotide; and P represents that the nucleotide adjacent to the right side of the letter P is a 5′-phosphate nucleotide.
[0052] In the context of the present disclosure, a “fluoro modified nucleotide” refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group with a fluorine atom. A “non-fluoro modified nucleotide” refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group with a non-fluoro group, or a nucleotide analogue. A “nucleotide analogue” refers to a group that can replace a nucleotide in a nucleic acid, while structurally differs from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or thymine deoxyribonucleotide, such as an isonucleotide, a bridged nucleotide (bridged nucleic acid, BNA) or an acyclic nucleotide. The “methoxy modified nucleotide” refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group with a methoxy group.
[0053] In the context of the present disclosure, expressions “complementary” and “reverse complementary” can be interchangeably used, and have a well-known meaning in the art, namely, the bases in one strand are complementarily paired with those in the other strand in a double-stranded nucleic acid molecule. In DNAs, a purine base adenine (A) is always paired with a pyrimidine base thymine (T) (or a uracil (U) in RNAs); and a purine base guanine (G) is always paired with a pyrimidine base cytosine (C). Each base pair comprises a purine and a pyrimidine. While adenines in one strand are always paired with thymines (or uracils) in another strand, and guanines are always paired with cytosines, the two strands are considered as being complementary with each other; and the sequence of a strand may be deduced from the sequence of its complementary strand. Correspondingly, a “mispairing” means that the bases at corresponding positions are not present in a manner of complementary pairing in a double-stranded nucleic acid.
[0054] In the context of the present disclosure, unless otherwise specified, “basically reverse complementary” means that there are no more than 3 base mispairings between two nucleotide sequences. “Substantially reverse complementary” means that there is no more than 1 base mispairing between two nucleotide sequences. “Completely reverse complementary” means that there is no base mispairing between two nucleotide sequences.
[0055] In the context of the present disclosure, a “nucleotide difference” between a nucleotide sequence and another nucleotide sequence refers to a change in the type of the nucleotide base at the same position therebetween. For example, in case that a nucleotide base in the latter sequence is A while the nucleotide base at the same position in the former sequence is U, C, G, or T, it is considered that a nucleotide difference is located in this position between these two nucleotide sequences. In some embodiments, if a nucleotide at a position is replaced with an abasic nucleotide or a nucleotide analogue, it is also considered that there is a nucleotide difference at the position.
[0056] In the context of the present disclosure, particularly in the description of the method for preparing the siRNA, the composition comprising the siRNA, or the siRNA conjugate of the present disclosure, unless otherwise specified, the “nucleoside monomer” refers to, according to the type and sequence of the nucleotides in the siRNA or siRNA conjugate to be prepared, unmodified or modified RNA phosphoramidites (sometimes RNA phosphoramidites are referred to as nucleoside phosphoramidites) used in a phosphoramidite solid phase synthesis. The phosphoramidite solid phase synthesis is a well-known method for RNA synthesis by those skilled in the art. Nucleoside monomers used in the present disclosure are all commercially available.
[0057] In the context of the present disclosure, unless otherwise specified, “conjugation” means that two or more chemical moieties each having specific function are linked to each other via a covalent linkage. Correspondingly, a “conjugate” refers to a compound formed by covalent linkage of individual chemical moieties. Furthermore, a “siRNA conjugate” represents a compound formed by covalently linking one or more chemical moieties each with specific functions to an siRNA. In the following text, the siRNA conjugate of the present disclosure is sometimes abbreviated as “conjugate”. According to the context of the present disclosure, the siRNA conjugate should be understood as the generic term of siRNA conjugates, the generic term of siRNA conjugates as shown by Formulae (305) and (307), or siRNA conjugates as shown by Formula (305), (307) or (308). In the context of the present disclosure, “conjugating molecules” should be interpreted as specific compounds capable of being conjugated to an siRNA via reactions, thereby finally forming the siRNA conjugates of the present disclosure.
[0058] As used herein, “optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances in which the event or circumstance occurs and instances in which it does not. For example, “optionally substituted alkyl” encompasses both “alkyl” and “substituted alkyl” as defined below. It will be understood by those skilled in the art, with respect to any group containing one or more substituents, that such groups are not intended to introduce any substitution or substitution patterns that are sterically impractical, synthetically infeasible and/or inherently unstable.
[0059] As used herein, “alkyl” refers to straight chain and branched chain having the indicated number of carbon atoms, usually from 1 to 20 carbon atoms, for example 1 to 10 carbon atoms, such as 1 to 8 or 1 to 6 carbon atoms. For example, C.sub.1-C.sub.6 alkyl encompasses both straight and branched chain alkyl of from 1 to 6 carbon atoms. When an alkyl residue having a specific number of carbon atoms is mentioned, all branched and straight chain forms having that number of carbon atoms are intended to be encompassed; thus, for example, “butyl” is meant to encompass n-butyl, sec-butyl, isobutyl, and t-butyl; “propyl” includes n-propyl and isopropyl. Alkylene is a subset of alkyl, referring to the same residues as alkyl, but having two attachment points.
[0060] As used herein, “alkenyl” refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon double bond obtained by removing one hydrogen molecule from two adjacent carbon atoms of the parent alkyl. The group may be in either the cis or trans configuration of the double bond(s). Typical alkenyl groups include, but are not limited to, ethenyl; propenyl, such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl; butenyl, such as but-1-en-1-yl, but-1-en-2-yl, 2-methyl-prop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, buta-1,3-dien-1-yl, buta-1,3-dien-2-yl; and the like. In certain embodiments, an alkenyl group has from 2 to 20 carbon atoms, and in other embodiments, from 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl, referring to the same residues as alkenyl, but having two attachment points.
[0061] As used herein, “alkynyl” refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon triple bond obtained by removing two hydrogen molecules from two adjacent carbon atoms of the parent alkyl. Typical alkynyl groups include, but are not limited to, ethynyl; propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl, such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1 -yl; and the like. In certain embodiments, an alkynyl group has from 2 to 20 carbon atoms, and in other embodiments, from 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a subset of alkynyl, referring to the same residues as alkynyl, but having two attachment points.
[0062] As used herein, “alkoxy” refers to an alkyl group of the indicated number of carbon atoms linked through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy, and the like. Alkoxy group usually has from 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms linked through oxygen bridge.
[0063] As used herein, “aryl” refers to a radical derived from an aromatic monocyclic or multicyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. The aromatic monocyclic or multicyclic hydrocarbon ring system contains only hydrogen and carbon, including from 6 to 18 carbon atoms, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2)π-electron system in accordance with the Mickel theory. Aryl groups include, but are not limited to, groups such as phenyl, fluorenyl, and naphthyl. Arylene is a subset of aryl, referring to the same residues as aryl, but having two attachment points.
[0064] As used herein, “halo substituent” or “halogen” refers to fluoro, chloro, bromo, and iodo, and the term “halogen” includes fluorine, chlorine, bromine, and iodine.
[0065] As used herein, “haloalkyl” refers to alkyl as defined above with the specified number of carbon atoms being substituted with one or more halogen atoms, up to the maximum allowable number of halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and penta-fluoroethyl.
[0066] “Heterocyclyl” refers to a stable 3- to 18-membered non-aromatic ring radical that comprises two to twelve carbon atoms and from one to six heteroatoms selected from nitrogen, oxygen or sulfur. Unless stated otherwise in the description, heterocyclyl is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring system(s). The heteroatom(s) in the heterocyclyl radical may be optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heterocyclyl radical is partially or fully saturated. The heterocyclyl may be linked to the rest of the molecule through any atom of the ring(s). Examples of such heterocyclyl radicals include, but are not limited to, dioxolanyl, thienyl [1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxapyrimidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxa-thiomorpholinyl, and 1,1-dioxa-thiomorpholinyl.
[0067] “Heteroaryl” refers to a radical derived from a 3- to 18-membered aromatic ring radical that comprises two to seventeen carbon atoms and one to six heteroatoms selected from nitrogen, oxygen or sulfur. As used herein, heteroaryl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, wherein at least one ring in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π-electron system in accordance with the Hückel theory. Heteroaryl includes fused or bridged ring system(s). The heteroatom(s) in the heteroaryl radical is optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heteroaryl is linked to the rest of the molecule through any atom of the ring(s). Examples of heteroaryls include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3 -b enzodioxazolyl, benzofuranyl, benzoxazolyl, b enzo [d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodi oxolyl, benzodi oxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-di hydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanonyl, furo[3,2-c]pyridinyl, 5,6,7, 8,9, 10-hexahydrocyclohepta[d]pyrimidinyl, 5,6,7,8,9, 10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7, 8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6, 6a, 7,8,9,10, 10a-octahydrobenzo[h]quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7, 8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro-5H-cyclohepta [4,5]thieno[2,3-d]pyrimidinyl, 5,6,7, 8-tetrahydropyri do[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl/thienyl.
[0068] Various hydroxyl protecting groups may be used in the present disclosure. In general, protecting groups render chemical functional groups inert to specific reaction conditions, and may be appended to and removed from such functional groups in a molecule without substantially damaging the remainder of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage, et al., Tetrahedron 1992, 48, 2223-2311, and also in Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, each of which is hereby incorporated by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but may be removed under acidic conditions. In some embodiments, non-exclusive examples of the hydroxyl protecting groups that may be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein comprises Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4′-dimethoxytrityl), and TMTr (4,4′,4″-trimethoxytrityl).
[0069] The term “subject”, as used herein, refers to any animal, e.g., a mammal or marsupial. Subject of the present disclosure includes but are not limited to human, non-human primate (e.g., rhesus or other kinds of macaque), mouse, pig, horse, donkey, cow, sheep, rat and fowl of any kind.
[0070] As used herein, “treating” refers to an approach for obtaining advantageous or desired results, including but not limited to, therapeutic benefit. By “therapeutic benefit” is meant eradication or improvement of potential disorder being treated. Also, a therapeutic benefit is achieved by eradication or amelioration of one or more of physiological symptoms associated with the potential disorder such that an improvement is observed in the subject, notwithstanding that the subject may still be afflicted with the potential disorder.
[0071] As used herein, “preventing” refers to an approach for obtaining advantageous or desired results, including but not limited to, a prophylactic benefit. For “prophylactic benefit”, the siRNAs, siRNA conjugates or pharmaceutical compositions may be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of the disease, even though the diagnosis of this disease may not have been made.
[0072] In one aspect, the present disclosure provides the first to ninth siRNAs capable of inhibiting the expression of FXI gene. They will be successively described in detail below.
[0073] The siRNA of the present disclosure comprises nucleotide groups as basic structural units. It is well known to those skilled in the art that the nucleotide group contains a phosphate group, a ribose group and a base. Detailed illustrations of these groups are omitted herein.
[0074] First siRNA
[0075] According to the present disclosure, the siRNA may be a first siRNA.
[0076] The first siRNA comprises a sense strand and an antisense strand; each nucleotide in the first siRNA being independently a modified or unmodified nucleotide; wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 1 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 2 with no more than 3 nucleotide differences therebetween:
TABLE-US-00010 (SEQ ID NO: 1) 5′-GGGUAUUCUUUCAAGCAAZ.sub.1-3′; (SEQ ID NO: 2) 5′-Z.sub.2UUGCUUGAAAGAAUACCC-3′,
[0077] wherein, Z.sub.1 is U and Z.sub.2 is A, and the nucleotide sequence I comprises a nucleotide Z.sub.3 at the position corresponding to Z.sub.1; the nucleotide sequence II comprises a nucleotide Z.sub.4 at the position corresponding to Z.sub.2, wherein Z.sub.4 is the first nucleotide at 5′ terminal of the antisense strand.
[0078] In the context of the present disclosure, “corresponding position” refers to the same position in the nucleotide sequence by counting from the same terminal of the nucleotide sequence. For example, the first nucleotide at 3′ terminal of the nucleotide sequence I is a nucleotide at the position corresponding to the first nucleotide at 3′ terminal of SEQ ID NO: 1.
[0079] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0080] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 1, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 2.
[0081] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 2 includes a difference at the position Z.sub.4, where Z.sub.4 is selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.4, wherein Z.sub.4 is selected from U, C or G. In some embodiments, Z.sub.3 is a nucleotide complementary to Z.sub.4. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0082] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other; the “basically reverse complementary” means that there is no more than 3 base mispairings between two nucleotide sequences; the “substantially reverse complementary” means that there is no more than 1 base mispairing between two nucleotide sequences; the “completely reverse complementary” means that there is no mispairing between two nucleotide sequences.
[0083] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 3, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 4:
TABLE-US-00011 (SEQ ID NO: 3) 5′-GGGUAUUCUUUCAAGCAAZ.sub.3-3′; (SEQ ID NO: 4) 5′-Z.sub.4UUGCUUGAAAGAAUACCC-3′,
[0084] wherein, Z.sub.4 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.3 is selected from A, U, G, or C, and Z.sub.4 is a nucleotide complementary to Z.sub.3; in some embodiments, Z.sub.3 is U, and Z.sub.4 is A.
[0085] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides. As such, the length ratio of the sense strand to the antisense strand in the siRNA of the present disclosure may be 19/19, 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20/20, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/20, 21/21, 21/22, 21/23, 21/24, 21/25, 21/26, 22/20, 22/21, 22/22, 22/23, 22/24, 22/25, 22/26, 23/20, 23/21, 23/22, 23/23, 23/24, 23/25, or 23/26. In some embodiments, the length ratio of the sense strand to the antisense strand in the siRNA of the present disclosure may be 19/21, 21/23 or 23/25.
[0086] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I; and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 1 in the target mRNA and has the same length as the nucleotide sequence IV.
[0087] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U, and the base of the nucleotide sequence IV is A; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CU, and the base composition of the nucleotide sequence IV is AG; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UCU, and the base composition of the nucleotide sequence IV is AGA; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UUCU, and the base composition of the nucleotide sequence IV is AGAA; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CU, and the base composition of the nucleotide sequence IV is AG; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0088] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0089] Second siRNA
[0090] According to the present disclosure, the siRNA may be a second siRNA.
[0091] The second siRNA comprises a sense strand and an antisense strand; each nucleotide in the second siRNA being independently a modified or unmodified nucleotide; wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 61 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 62 with no more than 3 nucleotide differences therebetween:
TABLE-US-00012 (SEQ ID NO: 61) 5′-GGCAUAAACUAUAACAGCZ.sub.5-3′; (SEQ ID NO: 62) 5′-Z.sub.6GCUGUUAUAGUUUAUGCC-3′,
[0092] wherein, Z.sub.5 is U and Z.sub.6 is A, and
[0093] the nucleotide sequence I comprises a nucleotide Z.sub.7 at the position corresponding to Z.sub.5; the nucleotide sequence II comprises a nucleotide Z.sub.8 at the position corresponding to Z.sub.6, wherein Z.sub.8 is the first nucleotide at 5′ terminal of the antisense strand.
[0094] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0095] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 61, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 62.
[0096] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 62 includes a difference at the position Z.sub.8, where Z.sub.8 is selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.8, wherein Z.sub.8 is selected from U, C or G. In some embodiments, Z.sub.7 is a nucleotide complementary to Z.sub.8. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0097] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0098] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 63, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 64:
TABLE-US-00013 (SEQ ID NO: 63) 5′-GGCAUAAACUAUAACAGCZ.sub.7-3′; (SEQ ID NO: 64) 5′-Z.sub.8GCUGUUAUAGUUUAUGCC-3′,
[0099] wherein, Z.sub.8 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.7 is selected from A, U, G, or C, and Z.sub.8 is a nucleotide complementary to Z.sub.7; in some embodiments, Z.sub.7 is U, and Z.sub.8 is A.
[0100] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0101] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I, and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II; the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 61 in the target mRNA and has the same length as the nucleotide sequence IV.
[0102] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AAG, and the base composition of the nucleotide sequence IV is CUU; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GAAG, and the base composition of the nucleotide sequence IV is CUUC; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AG, and the base composition of the nucleotide sequence IV is CU; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0103] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0104] Third siRNA
[0105] According to the present disclosure, the siRNA may be a third siRNA.
[0106] The third siRNA comprises a sense strand and an antisense strand; each nucleotide in the third siRNA being independently a modified or unmodified nucleotide; wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 121 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 122 with no more than 3 nucleotide differences therebetween:
TABLE-US-00014 (SEQ ID NO: 121) 5′-GCUCAAGAAUGCCAAGAAZ.sub.9-3′; (SEQ ID NO: 122) 5′-Z.sub.10UUCUUGGCAUUCUUGAGC-3′,
[0107] wherein, Z.sub.9 is A and Z.sub.10 is U, and the nucleotide sequence I comprises a nucleotide Z.sub.11 at the position corresponding to Z.sub.9; the nucleotide sequence II comprises a nucleotide Z.sub.12 at the position corresponding to Z.sub.10 , wherein Z.sub.12 is the first nucleotide at 5′ terminal of the antisense strand.
[0108] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0109] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 121, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 122.
[0110] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 122 includes a difference at the position Z.sub.12, where Z.sub.12 is selected from A, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.12, wherein Z.sub.12 is selected from A, C or G. In some embodiments, Zii is a nucleotide complementary to Z.sub.12. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0111] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0112] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 123, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 124:
TABLE-US-00015 (SEQ ID NO: 123) 5′-GCUCAAGAAUGCCAAGAAZ.sub.11-3′; (SEQ ID NO: 124) 5′-Z.sub.12UUCUUGGCAUUCUUGAGC-3′,
[0113] wherein, Z.sub.12 is the first nucleotide at 5′ terminal of the antisense strand, Zii is selected from A, U, G, or C, and Z.sub.12 is a nucleotide complementary to Z.sub.11; in some embodiments, Z.sub.11 is A, and Z.sub.12 is U.
[0114] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0115] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I, and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II; the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 121 in the target mRNA and has the same length as the nucleotide sequence IV.
[0116] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U, and the base of the nucleotide sequence IV is A; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GU, and the base composition of the nucleotide sequence IV is AC; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AGU, and the base composition of the nucleotide sequence IV is ACU; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GAGU, and the base composition of the nucleotide sequence IV is ACUC; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GU, and the base composition of the nucleotide sequence IV is AC; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0117] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0118] Fourth siRNA
[0119] According to the present disclosure, the siRNA may be a fourth siRNA.
[0120] The fourth siRNA comprises a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 181 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 182 with no more than 3 nucleotide differences therebetween:
TABLE-US-00016 (SEQ ID NO: 181) 5′-GCAACAAAGACAUUUAUGZ.sub.13-3′; (SEQ ID NO: 182) 5′-Z.sub.14CAUAAAUGUCUUUGUUGC-3′,
[0121] wherein, Z.sub.13 is U and Z.sub.14 is A, and the nucleotide sequence I comprises a nucleotide Z.sub.15 at the position corresponding to Z.sub.13; the nucleotide sequence II comprises a nucleotide Z.sub.16 at the position corresponding to Z.sub.14, wherein Z.sub.16 is the first nucleotide at 5′ terminal of the antisense strand.
[0122] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0123] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 181, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 182.
[0124] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 182 includes a difference at the position Z.sub.16, where Z.sub.16 is selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.16, wherein Z.sub.16 is selected from U, C or G. In some embodiments, Z.sub.15 is a nucleotide complementary to Z.sub.16. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0125] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0126] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 183, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 184:
TABLE-US-00017 (SEQ ID NO: 183) 5′-GCAACAAAGACAUUUAUGZ.sub.15-3′; (SEQ ID NO: 184) 5′-Z.sub.16CAUAAAUGUCUUUGUUGC-3′,
[0127] wherein, Z.sub.16 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.15 is selected from A, U, G, or C, and Z.sub.16 is a nucleotide complementary to Z.sub.15; in some embodiments, Z.sub.15 is U, and Z.sub.16 is A.
[0128] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0129] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II; the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 181 in the target mRNA and has the same length as the nucleotide sequence IV.
[0130] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U, and the base of the nucleotide sequence IV is A; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UU, and the base composition of the nucleotide sequence IV is AA; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CUU, and the base composition of the nucleotide sequence IV is AAG; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GCUU, and the base composition of the nucleotide sequence IV is AAGC; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UU, and the base composition of the nucleotide sequence IV is AA; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0131] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0132] Fifth siRNA
[0133] According to the present disclosure, the siRNA may be a fifth siRNA.
[0134] The fifth siRNA comprises a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 241 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 242 with no more than 3 nucleotide differences therebetween:
TABLE-US-00018 (SEQ ID NO: 241) 5′-GAAUCUCAAAGAAAUCUUZ.sub.17-3′; (SEQ ID NO: 242) 5′-Z.sub.18AAGAUUUCUUUGAGAUUC-3′,
[0135] wherein, Z.sub.17 is U and Z.sub.18 is A, and the nucleotide sequence I comprises a nucleotide Z.sub.19 at the position corresponding to Z.sub.17; the nucleotide sequence II comprises a nucleotide Z.sub.20 at the position corresponding to Z.sub.18, wherein Z.sub.20 is the first nucleotide at 5′ terminal of the antisense strand.
[0136] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0137] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 241, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 242.
[0138] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 242 includes a difference at the position Z.sub.20, where Z.sub.20 is selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.20, wherein Z.sub.20 is selected from U, C or G. In some embodiments, Z.sub.19 is a nucleotide complementary to Z.sub.20. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0139] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0140] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 243, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 244:
TABLE-US-00019 (SEQ ID NO: 243) 5′-GAAUCUCAAAGAAAUCUUZ.sub.19-3′; (SEQ ID NO: 244) 5′-Z.sub.20AAGAUUUCUUUGAGAUUC-3′,
[0141] wherein, Zzo is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.19 is selected from A, U, G, or C, and Z.sub.20 is a nucleotide complementary to Z.sub.19; in some embodiments, Z.sub.19 is U, and Z.sub.20 is A.
[0142] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0143] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I, and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II; the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 241 in the target mRNA and has the same length as the nucleotide sequence IV.
[0144] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is A, and the base of the nucleotide sequence IV is U; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AA, and the base composition of the nucleotide sequence IV is UU; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AAA, and the base composition of the nucleotide sequence IV is UUU; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CAAA, and the base composition of the nucleotide sequence IV is UUUG; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AA, and the base composition of the nucleotide sequence IV is UU; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0145] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0146] Sixth siRNA
[0147] According to the present disclosure, the siRNA may be a sixth siRNA.
[0148] The sixth siRNA comprises a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 301 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 302 with no more than 3 nucleotide differences therebetween:
TABLE-US-00020 (SEQ ID NO: 301) 5′-GUACGUGGACUGGAUUCUZ.sub.21-3′; (SEQ ID NO: 302) 5′-Z.sub.22AGAAUCCAGUCCACGUAC-3′,
[0149] wherein, Z.sub.21 is G and Z.sub.22 is C, and the nucleotide sequence I comprises a nucleotide Z.sub.23 at the position corresponding to Z.sub.21; the nucleotide sequence II comprises a nucleotide Z.sub.24 at the position corresponding to Z.sub.22, wherein Z.sub.24 is the first nucleotide at 5′ terminal of the antisense strand.
[0150] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0151] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 301, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 302.
[0152] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 302 includes a difference at the position Z.sub.24, where Z.sub.24 is selected from U, G or A. In some embodiments, the nucleotide difference is a difference at the position Z.sub.24, wherein Z.sub.24 is selected from U, G or A. In some embodiments, Z.sub.23 is a nucleotide complementary to Z.sub.24. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0153] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0154] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 303, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 304:
TABLE-US-00021 (SEQ ID NO: 303) 5′-GUACGUGGACUGGAUUCUZ.sub.23-3′; (SEQ ID NO: 304) 5′-Z.sub.24AGAAUCCAGUCCACGUAC-3′,
[0155] wherein, Z.sub.24 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.23 is selected from A, U, G, or C, and Z.sub.24 is a nucleotide complementary to Z.sub.23; in some embodiments, Z.sub.23 is G, and Z.sub.24 is C.
[0156] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0157] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I, and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II; the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 301 in the target mRNA and has the same length as the nucleotide sequence IV.
[0158] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is A, and the base of the nucleotide sequence IV is U; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GA, and the base composition of the nucleotide sequence IV is UC; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CGA, and the base composition of the nucleotide sequence IV is UCG; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UCGA, and the base composition of the nucleotide sequence IV is UCGA; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GA, and the base composition of the nucleotide sequence IV is UC; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0159] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0160] Seventh siRNA
[0161] According to the present disclosure, the siRNA may be a seventh siRNA.
[0162] The seventh siRNA comprises a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 361 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 362 with no more than 3 nucleotide differences therebetween:
TABLE-US-00022 (SEQ ID NO: 361) 5′-AUUUCUGGGUAUUCUUUCZ.sub.25-3′; (SEQ ID NO: 362) 5′-Z.sub.26GAAAGAAUACCCAGAAAU-3′,
[0163] wherein, Z.sub.25 is A and Z.sub.26 is U, and the nucleotide sequence I comprises a nucleotide Z.sub.27 at the position corresponding to Z.sub.25; the nucleotide sequence II comprises a nucleotide Z.sub.28 at the position corresponding to Z.sub.26, wherein Z.sub.28 is the first nucleotide at 5′ terminal of the antisense strand.
[0164] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0165] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 361, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 362.
[0166] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 362 includes a difference at the position Z.sub.28, where Z.sub.28 is selected from A, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.28, wherein Z.sub.28 is selected from A, C or G. In some embodiments, Z.sub.27 is a nucleotide complementary to Z.sub.28. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0167] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0168] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 363, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 364:
TABLE-US-00023 (SEQ ID NO: 363) 5′-AUUUCUGGGUAUUCUUUCZ.sub.27-3′; (SEQ ID NO: 364) 5′-Z.sub.28GAAAGAAUACCCAGAAAU-3′,
[0169] wherein, Z.sub.28 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.27 is selected from A, U, G, or C, and Z.sub.28 is a nucleotide complementary to Z.sub.27; in some embodiments, Z.sub.27 is A, and
[0170] Z.sub.28 1S U.
[0171] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0172] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I; and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 361 in the target mRNA and has the same length as the nucleotide sequence IV.
[0173] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CG, and the base composition of the nucleotide sequence IV is CG; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GCG, and the base composition of the nucleotide sequence IV is CGC; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AGCG, and the base composition of the nucleotide sequence IV is CGCU; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CG, and the base composition of the nucleotide sequence IV is CG; in this case, the length ratio of the sense strand and the anti sense strand thereof is 21/21.
[0174] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0175] Eighth siRNA
[0176] According to the present disclosure, the siRNA may be a eighth siRNA.
[0177] The eighth siRNA comprises a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 421 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 422 with no more than 3 nucleotide differences therebetween:
TABLE-US-00024 (SEQ ID NO: 421) 5′-CAUGAAGGGCAUAAACUAZ.sub.29-3′; (SEQ ID NO: 422) 5′-Z.sub.30UAGUUUAUGCCCUUCAUG-3′,
[0178] wherein, Z.sub.29 is U and Z.sub.30 is A, and the nucleotide sequence I comprises a nucleotide Z.sub.31 at the position corresponding to Z.sub.29; the nucleotide sequence II comprises a nucleotide Z.sub.32 at the position corresponding to Z.sub.30, wherein Z.sub.32 is the first nucleotide at 5′ terminal of the antisense strand.
[0179] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0180] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 421, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 422.
[0181] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 422 includes a difference at the position Z.sub.32, where Z.sub.32 is selected from U, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.32, wherein Z.sub.32 is selected from U, C or G. In some embodiments, Z.sub.31 is a nucleotide complementary to Z.sub.32. The siRNAs having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0182] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0183] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 423, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 424:
TABLE-US-00025 (SEQ ID NO: 423) 5′-CAUGAAGGGCAUAAACUAZ.sub.31-3′; (SEQ ID NO: 424) 5′-Z.sub.32UAGUUUAUGCCCUUCAUG-3′,
[0184] wherein, Z.sub.32 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.31 is selected from A, U, G, or C, and Z.sub.32 is a nucleotide complementary to Z.sub.31; in some embodiments, Z.sub.31 is U, and Z.sub.32 is A.
[0185] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0186] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I; and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 421 in the target mRNA and has the same length as the nucleotide sequence IV.
[0187] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is A, and the base of the nucleotide sequence IV is U; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GA, and the base composition of the nucleotide sequence IV is UC; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is AGA, and the base composition of the nucleotide sequence IV is UCU; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is UAGA, and the base composition of the nucleotide sequence IV is UCUA; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GA, and the base composition of the nucleotide sequence IV is UC; in this case, the length ratio of the sense strand and the anti sense strand thereof is 21/21.
[0188] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0189] Ninth siRNA
[0190] According to the present disclosure, the siRNA may be a ninth siRNA.
[0191] The ninth siRNA comprises a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein the sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are at least partly reverse complementary to form a double-stranded region; wherein the nucleotide sequence I has the same length as the nucleotide sequence as shown by SEQ ID NO: 481 with no more than 3 nucleotide differences therebetween, and the nucleotide sequence II has the same length as the nucleotide sequence as shown by SEQ ID NO: 482 with no more than 3 nucleotide differences therebetween:
TABLE-US-00026 (SEQ ID NO: 481) 5′-GGAUUCUGGAGAAAACUCZ.sub.33-3′; (SEQ ID NO: 482) 5′-Z.sub.34GAGUUUUCUCCAGAAUCC-3′,
[0192] wherein, Z.sub.33 is A and Z.sub.34 is U, and the nucleotide sequence I comprises a nucleotide Z.sub.35 at the position corresponding to Z.sub.33; the nucleotide sequence II comprises a nucleotide Z.sub.36 at the position corresponding to Z.sub.34, wherein Z.sub.36 is the first nucleotide at 5′ terminal of the antisense strand.
[0193] In some embodiments, the sense strand comprises only the nucleotide sequence I, and the antisense strand comprises only the nucleotide sequence II.
[0194] In some embodiments, there is no more than 1 nucleotide difference between the nucleotide sequence I and the nucleotide sequence as shown by SEQ ID NO: 481, and/or there is no more than 1 nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 482.
[0195] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence as shown by SEQ ID NO: 482 includes a difference at the position Z.sub.36, where Z.sub.36 is selected from A, C or G. In some embodiments, the nucleotide difference is a difference at the position Z.sub.36, wherein Z.sub.36 is selected from A, C or G. In some embodiments, Z.sub.35 is a nucleotide complementary to Z.sub.36. The siRNA having these nucleotide differences also exhibit high capacity to inhibit the target mRNA, and thus these siRNAs comprising the nucleotide differences are also within the protection scope of the present disclosure.
[0196] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary to each other.
[0197] In some embodiments, the nucleotide sequence I is the nucleotide sequence as shown by SEQ ID NO: 483, and the nucleotide sequence II is the nucleotide sequence as shown by SEQ ID NO: 484:
TABLE-US-00027 (SEQ ID NO: 483) 5′-GGAUUCUGGAGAAAACUCZ.sub.35-3′; (SEQ ID NO: 484) 5′-Z.sub.36GAGUUUUCUCCAGAAUCC-3′,
[0198] wherein, Z.sub.36 is the first nucleotide at 5′ terminal of the antisense strand, Z.sub.35 is selected from A, U, G, or C, and Z.sub.36 is a nucleotide complementary to Z.sub.35; in some embodiments, Z.sub.35 is A, and Z.sub.36 1S U.
[0199] Moreover, the sense strand and the antisense strand have the same or different length, wherein the sense strand has a length of 19 to 23 nucleotides, and the antisense strand has a length of 19 to 26 nucleotides.
[0200] In some embodiments, the sense strand further comprises a nucleotide sequence III, the antisense strand further comprises a nucleotide sequence IV, and the nucleotide sequence III and the nucleotide sequence IV independently of each other have a length of 1 to 4 nucleotides; the nucleotide sequence III and the nucleotide sequence IV have the same length and are substantially reverse complementary or completely reverse complementary to each other; the nucleotide sequence III is linked to the 5′ terminal of the nucleotide sequence I, and the nucleotide sequence IV is linked to the 3′ terminal of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV is substantially reverse complementary, or completely reverse complementary to a second nucleotide sequence, which refers to a nucleotide sequence that is adjacent to the 5′ terminal of the nucleotide sequence as shown by SEQ ID NO: 481 in the target mRNA and has the same length as the nucleotide sequence IV.
[0201] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotide sequence III and the nucleotide sequence IV both have a length of 1 nucleotide, and the base of the nucleotide sequence III is U, and the base of the nucleotide sequence IV is A; in this case, the length ratio of the sense strand and the antisense strand thereof is 20/20; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CU, and the base composition of the nucleotide sequence IV is AG; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 3 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is ACU, and the base composition of the nucleotide sequence IV is AGU; in this case, the length ratio of the sense strand and the antisense strand thereof is 22/22; or, the nucleotide sequence III and the nucleotide sequence IV both have a length of 4 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is GACU, and the base composition of the nucleotide sequence IV is AGUC; in this case, the length ratio of the sense strand and the antisense strand thereof is 23/23. In some embodiments, the nucleotide sequence III and the nucleotide sequence IV have a length of 2 nucleotides, and in the direction from 5′ terminal to 3′ terminal, the base composition of the nucleotide sequence III is CU, and the base composition of the nucleotide sequence IV is AG; in this case, the length ratio of the sense strand and the antisense strand thereof is 21/21.
[0202] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary. Hence, where the base(s) of nucleotide sequence III is(are) provided, the base(s) of nucleotide sequence IV is(are) also determined.
[0203] The following description regarding the nucleotide sequence V, the nucleic acid sequence, or the nucleotide modification and the modified sequence in the siRNA is applicable to any one of the above-mentioned first siRNA to the ninth siRNA. Namely, unless stated otherwise, the following description of the siRNA should be regarded as the description of the first, second, third, fourth, fifth, sixth, seventh, eighth, and ninth siRNAs one by one. For example, if no particular siRNA is specifically indicated, “the siRNA further comprises a nucleotide sequence V” means “the first siRNA, the second siRNA, the third siRNA, the fourth siRNA, the fifth siRNA, the sixth siRNA, the seventh siRNA, the eighth siRNA, or the ninth siRNA further comprises a nucleotide sequence V”.
[0204] In some embodiments, the antisense strand further comprises a nucleotide sequence V. The nucleotide sequence V has a length of 1 to 3 nucleotides and is linked to 3′ terminal of the antisense strand, thereby forming a 3′ overhang of the antisense strand. In this case, the length ratio of the sense strand and the antisense strand of the siRNA of the present disclosure may be 19/20, 19/21, 19/22, 20/21, 20/22, 20/23, 21/22, 21/23, 21/24, 22/23, 22/24, 22/25, 23/24, 23/25, or 23/26. In some embodiments, the nucleotide sequence V has a length of 2 nucleotides. In this case, the length ratio of the sense strand and the antisense strand of the siRNA of the present disclosure may be 19/21, 21/23 or 23/25.
[0205] Each nucleotide in the nucleotide sequence V may be any nucleotide. In order to facilitate the synthesis and to save synthesis cost, the nucleotide sequence V is 2 consecutive thymine deoxyribonucleotides (dTdT) or 2 consecutive uracil ribonucleotides (UU); or, in order to enhance the affinity between the antisense strand of the siRNA and the target mRNA, the nucleotide sequence V is complementary to the nucleotides at the corresponding positions of the target mRNA. Thus, in some embodiments, the length ratio of the sense strand and the antisense strand of the siRNA of the present disclosure is 19/21 or 21/23. In this case, the siRNA of the present disclosure exhibits better activity for silencing the target mRNA.
[0206] The nucleotides at the corresponding positions of the target mRNA refer to the nucleotides or nucleotide sequence adjacent to 5′ terminal of a segment of the nucleotide sequence of the target mRNA. This segment of the nucleotide sequence of the target mRNA refers to the segment of the nucleotide sequence which is substantially reverse complementary or completely reverse complementary to the nucleotide sequence II, or is substantially reverse complementary or completely reverse complementary to the nucleotide sequence consisting of the nucleotide sequence II and the nucleotide sequence IV.
[0207] In some embodiments, for the first siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 5, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 6:
TABLE-US-00028 (SEQ ID NO: 5) 5′-GGGUAUUCUUUCAAGCAAZ.sub.3-3′; (SEQ ID NO: 6) 5′-Z.sub.4UUGCUUGAAAGAAUACCCAG-3′;
[0208] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 7, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 8:
TABLE-US-00029 (SEQ ID NO: 7) 5′-CUGGGUAUUCUUUCAAGCAAZ.sub.3-3′; (SEQ ID NO: 8) 5′-Z.sub.4UUGCUUGAAAGAAUACCCAGAA-3′;
[0209] wherein, Z.sub.4 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.3 is selected from A, U, G or C, and Z.sub.4 is a nucleotide complementary to Z.sub.3.
[0210] In some embodiments, for the second siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 65, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 66:
TABLE-US-00030 (SEQ ID NO: 65) 5′-GGCAUAAACUAUAACAGCZ.sub.7-3′; (SEQ ID NO: 66) 5′-Z.sub.8GCUGUUAUAGUUUAUGCCCU-3′,
[0211] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 67, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 68:
TABLE-US-00031 (SEQ ID NO: 67) 5′-AGGGCAUAAACUAUAACAGCZ.sub.7-3′; (SEQ ID NO: 68) 5′-Z.sub.8GCUGUUAUAGUUUAUGCCCUUC-3′,
[0212] wherein, Z.sub.8 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.7 is selected from A, U, G or C, and Z.sub.8 is a nucleotide complementary to Z.sub.7.
[0213] In some embodiments, for the third siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 125, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 126:
TABLE-US-00032 (SEQ ID NO: 125) 5′-GCUCAAGAAUGCCAAGAAZ.sub.11-3′; (SEQ ID NO: 126) 5′-Z.sub.12UUCUUGGCAUUCUUGAGCAC-3′,
[0214] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 127, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 128:
TABLE-US-00033 (SEQ ID NO: 127) 5′-GUGCUCAAGAAUGCCAAGAAZ.sub.11-3′; (SEQ ID NO: 128) 5′-Z.sub.12UUCUUGGCAUUCUUGAGCACUC-3′,
[0215] wherein, Z.sub.12 is the first nucleotide at 5′ terminal of the antisense strand; Zii is selected from A, U, G or C, and Z.sub.12 is a nucleotide complementary to Zii.
[0216] In some embodiments, for the fourth siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 185, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 186:
TABLE-US-00034 (SEQ ID NO: 185) 5′-GCAACAAAGACAUUUAUGZ.sub.15-3′; (SEQ ID NO: 186) 5′-Z.sub.16CAUAAAUGUCUUUGUUGCAA-3′,
[0217] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 187, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 188:
TABLE-US-00035 (SEQ ID NO: 187) 5′-UUGCAACAAAGACAUUUAUGZ.sub.15-3′; (SEQ ID NO: 188) 5′-Z.sub.16CAUAAAUGUCUUUGUUGCAAGC-3′,
[0218] wherein, Z.sub.16 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.15 is selected from A, U, G or C, and Z.sub.16 is a nucleotide complementary to Z.sub.15.
[0219] In some embodiments, for the fifth siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 245, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 246:
TABLE-US-00036 (SEQ ID NO: 245) 5′-GAAUCUCAAAGAAAUCUUZ.sub.19-3′; (SEQ ID NO: 246) 5′-Z.sub.20AAGAUUUCUUUGAGAUUCUU-3′,
[0220] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 247, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 248:
TABLE-US-00037 (SEQ ID NO: 247) 5′-AAGAAUCUCAAAGAAAUCUUZ.sub.19-3′; (SEQ ID NO: 248) 5′-Z.sub.20AAGAUUUCUUUGAGAUUCUUUG-3′,
[0221] wherein, Z.sub.20 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.19 is selected from A, U, G or C, and Zzo is a nucleotide complementary to Z.sub.19.
[0222] In some embodiments, for the sixth siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 305, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 306:
TABLE-US-00038 (SEQ ID NO: 305) 5′-GUACGUGGACUGGAUUCUZ.sub.23-3′; (SEQ ID NO: 306) 5′-Z.sub.24AGAAUCCAGUCCACGUACUC-3′,
[0223] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 307, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 308:
TABLE-US-00039 (SEQ ID NO: 307) 5′-GAGUACGUGGACUGGAUUCUZ.sub.23-3′; (SEQ ID NO: 308) 5′-Z.sub.24AGAAUCCAGUCCACGUACUCGA-3′,
[0224] wherein, Z.sub.24 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.23 is selected from A, U, G or C, and Z.sub.24 is a nucleotide complementary to Z.sub.23.
[0225] In some embodiments, for the seventh siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 365, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 366:
TABLE-US-00040 (SEQ ID NO: 365) 5′-AUUUCUGGGUAUUCUUUCZ.sub.27-3′; (SEQ ID NO: 366) 5′-Z.sub.28GAAAGAAUACCCAGAAAUCG-3′,
[0226] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 367, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 368:
TABLE-US-00041 (SEQ ID NO: 367) 5′-CGAUUUCUGGGUAUUCUUUCZ.sub.27-3′; (SEQ ID NO: 368) 5′-Z.sub.28GAAAGAAUACCCAGAAAUCGCU-3′,
[0227] wherein, Z.sub.28 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.27 is selected from A, U, G or C, and Z.sub.28 is a nucleotide complementary to Z.sub.27.
[0228] In some embodiments, for the eighth siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 425, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 426:
TABLE-US-00042 (SEQ ID NO: 425) 5′-CAUGAAGGGCAUAAACUAZ.sub.31-3′; (SEQ ID NO: 426) 5′-Z.sub.32UAGUUUAUGCCCUUCAUGUC-3′,
[0229] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 427, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 428:
TABLE-US-00043 (SEQ ID NO: 427) 5′-GACAUGAAGGGCAUAAACUAZ.sub.31-3′; (SEQ ID NO: 428) 5′-Z.sub.32UAGUUUAUGCCCUUCAUGUCUA-3′,
[0230] wherein, Z.sub.32 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.31 is selected from A, U, G or C, and Z.sub.32 is a nucleotide complementary to Z.sub.31.
[0231] In some embodiments, for the ninth siRNA, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 485, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 486:
TABLE-US-00044 (SEQ ID NO: 485) 5′-GGAUUCUGGAGAAAACUCZ.sub.35-3′; (SEQ ID NO: 486) 5′-Z.sub.36GAGUUUUCUCCAGAAUCCAG-3′,
[0232] or, the sense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 487, and the antisense strand of the siRNA comprises the nucleotide sequence as shown by SEQ ID NO: 488:
TABLE-US-00045 (SEQ ID NO: 487) 5′-CUGGAUUCUGGAGAAAACUCZ.sub.35-3′; (SEQ ID NO: 488) 5′-Z.sub.36GAGUUUUCUCCAGAAUCCAGUC-3′,
[0233] wherein, Z.sub.36 is the first nucleotide at 5′ terminal of the antisense strand; Z.sub.35 is selected from A, U, G or C, and Z.sub.36 is a nucleotide complementary to Z.sub.35.
[0234] In some embodiments, the siRNA of the present disclosure is siFXlal, siFXIa2, siFX1b1, siFXIb2, siFXIc1, siFXIc2, siFXld1, siFXId2, siFXIe1, siFXIe2, siFXIf1, siFXIf2, siFXIg1, siFXIg2, siFXlh1, siFXIh2, siFXli1, or siFXIi2 as shown in Tables 1a to 1i.
[0235] As mentioned above, in the siRNA of the present disclosure, each nucleotide is independently a modified or unmodified nucleotide. In some embodiments, the nucleotide in the siRNA of the present disclosure is an unmodified nucleotide; in some embodiments, in the siRNA of the present disclosure, some or all of the nucleotides are modified necleotides. These modifications on the nucleotide groups would not lead to significant decrease or loss of the functions of the siRNA conjugate of the present disclosure for inhibiting the expression of FXI gene.
[0236] In some embodiments, the siRNA of the present disclosure comprises at least 1 modified nucleotide. In the context of the present disclosure, the term “modified nucleotide” used refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group thereof with other groups, or nucleotide analogue, or a nucleotide with a modified base. The modified nucleotide would not lead to significant impairment or loss of the functions of the siRNA for inhibiting gene expression. For example, the modified nucleotides disclosed in J.K. Watts, G. F. Deleavey and M. J. Damha, Chemically Modified siRNA: tools and applications. Drug Discov Today, 2008.13(19-20): p.842-55 may be selected.
[0237] In some embodiments, at least one nucleotide in the sense strand or the antisense strand of the siRNA of the present disclosure is a modified nucleotide, and/or at least one phosphate group is a phosphate group with modified group(s). In other words, at least a portion of the phosphate and/or ribose groups in the phosphate-ribose backbone of at least one single strand in the sense strand and the antisense strand are phosphate groups with modified groups and/or ribose groups with modified groups.
[0238] In some embodiments, all the nucleotides in the sense strand and/or the antisense strand are modified nucleotides. In some embodiments, each nucleotide in the sense strand and the antisense strand of the siRNA of the present disclosure is independently a fluoro modified nucleotide or a non-fluoro modified nucleotide.
[0239] The inventors of the present disclosure have surprisingly found that the siRNAs of the present disclosure achieve high balance between plasma stability and gene silencing efficiency in animal experiments.
[0240] In some embodiments, the fluoro modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II. Moreover, in the direction from 5′ terminal to 3′ terminal, at least the nucleotides at positions 7, 8 and 9 of the nucleotide sequence I are fluoro modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, at least the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are fluoro modified nucleotides.
[0241] In some embodiments, the fluoro modified nucleotides are located in the nucleotide sequence I and the nucleotide sequence II; and the nucleotide sequence I comprises no more than 5 fluoro modified nucleotides. Moreover, in the direction from 5′ terminal to 3′ terminal, at least the nucleotides at positions 7, 8 and 9 of the nucleotide sequence I are fluoro modified nucleotides; the nucleotide sequence II comprises no more than 7 fluoro modified nucleotides; and al least the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are fluoro modified nucleotides.
[0242] In some embodiments, in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 7, 8 and 9 or at positions 5, 7, 8 and 9 of the nucleotide sequence I in the sense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand are non-fluoro modified nucleotides; in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14, and 16 or at positions 2, 6, 8, 9, 14, and 16 of the nucleotide sequence II in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are non-fluoro modified nucleotides.
[0243] In the context of the present disclosure, a “fluoro modified nucleotide” refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group thereof with a fluorine atom, which has a structure as shown by the following Formula (7). A “non-fluoro modified nucleotide” refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group thereof with a non-fluoro group, or a nucleotide analogue. In some embodiments, each non-fluoro modified nucleotide is independently selected from a nucleotide formed by substituting 2′-hydroxy of the ribose group thereof with a non-fluoro group, or a nucleotide analogue.
[0244] The nucleotides formed by substituting 2′-hydroxy of the ribose group with a non-fluoro group are well-known to those skilled in the art, and can be one selected from the group consisting of 2′-alkoxy modified nucleotides, 2′-substituted alkoxy modified nucleotides, 2′-alkyl modified nucleotides, 2′-substituted alkyl modified nucleotides, 2′-amino modified nucleotides, 2′-substituted amino modified nucleotides, and 2′-deoxy nucleotides.
[0245] In some embodiments, the 2′-alkoxy modified nucleotide is a 2′-methoxy (2′-OMe) modified nucleotide, as shown by Formula (8). In some embodiments, the 2′-substituted alkoxy modified nucleotide is for example a 2′-methoxyethyl (2′-M0E) modified nucleotide, as shown by Formula (9). In some embodiments, the 2′-amino (2′-NH.sub.2) modified nucleotide is as shown by Formula (10). In some embodiments, the 2′-deoxy nucleotide (DNA) is as shown by Formula (11).
##STR00001##
[0246] A nucleotide analogue refers to a group that can replace a nucleotide in a nucleic acid, while structurally differs from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, the nucleotide analogue may be an isonucleotide, a bridged nucleotide or an acyclic nucleotide.
[0247] Abridged nucleic acid (BNA) refers to a constrained or inaccessible nucleotide. BNA can contain a 5-, 6- membered or a 7-membered ring bridged structure with a “fixed” C3′-endo sugar puckering. The bridge is typically incorporated at the 2′- and 4′-positions of the ribose to afford a 2′, 4′-BNA nucleotide. In some embodiments, BNA may be LNA, ENA, cET BNA and so on, which are shown by Formulae (12), (13) and (14), respectively:
##STR00002##
[0248] An acyclic nucleotide refers to a class of nucleotides in which the sugar ring is opened. In some embodiments, the acrylic nucleotide may be an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA), which are as shown by Formulae (15) and (16), respectively:
##STR00003##
[0249] In the above Formulae (15) and (16), R is selected from H, OH or alkoxy (0-alkyl).
[0250] An isonucleotide is a compound formed by changing the position of the base on the ribose ring in the nucleotide. In some embodiments, the isonucleotide may be a compound formed by transposing the base from l′-position to 2′-position or 3′-position on the ribose ring, as shown by Formula (17) or (18), respectively.
##STR00004##
[0251] In the above compounds of Formulae (17)-(18), “Base” represents a base of a nucleic acid, such as A, U, G, C, or T; R is selected from H, OH, F, or the above non-fluoro group.
[0252] In some embodiments, a nucleotide analogue is one selected from the group consisting of isonucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluoro modified nucleotide is a methoxy modified nucleotide. In the context of the present disclosure, the methoxy modified nucleotide refers to a nucleotide formed by substituting 2′-hydroxy of the ribose group with a methoxy group.
[0253] In the context of the disclosure, a “fluoro modified nucleotide”, a “2′-fluoro modified nucleotide”, a “nucleotide in which 2′-hydroxy of a ribose group is substituted with a fluorine atom”, and a “nucleotide with 2′-fluororibosyl” have the same meaning, referring to a compound in which 2′-hydroxy of the nucleotide is substituted with a flurorin atom, which has a structure as shown by Formula (7). A “methoxy modified nucleotide”, a “2′-methoxy modified nucleotide”, a “nucleotide in which 2′-hydroxy of a ribose group is substituted with a methoxy” and a “nucleotide with 2′-methoxyribosyl” have the same meaning, referring to a compound in which 2′-hydroxy of the ribose group in the nucleotide is substituted with a methoxy, which has a structure as shown by Formula (8).
[0254] In some embodiments, the siRNA of the present disclosure is an siRNA with the following modifications: in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 7, 8 and 9 or at positions 5, 7, 8 and 9 of the nucleotide sequence I in the sense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand are methoxy modified nucleotides; the nucleotides at positions 2, 6, 14, and 16 or at positions 2, 6, 8, 9, 14, and 16 of the nucleotide sequence II in the antisense strand are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand are methoxy modified nucleotides.
[0255] In some embodiments, the siRNA of the present disclosure is an siRNA with the following modifications: in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence I in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions of the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of the nucleotide sequence II in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides;
[0256] or, in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 5, 7, 8, and 9 of the nucleotide sequence I in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides;
[0257] or, in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence I in the sense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the sense strand of the siRNA are methoxy modified nucleotides; and in the direction from 5′ terminal to 3′ terminal, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II in the antisense strand of the siRNA are fluoro modified nucleotides, and the nucleotides at the other positions in the antisense strand of the siRNA are methoxy modified nucleotides.
[0258] In some embodiments, the siRNA of the present disclosure is any one of siFXIa1-M1, siFXIa1-M2, siFXIa1-M3, siFXIa2-M1, siFXIa2-M2, siFXIa2-M3, siFXIb1-M1, siFXIb1-M2, siFXIb1-M3, siFXIb2-M1, siFXIb2-M2, siFXIb2-M3, siFXIcl-M1, siFXIcl-M2, siFXIcl-M3, siFXIc2-M1, siFXIc2-M2, siFXIc2-M3, siFXId1-M1, siFXId1-M2, siFXId1-M3, siFXId2-M1, siFXId2-M2, siFXId2-M3, siFXIe1-M1, siFXIe1-M2, siFXIe1-M3, siFXIe2-M1, siFXIe2-M2, siFXIe2-M3, siFXIf1-M1, siFXIf1-M2, siFXIf1-M3, siFXIf2-M1, siFXIf2-M2, siFXIf2-M3, siFXIg1-M1, siFXIg1-M2, siFXIg1-M3, siFXIg2-M1, siFXIg2-M2, siFXIg2-M3, siFXIh1-M1, siFXIh1-M2, siFXIh1-M3, siFXIh2-M1, siFXIh2-M2, siFXIh2-M3, siFXIi1-M1, siFXIi1-M2, siFXIi1-M3, siFXIi2-M1, siFXIi2-M2, and siFXIi2-M3 as shown in Tables 1a to 1i.
[0259] The siRNAs with the above modifications not only have lower costs, but also allow the ribonucleases in the blood to be less liable to cleaving the nucleic acid, thereby increasing the stability of the nucleic acid and rendering the nucleic acid to have stronger resistance against nuclease hydrolysis. Moreover, the siRNAs with the above modifications exhibit higher inhibitory activity against the target mRNA.
[0260] In some embodiments, at least a portion of the phosphate groups in the phosphate-ribose backbone of at least one single strand in the sense strand and the antisense strand of the siRNA of the present disclosure are phosphate groups with modified groups. In some embodiments, the phosphate group with modified group(s) is a phosphorothioate group formed by substituting at least one oxygen atom in a phosphodiester bond in a phosphate group with a sulfur atom. In some embodiments, the phosphate group with modified group(s) is a phosphorothioate group having a structure as shown by Formula (1):
##STR00005##
[0261] This modification can stabilize the double-stranded structure of the siRNA, thereby maintaining high specificity and high affinity of base pairing.
[0262] In some embodiments, in the siRNA of the present disclosure, the phosphorothioate linkage is located in at least one position selected from the group consisting of the following positions: the position between the first and the second nucleotides at either terminal of the sense or antisense strand, the position between the second and the third nucleotides at either terminal of the sense or antisense strand, or any combination thereof. In some embodiments, the phosphorothioate linkage is located in all the above positions except for 5′ terminal of the sense strand. In some embodiments, the phosphorothioate linkage is located in all the above positions except for 3′ terminal of the sense strand. In some embodiments, the phosphorothioate linkage is located in at least one of the following positions:
[0263] the position between the first and second nucleotides at 5′ terminal of the sense strand;
[0264] the position between the second and third nucleotides at 5′ terminal of the sense strand;
[0265] the position between the first and second nucleotides at 3′ terminal of the sense strand;
[0266] the position between the second and third nucleotides at 3′ terminal of the sense strand;
[0267] the position between the first and second nucleotides at 5′ terminal of the antisense strand;
[0268] the position between the second and third nucleotides at 5′ terminal of the antisense strand;
[0269] the position between the first and second nucleotides at 3′ terminal of the antisense strand; and
[0270] the position between the second and third nucleotides at 3′ terminal of the antisense strand.
[0271] In some embodiments, the siRNA of the present disclosure is any one of siFXIa1-M1S, siFXIa1-M2S, siFXIa1-M3S, siFXIa2-M1S, siFXIa2-M2S, siFXIa2-M3S, siFXIb1-M1S, siFXIb1-M2S, siFXIb1-M3S, siFXIb2-M1S, siFXIb2-M2S, siFXIb2-M3S, siFXIc1-M1S, siFXIc1-M2S, siFXIc1-M3S, siFXIc2-M1S, siFXIc2-M2S, siFXIc2-M3S, siFXId1-M1S, siFXId1-M2S, siFXId1-M3S, siFXId2-M1S, siFXId2-M2S, siFXId2-M3S, siFXIe1-M1S, siFXIe1-M2S, siFXIe1-M3S, siFXIe2-M1S, siFXIe2-M2S, siFXIe2-M3S, siFXIf1-M1S, siFXIf1-M2S, siFXIf1-M3S, siFXIf2-M1S, siFXIf2-M2S, siFXIf2-M3S, siFXIg1-M1S, siFXIg1-M2S, siFXIg1-M3S, siFXIg2-M1S, siFXIg2-M2S, siFXIg2-M3S, siFXIh1-M1S, siFXIh1-M2S, siFXIh1-M3S, siFXIh2-M1S, siFXIh2-M2S, siFXIh2-M3S, FXIi1-M1S, siFXIi1-M2S, siFXIi1-M3S, siFXIi2-M1S, siFXIi2-M2S, and siFXIi2-M3S as shown in Tables 1a to 1i.
[0272] In some embodiments, the nucleotide at 5′-terminal in the antisense strand of the siRNA is a 5′-phosphate nucleotide or a 5″-phosphate analogue modified nucleotide.
[0273] The commonly used 5′-phosphate nucleotides or 5′-phosphate analogue modified nucleotides are well known to those skilled in the art. For example, the 5′-phosphate nucleotides may have the following structure:
##STR00006##
as another example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48 discloses the following four 5′-phosphate analogue modified nucleotides:
##STR00007##
wherein R is selected from H, OH, methoxy, and F;
[0274] “Base” represents a nucleic acid base selected from A, U, C, G, or T.
[0275] In some embodiments, the 5′-phosphate nucleotide is a nucleotide with 5′-phosphate modification as shown by Formula (2); the 5′-phosphate analogue modified nucleotide is a nucleotide with vinylphosphonate modification as shown by Formula (3), or a phosphorothioate modified nucleotide as shown by Formula (5).
[0276] In some embodiments, the siRNA of the present disclosure is any one of siFXIa1-M1P1, siFXIa1-M2P1, siFXIa1-M3P1, siFXIa2-M1P1, siFXIa2-M2P1, siFXIa2-M3P1, siFXIa1-M1SP1, siFXIa1-M2SP1, siFXIa1-M3SP1, siFXIa2-M1SP1, siFXIa2-M2SP1, siFXIa2-M3SP1, siFXIb1-M1P1, siFXIb1-M2P1, siFXIb1-M3P1, siFXIb2-M1P1, siFXIb2-M2P1, siFXIb2-M3P1, siFXIb1-M1SP1, siFXIb1-M2SP1, siFXIb1-M3SP1, siFXIb2-M1SP1, siFXIb2-M2SP1, siFXIb2-M3SP1, siFXIc1-M1P1, siFXIc1-M2P1, siFXIc1-M3P1, siFXIc2-M1P1, siFXIc2-M2P1, siFXIc2-M3P1, siFXIc1-M1SP1, siFXIc1-M2SP1, siFXIc1-M3SP1, siFXIc2-M1SP1, siFXIc2-M2SP1, siFXIc2-M3SP1, siFXId1-M1P1, siFXId1-M2P1, siFXId1-M3P1, siFXId2-M1P1, siFXId2-M2P1, siFXId2-M3P1, siFXId1-M1SP1, siFXId1-M2SP1, siFXId1-M3SP1, siFXId2-M1SP1, siFXId2-M2SP1, siFXId2-M3SP1, siFXIe1-M1P1, siFXIe1-M2P1, siFXIe1-M3P1, siFXIe2-M1P1, siFXIe2-M2P1, siFXIe2-M3P1, siFXIe1-M1SP1, siFXIe1-M2SP1, siFXIe1-M3SP1, siFXIe2-M1SP1, siFXIe2-M2SP1, siFXIe2-M3SP1, siFXIf1-M1P1, siFXIf1-M2P1, siFXIf1-M3P1, siFXIf2-M1P1, siFXIf2-M2P1, siFXIf2-M3P1, siFXIf1-M1SP1, siFXIf1-M2SP1, siFXIf1-M3SP1, siFXIf2-M1SP1, siFXIf2-M2SP1, siFXIf2-M3SP1, siFXIg1-M1P1, siFXIg1-M2P1, siFXIg1-M3P1, siFXIg2-M1P1, siFXIg2-M2P1, siFXIg2-M3P1, siFXIg1-M1SP1, siFXIg1-M2SP1, siFXIg1-M3SP1, siFXIg2-M1SP1, siFXIg2-M2SP1, siFXIg2-M3SP1, siFXIh1-M1P1, siFXIh1-M2P1, siFXIh1-M3P1, siFXIh2-M1P1, siFXIh2-M2P1, siFXIh2-M3P1, siFXIh1-M1SP1, siFXIh1-M2SP1, siFXIh1-M3SP1, siFXIh2-M1SP1, siFXIh2-M2SP1, siFXIh2-M3SP1, FXIi1-M1P1, siFXli1-M2P1, siFXli1-M3P1, siFXIi2-M1P1, siFXli2-M2P1, siFXli2-M3P1, siFXli1-M1SP1, siFXli1-M2SP1, siFXli1-M3SP1, siFXIi2-M1SP1, siFXIi2-M2SP1, and siFXIi2-M3SP1 as shown in Tables 1a to 1i.
[0277] The inventors of the present disclosure have surprisingly found that the aboe siRNAs of the present disclosure have significantly enhanced plasma and lysosomal stability, while displaying high target mRNA inhibitory activity.
[0278] The siRNAs of the present disclosure can be obtained by conventional methods for preparing siRNAs in the art, e.g., solid phase synthesis method and liquid phase synthesis method. Among them, commercial customization services have already been available for solid phase synthesis. A modified nucleotide group can be introduced into the siRNA of the present disclosure by using a nucleotide monomer having the corresponding modification. The method for preparing a nucleotide monomer having the corresponding modification and the method for introducing a modified nucleotide group into an siRNA are also well known to those skilled in the art.
[0279] Pharmaceutical Composition
[0280] The present disclosure provides a pharmaceutical composition, comprising the above siRNA as an active ingredient and a pharmaceutically acceptable carrier.
[0281] The pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, for example, but not limited to, one or more of magnetic nanoparticles (such as Fe.sub.3O.sub.4 and Fe.sub.2O.sub.3-based nanoparticle), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic/glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof.
[0282] In the pharmaceutical composition, there are no special requirements for the contents of the siRNA and the pharmaceutically acceptable carrier. They may be present in any amount conventionally used for each component. In some embodiments, the weight ratio of the siRNA to the pharmaceutically acceptable carrier may be 1: (1-500), and in some embodiments, the above weight ratio is 1: (1-50).
[0283] In some embodiments, the pharmaceutical composition may also contain other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally employed in the art. For example, said other pharmaceutically acceptable excipients may comprise at least one of a pH buffer, a protective agent and an osmotic pressure regulator.
[0284] The pH buffer may be a tris(hydroxymethyl) aminomethane hydrochloride buffer solution with a pH of 7.5-8.5, and/or a phosphate buffer solution with a pH of 5.5-8.5, such as a phosphate buffer solution with a pH of 5.5-8.5.
[0285] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The content of the protective agent may be from 0.01 wt % to 30 wt % based on the total weight of the pharmaceutical composition.
[0286] The osmotic pressure regulator may be sodium chloride and/or potassium chloride. The content of the osmotic pressure regulator renders the osmotic pressure of the pharmaceutical composition to be 200-700 mOsm/kg. Depending on the desired osmotic pressure, those skilled in the art can readily determine the content of the osmotic pressure regulator.
[0287] In some embodiments, the pharmaceutical composition may be a liquid formulation, for example, an injection solution; or a lyophilized powder for injection, which will be mixed with a liquid excipient to form a liquid formulation upon administration. The liquid formulation may be administered by, but not limited to, subcutaneous, intramuscular or intravenous injection, and also may be administered to, but not limited to, lung by spray, or other organ tissues (such as liver) via lung by spray. In some embodiments, the pharmaceutical composition is administered by intravenous injection.
[0288] In some embodiments, the pharmaceutical composition may be in the form of a liposome formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a helper lipid and/or a PEGylated lipid. Therein, the organic amine, the helper lipid and the PEGylated lipid may be respectively selected from one or more of the amine-containing transfection compounds or the pharmaceutically acceptable salts or derivatives thereof, the helper lipids and the PEGylated lipids as described in CN103380113A, which is incorporated herein by reference in its entirety.
[0289] In some embodiments, the organic amine may be a compound as shown by Formula (201) or a pharmaceutically acceptable salt thereof as described in CN103380113A:
##STR00008##
[0290] wherein,
[0291] X.sub.101 and X.sub.102 independently of one another are selected from O, S, N-A or C-A, wherein A is hydrogen or a C.sub.1-C.sub.20 hydrocarbon chain;
[0292] Y.sub.101 and Z.sub.101 independently of one another are selected from C═O, C═S, S═O, CH—OH or SO.sub.2;
[0293] R.sub.101, R102, R103, R104, R105, R106 and R.sub.107 independently of one another are selected from hydrogen; a cyclic or an acyclic, substituted or unsubstituted, branched or linear aliphatic group;
[0294] a cyclic or an acyclic, substituted or unsubstituted, branched or linear heteroaliphatic group; a substituted or unsubstituted, branched or linear acyl group; a substituted or unsubstituted, branched or linear aryl group; and a substituted or unsubstituted, branched or linear heteroaryl group;
[0295] x is an integer of 1-10;
[0296] n is an integer of 1-3, m is an integer of 0-20, p is 0 or 1, wherein if m=p=0, then R.sub.102 is hydrogen; and
[0297] if at least one of n and m is 2, then R.sub.103 and nitrogen in Formula (201) form a structure as shown by Formula (202) or (203):
##STR00009##
[0298] wherein g, e and f independently of one another are an integer of 1-6; “HCC” represents a hydrocarbon chain, and each *N represents a nitrogen atom shown in Formula (201).
[0299] In some embodiments, R.sub.103 is a polyamine. In other embodiments, R103 is a ketal. In some embodiments, R.sub.101 and R.sub.102 in the Formula (201) independently of one another are any substituted or unsubstituted, branched or linear alkyl or alkenyl, wherein the alkyl or alkenyl has 3 to about 20 carbon atoms (such as 8 to about 18 carbon atoms) and 0-4 double bonds (such as 0-2 double bonds).
[0300] In some embodiments, if n and m independently of one another are 1 or 3, R.sub.103 may be any of the following Formulae (204)-(213):
##STR00010##
wherein, in Formulae (204)-(213), g, e and f independently of one another are an integer of 1-6, each “HCC” represents a hydrocarbon chain, and each * represents a potential attachment point of R.sub.103 to the nitrogen atom in Formula (201), wherein each H at any *position can be replaced to achieve the attachment to the nitrogen atom in Formula (201).
[0301] The compound as shown by Formula (201) may be prepared according to the description of CN103380113A.
[0302] In some embodiments, the organic amine is an organic amine as shown by Formula (214) and/or an organic amine as shown by Formula (215):
##STR00011## ##STR00012##
the helper lipid is cholesterol, cholesterol analogs and/or cholesterol derivatives, and
[0303] the PEGylated lipid is 1,2-dipalmitoylamine-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.
[0304] In some embodiments, the molar ratio among the organic amine, the helper lipid, and the PEGylated lipid in the pharmaceutical composition is (19.7-80): (19.7-80): (0.3-50), for example, the molar ratio may be (50-70): (20-40): (3-20).
[0305] In some embodiments, the pharmaceutical composition particles formed by the siRNA of the present disclosure and the above amine-containing transfection reagents have an average diameter from about 30 nm to about 200 nm, typically from about 40 nm to about 135 nm, and more typically, the average diameter of the liposome particles is from about 50 nm to about 120 nm, from about 50 nm to about 100 nm, from about 60 nm to about 90 nm, or from about 70 nm to about 90 nm; for example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150 or 160 nm.
[0306] In some embodiments, in the pharmaceutical composition formed by the siRNA of the present disclosure and the above amine-containing transfection reagents, the weight ratio (weight/weight ratio) of the siRNA to total lipids, e.g., the organic amines, the helper lipids and/or the PEGylated lipids, ranges from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1:18, from about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12, or from about 1:6 to about 1:10. For example, the weight ratio of the siRNA of the present disclosure to total lipids is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.
[0307] In some embodiments, the pharmaceutical composition may be marketed with each component being separate, and used in the form of a liquid formulation. In some embodiments, the pharmaceutical composition formed by the siRNA of the present disclosure and the above pharmaceutically acceptable carrier may be prepared by various known processes, except for replacing the existing siRNA with the siRNA of the present disclosure. In some specific embodiments, the pharmaceutical composition may be prepared according to the following process:
[0308] The organic amines, helper lipids and PEGylated lipids are suspended in alcohol at a molar ratio as described above and mixed homogeneously to yield a lipid solution; the alcohol is used in an amount such that the resultant lipid solution is present at a total mass concentration of 2 to 25 mg/mL (e.g., 8 to 18 mg/mL). The alcohol is a pharmaceutically acceptable alcohol, such as an alcohol that is in liquid form at about room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, polyethylene glycol 200, polyethylene glycol 300, and polyethylene glycol 400, such as ethanol.
[0309] The siRNA of the present disclosure is dissolved in a buffered salt solution to produce an aqueous solution of the siRNA. The buffered salt solution has a concentration of 0.05 to 0.5 M, such as 0.1 to 0.2 M. The pH of the buffered salt solution is adjusted to 4.0 to 5.5, such as 5.0 to 5.2. The buffered salt solution is used in an amount such that the siRNA is present at a concentration of no more than 0.6 mg/ml, such as 0.2 to 0.4 mg/mL. The buffered salt may be one or more selected from the group consisting of soluble acetate and soluble citrate, such as sodium acetate and/or potassium acetate.
[0310] The lipid solution and the aqueous solution of the siRNA are mixed. The product obtained by mixing is incubated at a temperature of 40 to 60° C. for at least 2 minutes (e.g., 5 to 30 minutes) to produce an incubated liposome formulation. The volume ratio of the lipid solution to the aqueous solution of the siRNA is 1: (2-5) (such as 1:4).
[0311] The incubated liposome formulation is concentrated or diluted, and then subjected to impurity removal and sterilization to afford the pharmaceutical composition of the present disclosure, which has the following physicochemical parameters: a pH of 6.5 to 8, an encapsulation percentage of not lower than 80%, a particle size of 40 to 200 nm, a polydispersity index of no greater than 0.30, and an osmotic pressure of 250 to 400 mOsm/kg. For example, the physicochemical parameters may be as follows: a pH of 7.2 to 7.6, an encapsulation percentage of not lower than 90%, a particle size of 60 to 100 nm, a polydispersity index of no greater than 0.20, and an osmotic pressure of 300 to 400 mOsm/kg.
[0312] Therein, the concentration or dilution step may be performed before, after or simultaneously with removal of the impurities. The method for removing impurities may be any of various existing methods, for example, ultrafiltration under 100 kDa using a hollow fiber column, a phosphate buffer (PBS) at pH 7.4 as ultrafiltration exchange solution, and tangential flow system. The method for sterilization may be any of various existing methods, such as filtration sterilization on a 0.22 μm filter.
[0313] siRNA Conjugate
[0314] The present disclosure provides an siRNA conjugate comprising the above siRNA and a conjugation group conjugatively linked to the siRNA.
[0315] Generally speaking, the conjugation group comprises at least one pharmaceutically acceptable targeting group and an optional linker. Moreover, the siRNA, the linker and the targeting group are sequentially linked. In some embodiments, the nubmer of the targeting groups is 1 to 6. In some embodiments, the number of traget groups is 2 to 4. The siRNA molecule may be non-covalently or covalently conjugated to the conjugation group, for example the siRNA molecule may be covalently conjugated to the conjugation group. The conjugation site between the siRNA and the conjugation group can be at 3′ terminal or 5′ terminal of the sense strand of the siRNA, or at 5′ terminal of the antisense strand of the siRNA, and can be within the internal sequence of the siRNA. In some embodiments, the conjugation site between the siRNA and the conjugation group is at 3′ terminal of the sense strand of the siRNA.
[0316] In some embodiments, the conjugation group may be linked to the phosphate group, the 2′-hydroxy or the base of a nucleotide. In some embodiments, the conjugation group may also be linked to the 3′-hydroxy group when the nucleotides are linked via a 2′-5′-phosphodiester bond. When the conjugation group is linked to a terminal of the siRNA strand, the conjugation group is typically linked to the phosphate group of a nucleotide; when the conjugation group is linked to an internal sequence of the siRNA, the conjugation group is typically linked to a ribose ring or a base. For variou linking modes, reference may be made to: Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.
[0317] In some embodiments, the siRNA and the conjugation group can be linked by an acid-labile or reducible chemical bond, and these chemical bonds can be degraded under the acidic environment of cell endosomes, thereby making the siRNA to be in free state. For non-degradable conjugation modes, the conjugation group can be linked to the sense strand of the siRNA, thereby minimizing the effect of conjugation on the activity of the siRNA.
[0318] In some embodiments, the pharmaceutically acceptable targeting group may be a ligand conventionally used in the field of siRNA administration, for example, various ligands as described in WO2009082607A2, which is incorporated herein by reference in its entirety.
[0319] In some embodiments, the pharmaceutically acceptable targeting group may be selected from one or more of the ligands formed by the following targeting molecules or derivatives thereof: lipophilic molecules, such as cholesterol, bile acids, vitamins (such as vitamin E), lipid molecules with different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as cell-penetrating peptide; aptamers; antibodies; quantum dots; saccharides, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folate; or receptor ligands expressed in hepatic parenchymal cells, such as asialoglycoprotein, asialo-sugar residue, lipoproteins (such as high density lipoprotein, low density lipoprotein and the like), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin and the like.
[0320] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a surface receptor of a hepatocyte. In some embodiments, at least one ligand is a ligand capable of binding to a surface receptor of a mammalian hepatocyte. In some embodiments, at least one ligand is a ligand capable of binding to a surface receptor of a human hepatocyte. In some embodiments, at least one ligand is a ligand capable of binding to an asialoglycoprotein receptor (ASGPR) on the surface of hepatocytes. The types of these ligands are well-known to those skilled in the art and they typically serve the function of binding to specific receptor on the surface of the target cell, thereby mediating delivery of the siRNA linked to the ligand into the target cell.
[0321] In some embodiments, the pharmaceutically acceptable targeting group may be any ligand that has affinity to the asialoglycoprotein receptors (ASGPR) on the surface of mammalian hepatocytes. In some embodiments, each ligand is independently an asialoglycoprotein, such as asialoorosomucoid (ASOR) or asialofetuin (ASF). In some embodiments, the ligand is a saccharide or its derivatives.
[0322] In some embodiments, at least one ligand is a saccharide. In some embodiments, each ligand is a saccharide. In some embodiments, at least one ligand is a monosaccharide, polysaccharide, modified monosaccharide, modified polysaccharide, or saccharide derivative. In some embodiments, at least one ligand may be a monosaccharide, disaccharide or trisaccharide. In some embodiments, at least one ligand is a modified saccharide. In some embodiments, each ligand is a modified saccharide. In some embodiments, each ligand is independently selected from a polysaccharide, modified polysaccharide, monosaccharide, modified monosaccharide, polysaccharide derivative, and monosaccharide derivative. In some embodiments, each ligand or at least one ligand is selected from the group consisting of glucose and its derivatives, mannose and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives, and sialic acid.
[0323] In some embodiments, each ligand may be independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-i sobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-0-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose. Other options of the ligand may be found, for example, in the disclosure of CN105378082A, which is incorporated herein by reference in its entirety.
[0324] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate may be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecules may be be mono-, bi-, tri-, or tetra-valent. It should be understood that the terms mono-, bi-, tri-, or tetra-valent described herein respectively mean that the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3 or 1:4, wherein the siRNA conjugate is formed from the siRNA molecule and the conjugation group containing galactose or N-acetylgalactosamine molecule as the targeting group. In some embodiments, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA of the present disclosure is conjugated to a conjugation group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA of the present disclosure is conjugated to a conjugation group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.
[0325] The targeting group can be linked to the siRNA molecule via an appropriate linker, and the appropriate linker can be selected by those skilled in the art according to the specific type of the targeting group. The types of these linkers and targeting groups and the linking modes with the siRNA may be found in the disclosure of WO2015006740A2, which is incorporated herein by reference in its entirety.
[0326] In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker may have the following structure as shown by Formula (301):
##STR00013##
wherein, [0327] k is an integer of 1-3; [0328] L.sup.A is an amide bond-comprising chain moiety that has a structure as shown by Formula (302), and each L.sup.A is respectively linked to the targeting group and the L.sup.C moiety through an ether bond at its two terminals:
##STR00014## [0329] L.sup.B is a N-acylpyrrolidine-comprising chain moiety that has a structure as shown by Formula (303), wherein the chain moity has a carbonyl group at its one terminal and is linked to the L.sup.C moiety through an amide bond, and has an oxy group at the other terminal and is linked to the siRNA via a phosphoester bond:
##STR00015## [0330] L.sup.C is a bivalent to tetravalent linking group based on hydroxymethyl aminomethane, dihydroxymethyl aminomethane or trihydroxymethyl aminomethane, and L.sup.C is linked to each L.sup.A moiety through an ether bond via an oxygen atom, and is linked to L.sup.B moiety through an [0331] amide bond via a nitrogen atom.
[0332] In some embodiments, when n=3 and L.sup.C is a tetravalent linking group based on trihydroxymethyl aminomethane, the siRNA conjugate formed by linking N-acetylgalactosamine molecules with an siRNA molecule via -(L.sup.A).sub.3-trihydroxymethyl aminomethane-L.sup.B-as a linker has a structure as shown by Formula (304):
##STR00016##
wherein the double helix structure represents the siRNA.
[0333] Likewise, the conjugation site between the siRNA and the conjugation group can be at 3′-terminal or 5′-terminal of the sense strand of the siRNA, or at 5′-terminal of the antisense strand, or within the internal sequence of the siRNA.
[0334] In some embodiments, the 3′-terminal of the sense strand of the siRNA of the present disclosure is covalently conjugated to three N-acetyl gal actosamine (GalNAc) molecules via a linker -(L.sup.A).sub.3-trihydroxymethyl aminomethane-L.sup.B-, to afford an siRNA conjugate in which the molar ratio of the siRNA molecule to the GaINAc molecule is 1:3 (hereinafter also referred to as (GaINAc)3-siRNA), and this siRNA conjugate has a structure as shown by Formula (305):
##STR00017##
wherein the double helix structure represents the siRNA; and the linker is linked to 3′-terminal of the sense strand of the siRNA.
[0335] In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker may has a structure as shown by Formula (306):
##STR00018##
wherein, [0336] 1 is an integer of 0-3; [0337] *represents a site on the linker linked to the targeting group via an ether bond; and [0338] #represents a site on the linker linked to the siRNA via a phosphoester bond.
[0339] In some embodiments, when 1=2, the siRNA conjugate has a structure as shown by Formula (307):
##STR00019##
wherein, the double helix structure represents the siRNA; and the linker is linked to 3′-terminal of the sense strand of the siRNA.
[0340] The above conjugates can be synthesized according to the method described in detail in the prior art. For example, WO2015006740 A2 describes in detail the preparation methods of various conjugates. The siRNA conjugate of the present disclosure may be obtained by the methods well-known to those skilled in the art. For example, WO2014025805A1 describes the preparation method of the conjugate having the structure as shown by Formula (305). Rajeev et al., ChemBioChem 2015, 16, 903-908 describes the preparation method of the conjugate having the structure as shown by Formula (307).
[0341] In some embodiments, the siRNA conjugate has a structure as shown by Formula (308):
##STR00020##
wherein, [0342] n1 is an integer of 1-3, and n3 is an integer of 0-4; [0343] m1, m2, and m3 independently of one another are an integer of 2-10; [0344] R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R15 independently of one another are H, or selected from the group consisting of C.sub.1-C.sub.10 alkyl, C.sub.1-C.sub.10 haloalkyl, and C.sub.1-C.sub.10 alkoxy, [0345] R.sub.3 is a group having a structure as shown by Formula (A59):
##STR00021##
wherein E.sub.1 is OH, SH or BH.sub.2; and Nu is the siRNA of the present disclosure;
[0346] R.sub.2 is a linear alkylene of 1 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with any one or more groups selected from the group consisting of: C(O), NH, O, S, CH═N, S(O).sub.2, C.sub.2-C.sub.10 alkenylene, C.sub.2-C.sub.10 alkynylene, C.sub.6-C.sub.10 arylene, C.sub.3-C.sub.18 heterocyclylene, and C.sub.5-C.sub.10 heteroarylene, and wherein R.sub.2 optionally has any one or more substituents selected from the group consisting of: C.sub.1-C.sub.10 alkyl, C.sub.6-C.sub.10 aryl, C.sub.5-C.sub.10 heteroaryl, C.sub.1-C.sub.10 haloalkyl, —OC.sub.1-C.sub.10 alkyl, —OC.sub.1-C.sub.10 alkylphenyl, alkyl-OH, haloalkyl, —SC.sub.1-C.sub.10 alkyl, —SC.sub.1-C.sub.10 alkylphenyl, —C.sub.1-C.sub.10 alkyl-SH, —SC.sub.1-C.sub.10 haloalkyl, halo, —OH, —SH, —NH.sub.2, —C.sub.1-C.sub.10 alkyl-NH.sub.2, —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —NH(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkylphenyl), —NH(C.sub.1-C.sub.10 alkylphenyl), cyano, nitro, -CO.sub.2H, —C(O)O(C.sub.1-C.sub.10) alkyl, —CON(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —CONH(C.sub.1-C.sub.10 alkyl), —CONH.sub.2, —NHC(O)(C.sub.1-C.sub.10 alkyl), —NHC(O)(phenyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(C.sub.1-C.sub.10 alkyl), alkyl)C(O)(phenyl), —C(O)C.sub.1-C.sub.10 alkyl, —C(O)C.sub.1-C.sub.10 alkylphenyl, —C(O)C.sub.1-C.sub.10 haloalkyl, —OC(O)C.sub.1-C.sub.10 alkyl, —SO.sub.2(C.sub.1-C.sub.10 alkyl), —SO.sub.2(phenyl), —SO.sub.2(C.sub.1-C.sub.10 haloalkyl), —SO.sub.2NH.sub.2, —SO.sub.2NH(C.sub.1-C.sub.10 alkyl), —SO.sub.2NH(phenyl), —NHSO(C.sub.1-C.sub.10 alkyl), —NHSO(phenyl), and —NHSO.sub.2(C.sub.1-C.sub.10 haloalkyl);
[0347] each L.sub.1 is a linear alkylene of 1 to 70 carbon atoms in length, wherein one or more carbon atoms are optionally replaced with any one or more groups selected from the group consisting of: C(O), NH, O, S, CH═N, S(O).sub.2, C2-C.sub.10 alkenylene, C2-C.sub.10 alkynylene, C.sub.6-C.sub.10 arylene, C.sub.3-C.sub.18 heterocyclylene, and C.sub.5-C.sub.10 heteroarylene, and wherein L.sub.1 optionally has any one or more substituents selected from the group consisting of: C.sub.1-C.sub.10 alkyl, C.sub.6-C.sub.10 aryl, C5-C10 heteroaryl, Ci-C.sub.10 haloalkyl, —OC.sub.1-C.sub.10 alkyl, —OC1-C.sub.10 alkylphenyl, —C.sub.1-C.sub.10 alkyl-OH, —OC.sub.1-C.sub.10 haloalkyl, —SC.sub.1-C.sub.10 alkyl, —SC.sub.1-C.sub.10 alkylphenyl, haloalkyl, halo, —OH, —SH, —NH.sub.2, —C.sub.1-C.sub.10 alkyl-NH.sub.2, —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —NH(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkylphenyl), —NH(C.sub.1-C.sub.10 alkylphenyl), cyano, nitro, -CO.sub.2H, —C(O)O(C.sub.1-C.sub.10 alkyl), —CON(C.sub.1-C.sub.10 alkyl)(C.sub.1-C.sub.10 alkyl), —CONH(C.sub.1-C.sub.10 alkyl), —CONH.sub.2, —NHC(O)(C.sub.1-C.sub.10 alkyl), —NHC(O)(phenyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(C.sub.1-C.sub.10 alkyl), —N(C.sub.1-C.sub.10 alkyl)C(O)(phenyl), —C(O)C.sub.1-C.sub.10 alkyl, —C(O)C.sub.1-C.sub.10 alkylphenyl, —C(O)C.sub.1-C.sub.10 haloalkyl, —OC(O)C.sub.1-C.sub.10 alkyl, —SO.sub.2(C.sub.1-C.sub.10 alkyl), —SO.sub.2(phenyl), —SO.sub.2(C.sub.1-C.sub.10 haloalkyl), —SO.sub.2NH.sub.2, —SO.sub.2NH(C.sub.1-C.sub.10 alkyl), —SO.sub.2NH(phenyl), —NHSO(C.sub.1-C.sub.10 alkyl), —NHSO(phenyl), and —NHSO.sub.2(C.sub.1-C.sub.10 haloalkyl).
[0348] In some embodiments, L.sub.1 may be selected from the group consisting of the groups of Formulae (A1)-(A26) or any combination thereof, wherein the structures and definitions of A1-A26 are as follows:
##STR00022## ##STR00023## ##STR00024##
wherein j 1 is an integer of 1-20; [0349] j.sub.2 is an integer of 1-20; [0350] R′ is a C.sub.1-C.sub.10 alkyl; [0351] Ra is selected from the group consisting of the groups of Formulae (A27)-(A45) or any combination thereof:
##STR00025## ##STR00026## ##STR00027##
[0352] Rb is a C.sub.1-C.sub.10 alkyl; and
[0353] represents the site at which a group is covalently linked.
[0354] Those skilled in the art would understand that, though L.sub.1 is defined as a linear alkyl for convenience, but it may not be a linear group or be named differently, such as an amine or alkenyl produced by the above replacement and/or substitution. For the purpose of the present disclosure, the length of L.sub.1 is the number of the atoms in the chain linking the two attachment points. For this purpose, a ring obtained by replacing a carbon atom in the linear alkylene, such as a heterocyclylene or heteroarylene, is counted as one atom.
[0355] M.sub.1 represents a targeting group, of which the definitions and options are the same as those of the above targeting groups. In some embodiments, each M.sub.1 is independently one selected from the ligands that have affinity to the asialoglycoprotein receptor on the surface of mammalian hepatocytes.
[0356] When M.sub.1 is a ligand that has affinity to the asialoglycoprotein receptor on the surface of mammalian hepatocyte, in some embodiments, n1 may be an integer of 1-3, and n3 may be an integer of 0-4 to ensure that the number of the M.sub.1 targeting group in the conjugate may be at least 2. In some embodiments, n1+n3≥2, such that the number of the M.sub.1 targeting group is at least 3, thereby rendering the M.sub.1 targeting group to more easily bind to the asialoglycoprotein receptor on the surface of hepatocytes, which may facilitates the endocytosis of the conjugate into cells. Experiments have shown that when the number of the M.sub.1 targeting groups is greater than 3, the ease of the binding between the M.sub.1 targeting groups and the asialoglycoprotein receptor on the surface of hepatocytes is not significantly increased. Therefore, in view of various aspects such as synthesis convenience, structure/process costs and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3 =2−3.
[0357] In some embodiments, when ml, m2, and m3 independently of one another are an integer selected from 2-10, the steric positions among many M.sub.1 targeting groups may be suitable for the binding between the M.sub.1 targeting groups and the asialoglycoprotein receptor on the surface of hepatocytes. In order to make the conjugate of the present disclosure have simpler structure, easier synthesis and/or reduced cost, in some embodiments, m1, m2 and m3 independently of one another are an integer of 2-5; in some embodiments, m1=m2=m3.
[0358] Those skilled in the art would understand that when R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, or R.sub.15 independently of one another is one selected from H, C.sub.1-C.sub.10 alkyl, C.sub.1-C.sub.10 haloalkyl, and C.sub.1-C.sub.10 alkoxy, they would not change the properties of the conjugate of the present disclosure and could all achieve the purpose of the present disclosure. In some embodiments, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, or R.sub.15 independently of one another are selected from H, methyl and ethyl. In some embodiments, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 are H.
[0359] R.sub.3 is a group having the structure as shown by Formula A59, wherein E.sub.1 is OH, SH or BH.sub.2, and considering the easy availability of the starting materials, in some embodiments, E.sub.1 is OH or SH.
[0360] R.sub.2 is selected to achieve the linkage between the group as shown by Formula A59 and the N atom on a nitrogenous backbone. In the context of the present disclosure, a “nitrogenous backbone” refers to a chain structure in which the N atom are coadjacently linked to the carbon atoms to which R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 are attached. Therefore, R.sub.2 may be any linking group capable of linking the group as shown by Formula (A59) to the N atom on the nitrogenous backbone by suitable means. In some embodiments, in the case where the siRNA conjugate as shown by Formula (308) is prepared by a solid phase synthesis process, R.sub.2 group needs to have both a site linking to the N atom on the nitrogenous backbone and a site linking to the P atom in R.sub.3. In some embodiments, in R.sub.2, the site linking to the N atom on the nitrogenous backbone forms an amide bond with the N atom, and the site linking to the P atom in R.sub.3 forms a phosphoester bond with the P atom. In some embodiments, R.sub.2 may be B5, B6, B5′, or B6′:
##STR00028##
wherein represents the site where the group is covalently linked;
[0361] q.sub.2 may be an integer of 1-10; in some embodiments, q2 is an integer of 1-5.
[0362] L.sub.1 is used to link the M.sub.1 targeting group to the N atom on the nitrogenous backbone, thereby providing liver targeting function for the siRNA conjugate as shown by Formula (308). In some embodiments, L.sub.1 is selected from the connection combinations of one or more of the groups of Formulae (A1)-(A26). In some embodiments, L.sub.1 is selected from the connection combinations of one or more of Formulae (A1), (A4), (A5), (A6), (A8), (A10), (A11), and (A13). In some embodiments, L.sub.1 is selected from the connection combinations of at least two of Formulae (A1), (A4), (A8), (A10), and (A11). In some embodiments, L.sub.1 is selected from the connection combinations of at least two of Formulae (A1), (A8) and (A10).
[0363] In some embodiments, L.sub.1 may have a length of 3 to 25, 3 to 20, 4 to 15 or 5 to 12 atoms. In some embodiments, L.sub.1 has a length of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or 60 atoms.
[0364] In some embodiments, L.sub.1 is an integer of 2-10, and in some embodiments, j1 is an integer of 3-5. In some embodiments, j2 is an integer of 2-10, and in some embodiments, j2 is an integer of 3-5. R′ is a C.sub.1-C.sub.4 alkyl, and in some embodiments, R′ is one of methyl, ethyl and isopropyl. Ra is one of Formulae (A27), (A28), (A29), (A30), and (A31), and in some embodiments, Ra is Formula (A27) or (A28). Rb is a C.sub.1-C.sub.5 alkyl, and in some embodiments, is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, j1, j2, R′, Ra, and Rb in Formulae (A1)-(A26) are respectively selected to achieve the linkage between the M.sub.1 targeting groups and the N atom on the nitrogenous backbone, and to make the steric position among the M.sub.1 targeting groups more suitable for binding between the M.sub.1 targeting groups and the asialoglycoprotein receptor on the surface of hepatocytes.
[0365] In some embodiments, the siRNA conjugate has a structure as shown by Formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422):
##STR00029## ##STR00030## ##STR00031## ##STR00032## ##STR00033## ##STR00034## ##STR00035## ##STR00036##
[0366] In some embodiments, the P atom in Formula (A59) may be linked to any possible position in the siRNA sequence. For example, the P atom in Formula (A59) may be linked to any nucleotide in the sense or antisense strand of the siRNA. In some embodiments, the P atom in Formula (A59) is linked to any nucleotide in the sense strand of the siRNA. In some embodiments, the P atom in Formula (A59) may be linked to a terminal region of the sense or antisense strand of the siRNA. In some embodiments, the P atom in Formula (A59) is linked to a terminal region of the sense strand of the siRNA. Said terminal region refers to the first 4 nucleotides counted from one terminal of the sense or antisense strand. In some embodiments, the P atom in Formula (A59) is linked to either terminal of the sense or antisense strand of the siRNA. In some embodiments, the P atom in Formula (A59) is linked to 3′ terminal of the sense strand of the siRNA. In the case where the P atom in Formula (A59) is linked to the above position of the sense strand of the siRNA, after having entered into cells, the siRNA conjugate as shown by Formula (308) can release a separate antisense strand of the siRNA during unwinding, thereby blocking the translation of the FXI mRNA into a protein and inhibiting the expression of the FXI gene.
[0367] In some embodiments, the P atom in Formula (A59) may be linked to any possible position of a nucleotide in the siRNA, for example, position 5′, position 2′, position 3′, or the base of the nucleotide. In some embodiments, the P atom in Formula (A59) may be linked to position 2′, 3′, or 5′ of a nucleotide in the siRNA by forming a phosphodiester bond. In some embodiments, the P atom in Formula (A59) is linked to an oxygen atom formed by dehydrogenation of 3′-hydroxy of the nucleotide at 3′ terminal of the sense strand of the siRNA (in this case, the P atom in Formula (A59) may be also regarded as the P atom in the phosphate group contained in the siRNA), or the P atom in Formula (A59) is linked to a nucleotide by substituting a hydrogen atom in 2′-hydroxy of a nucleotide of the sense strand of the siRNA, or the P atom in Formula (A59) is linked to a nucleotide by substituting a hydrogen atom in 5′-hydroxy of the nucleotide at 5′ terminal of the sense strand of the siRNA.
[0368] The inventors of the present disclosure have surprisingly found that the siRNA conjugate of the present disclosure exhibits significantly improved stability in plasma and low off-target effect, and further shows higher silencing activity against FXI mRNA. In some embodiments, the siRNA of the present disclosure may be one of the siRNAs as shown in Tables 1a to 1i. The siRNA conjugates containing such siRNAs exhibit much higher silencing activity against FXI mRNA.
TABLE-US-00046 TABLE 1a The sequences of first siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIa1 9 GGGUAUUCUUUCAAGCAAU 10 AUUGCUUGAAAGAAUACCCAG siFXIa2 11 CUGGGUAUUCUUUCAAGCAAU 12 AUUGCUUGAAAGAAUACCCAGAA siFXIa1- 13 GmGmGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmAmUm M1 14 AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmAm Gm siFXIa1- 15 GmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M2 16 AmUfUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmAmGm siFXIa1- 17 GmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M3 18 AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmAm Gm siFXIa2- 19 CmUmGmGmGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmAm M1 Um 20 AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmAm GmAmAm siFXIa2- 21 CmUmGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAm M2 Um 22 AmUfUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmAmGm AmAm siFXIa2- 23 CmUmGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAm M3 Um 24 AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmAm GmAmAm siFXIa1- 25 GmsGmsGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmAmUm M1S 26 AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmsA msGm siFXIa1- 27 GmsGmsGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M2S 28 AmsUfsUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmsAms Gm siFXIa1- 29 GmsGmsGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M3S 30 AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmsA msGm siFXIa2- 31 CmsUmsGmGmGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmA M1S mUm 32 AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmA mGmsAmsAm siFXIa2- 33 CmsUmsGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmA M2S mUm 34 AmsUfsUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmAmG msAmsAm siFXIa2- 35 CmsUmsGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmA M3S mUm 36 AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmA mGmsAmsAm siFXIa1- 37 GmGmGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmAmUm M1P1 38 P1AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmA mGm siFXIa1- 39 GmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M2P1 40 P1AmUfUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmAm Gm siFXIa1- 41 GmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M3P1 42 P1AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmA mGm siFXIa2- 43 CmUmGmGmGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmAm M1P1 Um 44 P1AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmA mGmAmAm siFXIa2- 45 CmUmGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAm M2P1 Um 46 P1AmUfUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmAm GmAmAm siFXIa2- 47 CmUmGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAm M3P1 Um 48 P1AmUfUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCmA mGmAmAm siFXIa1- 49 GmsGmsGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmAmUm M1SP1 50 P1AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCm sAmsGm siFXIa1- 51 GmsGmsGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M2SP1 52 P1AmsUfsUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmsA msGm siFXIa1- 53 GmsGmsGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmAmUm M3SP1 54 P1AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCm sAmsGm siFXIa2- 55 CmsUmsGmGmGmUmAmUmUfCfUfUmUmCmAmAmGmCmAmA M1SP1 mUm 56 P1AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCm AmGmsAmsAm siFXIa2- 57 CmsUmsGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmA M2SP1 mUm 58 P1AmsUfsUmGmCmUfUmGfAfAmAmGmAmAfUmAfCmCmCmA mGmsAmsAm siFXIa2- 59 CmsUmsGmGmGmUmAfUmUfCfUfUmUmCmAmAmGmCmAmA M3SP1 mUm 60 P1AmsUfsUmGmCmUfUmGmAmAmAmGmAmAfUmAfCmCmCm AmGmsAmsAm
TABLE-US-00047 TABLE 1b The sequences of second siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIb1 69 GGCAUAAACUAUAACAGCU 70 AGCUGUUAUAGUUUAUGCCCU siFXIb2 71 AGGGCAUAAACUAUAACAGCU 72 AGCUGUUAUAGUUUAUGCCCUUC siFXIb1- 73 GmGmCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmCmUm M1 74 AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmCm Um siFXIb1- 75 GmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M2 76 AmGfCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmCmUm siFXIb1- 77 GmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M3 78 AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmCm Um siFXIb2- 79 AmGmGmGmCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmCm M1 Um 80 AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmCm UmUmCm siFXIb2- 81 AmGmGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCm M2 Um 82 AmGfCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmCmUm UmCm siFXIb2- 83 AmGmGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCm M3 Um 84 AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmCm UmUmCm siFXIb1- 85 GmsGmsCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmCmUm M1S 86 AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmsC msUm siFXIb1- 87 GmsGmsCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M2S 88 AmsGfsCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmsCms Um siFXIb1- 89 GmsGmsCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M3S 90 AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmsC msUm siFXIb2- 91 AmsGmsGmGmCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmC M1S mUm 92 AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmC mUmsUmsCm siFXIb2- 93 GmsGmsCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M2S 94 AmsGfsCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmCmU msUmsCm siFXIb2- 95 AmsGmsGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmC M3S mUm 96 AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmC mUmsUmsCm siFXIb1- 97 GmGmCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmCmUm M1P1 98 P1AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmC mUm siFXIb1- 99 GmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M2P1 100 P1AmGfCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmCm Um siFXIb1- 101 GmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M3P1 102 P1AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmC mUm siFXIb2- 103 AmGmGmGmCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmCm M1P1 Um 104 P1AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmC mUmUmCm siFXIb2- 105 AmGmGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCm M2P1 Um 106 P1AmGfCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmCm UmUmCm siFXIb2- 107 AmGmGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCm M3P1 Um 108 P1AmGfCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCmC mUmUmCm siFXIb1- 109 GmsGmsCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmCmUm M1SP1 110 P1AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCm sCmsUm siFXIb1- 111 GmsGmsCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M2SP1 112 P1AmsGfsCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmsC msUm siFXIb1- 113 GmsGmsCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmCmUm M3SP1 114 P1AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCm sCmsUm siFXIb2- 115 AmsGmsGmGmCmAmUmAmAfAfCfUmAmUmAmAmCmAmGmC M1SP1 mUm 116 P1AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCm CmUmsUmsCm siFXIb2- 117 AmsGmsGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmC M2SP1 mUm 118 P1AmsGfsCmUmGmUfUmAfUfAmGmUmUmUfAmUfGmCmCmC mUmsUmsCm siFXIb2- 119 AmsGmsGmGmCmAmUfAmAfAfCfUmAmUmAmAmCmAmGmC M3SP1 mUm 120 P1AmsGfsCmUmGmUfUmAmUmAmGmUmUmUfAmUfGmCmCm CmUmsUmsCm
TABLE-US-00048 TABLE 1c The sequences of third siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIc1 129 GCUCAAGAAUGCCAAGAAA 130 UUUCUUGGCAUUCUUGAGCAC siFXIc2 131 GUGCUCAAGAAUGCCAAGAAA 132 UUUCUUGGCAUUCUUGAGCACUC siFXIc1- 133 GmCmUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmAmAm M1 134 UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmAmC m siFXIc1- 135 GmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M2 136 UmUfUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmAmCm siFXIc1- 137 GmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M3 138 UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmAmC m siFXIc2- 139 GmUmGmCmUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmAm M1 Am 140 UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmAmC mUmCm siFXIc2- 141 GmUmGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAm M2 Am 142 UmUfUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmAmCm UmCm siFXIc2- 143 GmUmGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAm M3 Am 144 UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmAmC mUmCm siFXIc1- 145 GmsCmsUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmAmAm M1S 146 UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmsA msCm siFXIc1- 147 GmsCmsUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M2S 148 UmsUfsUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmsAms Cm siFXIc1- 149 GmsCmsUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M3S 150 UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmsA msCm siFXIc2- 151 GmsUmsGmCmUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmA M1S mAm 152 UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmA mCmsUmsCm siFXIc2- 153 GmsUmsGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmA M2S mAm 154 UmsUfsUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmAmC msUmsCm siFXIc2- 155 GmsUmsGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmA M3S mAm 156 UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmA mCmsUmsCm siFXIc1- 157 GmCmUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmAmAm M1P1 158 P1UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmA mCm siFXIc1- 159 GmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M2P1 160 P1UmUfUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmAm Cm siFXIc1- 161 GmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M3P1 162 P1UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmA mCm siFXIc2- 163 GmUmGmCmUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmAm M1P1 Am 164 P1UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmA mCmUmCm siFXIc2- 165 GmUmGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAm M2P1 Am 166 P1UmUfUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmAm CmUmCm siFXIc2- 167 GmUmGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAm M3P1 Am 168 P1UmUfUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCmA mCmUmCm siFXIc1- 169 GmsCmsUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmAmAm M1SP1 170 P1UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCm sAmsCm siFXIc1- 171 GmsCmsUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M2SP1 172 P1UmsUfsUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmsA msCm siFXIc1- 173 GmsCmsUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmAmAm M3SP1 174 P1UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCm sAmsCm siFXIc2- 175 GmsUmsGmCmUmCmAmAmGfAfAfUmGmCmCmAmAmGmAmA M1SP1 mAm 176 P1UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCm AmCmsUmsCm siFXIc2- 177 GmsUmsGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmA M2SP1 mAm 178 P1UmsUfsUmCmUmUfGmGfCfAmUmUmCmUfUmGfAmGmCmA mCmsUmsCm siFXIc2- 179 GmsUmsGmCmUmCmAfAmGfAfAfUmGmCmCmAmAmGmAmA M3SP1 mAm 180 P1UmsUfsUmCmUmUfGmGmCmAmUmUmCmUfUmGfAmGmCm AmCmsUmsCm
TABLE-US-00049 TABLE 1d The sequences of fourth siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXId1 189 GCAACAAAGACAUUUAUGU 190 ACAUAAAUGUCUUUGUUGCAA siFXId2 191 UUGCAACAAAGACAUUUAUGU 192 ACAUAAAUGUCUUUGUUGCAAGC siFXId1- 193 GmCmAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmGmUm M1 194 AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmAm Am siFXId1- 195 GmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M2 196 AmCfAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmAmAm siFXId1- 197 GmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M3 198 AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmAm Am siFXId2- 199 UmUmGmCmAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmGm M1 Um 200 AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmAm AmGmCm siFXId2- 201 UmUmGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGm M2 Um 202 AmCfAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmAmAm GmCm siFXId2- 203 UmUmGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGm M3 Um 204 AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmAm AmGmCm siFXId1- 205 GmsCmsAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmGmUm M1S 206 AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmsA msAm siFXId1- 207 GmsCmsAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M2S 208 AmsCfsAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmsAm sAm siFXId1- 209 GmsCmsAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M3S 210 AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmsA msAm siFXId2- 211 UmsUmsGmCmAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmG M1S mUm 212 AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmA mAmsGmsCm siFXId2- 213 UmsUmsGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmG M2S mUm 214 AmsCfsAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmAmA msGmsCm siFXId2- 215 UmsUmsGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmG M3S mUm 216 AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmA mAmsGmsCm siFXId1- 217 GmCmAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmGmUm M1P1 218 P1AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmA mAm siFXId1- 219 GmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M2P1 220 P1AmCfAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmAm Am siFXId1- 221 GmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M3P1 222 P1AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmA mAm siFXId2- 223 UmUmGmCmAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmGm M1P1 Um 224 P1AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmA mAmGmCm siFXId2- 225 UmUmGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGm M2P1 Um 226 P1AmCfAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmAm AmGmCm siFXId2- 227 UmUmGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGm M3P1 Um 228 P1AmCfAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCmA mAmGmCm siFXId1- 229 GmsCmsAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmGmUm M1SP1 230 P1AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCm sAmsAm siFXId1- 231 GmsCmsAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M2SP1 232 P1AmsCfsAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmsA msAm siFXId1- 233 GmsCmsAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmGmUm M3SP1 234 P1AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCm sAmsAm siFXId2- 235 UmsUmsGmCmAmAmCmAmAfAfGfAmCmAmUmUmUmAmUmG M1SP1 mUm 236 P1AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCm AmAmsGmsCm siFXId2- 237 UmsUmsGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmG M2SP1 mUm 238 P1AmsCfsAmUmAmAfAmUfGfUmCmUmUmUfGmUfUmGmCmA mAmsGmsCm siFXId2- 239 UmsUmsGmCmAmAmCfAmAfAfGfAmCmAmUmUmUmAmUmG M3SP1 mUm 240 P1AmsCfsAmUmAmAfAmUmGmUmCmUmUmUfGmUfUmGmCm AmAmsGmsCm
TABLE-US-00050 TABLE 1e The sequences of fifth siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIe1 249 GAAUCUCAAAGAAAUCUUU 250 AAAGAUUUCUUUGAGAUUCUU siFXIe2 251 AAGAAUCUCAAAGAAAUCUUU 252 AAAGAUUUCUUUGAGAUUCUUUG siFXIe1- 253 GmAmAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUmUm M1 254 AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmUm Um siFXIe1- 255 GmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M2 256 AmAfAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmUmU m siFXIe1- 257 GmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M3 258 AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmUm Um siFXIe2- 259 AmAmGmAmAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUm M1 Um 260 AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmUm UmUmGm siFXIe2- 261 AmAmGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUm M2 Um 262 AmAfAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmUmU mUmGm siFXIe2- 263 AmAmGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUm M3 Um 264 AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmUm UmUmGm siFXIe1- 265 GmsAmsAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUmUm M1S 266 AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmsU msUm siFXIe1- 267 GmsAmsAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M2S 268 AmsAfsAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmsUm sUm siFXIe1- 269 GmsAmsAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M3S 270 AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmsU msUm siFXIe2- 271 AmsAmsGmAmAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmU M1S mUm 272 AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmU mUmsUmsGm siFXIe2- 273 AmsAmsGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmU M2S mUm 274 AmsAfsAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmUm UmsUmsGm siFXIe2- 275 AmsAmsGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmU M3S mUm 276 AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmU mUmsUmsGm siFXIe1- 277 GmAmAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUmUm M1P1 278 P1AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmU mUm siFXIe1- 279 GmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M2P1 280 P1AmAfAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmUm Um siFXIe1- 281 GmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M3P1 282 P1AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmU mUm siFXIe2- 283 AmAmGmAmAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUm M1P1 Um 284 P1AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmU mUmUmGm siFXIe2- 285 AmAmGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUm M2P1 Um 286 P1AmAfAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmUm UmUmGm siFXIe2- 287 AmAmGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUm M3P1 Um 288 P1AmAfAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCmUm UmUmGm siFXIe1- 289 GmsAmsAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUmUm M1SP1 290 P1AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCms UmsUm siFXIe1- 291 GmsAmsAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M2SP1 292 P1AmsAfsAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCms UmsUm siFXIe1- 293 GmsAmsAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUmUm M3SP1 294 P1AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCms UmsUm siFXIe2- 295 AmsAmsGmAmAmUmCmUmCfAfAfAmGmAmAmAmUmCmUmUm M1SP1 Um 296 P1AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCm UmUmsUmsGm siFXIe2- 297 AmsAmsGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUm M2SP1 Um 298 P1AmsAfsAmGmAmUfUmUfCfUmUmUmGmAfGmAfUmUmCmU mUmsUmsGm siFXIe2- 299 AmsAmsGmAmAmUmCfUmCfAfAfAmGmAmAmAmUmCmUmUm M3SP1 Um 300 P1AmsAfsAmGmAmUfUmUmCmUmUmUmGmAfGmAfUmUmCm UmUmsUmsGm
TABLE-US-00051 TABLE 1f The sequences of sixth siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIf1 309 GUACGUGGACUGGAUUCUG 310 CAGAAUCCAGUCCACGUACUC siFXIf2 311 GAGUACGUGGACUGGAUUCUG 312 CAGAAUCCAGUCCACGUACUCGA siFXIf1- 313 GmUmAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmUmGm M1 314 CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmUmC m siFXIf1- 315 GmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M2 316 CmAfGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmUmCm siFXIf1- 317 GmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M3 318 CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmUmC m siFXIf2- 319 GmAmGmUmAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmUm M1 Gm 320 CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmUmC mGmAm siFXIf2- 321 GmAmGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUm M2 Gm 322 CmAfGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmUmCm GmAm siFXIf2- 323 GmAmGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUm M3 Gm 324 CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmUmC mGmAm siFXIf1- 325 GmsUmsAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmUmGm M1S 326 CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmsU msCm siFXIf1- 327 GmsUmsAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M2S 328 CmsAfsGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmsUms Cm siFXIf1- 329 GmsUmsAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M3S 330 CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmsU msCm siFXIf2- 331 GmsAmsGmUmAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmU M1S mGm 332 CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmUm CmsGmsAm siFXIf2- 333 GmsAmsGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmU M2S mGm 334 CmsAfsGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmUmC msGmsAm siFXIf2- 335 GmsAmsGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmU M3S mGm 336 CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmUm CmsGmsAm siFXIf1- 337 GmUmAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmUmGm M1P1 338 P1CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmU mCm siFXIf1- 339 GmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M2P1 340 P1CmAfGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmUmC m siFXIf1- 341 GmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M3P1 342 P1CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmU mCm siFXIf2- 343 GmAmGmUmAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmUm M1P1 Gm 344 P1CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmU mCmGmAm siFXIf2- 345 GmAmGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUm M2P1 Gm 346 P1CmAfGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmUmC mGmAm siFXIf2- 347 GmAmGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUm M3P1 Gm 348 P1CmAfGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCmU mCmGmAm siFXIf1- 349 GmsUmsAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmUmGm M1SP1 350 P1CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCms UmsCm siFXIf1- 351 GmsUmsAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M2SP1 352 P1CmsAfsGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmsU msCm siFXIf1- 353 GmsUmsAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmUmGm M3SP1 354 P1CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCms UmsCm siFXIf2- 355 GmsAmsGmUmAmCmGmUmGfGfAfCmUmGmGmAmUmUmCmU M1SP1 mGm 356 P1CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCm UmCmsGmsAm siFXIf2- 357 GmsAmsGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmU M2SP1 mGm 358 P1CmsAfsGmAmAmUfCmCfAfGmUmCmCmAfCmGfUmAmCmU mCmsGmsAm siFXIf2- 359 GmsAmsGmUmAmCmGfUmGfGfAfCmUmGmGmAmUmUmCmU M3SP1 mGm 360 P1CmsAfsGmAmAmUfCmCmAmGmUmCmCmAfCmGfUmAmCm UmCmsGmsAm
TABLE-US-00052 TABLE 1g The sequences of seventh siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIg1 369 AUUUCUGGGUAUUCUUUCA 370 UGAAAGAAUACCCAGAAAUCG siFXIg2 371 CGAUUUCUGGGUAUUCUUUCA 372 UGAAAGAAUACCCAGAAAUCGCU siFXIg1- 373 AmUmUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmCmAm M1 374 UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmCm Gm siFXIg1- 375 AmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M2 376 UmGfAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmCmGm siFXIg1- 377 AmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M3 378 UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmCm Gm siFXIg2- 379 CmGmAmUmUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmCm M1 Am 380 UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmCm GmCmUm siFXIg2- 381 CmGmAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCm M2 Am 382 UmGfAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmCmGm CmUm siFXIg2- 383 CmGmAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCm M3 Am 384 UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmCm GmCmUm siFXIg1- 385 AmsUmsUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmCmAm M1S 386 UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmsC msGm siFXIg1- 387 AmsUmsUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M2S 388 UmsGfsAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmsCms Gm siFXIg1- 389 AmsUmsUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M3S 390 UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmsC msGm siFXIg2- 391 CmsGmsAmUmUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmC M1S mAm 392 UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmC mGmsCmsUm siFXIg2- 393 CmsGmsAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmC M2S mAm 394 UmsGfsAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmCmG msCmsUm siFXIg2- 395 CmsGmsAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmC M3S mAm 396 UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmC mGmsCmsUm siFXIg1- 397 AmUmUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmCmAm M1P1 398 P1UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmC mGm siFXIg1- 399 AmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M2P1 400 P1UmGfAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmCm Gm siFXIg1- 401 AmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M3P1 402 P1UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmC mGm siFXIg2- 403 CmGmAmUmUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmCm M1P1 Am 404 P1UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmC mGmCmUm siFXIg2- 405 CmGmAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCm M2P1 Am 406 P1UmGfAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmCm GmCmUm siFXIg2- 407 CmGmAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCm M3P1 Am 408 P1UmGfAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUmC mGmCmUm siFXIg1- 409 AmsUmsUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmCmAm M1SP1 410 P1UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUm sCmsGm siFXIg1- 411 AmsUmsUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M2SP1 412 P1UmsGfsAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmsC msGm siFXIg1- 413 AmsUmsUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmCmAm M3SP1 414 P1UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUm sCmsGm siFXIg2- 415 CmsGmsAmUmUmUmCmUmGfGfGfUmAmUmUmCmUmUmUmC M1SP1 mAm 416 P1UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUm CmGmsCmsUm siFXIg2- 417 CmsGmsAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmC M2SP1 mAm 418 P1UmsGfsAmAmAmGfAmAfUfAmCmCmCmAfGmAfAmAmUmC mGmsCmsUm siFXIg2- 419 CmsGmsAmUmUmUmCfUmGfGfGfUmAmUmUmCmUmUmUmC M3SP1 mAm 420 P1UmsGfsAmAmAmGfAmAmUmAmCmCmCmAfGmAfAmAmUm CmGmsCmsUm
TABLE-US-00053 TABLE 1h The sequences of eighth siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIh1 429 CAUGAAGGGCAUAAACUAU 430 AUAGUUUAUGCCCUUCAUGUC siFXIh2 431 GACAUGAAGGGCAUAAACUAU 432 AUAGUUUAUGCCCUUCAUGUCUA siFXIh1- 433 CmAmUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmAmUm M1 434 AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmUmC m siFXIh1- 435 CmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M2 436 AmUfAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmUmCm siFXIh1- 437 CmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M3 438 AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmUmC m siFXIh2- 439 GmAmCmAmUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmAm M1 Um 440 AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmUmC mUmAm siFXIh2- 441 GmAmCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAm M2 Um 442 AmUfAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmUmCm UmAm siFXIh2- 443 GmAmCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAm M3 Um 444 AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmUmC mUmAm siFXIh1- 445 CmsAmsUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmAmUm M1S 446 AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmsU msCm siFXIh1- 447 CmsAmsUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M2S 448 AmsUfsAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmsUms Cm siFXIh1- 449 CmsAmsUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M3S 450 AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmsU msCm siFXIh2- 451 GmsAmsCmAmUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmA M1S mUm 452 AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmU mCmsUmsAm siFXIh2- 453 GmsAmsCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmA M2S mUm 454 AmsUfsAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmUmC msUmsAm siFXIh2- 455 GmsAmsCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmA M3S mUm 456 AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmU mCmsUmsAm siFXIh1- 457 CmAmUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmAmUm M1P1 458 P1AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmU mCm siFXIh1- 459 CmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M2P1 460 P1AmUfAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmUm Cm siFXIh1- 461 CmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M3P1 462 P1AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmU mCm siFXIh2- 463 GmAmCmAmUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmAm M1P1 Um 464 P1AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmU mCmUmAm siFXIh2- 465 GmAmCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAm M2P1 Um 466 P1AmUfAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmUm CmUmAm siFXIh2- 467 GmAmCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAm M3P1 Um 468 P1AmUfAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGmU mCmUmAm siFXIh1- 469 CmsAmsUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmAmUm M1SP1 470 P1AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGm sUmsCm siFXIh1- 471 CmsAmsUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M2SP1 472 P1AmsUfsAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmsU msCm siFXIh1- 473 CmsAmsUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmAmUm M3SP1 474 P1AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGm sUmsCm siFXIh2- 475 GmsAmsCmAmUmGmAmAmGfGfGfCmAmUmAmAmAmCmUmA M1SP1 mUm 476 P1AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGm UmCmsUmsAm siFXIh2- 477 GmsAmsCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmA M2SP1 mUm 478 P1AmsUfsAmGmUmUfUmAfUfGmCmCmCmUfUmCfAmUmGmU mCmsUmsAm siFXIh2- 479 GmsAmsCmAmUmGmAfAmGfGfGfCmAmUmAmAmAmCmUmA M3SP1 mUm 480 P1AmsUfsAmGmUmUfUmAmUmGmCmCmCmUfUmCfAmUmGm UmCmsUmsAm
TABLE-US-00054 TABLE 1i The sequences of ninth siRNAs of the present disclosure SEQ siRNA ID NO. NO: Sequence direction 5′-3′ siFXIi1 489 GGAUUCUGGAGAAAACUCA 490 UGAGUUUUCUCCAGAAUCCAG siFXIi2 491 CUGGAUUCUGGAGAAAACUCA 492 UGAGUUUUCUCCAGAAUCCAGUC siFXIi1- 493 GmGmAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmCmAm M1 494 UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmAmG m siFXIi1- 495 GmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M2 496 UmGfAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmAmGm siFXIi1- 497 GmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M3 498 UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmAmG m siFXIi2- 499 CmUmGmGmAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmCm M1 Am 500 UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmAmG mUmCm siFXIi2- 501 CmUmGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCm M2 Am 502 UmGfAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmAmGm UmCm siFXIi2- 503 CmUmGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCm M3 Am 504 UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmAmG mUmCm siFXIi1- 505 GmsGmsAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmCmAm M1S 506 UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmsA msGm siFXIi1- 507 GmsGmsAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M2S 508 UmsGfsAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmsAms Gm siFXIi1- 509 GmsGmsAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M3S 510 UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmsA msGm siFXIi2- 511 CmsUmsGmGmAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmC M1S mAm 512 UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmA mGmsUmsCm siFXIi2- 513 CmsUmsGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmC M2S mAm 514 UmsGfsAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmAmG msUmsCm siFXIi2- 515 CmsUmsGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmC M3S mAm 516 UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmA mGmsUmsCm siFXIi1- 517 GmGmAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmCmAm M1P1 518 P1UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmA mGm siFXIi1- 519 GmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M2P1 520 P1UmGfAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmAm Gm siFXIi1- 521 GmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M3P1 522 P1UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmA mGm siFXIi2- 523 CmUmGmGmAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmCm M1P1 Am 524 P1UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmA mGmUmCm siFXIi2- 525 CmUmGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCm M2P1 Am 526 P1UmGfAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmAm GmUmCm siFXIi2- 527 CmUmGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCm M3P1 Am 528 P1UmGfAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCmA mGmUmCm siFXIi1- 529 GmsGmsAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmCmAm M1SP1 530 P1UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCms AmsGm siFXIi1- 531 GmsGmsAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M2SP1 532 P1UmsGfsAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmsA msGm siFXIi1- 533 GmsGmsAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmCmAm M3SP1 534 P1UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCms AmsGm siFXIi2- 535 CmsUmsGmGmAmUmUmCmUfGfGfAmGmAmAmAmAmCmUmC M1SP1 mAm 536 P1UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCm AmGmsUmsCm siFXIi2- 537 CmsUmsGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmC M2SP1 mAm 538 P1UmsGfsAmGmUmUfUmUfCfUmCmCmAmGfAmAfUmCmCmA mGmsUmsCm siFXIi2- 539 CmsUmsGmGmAmUmUfCmUfGfGfAmGmAmAmAmAmCmUmC M3SP1 mAm 540 P1UmsGfsAmGmUmUfUmUmCmUmCmCmAmGfAmAfUmCmCm AmGmsUmsCm
wherein, C, G, U, and A represent the base composition of a nucleotide; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; s represents the two nucleotides adjacent to both sides of the letter s are linked by a thiophosphate linkage; P1 represents that the nucleotide adjacent to the right side of P1 is a 5′-phosphate nucleotide or a 5′-phosphate analogue modified nucleotide; in some embodiments, P1 represents the specific modifed nucleitide VP, Ps or P, wherein VP represents that the nucleotide adjacent to the right side of VP is a vinyl phosphate modified nucleotide; Ps represents that the nucleotide adjacent to the right side of Ps is a thiophosphate modified nucleotide; and P represents that the nucleotide adjacent to the right side of the letter P is a 5′-phosphate nucleotide.
[0369] In the siRNA or siRNA conjugate of the present disclosure, each pair of adjacent nucleotides is linked via a phosphodiester bond or phosphorothioate diester bond. The non-bridging oxygen or sulfur atom in the phosphodiester bond or phosphorothioate diester bond has negative charges, and may be present in the form of hydroxy or sulfhydryl. Moreover, the hydrogen ion in the hydroxy or sulfhydryl may be partially or completely substituted with a cation. The cation may be any cation, such as one of a metal cation, an ammonium cation NH.sub.4.sup.+ or an organic ammonium cation. In order to increase solubility, in one embodiment, the cation is selected from one or more of an alkali metal cation, an ammonium cation formed by a tertiary amine and a quaternary ammonium cation. The alkali metal ion may be K.sup.+ and/or Na.sup.+, and the cation formed by a tertiary amine may be an ammonium cation formed by triethylamine and/or an ammonium cation formed by N,N-diisopropylethylamine. Thus, the siRNA and the siRNA conjugate of the present disclosure can be at least partially present in the form of salt. In one embodiment, the non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate diester bond at least partly binds to sodium ion, and thus the siRNA and the siRNA conjugate of the present disclosure are present or partially present in the form of sodium salt.
[0370] Those skilled in the art clearly understand that a modified nucleotide group can be introduced into the siRNA of the present disclosure by a nucleoside monomer with a corresponding modification. The methods for preparing a nucleoside monomer having the corresponding modification and the methods for introducing a modified nucleotide group into an siRNA are also well-known to those skilled in the art. All modified nucleoside monomers may be either commercially available or prepared by known methods.
Preparation of the siRNA Conjugate as Shown by Formula (308)
[0371] The siRNA conjugate as shown by Formula (308) can be prepared by any appropriate synthetic routes.
[0372] In some embodiments, the siRNA conjugate as shown by Formula (308) can be prepared by the following method, comprising: sequentially linking nucleoside monomers in 3′ to 5′ direction according to the type and sequence of the nucleotides in the sense strand and antisense strands of the siRNA respectively, under the condition for phosphoramidite solid phase synthesis, wherein the step of linking each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization; isolating the sense strand and the antisense strand of the siRNA; and annealing; wherein the siRNA is the above siRNA of the present disclosure.
[0373] Moreover, the method further comprises: contacting the compound as shown by Formula (321) with a nucleoside monomer or a nucleotide sequence attached to a solid phase support under coupling reaction condition and in the presence of a coupling agent, thereby linking the compound as shown by Formula (321) to the nucleotide sequence via a coupling reaction. Hereinafter, the compound as shown by Formula (321) is also referred to as a conjugation molecule.
##STR00037##
wherein,
[0374] R.sub.4 is a group capable of binding to the siRNA represented by Nu in the compound as shown by Formula (308). In some embodiments, R.sub.4 is a group capable of binding to the siRNA represented by Nu via a covalent bond. In some embodiments, R.sub.4 is a group capable of being conjugated to any functional group of the siRNA represented by Nu via a phosphodiester bond by a reaction;
[0375] Each S.sub.1 is independently a group formed by substituting all active hydroxyls in M.sub.1 with the group YCOO—, wherein each Y is independently one selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl; in some embodiments, Y is methyl.
[0376] The definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1, and M.sub.1 are respectively as described above.
[0377] R.sub.4 is selected to achieve the linkage to the N atom on a nitrogenous backbone and to provide a suitable reaction site for synthesizing the siRNA conjugate as shown by Formula (308). In some embodiments, R.sub.4 comprises a R.sub.2 linking group or a protected R.sub.2 linking group, and a functional group than can react with an siRNA to form a structure as shown by Formula (A59).
[0378] In some embodiments, R.sub.4 comprises a first functional group that can react with a group on the siRNA represented by Nu or a nucleoside monomer to form a phosphite ester, and a second functional group that can react with a hydroxy group or an amino group to form a covalent bond, or comprises a solid phase support linked by the covalent bond. In some embodiments, the first functional group is a phosphoramidite, a hydroxy or a protected hydroxy. In some embodiments, the second functional group is a phosphoramidite, a carboxyl or a carboxylate salt. In some embodiments, the second functional group is a solid phase support linked to the rest of the molecule via a covalent bond which is formed by a hydroxy group or an amino group. In some embodiments, the solid phase support is linked via a phosphoester bond, a carboxylate ester bond or an amide bond. In some embodiments, the solid phase support is a resin.
[0379] In some embodiments, the first functional group comprises hydroxy, —OR.sub.k or a group as shown by Formula (C3); the second functional group has a structure as shown by Formula (C1), (C2), (C3), (C1′), or (C3′):
##STR00038##
wherein q.sub.1 is an integer of 1-4, X is O or NH, M.sup.+ is a cation, R.sub.k is a hydroxy protection group, SPS represents a solid phase support, and represents the site where a group is covalently linked.
[0380] In some embodiments, the first functional group comprises a phosphoramidite group, such as the group as shown by Formula (C3). The phosphoramidite group can form a phosphite ester with a hydroxy at any position (such as a 2′- hydroxy or 3′- hydroxy) on a nucleotide by a coupling reaction, and the phosphite ester can form a phosphodiester bond or phosphorothioate ester bond as shown by Formula (A59) via oxidation or sulfurization, so as to conjugate the conjugation molecule to an siRNA. Here, even if the second functional group does not exist, the compound as shown by Formula (321) could still be conjugated to the nucleotide, while not affecting the obtaining of the siRNA conjugate as shown by Formula (308). Under such circumstances, after obtaining a sense or antisense strand of the siRNA by a method such as phosphoramidite solid phase synthesis, the compound as shown by Formula (321) is reacted with a hydroxy on the nucleotide at the terminal of the nucleotide sequence, and a phosphodiester bond linkage or a phosphorothioate bond linkage is formed in the subsequent oxidation or sulfurization process, thereby conjugating the compound as shown by Formula (321) to the siRNA.
[0381] In some embodiments, the first functional group comprises a protected hydroxy. In some embodiments, the second functional group comprises a group that can react with a solid phase support to provide a conjugation molecule comprising a solid phase support. In some embodiments, the second functional group comprises a carboxyl, a carboxylate salt or a phosphoramidite, such as the functional group as shown by Formula (C1), (C2) or (C3). When the second functional group comprises a carboxyl or a carboxylate salt, the compound as shown by Formula (321) can react with a hydroxy or an amino group on a solid phase support (such as a resin) via esterification or amidation reaction, to form a conjugation molecule comprising a solid phase support linked via a carboxylate ester bond. When the second functional group comprises a phosphoramidite functional group, the compound as shown by Formula (321) can couple with a hydroxy group on a universal solid phase support (such as a resin), and form a conjugation molecule comprising a solid phase support linked via a phosphodiester bond by oxidation. Next, starting from the above product linked to a solid phase support, the nucleoside monomers are linked sequentially through a phosphoramidite solid phase synthesis method, so as to obtain a sense strand or an antisense strand of the siRNA linked to a conjugation group. In the process of phosphoramidite solid phase synthesis, the first functional group is deprotected, and then coupled with a phosphoramidite group on a nucleoside monomer under coupling reaction condition.
[0382] In some embodiments, the first functional group comprises a hydroxy or a protected hydroxy group; the second functional group comprises a solid phase support linked via a carboxylate ester bond, an amide bond, or a phosphoester bond, as shown by Formula (C1′) or (C3′). In this case, starting from the compound as shown by Formula (321) in place of a solid phase support, the nucleoside monomers are linked sequentially through a phosphoramidite solid phase synthesis method, so as to obtain a sense strand or an antisense strand of the siRNA linked to a conjugation group.
[0383] In some embodiments, the carboxylate may be expressed as —COO.sup.−M.sup.+, wherein M.sup.+ is a cation such as one selected from a metal cation, an ammonium cation NH.sub.4.sup.+ and an organic ammonium cation. In one embodiment, the metal cation may be an alkali metal cation, such as K.sup.+ or Na.sup.+. In order to increase solubility and facilitate the reaction, in some embodiments, the organic ammonium cation is an ammonium cation formed by a tertiary amine or a quaternary ammonium cation, such as an ammonium cation formed by triethylamine or an ammonium cation formed by N,N-diisopropylethylamine. In some embodiments, the carboxylate is a triethylamine carboxylate or an N,N-diisopropylethylamine carboxylate.
[0384] In some embodiments, R.sub.4 comprises the structure as shown by Formula (B9), (B10), (B9′), (B10′), (B11), (B12), (B11′), or B(12′):
##STR00039## ##STR00040##
wherein qi is an integer of 1-4, q.sub.2 is an integer of 1-10, X is O or NH, M.sup.+ is a cation, R.sub.k is a hydroxy protection group, SPS represents a solid phase support, and represents the site where the group is covalently linked. In some embodiments, q.sub.1 is 1 or 2. In some embodiments, q.sub.2 is an integer of 1-5. In some embodiments, R.sub.4 comprises a structure as shown by Formula (B9) or (B10). In some embodiments, R.sub.4 comprises a structure as shown by Formula (B11) or (B12).
[0385] In some embodiments, R.sub.k is one or more of Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4′-dimethoxytrityl), and TMTr (4,4′,4′-trimethoxytrityl). In some embodiments, R.sub.k may be DMTr, i.e., 4,4′-dimethoxytrityl.
[0386] The definition of L.sub.1 is as described above.
[0387] In some embodiments, L.sub.1 is used to link the M.sub.1 targeting group to the N atom on the nitrogenous backbone, thereby providing liver targeting function for the siRNA conjugate as shown by Formula (308). In some embodiments, L.sub.1 comprises any one of Formulae (A1)-(A26), or combination thereof.
[0388] According to the above description, those skilled in the art would easily understand that as compared with the well-known phosphoramidite solid phase synthesis method in the art, the siRNA conjugate as shown by Formula (308) in which the conjugation molecule is linked to any possible position of the nucleotide sequence can be obtained by using the above first functional group and an optional second functional group. For example, the conjugation molecule is linked to a terminal region of the nucleotide sequence, or to a terminal of the nucleotide sequence. Correspondingly, unless otherwise specified, in the following description regarding preparation of the conjugate and/or the conjugation molecule, when referring to the reactions such as “deprotection”, “coupling”, “capping”, “oxidation”, “sulfurization”, it should be understood that the reaction conditions and agents involved in the well-known phosphoramidite solid phase synthesis method in the art would also apply to these reactions. Exemplary reaction conditions and agents will be described in detail hereinafter.
[0389] In some embodiments, each S.sub.1 is independently a M.sub.1. In some embodiments, each S.sub.1 is independently a group formed by protecting at least one active hydroxyl group in M.sub.1 with a hydroxyl protection group. In some embodiments, each S.sub.1 is independently a group formed by protecting all existing active hydroxyl groups in M.sub.1 with hydroxyl protection groups. In some embodiments, any hydroxyl protection group known to a skilled one may be used to protect the active hydroxyl group in M.sub.1. In some embodiments, the protected hydroxy can be expressed as the Formula YCOO—, wherein each Y is independently selected from the group consisting of C.sub.1-C.sub.10 alkyl and C.sub.6-C.sub.10 aryl, which is optionally substituted with one or more substituents selected from the group consisting of halo and C.sub.1-C.sub.6 alkyl. In some embodiments, each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and C.sub.1-C.sub.6 alkylphenyl.
[0390] In some embodiments, each S.sub.1 is independently selected from the group consisting of Formulae (A46)-(A54):
##STR00041## ##STR00042##
[0391] In some embodiments, S.sub.1 is A49 or A50.
[0392] In some embodiments, each Y is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl. In some embodiments, Y is methyl.
[0393] As mentioned above, the method for preparing the siRNA conjugate as shown by Formula (308) further comprises the following steps: synthesizing the other strand of the siRNA (for example, when a sense strand of the siRNA linked to a conjugation molecule is synthesized in the above step, the method further comprises synthesizing an antisense strand of the siRNA according to the solid phase synthesis method, vice versa), isolating the sense strand and the antisense strand, and annealing. In particular, in the step of isolating, the solid phase support linked to the nucleotide sequence and/or the conjugation molecule is cleaved, and the necessary protection group is removed (in this case, each S.sub.1 group in the compound of Formula (321) is converted to the corresponding M.sub.1 targeting group), to afford a sense strand (or an antisense strand) of the siRNA linked to a conjugation molecule and the corresponding antisense strand (or sense strand). The sense strand and the antisense strand are annealed to form a double-strand RNA structure, thereby affording the siRNA conjugate as shown by Formula (308).
[0394] In some embodiments, the method for preparing the siRNA conjugate as shown by Formula (308) comprises the following steps: contacting the compound as shown by Formula (321) with the first nucleoside monomer at 3′ terminal of the sense strand or the antisense strand under coupling reaction condition in the presence of a coupling agent, thereby linking the compound as shown by Formula (321) to the first nucleotide in the sequence; sequentially linking nucleoside monomers in 3′ to 5′ direction to synthesize a sense or antisense strand of the siRNA according to the type and sequence of the nucleotides in the desired sense or antisense strand under the condition for phosphoramidite solid phase synthesis, wherein the compound as shown by Formula (321) is a compound in which R.sub.4 comprises a first functional group and a second functional group, wherein the first functional group comprises a protected hydroxyl and the second functional group has a structure as shown by Formula (C1′) or (C3′), and the compound as shown by Formula (321) is deprotected before being linked to the first nucleoside monomer; and the linking of each nucleoside monomer comprises a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization; thus obtaining a sense or antisense strand of the nucleic acid linked to a conjugation group; sequentially linking nucleoside monomers in 3′ to 5′ direction to synthesize an antisense or sense strand of the nucleic acid according to the type and sequence of the nucleotides in the sense or antisense strand under the condition for phosphoramidite solid phase synthesis; wherein the linking of each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization; removing the protection group and cleaving the solid phase support; isolating and purifying the sense strand and the antisense strand of the nucleic acid; and annealing.
[0395] In some embodiments, the method for preparing the siRNA conjugate as shown by Formula (308) comprises the following steps: according to the type and sequence of the nucleotides in the sense or antisense strand of the double-strand siRNA, sequentially linking nucleoside monomers in 3′ to 5′ direction to synthesize the antisense and sense strand; wherein the linking of each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization, to obtain the sense strand linked to the solid phase support and the antisense strand linked to the solid phase support; contacting the compound as shown by Formula (321) with the sense strand linked to the solid phase support or the antisense strand linked to the solid phase support under coupling reaction condition in the presence of a coupling agent, thereby linking the compound as shown by Formula (321) to the sense strand or antisense strand; wherein the compound as shown by Formula (321) is a compound in which R.sub.4 comprises a first functional group which is a phosphoramidite group; removing the protection group and cleaving the solid phase support; respectively isolating and purifying the sense strand or the antisense strand of the siRNA; and annealing, wherein the sense or antisense strand of the siRNA is linked to a conjugation group.
[0396] In some embodiments, the P atom in the Formula (A59) is linked to the 3′ terminal of the sense strand of the siRNA, and the method for preparing the siRNA conjugate as shown by Formula (308) comprises: [0397] (1) removing the hydroxyl protection group Pk in the compound as shown by Formula (321), wherein the compound as shown by Formula (321) is a compound in which R.sub.4 comprises a first functional group comprising a protected hydroxyl OR.sub.k, and a second functional group having a structure as shown by Formulas (C1′) or (C3′); contacting the deprotected product with a nucleoside monomer to afford a nucleoside monomer linked to a solid phase support via a conjugation molecule under coupling reaction condition in the presence of a coupling agent; [0398] (2) starting from the nucleoside monomer linked to a solid phase support via the conjugation molecule, synthesizing a sense strand of the siRNA in 3′ to 5′ direction by a phosphoramidite solid phase synthesis method; [0399] (3) synthesizing an antisense strand of the siRNA by a phosphoramidite solid phase synthesis method; and [0400] (4) isolating the sense strand and the antisense strand of the siRNA and annealing the same to afford the siRNA conjugate as shown by Formula (308).
[0401] Therein, in step (1), the method for removing the protection group R.sub.k in the compound as shown by Formula (321) comprises contacting the compound as shown by Formula (321) with a deprotection agent under deprotection condition. The deprotection condition comprises a temperature of 0-50° C., and in some embodiments, 15-35° C., and a reaction time of 30-300 seconds, and in some embodiments, 50-150 seconds. The deprotection agent may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in some embodiments, dichloroacetic acid. The molar ratio of the deprotection agent to the compound as shown by Formula (321) is 10:1 to 1000:1, and in some embodiments, 50:1 to 500:1.
[0402] The coupling reaction condition and the coupling agent may be any condition and agent suitable for the above coupling reaction. In some embodiments, the same condition and agent as those of the coupling reaction in the solid phase synthesis method can be used.
[0403] In some embodiments, the coupling reaction condition comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C. The molar ratio of the compound as shown by Formula (321) to the nucleoside monomer is 1:1 to 1:50, and in some embodiments, 1:2 to 1:5. The molar ratio of the compound as shown by Formula (321) to the coupling agent may be 1:1 to 1:50, and in some embodiments, 1:3 to 1:10. The reaction time is 200-3,000 seconds, and in some embodiments, 500-1,500 seconds. The coupling agent is selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole, and in some embodiments, is 5-ethylthio-1H-tetrazole. The coupling reaction may be performed in an organic solvent. The organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF and anhydrous dichloromethane, and in some embodiments, is anhydrous acetonitrile. With respect to the compound as shown by Formula (321), the amount of the organic solvent is 3-50 L/mol, and in some embodiments, 5-20 L/mol.
[0404] In step (2), starting from the nucleoside monomer linked to a solid phase support via a conjugation molecule prepared in the above steps, a sense strand SS of the second siRNA conjugate is synthesized in 3′ to 5′ direction by the phosphoramidite solid phase synthesis method. In this case, the conjugation group is linked to 3′ terminal of the resultant sense strand.
[0405] Other conditions for the solid phase synthesis in steps (2) and (3), including the deprotection condition for the nucleoside monomer, the type and amount of the deprotection agent, the coupling reaction condition, the type and amount of the coupling agent, the capping reaction condition, the type and amount of the capping agent, the oxidation reaction condition, the type and amount of the oxidation agent, the sulfurization reaction condition, and the type and amount of the sulfurization agent, adopt various agents, amounts, and conditions conventionally used in the art.
[0406] In some embodiments, for example, the solid phase synthesis in steps (2) and (3) can be performed by using the following conditions:
[0407] The deprotection condition for the nucleoside monomer comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C., and a reaction time of 30-300 seconds, and in some embodiments, 50-150 seconds. The deprotection agent may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in some embodiments, is dichloroacetic acid. The molar ratio of the deprotection agent to the protection group 4,4′-dimethoxytrityl on the solid phase support is 2:1 to 100:1, and in some embodiments, 3:1 to 50:1.
[0408] The coupling reaction condition comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C. The molar ratio of the nucleic acid sequence linked to the solid phase support to the nucleoside monomer is 1:1 to 1:50, and in some embodiments, 1:5 to 1:15. The molar ratio of the nucleic acid sequence linked to the solid phase support to the coupling agent is 1:1 to 1:100, and in some embodiments, 1:50 to 1:80. The selection of the reaction time and the coupling agent is the same as above.
[0409] The capping reaction condition comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C., and a reaction time of 5-500 seconds, and in some embodiments, 10-100 seconds. The selection of the capping agent is the same as above. The molar ratio of the total amount of the capping agent to the nucleic acid sequence linked to the solid phase support is 1:100 to 100:1, and in some embodiments, is 1:10 to 10:1. In the case where equimolar acetic anhydride and N-methylimidazole are used as a capping agent, the molar ratio of acetic anhydride, N-methylimidazole, and the nucleic acid sequence linked to the solid phase support may be 1:1:10-10:10:1, and in some embodiments, is 1:1:2-2:2:1.
[0410] The oxidation reaction condition comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C., and a reaction time of 1-100 seconds, and in some embodiments, 5-50 seconds. In some embodiments, the oxidation agent is iodine (in some embodiments provided as iodine water). The molar ratio of the oxidation agent to the nucleic acid sequence linked to the solid phase support in the coupling step may be 1:1 to 100:1, and in some embodiments, is 5:1 to 50:1. In some embodiments, the oxidation reaction is performed in a mixed solvent in which the ratio of tetrahydrofuran: water: pyridine is 3:1:1-1:1:3. The sulfurization reaction condition comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C., and a reaction time of 50-2,000 seconds, and in some embodiments, 100-1,000 seconds. in some embodiments, the sulfurization agent is xanthane hydride. The molar ratio of the sulfurization agent to the nucleic acid sequence linked to the solid phase support in the coupling step is 10:1 to 1,000:1, and in some embodiments, is 10:1 to 500:1. In some embodiments, the sulfurization reaction is performed in a mixed solvent in which the ratio of acetonitrile: pyridine is 1:3-3:1.
[0411] The method further comprises isolating the sense strand and the antisense strand of the siRNA after linking all nucleoside monomers and before the annealing. Methods for isolation are well-known to those skilled in the art and generally comprise cleaving the synthesized nucleotide sequence from the solid phase support, removing the protection groups on the bases, phosphate groups and ligands, purifying, and desalting.
[0412] The synthesized nucleotide sequence may be cleaved from the solid phase support, and the protection groups on the bases, phosphate groups and ligands are removed, according to conventional cleavage and deprotection methods in the synthesis of siRNAs. For example, the resultant nucleotide sequence linked to the solid phase support is contacted with concentrated aqueous ammonia; during deprotection, the protection group YCOO- in groups A46-A54 is converted to a hydroxyl group, and thus the S.sub.1 groups are converted to corresponding M.sub.1 groups, providing the siRNA conjugate as shown by Formula (308); wherein the concentrated aqueous ammonia may be aqueous ammonia of a concentration of 25-30 wt %. With respect to the target siRNA sequence, the amount of the concentrated aqueous ammonia may be 0.2 ml/μmol-0.8 ml/μmol.
[0413] When there is at least one 2′-TBDMS protection on the synthesized nucleotide sequence, the method further comprises contacting the nucleotide sequence removed from the solid phase support with triethylamine trihydrofluoride to remove the 2′-TBDMS protection. Here, the corresponding nucleoside in the resultant target siRNA sequence has a free 2′-hydroxy. With respect to the target siRNA sequence, the amount of pure triethylamine trihydrofluoride may be 0.4 ml/μmol-1.0 ml/μmol. As such, the siRNA conjugate as shown by Formula (308) can be obtained.
[0414] Methods for purification and desalination are well-known to those skilled in the art. For example, nucleic acid purification may be performed using a preparative ion chromatography purification column with a gradient elution of NaBr or NaCl; after collection and combination of the product, the desalination may be performed using a reverse phase chromatography purification column.
[0415] In the resultant siRNA conjugate as shown by Formula (308), the non-bridging oxygen or sulfur atom in the phosphodiester bond or phosphorothioate diester bond between the nucleotides substantially binds to sodium ion, and the siRNA conjugate as shown by Formula (308) is substantially present in the form of a sodium salt. The well-known ion-exchange methods may be used, in which the sodium ion may be replaced with hydrogen ion and/or other cations, thereby providing other forms of siRNA conjugates as shown by Formula (308). The cations are as described above.
[0416] During synthesis, the purity and molecular weight of the nucleic acid sequence may be determined at any time, in order to better control the synthesis quality. Such determination methods are well-known to those skilled in the art. For example, the purity of the nucleic acid may be determined by ion exchange chromatography, and the molecular weight may be determined by liquid chromatography-mass spectrometry (LC-MS).
[0417] Methods for annealing are also well-known to those skilled in the art. For example, the synthesized sense strand (S strand) and the antisense strand (AS strand) may be simply mixed in water for injection at an equimolar ratio, heated to 70-95° C., and then cooled at room temperature to form a double-stranded structure via hydrogen bond. Hence, the siRNA conjugate as shown by Formula (308) can be obtained.
[0418] After having obtained the conjugate, in some embodiments, the synthesized siRNA conjugate as shown by Formula (308) can also be characterized by the means such as molecular weight detection using the methods such as liquid chromatography-mass spectrometry, to confirm that the synthesized siRNA conjugate is the siRNA conjugate as shown by Formula (308) as a designed target, and the synthesized siRNA sequence is the desired siRNA sequence, for example, is one of the sequences listed in Table 1.
[0419] The compound as shown by Formula (321) may be obtained by the following preparation method comprising: contacting a compound as shown by Formula (313) with a cyclic anhydride in an organic solvent under esterification reaction condition in the presence of a base and an esterification catalyst; ion exchanging and isolating the compound as shown by Formula (321):
##STR00043##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, Ru.sub.12, R.sub.13, R14, R15, L.sub.1, and
[0420] S.sub.1 are respectively as described above;
[0421] R.sub.6 is a group for providing R.sub.4 of Formula (321); in some embodiments, R6 has a structure as shown by Formula (A61):
##STR00044##
wherein R.sub.i is any group capable of linking to the N atom on the nitrogenous backbone, linking to R.sub.kO and linking to a free hydroxy group; R.sub.k is a hydroxy protection group. In this case, a compound as shown by Formula (321) is obtained, wherein R.sub.4 comprises a first functional group as a hydroxy protection group and a second functional group which comprises a structure as shown by Formula (C1) or (C2).
[0422] The esterification reaction condition includes a reaction temperature of 0-100° C. and a reaction time of 8-48 hours. In some embodiments, the esterification reaction condition comprises a reaction temperature of 10-40° C. and a reaction time of 20-30 hours.
[0423] In some embodiments, the organic solvent comprises one or more of an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran, the ether solvent is diethyl ether and/or methyl tertbutyl ether, and the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane.
[0424] In some embodiments, the organic solvent is dichloromethane. With respect to the compound as shown by Formula (313), the amount of the organic solvent is 3-50 L/mol, and in some embodiments, 5-20 L/mol.
[0425] In some embodiments, the cyclic anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride or pimelic anhydride, and in some embodiments, the cyclic anhydride is succinic anhydride. The molar ratio of the cyclic anhydride to the compound as shown by Formula (313) is 1:1 to 10:1, and in some embodiments, 2:1 to 5:1.
[0426] The esterification catalyst may be any catalyst capable of catalyzing esterification, such as 4-dimethylaminopyridine. The molar ratio of the catalyst to the compound as shown by Formula (313) is 1:1 to 10:1, and in some embodiments, is 2:1 to 5:1.
[0427] In some embodiments, the base may be any inorganic base, organic base or combination thereof. Considering solubility and product stability, the base may be, for example, a tertiary amine. In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound as shown by Formula (313) is 1:1 to 20:1, and in some embodiments, 3:1 to 10:1.
[0428] The ion exchange serves the function of converting the compound as shown by Formula (321) into a desired form of carboxylic acid or carboxylic salt and the methods of ion exchange are well-known to those skilled in the art. The above conjugation molecule in which the cation is M.sup.+ may be obtained by using suitable ion exchange solution and ion exchange condition, which are omitted herein. In some embodiments, the ion exchange reaction is performed using a triethylamine phosphate solution, and the concentration of the triethylamine phosphate solution is 0.2-0.8 M. In some embodiments, the concentration of the triethylamine phosphate solution is 0.4-0.6 M, and with respect to the compound as shown by Formula (313), the amount of the triethylamine phosphate solution is 3-6 L/mol, and in further embodiments, 4-5 L/mol.
[0429] The compound as shown by Formula (321) may be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound as shown by Formula (321) may be isolated by removal of solvent via evaporation followed by chromatography. For example, the following two chromatographic conditions can be used for isolation: (1) normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of 1 wt % triethylamine-containing dichloromethane: methanol=100:18-100:20; or (2) reverse phase purification: C18 and C8 reverse phase filler, with gradient elution of methanol: acetonitrile=0.1: 1-1:0.1. In some embodiments, the solvent may be directly removed to obtain a crude product of the compound as shown by Formula (321), which may be directly used in subsequent reactions.
[0430] In some embodiments, the method for preparing the compound as shown by Formula (321) further comprises: further contacting the product obtained by the above ion exchanging reaction with a solid phase support with amino or hydroxy groups in an organic solvent under condensation reaction condition in the presence of a condensation agent, a condensation catalyst and a tertiary amine. In this case, a compound as shown by Formula (321) is obtained, wherein R.sub.4 comprises a first functional group which comprises a hydroxy protection group and a second functional group which comprises a structure as shown by Formula (C1′).
[0431] The solid phase support is one of the supports used in solid phase synthesis of siRNA, some of which are well-known to those skilled in the art. For example, the solid phase support may be selected from the solid phase supports containing active hydroxy or amino functional group(s), and in some embodiments, is an amino or hydroxy resin. In some embodiments, the amino or hydroxy resin has the following parameters: particle size of 100-400 mesh, and surface amino or hydroxy loading of 0.2-0.5 mmol/g. The ratio of the compound as shown by Formula (321) to the solid phase support is 10-400 μmol compound per gram of the solid phase support (μmol/g). In some embodiments, the ratio of the compound as shown by Formula (321) to the solid phase support is 50 μmol/g to 200 μmol/g.
[0432] The organic solvent may be any suitable solvent or mixed solvent known to those skilled in the art. In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran; the ether solvent is diethyl ether and/or methyl tert-butyl ether; the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. With respect to the compound as shown by Formula (321), the amount of the organic solvent is 20-200 L/mol, and in some embodiments, 50-100 L/mol.
[0433] In some embodiments, the condensation agent may be benzotriazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate (PyBop), 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one (DEPBT) and/or O-benzotriazol-tetramethyluronium hexafluorophosphate. In some embodiments, the condensation agent is O-benzotriazol-tetramethyluronium hexafluorophosphate. The molar ratio of the condensation agent to the compound as shown by Formula (321) is 1:1 to 20:1, and in some embodiments, 1:1 to 5:1.
[0434] In some embodiments, the tertiary amine is triethylamine and/or N,N-diisopropylethylamine, and in some embodiments, N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound as shown by Formula (321) is 1:1 to 20:1, and in some embodiments, 1:1 to 5:1.
[0435] In some embodiments, the method for preparing the compound as shown by Formula (321) further comprises: contacting the resultant condensation product with a capping agent and an acylation catalyst in an organic solvent under capping reaction condition, and isolating the compound as shown by Formula (321). The capping reaction is used to remove any active functional group that does not completely react, so as to avoid producing unnecessary by-products in subsequent reactions. The capping reaction condition comprises a reaction temperature of 0-50° C., and in some embodiments, 15-35° C., and a reaction time of 1-10 hours, and in some embodiments, 3-6 hours. The capping agent may be the capping agent used in solid phase synthesis of siRNA, which are well-known to those skilled in the art.
[0436] In some embodiments, the capping agent is composed of a capping agent 1 (capl) and a capping agent 2 (cap2). The cap1 is N-methylimidazole, and in some embodiments, provided as a mixed solution of N-methylimidazole in pyridine/acetonitrile, wherein the volume ratio of pyridine to acetonitrile is 1:10 to 1:1, and in some embodiments, 1:3 to 1:1. In some embodiments, the ratio of the total volume of pyridine and acetonitrile to the volume of N-methylimidazole is 1:1 to 10:1, and in some embodiments, 3:1 to 7:1. The cap2 is acetic anhydride, and in some embodiments, provided as a solution of acetic anhydride in acetonitrile, wherein the volume ratio of acetic anhydride to acetonitrile is 1:1 to 1:10, and in further embodiments, 1:2 to 1:6.
[0437] In some embodiments, the ratio of the volume of the mixed solution of N-methylimidazole in pyridine/acetonitrile to the mass of the compound as shown by Formula (321) is 5 ml/g-50 ml/g, and in some embodiments, 15 ml/g-30 ml/g. The ratio of the volume of the solution of acetic anhydride in acetonitrile to the weight of the compound as shown by Formula (321) is 0.5 ml/g-10 ml/g, and in some embodiments, 1 ml/g-5 ml/g.
[0438] In some embodiments, the capping agent comprises equimolar acetic anhydride and N-methylimidazole. In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the organic solvent is acetonitrile. With respect to the compound as shown by Formula (321), the amount of the organic solvent is 10-50 L/mol, and in some embodiments, 5-30 L/mol.
[0439] In some embodiments, the acylation catalyst may be selected from any catalyst that may be used for esterification condensation or amidation condensation, such as alkaline heterocyclic compounds. In some embodiments, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the catalyst to the compound as shown by Formula (321) is 0.001:1 to 1:1, and in some embodiments, 0.01:1 to 0.1:1.
[0440] In some embodiments, the compound as shown by Formula (321) may be isolated from the reaction mixture by any suitable separation methods. In some embodiments, the compound as shown by Formula (321) may be obtained by thoroughly washing with an organic solvent and filtering to remove unreacted reactants, excess capping agent and other impurities, wherein the organic solvent is selected from acetonitrile, dichloromethane and methanol. In some embodiments, the organic solvent is acetonitrile.
[0441] In some embodiments, the preparation method of the conjugation molecule as shown by Formula (321) comprises contacting a compound as shown by Formula (313) with a phosphorodiamidite in an organic solvent under coupling reaction condition in the presence of a coupling agent, and isolating the compound as shown by Formula (321). In this case, a compound as shown by Formula (321) is obtained, wherein R.sub.4 comprises a first functional group comprising a hydroxy protection group and a second functional group comprising a structure as shown by Formula (C3).
[0442] In some embodiments, the coupling reaction condition comprises: a reaction temperature of 0-50° C., such as 15-35° C.; the molar ratio of the compound as shown by Formula (313) to the phosphorodiamidite of 1:1 to 1:50, such as 1:5 to 1:15; the molar ratio of the compound as shown by Formula (313) to the coupling agent of 1:1 to 1:100, such as 1:50 to 1:80; and a reaction time of 200-3,000 seconds, such as 500-1,500 seconds. The phosphorodiamidite may be, for example, bis(diisopropylamino)(2-cyanoethoxy)phosphine, which may be commercially available or synthesized according to the methods well-known in the art. The coupling agent is selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole, such as 5-ethylthio-1H-tetrazole. The coupling reaction may be performed in an organic solvent. The organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF and anhydrous dichloromethane, such as anhydrous acetonitrile. In some embodiments, with respect to the compound as shown by Formula (313), the amount of the organic solvent is 3-50 L/mol, such as 5-20 L/mol. By coupling reaction, the hydroxy group in the compound as shown by Formula (313) reacts with the phosphorodiamidite to form a phosphoramidite group. In some embodiments, the solvent may be directly removed to afford a crude product of the compound as shown by Formula (321), which may be directly used in subsequent reactions.
[0443] In some embodiments, the preparation method of the compound as shown by Formula (321) further comprises the following steps: further contacting the isolated product with a solid phase support with hydroxy groups in an organic solvent under coupling reaction condition in the presence of a coupling agent, followed by capping, oxidation, and isolation, to afford the compound as shown by Formula (321), wherein R.sub.4 comprises a first functional group comprising a hydroxy protection group and a second functional group comprising a structure as shown by Formula (C3′).
[0444] In some embodiments, the solid phase support is a solid support well-known in the art used in solid phase synthesis of nucleic acid, such as, a deprotected commercially available universal solid phase support (NittoPhase®HL UnyLinker™ 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences, as shown by Formula B80):
##STR00045##
[0445] A deprotection reaction is well-known to those skilled in the art. In some embodiments, the deprotection condition comprises a temperature of 0-50° C., such as 15-35° C., and a reaction time of 30-300 seconds, such as 50-150 seconds. The deprotection agent may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid. In some embodiments, the deprotection agent is dichloroacetic acid. The molar ratio of the deprotection agent to the protection group -DMTr (4,4′-dimethoxytrityl) on the solid phase support is 2:1 to 100:1, such as 3:1 to 50:1. Through such deprotection, reactive free hydroxy groups are obtained on the surface of the solid phase support, for facilitating the subsequent coupling reaction.
[0446] The coupling reaction condition and the coupling agent may be selected as above. Through the coupling reaction, the free hydroxy groups formed in the deprotection react with the phosphoramidite groups, so as to form a phosphite ester linkage.
[0447] In some embodiments, the capping reaction condition comprises a temperature of 0-50° C., such as 15-35° C., and a reaction time of 5-500 seconds, such as 10-100 seconds. The capping reaction is carried out in the presence of a capping agent. The selection and amount of the capping agent are as described above.
[0448] The oxidation reaction condition comprises a temperature of 0-50° C., such as 15-35° C., and a reaction time of 1-100 seconds, such as 5-50 seconds. The oxidation agent may be, for example, iodine (in some embodiments, provided as iodine water). In some embodiments, the molar ratio of the oxidation agent to the nucleic acid sequence linked to the solid phase support is 1:1 to 100:1, such as, may be 5:1 to 50:1. In some embodiments, the oxidation reaction is performed in a mixed solvent in which the ratio of tetrahydrofuran: water: pyridine=3:1:1-1:1:3.
[0449] In some embodiments, R.sub.6 is one of the groups of Formula B7 or B8:
##STR00046##
wherein the definition of q2 is as described above.
[0450] In this case, the compound as shown by Formula (313) may be obtained by the following preparation method, comprising: contacting the compound as shown by Formula (314) with a compound as shown by Formula (A-1) or (A-2) in an organic solvent under amidation reaction condition in the presence of a condensation agent for amidation reaction and a tertiary amine, followed by isolation:
##STR00047##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, R.sub.15, L.sub.1, S.sub.1, q.sub.2, and R.sub.k are respectively as described above.
[0451] The amidation reaction condition may comprise a reaction temperature of 0-100° C. and a reaction time of 1-48 hours. In some embodiments, the amidation reaction condition is a reaction temperature of 10-40° C. and a reaction time of 2-16 hours.
[0452] In some embodiments, the organic solvent is one or more of an alcohol solvent, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the alcohol solvent is one or more of methanol, ethanol and propanol, and in some embodiments, ethanol. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. With respect to the compound as shown by Formula (314), the amount of the organic solvent is 3-50 L/mol, and in some embodiments, 3-20 L/mol.
[0453] In some embodiments, the condensation agent for amidation reaction is benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ), or O-benzotriazol-tetramethyluronium hexafluorophosphate, and in further embodiments, 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one. The molar ratio of the condensation agent for amidation reaction to the compound as shown by Formula (314) may be 1:1 to 10:1, and in some embodiments, 2.5:1 to 5:1.
[0454] In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine, and in some embodiments, N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound as shown by Formula (314) is 3:1 to 20:1, and in some embodiments, 5:1 to 10:1.
[0455] The compounds as shown by Formula (A-1) and (A-2) may be prepared by any suitable means. For example, when Rk is a DMTr group, the compound as shown by Formula (A-1) may be prepared by reacting calcium glycerate with DMTrCl. Similarly, the compound as shown by Formula (A-2) may be prepared by firstly contacting 3-amino-1,2-propanediol with a cyclic anhydride and then reacting with DMTrCl, wherein the cyclic anhydride may have 4-13 carbon atoms, and in some embodiments, 4-8 carbon atoms. Those skilled in the art would easily understand that the selections of different cyclic anhydrides correspond to different values for q2 in the compound as shown by Formula (A-2). For example, when the cyclic anhydride is succinic anhydride, q2=1; when the cyclic anhydride is glutaric anhydride, q2=2, and so on.
[0456] In some variations, the compound as shown by Formula (313) can also be prepared by sequentially reacting the compound as shown by Formula (314) with the cyclic anhydride, 3-amino-1,2-propanediol and DMTrCl. Those skilled in the art would easily understand that these variations would not affect the structure and function of the compound as shown by Formula (313), and these variations are readily realized by those skilled in the art on the basis of the above methods.
[0457] Similarly, the compound as shown by Formula (313) may be isolated from the reaction mixture by any suitable isolation methods. In some embodiments, the compound as shown by Formula (313) may be isolated by removal of solvent via evaporation followed by chromatography. For example, the following two chromatographic conditions may be used for isolation: (1) normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide =1:1:1:0.5-1:1:1:0.6; and (2) reverse phase purification: C18 and C8 reverse phase fillers, with gradient elution of methanol: acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to afford a crude product of the compound as shown by Formula (313), which may be directly used in subsequent reactions.
[0458] In some embodiments, the compound as shown by Formula (314) may be obtained by the following preparation method, comprising: contacting the compound as shown by Formula (320) with the compound as shown by Formula (316) in an organic solvent under condensation reaction condition in the presence of a condensation agent for amidation reaction and a tertiary amine, followed by isolation:
##STR00048##
wherein the definitions and options of n1, n3, m1, m2, m3, R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 are respectively as described above.
[0459] The compound as shown by Formula (316) can be, such as, compound disclosed in J. Am. Chem. Soc. 2014, 136, 16958-16961. Alternatively, the compounds as shown by Formula (316) may be prepared by those skilled in the art via various methods. For example, some compounds as shown by Formula (316) may be prepared according to the method disclosed in Example 1 of the US patent US8,106,022 B2, which is incorporated herein by reference in its entirety.
[0460] In some embodiments, the condensation reaction condition comprises a reaction temperature of 0-100° C. and a reaction time of 0.1-24 hours, and in some embodiments, a reaction temperature of 10-40° C. and a reaction time of 0.5-16 hours.
[0461] Considering the structure of the desired product compound as shown by Formula (314), the molar ratio of the compound as shown by Formula (316) to the compound as shown by Formula (320) should be determined based on the sum of nl and n3 in Formula (320). In some embodiments, for example, when nl+n3=3, to ensure complete reaction without any excess, the molar ratio of the compound as shown by Formula (316) to the compound as shown by Formula (320) may be 3:1 to 3.5:1, and in some embodiments, 3.01:1 to 3.15:1.
[0462] In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, an haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. With respect to the compound as shown by Formula (320), the amount of the organic solvent may be 3-50 L/mol, and in some embodiments, 5-20 L/mol.
[0463] In some embodiments, the condensing agent for amidation reaction is one or more of benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryl oxy-1,2,3 -b enzotrizin-4(3H)-one (DEPBT), 0-benzotriazol-tetramethyluronium hexafluorophosphate, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, or 1-hydroxybenzotriazole, and in further embodiments, is a mixture of benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate and 1-hydroxybenzotriazole, wherein benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate and 1-hydroxybenzotriazole are used in equimolar amounts. The molar ratio of the total condensing agent for amidation reaction to the compound as shown by Formula (316) may be 1:1 to 3:1, and in some embodiments, 1.05:1 to 1.5:1.
[0464] The tertiary amine may be N-methylmorpholine, triethylamine or N,N-diisopropylethylamine, and in some embodiments, N-methylmorpholine. The molar ratio of the tertiary amine to the compound as shown by Formula (316) may be 2:1 to 10:1, and in some embodiments, 2:1 to 5:1.
[0465] Similarly, the compound as shown by Formula (314) may be isolated from the reaction mixture by any suitable isolation method. In some embodiments, the compound as shown by Formula (314) may be isolated by removal of solvent via evaporation followed by chromatography, for example, using the following two chromatographic conditions for isolation: (1) normal phase purification of silica gel: 200-300 mesh silica gel filler, with gradient elution of dichloromethane: methanol=100:5-100:7; and (2) reverse phase purification: C.sub.18 and C.sub.8 reverse phase fillers, with gradient elution of methanol: acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent may be directly removed to afford a crude product of the compound as shown by Formula (314), which may be directly used in subsequent reactions.
[0466] The compound as shown by Formula (320) may be commercially available, or prepared by those skilled in the art via known methods. For example, in the case where m1=m2=m3=3, n1=1, n3=2, and R.sub.10, R.sub.11, R.sub.12, R.sub.13, R.sub.14, and R.sub.15 are all H, the compound as shown by Formula (320) may be commercially available from Alfa Aesar Inc.
[0467] The siRNA conjugate of the present disclosure may also be used in combination with other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally employed in the art. For details, please refer to the above description of the pharmaceutical compositions of the present disclosure.
[0468] Use of the siRNA, the Pharmaceutical Composition and the Conjugate Comprising the siRNA of the Present Disclosure
[0469] In some embodiments, the present disclosure provides the use of the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure in the manufacture of a medicament for treating and/or preventing thrombotic diseases and/or ischemic stroke.
[0470] In some embodiments, the present disclosure provides a method for preventing and/or treating thrombotic diseases and/or ischemic stroke, comprising administering an effective amount of the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure to a subject in need thereof.
[0471] The purpose of preventing and/or treating thrombotic diseases and/or ischemic stroke may be achieved through the mechanism of RNA interference by administering the siRNA active ingredient of the present disclosure to a subject in need thereof. Therefore, the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure may be used for preventing and/or treating thrombotic diseases and/or ischemic stroke, or for preparing a medicament for preventing and/or treating thrombotic diseases and/or ischemic stroke.
[0472] As used herein, the term “administration/administer” refers to the placing the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure into a subject's body by a method or a route that at least partly the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure is located at a desired site to produce a desired effect. Suitable administration routes for the methods of the present disclosure include topical administration and systemic administration. In general, topical administration results in the delivery of more siRNA conjugate to a particular site as compared with the systemic circulation of the subject; whereas systemic administration results in the delivery of the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure to substantially systemic circulation of the subj ect. Considering that the present disclosure is intended to provide a means for preventing and/or treating thrombotic diseases and/or ischemic stroke, in some embodiments, an administration mode capable of delivering a medicament to the liver is employed.
[0473] The administration to a subject may be achieved by any suitable routes known in the art, including but not limited to, oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, intratracheal administration (aerosol), pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The frequency of administration may be once or more times daily, weekly, biweekly, triweekly, monthly, or yearly.
[0474] The used dosage of the siRNA or the pharmaceutical composition or the siRNA conjugate of the present disclosure may be a conventional dose in the art, which may be determined according to various parameters, especially age, weight and gender of a subject. Toxicity and efficacy may be determined in cell cultures or experimental animals by standard pharmaceutical procedures, for example, by determining LD.sub.50 (the lethal dose that causes 50% population death) and ED.sub.50 (the dose that can cause 50% of the maximum response intensity in a quantitative response, and that causes 50% of the experimental subjects to have a positive response in a qualitative response). The dose range for human use may be derived based on data obtained from cell culture analysis and animal studies.
[0475] When the siRNA, the pharmaceutical composition and/or the siRNA conjugate of the present disclosure is administered, for example, to male or female, 6 to 12 weeks old, C57BL/6N mice of 18 to 25 g body weight, based on the amount of the siRNA: (i) for the siRNA conjugate, the dosage of the siRNA thereof may be 0.001 to 100 mg/kg body weight, in some embodiments 0.01 to 50 mg/kg body weight, in some embodiments 0.05 to 20 mg/kg body weight, in further embodiments 0.1 to 15 mg/kg body weight, and in further embodiments 0.1 to 10 mg/kg body weight; (ii) for a pharmaceutical composition formed by the siRNA and the pharmaceutically acceptable carrier, the dosage of the siRNA thereof may be 0.001 to 50 mg/kg body weight, in some embodiments 0.01 to 10 mg/kg body weight, in some embodiments 0.05 to 5 mg/kg body weight, and in some embodiments 0.1 to 3 mg/kg body weight.
[0476] In some embodiments, the present disclosure provides a method of inhibiting the expression of FXI gene in hepatocytes, comprising contacting an effective amount of the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure with the hepatocytes, and introducing the siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure into the hepatocytes, so as to realize the purpose of inhibiting the expression of FXI gene in hepatocytes through the mechanism of RNA interference. The hepatocytes may be selected from hepatoma cell lines (such as SMMC-7721, HepG2 and Huh7), or isolated liver primary cells. In some embodiments, the hepatocytes are HepG2 hepatoma cells.
[0477] In the case where the expression of FXI gene in a cell is inhibited by using the method of the present disclosure, the amount of the siRNA in the modified siRNA and/or the pharmaceutical composition and/or the siRNA conjugate of the present disclosure is generally such an amount that is sufficient to reduce the expression of the target gene and results in an extracellular concentration of 1 μM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM on the surface of the target cells. The amount required to achieve this topical concentration will vary with various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cells or tissues, the delivery route (topical or systemic), etc. The concentration at the delivery site may be significantly higher than that on the surface of the target cells or tissues.
[0478] Kit
[0479] The present disclosure provides a kit comprising an effective amount of at least one of the modified siRNA, the pharmaceutical composition, and the siRNA conjugate of the present disclosure.
[0480] In some embodiments, the kit of the present disclosure may provide the modified siRNA in a container. In some embodiments, the kit of the present disclosure may comprise a container containing a pharmaceutically acceptable excipient. In some embodiments, the kit may further comprise other ingredients, such as stabilizers or preservatives. In some embodiments, the kit of the present disclosure may comprise at least one additional therapeutic agent in other container different from the container for providing the modified siRNA of the present disclosure. In some embodiments, the kit may comprise an instruction for mixing the modified siRNA with pharmaceutically acceptable carriers and/or excipients or other ingredients (if present).
[0481] In the kit of the present disclosure, the modified siRNA and the pharmaceutically acceptable carrier and/or excipient, as well as the modified siRNA, the pharmaceutical composition, and/or the siRNA conjugate and/or the conjugate, and/or the pharmaceutically acceptable exceipient may be provided in any form, such as in a liquid form, a dry form or a lyophilized form. In some embodiments, the modified siRNA and the pharmaceutically acceptable carrier and/or excipient, and the pharmaceutical composition and/or conjugate and optional pharmaceutically acceptable excipient(s) are substantially pure and/or sterilized. In some embodiments, sterilized water may be provided in the kit of the present disclosure.
[0482] Hereinafter, the present disclosure will be further illustrated by way of examples, but will not be limited thereto in any respect.
EXAMPLES
[0483] Unless otherwise specified, the reagents and culture media used in following examples are all commercially available, and the procedures used such as nucleic acid electrophoresis and real-time PCR are all performed according to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).
[0484] When the siRNA or the siRNA conjugate against FXI gene synthesized in the present disclosure or the siRNA or the siRNA conjugate as negative control was used to transfect cells, Lipofectamine'2000 (Invitrogen) was used as a transfection reagent. The specific procedures could refer to the instruction provided by the manufacturer.
[0485] C57BL/6N mice: 6-8 weeks old, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., and hereinafter referred to as C57 mice.
[0486] Heterozygous humanized mice: 6-8 weeks old, purchased from Cyagen Biosciences Inc.
[0487] Unless otherwise specified, ratios of reagents provided below are all calculated by volume ratio (v/v).
[0488] Unless otherwise specified, all the experimental data of the effects in vivo/in vitro are expressed as X±SEM, and the data are analyzed with Graphpad prism 5.0 statistical analysis software.
Preparation Example 1
The preparations of Conjugate L10-siFXIf1M1S
[0489] In this Preparation Example, Conjugate L10-siFXIf1M1S was synthesized. This conjugate was an siRNA conjugate formed by conjugating L-9 conjugation molecule to the siRNA No. siFXIf1M1S. The sequence of the siRNA conjugated in this conjugate may be found in Table 3.
[0490] (1-1) Synthesis of Compound L-10:
[0491] Compound L-10 was Synthesized according to the Following Method:
##STR00049## ##STR00050##
[0492] (1-1-1) Synthesis of the Conjugating Terminal Segment GAL-5
##STR00051##
[0493] (1-1-1a) Synthesis of GAL-2
[0494] 100.0 g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS No.: 1772-03-8, purchased from Ning Bo hongxiang bio-chem Co., Ltd., 463.8 mmol) was dissolved in 1000 ml of anhydrous pyridine, to which 540 ml of acetic anhydride (purchased from Enox Inc., 5565.6 mmol) was added in an ice water bath to react under stirring at room temperature for 1.5 hours. The resultant reaction solution was poured into 10 L of ice water and subjected to suction filtration under reduced pressure. The residue was washed with 2 L of ice water, and then added with a mixed solvent of acetonitrile/toluene (v/v ratio of acetonitrile: toluene =1:1) until completely dissolved. The solvent was evaporated to give 130.0 g of product GAL-2 as a white solid.
[0495] (1-1-1b) Synthesis of GAL-3
[0496] GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1-1a) was dissolved in 213 ml of anhydrous 1,2-dichloroethane, to which 24.0 g of TMSOTf (CAS No.: 27607-77-8, purchased from Macklin Inc., 108.0 mmol) was added in an ice water bath under nitrogen atmosphere to react at room temperature overnight.
[0497] The reaction solution was added with 400 ml dichloromethane for dilution, filtered with diatomite, and then added with 1L saturated aqueous sodium bicarbonate solution and stirred evenly. An organic phase was isolated. The aqueous phase remained was extracted twice, each with 300 ml of dichloroethane. The organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate solution and 300 ml of saturated brine, respectively. The organic phase was isolated and dried with anhydrous sodium sulfate. The solvent was evaporated to dryness under reduced pressure to give 26.9 g of product GAL-3 as a light yellow viscous syrup.
[0498] (1-1-1c) Synthesis of GAL-4
[0499] GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1-1b) was dissolved in 136 ml of anhydrous 1,2-dichloroethane, added with 30 g of dry 4A molecular sieve powder followed by 9.0 g of 5-hexen- 1-ol (CAS No.: 821-41-0, purchased from Adamas-beta Inc., 89.9 mmol), and stirred at room temperature for 30 minutes. 9.08 g of TMSOTf (40.9 mmol) was added in an ice bath under nitrogen atmosphere to react under stirring at room temperature overnight. The 4A molecular sieve powder was removed by filtration. The filtrate was added with 300 ml dichloroethane for dilution, filtered with diatomite, and then added with 500 ml of saturated aqueous sodium bicarbonate solution and stirred for 10 minutes for washing. An organic phase was isolated. The aqueous phase was extracted once with 300 ml of dichloroethane. The organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate solution and 300 ml of saturated brine, respectively. The organic phase was isolated and dried with anhydrous sodium sulfate. The solvent was evaporated to dryness under reduced pressure to give 41.3g of product GAL-4 as a yellow syrup, which was directly used in the next oxidation reaction without purification.
[0500] (1-1-1d) Synthesis of GAL-5
[0501] GAL-4 (14.9 g, 34.7 mmol) obtained according to the method described in step (1-1-1c) was dissolved in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile, added with 103 ml of deionized water and 29.7 g of sodium periodate (CAS No.: 7790-28-5, purchased from Aladdin Inc., 138.8 mmol) respectively, and stirred in an ice bath for 10 minutes. Ruthenium trichloride (CAS No.: 14898-67-0, available from Energy Chemical, 238 mg, 1.145 mmol) was added to react at room temperature overnight. The resultant reaction solution was diluted by adding 300 ml of water under stirring, and adjusted to a pH of about 7.5 by adding saturated sodium bicarbonate. The organic phase was isolated and discarded. The aqueous phase was extracted three times, each with 200 ml of dichloromethane, and the organic phase was discarded. The aqueous phase was adjusted to a pH of about 3 with citric acid solids and extracted three times, each with 200 ml of dichloromethane, and the resultant organic phases were combined and dried with anhydrous sodium sulfate. The solvent was evaporated to dryness under reduced pressure to give 6.85 g of product GAL-5 as a white foamy solid. .sup.1H NMR (400 MHz, DMSO) 6 12.01 (br, 1H), 7.83 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.2 Hz, 1H), 4.96 (dd, J=11.2, 3.2 Hz, 1H), 4.49 (d, J=8.4 Hz, 1H), 4.07-3.95 (m, 3H), 3.92-3.85 (m, 1H), 3.74-3.67 (m, 1H), 3.48-3.39 (m, 1H), 2.20 (t, J=6.8 Hz, 2H), 2.11 (s, 3H), 2.00 (s, 3H), 1.90 (s, 3H), 1.77 (s, 3H), 1.55-1.45 (m, 4H).
[0502] (1-1-2) Synthesis of L-8
##STR00052##
[0503] J-0 (9.886 g, 52.5 mmol, purchased from Alfa Aesar Inc.) and GAL-5 (72.819 g, 162.75 mmol, obtained by combining several batches of products) obtained in step (1-1-1) were dissolved in 525 ml of dichloromethane, and added with diisopropylethylamine (DIEA, 44.782 g, 346.50 mmol), benzotriazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate (PyBOP, 90.158 g, 173.25 mmol) and hydroxybenzotriazole (HOBt, 23.410 g, 173.25mmo1) to react at room temperature for 4 hours. The resultant reaction solution was washed by adding 20 ml of saturated sodium bicarbonate solution and 200 ml of saturated brine. The aqueous phase was extracted twice, each with 100 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. Then the solvent was evaporated to dryness under reduced pressure to give a crude product. The crude product was purified by using a normal phase silica gel column (200-300 mesh). The column was added with 10 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with lwt %o triethylamine, and eluted with a gradient elution of dichloromethane: methanol=100:25-100:40. The eluate of product was collected, and the solvent was evaporated to dryness under reduced pressure to give 38.8 g of pure product L-8. .sup.1H NMR (400 MHz, DMSO) 6 7.84 (d, J=9.0 Hz, 3H), 7.27-7.23 (m, 1H), 7.13-7.18 (m, 1H), 5.22 (d, J=3.1 Hz, 3H), 4.97 (dd, J=11.3, 3.1 Hz, 3H), 4.48 (d, J=8.4 Hz, 3H), 4.09-3.98 (m, 9H), 3.88 (dd, J=19.3, 9.3 Hz, 3H), 3.75-3.66 (m, 3H), 3.44-3.38 (m, 3H), 3.17-3.30 (m, 4H), 3.10-2.97 (m, 4H), 2.35-2.20 (m, 6H), 2.15-2.08 (m, 9H), 2.07-1.98 (m, 13H), 1.94-1.87 (m, 9H), 1.81-1.74 (m, 9H), 1.65-1.42 (m, 18H). MS m/z: C85Hii9N7030, [M+H].sup.P, calculated: 1477.59, measured: 1477.23.
[0504] (1-1-3) Synthesis of L-7
[0505] (1-1-3a) Synthesis of A-1
##STR00053##
[0506] DMTrC1 (4,4′-dimethoxytrityl chloride, 101.65 g, 300 mmol) was dissolved in 1000 ml of anhydrous pyridine, and added with calcium DL-glycerate hydrate (28.63 g, 100 mmol) to react at 45° C. for 20 hours. The resultant reaction solution was filtered. The residue was rinsed with 200 ml of DCM, and the filtrate was concentrated to dryness under reduced pressure. The residue was redissolved in 500 ml of dichloromethane and washed twice, each with 200 ml of 0.5 M triethylamine phosphate (pH=7-8). The aqueous phase was extracted twice, each with 200 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was evaporated to dryness under reduced pressure, and the residue was purified by using a normal phase silica gel column (200-300 mesh). The column was eluted with a gradient elution of petroleum ether: ethyl acetate: dichloromethane: methanol=1:1:1:0.35-1:1:1:0.55. The eluate of product was collected, and the solvent was evaporated to dryness under reduced pressure. The residue was redissolved in 600 ml of dichloromethane, and washed once with 200 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted once with 200 ml of dichloromethane. The organic phases were combined, dried with anhydrous sodium sulfate, and filtered. The solvent was evaporated to dryness under reduced pressure, and the residue was subject to a reduced pressure with a vacuum oil pump overnight to give 50.7 g of product A-1 as a white solid. .sup.1-E1 NMR (400 MHz, DMSO-d6) 6 7.46 (ddd, J=6.5, 2.3, 1.1 Hz, 1H), 7.40-7.28 (m, 7H), 6.89-6.81 (m, 4H), 4.84 (d, J=5.0 Hz, 1H), 4.36-4.24 (m, 1H), 4.29 (s, 6H), 3.92 (dd, J=12.4, 7.0 Hz, 1H), 3.67 (dd, J=12.3, 7.0 Hz, 1H), 2.52 (q, J=6.3 Hz, 6H), 1.03 (t, J=6.3 Hz, 9H). MS m/z: C24H2306, EM-Hr, calculated: 407.15, measured: 406.92.
[0507] (1-1-3b) Synthesis of L-7
##STR00054##
[0508] L-8 (40 g, 27.09 mmol, obtained by combining several batches of products) obtained in step (1-1-2) and A-1 (41.418 g, 81.27 mmol) obtained in step (1-1-3a) were mixed and dissolved in 271 ml of dichloromethane, added with 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one (DEPBT) (24.318 g, 81.37 mmol), and further added with diisopropylethylamine (21.007 g, 162.54 mmol) to react under stirring at 25° C. for 1.5 hours. The organic phase was washed with 800 ml of saturated sodium bicarbonate. The aqueous phase was extracted three times, each with 50 ml of dichloromethane. The organic phase was washed with 150 ml of saturated brine, and the aqueous phase was extracted once with 50 ml of dichloromethane, and the organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was evaporated to dryness under reduced pressure, and the residue was foam-dried with a vacuum oil pump overnight to give a crude product. The crude product was subjected to a column purification. The column was filled with 2 kg normal phase silica gel (200-300 mesh), added with 200 ml triethylamine for neutralizing the acidity of silica gel, equilibrated with petroleum ether containing 1 wt % triethylamine, and eluted with a gradient elution of petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide =1:1:1:0.5-1:1:1:0.6. The eluate of product was collected, and the solvent was evaporated to dryness under reduced pressure to give 40.4 g of pure product L-7. .sup.iH NMR (400 MHz, DMSO) 67.90-7.78 (m, 4H), 7.75-7.64 (m, 1H), 7.38-7.18 (m, 9H), 6.91-6.83 (m, 4H), 5.25-5.10 (m, 4H), 4.97 (dd, J=11.2, 3.2 Hz, 3H), 4.48-4.30 (m, 4H), 4.02 (s, 9H), 3.93-3.84 (m, 3H), 3.76-3.66 (m, 9H), 3.45-3.35 (m, 3H), 3.24-2.98 (m, 10H), 2.30-2.20 (m, 2H), 2.11-1.88 (m, 31H), 1.80-1.40 (m, 28H). MS m/z: C.sub.90E1128N7035, [M-DMT1].sup.+, calculated: 1564.65, measured: 1564.88.
[0509] (1-1-4) Synthesis of L-9
##STR00055##
[0510] L-7 (40 g, 21.4247 mmol) obtained in step (1-1-3b), succinic anhydride (4.288 g, 42.8494 mmol) and 4-dimethylaminopyridine (DMAP, 5.235 g, 42.8494 mmol) were mixed and dissolved in 215 ml of dichloromethane, further added with diisopropylethylamine (DIEA, 13.845 g, 107.1235 mmol), and stirred at 25° C. for 24 hours. The resultant reaction solution was washed with 800 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each with 5 ml of dichloromethane. The organic phases were combined and evaporated to dryness under reduced pressure to give a crude product. The crude product was subjected to a column purification. The columan was filled with 1 kg normal phase silica gel (200-300 mesh), added with 1 wt % triethylamine for neutralizing the acidity of silica gel, equilibrated with dichloromethane, and eluted with a gradient elution of lwt %o triethylamine-containing dichloromethane: methanol =100:18-100:20. The eluate of product was collected, and the solvent was evaporated to dryness under reduced pressure to give 31.0 g of pure product L-9 conjugation molecule. .sup.1-El NMR (400 MHz, DMSO) 6 8.58 (d, J=4.2 Hz, 1H), 7.94-7.82 (m, 3H), 7.41-7.29 (m, 5H), 7.22 (d, J=8.1 Hz, 5H), 6.89 (d, J=8.3 Hz, 4H), 5.49-5.37 (m, 1H), 5.21 (d, J=3.0 Hz, 3H), 4.97 (d, J=11.1 Hz, 3H), 4.49 (d, J=8.2 Hz, 3H), 4.02 (s, 9H), 3.88 (dd, J=19.4, 9.4 Hz, 3H), 3.77-3.65 (m, 9H), 3.50-3.39 (m, 6H), 3.11-2.90 (m, 5H), 2.61 — 2.54 (m, 4H), 2.47-2.41 (m, 2H), 2.26-2.17 (m, 2H), 2.15-1.95 (m, 22H), 1.92-1.84 (m, 9H), 1.80-1.70 (m, 10H), 1.65-1.35 (m, 17H), 1.31-1.19 (m, 4H), 0.96 (t, J=7.1 Hz, 9H). MS m/z: C94Hi32N7038, [M-DMTr].sup.+, calculated: 1664.72, measured: 1665.03.
[0511] (1-1-5) Synthesis of Compound L-10
##STR00056##
[0512] In this step, Compound L-10 was prepared by linking the L-9 conjugation molecule to a solid phase support.
[0513] The L-9 conjugation molecule (22.751 g, 11 mmol) obtained in step (1-1-4), O-benzotriazol-tetramethyluronium hexafluorophosphate (HBTU, 6.257 g, 16.5 mmol) and diisopropylethylamine (DIEA, 2.843 g, 22 mmol) were mixed and dissolved in 900 ml of acetonitrile, and stirred at room temperature for 5 minutes. The resultant reaction solution was added with Aminomethyl resin (88 g, 100-200 mesh, amino loading: 400 μmol/g, purchased from Tianjin Nankai HECHENG S&T Co., Ltd.). A reaction was performed on a shaker at 25° C. and at a rotation speed of 150 rpm/min for 18 hours, followed by filtration. The residue was rinsed twice (each with 300 ml of DCM) and three times (each with 300 ml of acetonitrile), and dried with a vacuum oil pump for 18 hours. Then starting materials (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) were added according to the charge ratio as shown in Table 2 for a capping reaction. The reaction was performed on a shaker at 25° C. and at a rotation speed of 150 rpm/min for 5 hours. The reaction liquid was filtered. The residue was rinsed three times, each with 300 ml of acetonitrile. The solvent was evaporated to dryness under reduced pressure, and the residue was dried under reduced pressure with a vacuum oil pump overnight to give 102 g of Compound L-10 (i.e., the L-9 conjugation molecule linked to a solid phase support), with a loading of 90.8 μmol/g.
TABLE-US-00055 TABLE 2 The charge ratio of capping reaction Starting Materials Amount Specs Lot No. Manufacturer CapA 1980 ml — — — CapB 220 ml — — — DMAP 1.100 g analytical pure I1422139 Aladdin Acetonitrile 220 ml spectroscopic pure O15161001 CINC (Shanghai) Co., Ltd
[0514] In the above table, Cap A and Cap B are solutions of capping agents. Cap A is a mixed solution of 20% by volume of N-methylimidazole in pyridine/acetonitrile, wherein the volume ratio of pyridine to acetonitrile is 3:5. Cap B is a solution of 20% by volume of acetic anhydride in acetonitrile.
[0515] (1-2) Synthesis of Sense Strand of Conjugate L10-siFXIf1M1S
[0516] Nucleoside monomers were linked one by one in 3′ to 5′ direction according to the arrangement sequences of nucleotides in the sense strand by the phosphoramidite solid phase synthesis method, starting the cycles from the Compound L-10 prepared in the above step. The linking of each nucleoside monomer included a four-step reaction of deprotection, coupling, capping, and oxidation or sulfurization. Therein, when two nucleotides are linked via a phosphoester linkage, a four-step reaction of deprotection, coupling, capping, and oxidation was included during linking of the later nucleoside monomer; and when two nucleotides is linked via a phosphorothioate linkage, a four-step reaction of deprotection, coupling, capping, and sulfurization was included during linking of the later nucleoside monomer. The synthesis conditions are given as follows.
[0517] The nucleoside monomers are provided in a 0.1 M acetonitrile solution. The condition for deprotection reaction in each step is identical, i.e., a temperature of 25° C., a reaction time of 70 seconds, a solution of dichloroacetic acid in dichloromethane (3% v/v) as a deprotection reagent, and a molar ratio of dichloroacetic acid to the protection group 4,4′-dimethoxytrityl on the solid phase support of 5:1.
[0518] The condition for coupling reaction in each step is identical, including a temperature of 25° C., a molar ratio of the nucleic acid sequence linked to the solid phase support to nucleoside monomers of 1:10, a molar ratio of the nucleic acid sequence linked to the solid phase support to a coupling reagent of 1:65, a reaction time of 600 seconds, and 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole (ETT) as a coupling reagent.
[0519] The condition for capping reaction in each step is identical, including a temperature of 25° C., a reaction time of 15 seconds, a mixed solution of Cap A and Cap B in a molar ratio of 1:1 as a solution of capping agent, and a molar ratio of the capping agent to the nucleic acid sequence linked to the solid phase support of 1:1:1 (acetic anhydride: N-methylimidazole: the nucleic acid sequence linked to the solid phase support).
[0520] The condition for oxidation reaction in each step is identical, including a temperature of 25° C., a reaction time of 15 seconds, and 0.05 M iodine water as an oxidation reagent; and a molar ratio of iodine to the nucleic acid sequence linked to the solid phase support in the coupling step of 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran: water: pyridine =3:1:1.
[0521] The condition for sulfurization reaction in each step is identical, including a temperature of 25° C., a reaction time of 300 seconds, and xanthane hydride as a sulfurization reagent; and a molar ratio of the sulfurization reagent to the nucleic acid sequence linked to the solid phase support in the coupling step of 120:1. The reaction is carried out in a mixed solvent of acetonitrile: pyridine=1.1.
[0522] After the linking of the last nucleoside monomer was completed, the nucleic acid sequence linked to the solid phase support was cleaved, deprotected, purified, desalted in turn, and then lyophilized to obtain the sense strand, wherein:
[0523] The conditions for cleavage and deprotection are as follows: adding the synthesized nucleotide sequence linked to the support into 25 wt % aqueous ammonia to react at 55° C. for 16 hours, wherein the amount of the aqueous ammonia is 0.5 ml4tmol. The liquid was removed by filtration, and the supernatant was concentrated to dryness in vacuum.
[0524] The conditions for purification and desalination were as follows: purification of the nucleic acid was achieved by using a preparative ion chromatography purification column (Source 15Q) with a gradient elution of NaCl. Specifically, eluent A: 20 mM sodium phosphate (pH 8.1), solvent: water/acetonitrile=9:1 (v/v); eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH 8.1), solvent: water/acetonitrile=9:1 (v/v); elution gradient: the ratio of eluent A: eluent B=100:0-50:50. The eluate of product was collected, combined and desalted by using a reverse phase chromatography purification column. The specific condition includes: using a Sephadex column for desalination with Sephadex-G25 as the filler and eluting with deionized water.
[0525] The detection method is described as follows: the purity of the above sense strand was determined by ion exchange chromatography (IEX-HPLC); and the molecular weight was analyzed by Liquid Chromatography-Mass Spectrometry (LC-MS), with the calculated value being 7584.5 and the measured value being 7584.0. The result that the measured value was in conformity with the calculated value indicates that the sense strand SS conjugated with L-9 conjugation molecule at 3′ terminal was synthesized.
[0526] (1-3) Synthesis of Antisense Strand of Conjugate L10-siFXIf1M1S
[0527] Antisense strand of Conjugate L10-siFXIf1M1S was synthesized by the phosphoramidite solid phase synthesis method, starting the cycles from a universal solid phase support (UnyLinker™ loaded NittoPhase®HL Solid Supports, Kinovate Life Sciences Inc.). The reaction conditions of deprotection, coupling, capping, oxidation or sulfurization, cleavage and deprotection, and purification and desalting in the solid phase synthesis method were the same as those used for the synthesis of the sense strand. The antisense strand AS was obtained by lyophilization.
[0528] The purity of the antisense strand was detected by ion exchange chromatography (IEX-HPLC); and the molecular weight of the antisense strand was analyzed by liquid chromatography-mass spectrometry (LC-MS). The result that the measured value was in conformity with the calculated value indicates that the antisense strand AS having the target sequence was synthesized.
[0529] (1-4) Synthesis of Conjugate L10-siFXIf1M1S
[0530] For Conjugate L10-siFXIf1M1S, the sense strand and antisense strand were respectively dissolved in water for injection to give a solution of 40 mg/mL. They were mixed in an equimolar ratio, heated at 50° C. for 15 min, cooled at room temperature to produce an annealed product, and then lyophilized to give a lyophilized powder. After the conjugate was diluted to a concentration of 0.2 mg/mL with ultra-pure water (Milli-Q ultra-pure water instrument, with resistivity of 18.2MS2*cm (25° C.)), the molecular weight was determined by a liquid chromatography-mass spectrometry (LC-MS) (purchased from Waters Corp., model: LCT Premier). The result that the measured value was in conformity with the calculated value indicates that the synthesized siRNA conjugate was the designed target double-stranded nucleic acid sequence with the L-9 conjugation molecule. The siRNA conjugate has a structure as shown by Formula (403). The siRNA has the sequence corresponding to Conjugate L10-siFXIf1M1S as shown in Table 3.
TABLE-US-00056 TABLE 3 siRNA conjugates SEQ Preparation ID Example No. Conjugate Sequence direction 5′-3′ NO Preparation L10- Sense GmsUmsAmCmGmUmGfGfAfCmUmGmGm 541 Example 1 siFXIf1 strand AmUmUmCmUmGm M1S Antisense CmsAfsGmAmAmUfCmCmAmGmUmCmC 542 strand mAfCmGfUmAmCmsUmsUm Preparation L10- Sense GmsGmsGmUmAmUmUfCfUfUmUmCmAm 543 Example 2 siFXIa1 strand AmGmCmAmAmUm M1SP Antisense PAmsUfsUmGmCmUfUmGmAmAmAmGm 544 strand AmAfUmAfCmCmCmsAmsGm Preparation L10- Sense GmsGmsCmAmUmAmAfAfCfUmAmUmAm 545 Example 3 siFXIb1 strand AmCmAmGmCmUm M1SP Antisense PAmsGfsCmUmGmUfUmAmUmAmGmUm 546 strand UmUfAmUfGmCmCmsCmsUm Preparation L10- Sense GmsCmsUmCmAmAmGfAfAfUmGmCmCm 547 Example 4 siFXIc1 strand AmAmGmAmAmAm M1SP Antisense PUmsUfsUmCmUmUfGmGmCmAmUmUm 548 strand CmUfUmGfAmGmCmsAmsCm Preparation L10- Sense GmsCmsAmAmCmAmAfAfGfAmCmAmUm 549 Example 5 siFXId1 strand UmUmAmUmGmUm M1SP Antisense PAmsCfsAmUmAmAfAmUmGmUmCmUm 550 strand UmUfGmUfUmGmCmsAmsAm Preparation L10- Sense GmsAmsAmUmCmUmCfAfAfAmGmAmAm 551 Example 6 siFXIe1 strand AmUmCmUmUmUm M1SP Antisense PAmsAfsAmGmAmUfUmUmCmUmUmUm 552 strand GmAfGmAfUmUmCmsUmsUm Preparation L10- Sense AmsUmsUmUmCmUmGfGfGfUmAmUmU 553 Example 7 siFXIg1 strand mCmUmUmUmCmAm M1SP Antisense PUmsGfsAmAmAmGfAmAmUmAmCmCm 554 strand CmAfGmAfAmAmUmsCmsGm Preparation L10- Sense CmsAmsUmGmAmAmGfGfGfCmAmUmAm 555 Example 8 siFXIh1 strand AmAmCmUmAmUm M1SP Antisense PAmsUfsAmGmUmUfUmAmUmGmCmCm 556 strand CmUfUmCfAmUmGmsUmsCm Preparation L10- Sense GmsGmsAmUmUmCmUfGfGfAmGmAmA 557 Example 9 siFXIi1 strand mAmAmCmUmCmAm M1S Antisense UmsGfsAmGmUmUfUmUmCmUmCmCmA 558 strand mGfAmAfUmCmCmsAmsGm Preparation L10- Sense GmsGmsAmUmUmCmUfGfGfAmGmAmA 559 Example 10 siFXIi1 strand mAmAmCmUmCmAm M1SP Antisense PUmsGfsAmGmUmUfUmUmCmUmCmCm 560 strand AmGfAmAfUmCmCmsAmsGm
[0531] wherein, C, G, U, and A represent the base composition of a nucleotide; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; s represents the two nucleotides adjacent to both sides of the letter s are linked by a thiophosphate linkage; and P represents that the nucleotide adjacent to the right side of the letter P is a 5′-phosphate nucleotide.
[0532] Preparation Examples 2 to 10: Synthesis of the siRNA conjugates of the present disclosure
[0533] The siRNA conjugates of the present disclosure: L10-siFXIa1M1SP, L10-siFX1b1M1SP, L10-siFXIc1M1 SP, L10-siFXId1M1 SP, L10-siFXIe1M1 SP, L10-siFXIg1M1 SP, L10-siFXIh1M1 SP, L10-siFXIi1M1S and L10-siFXIi1M1SP (which had the sequences corresponding to siFXIa 1M1 SP, siFX1b1M1 SP, siFXIc1M1 SP, siFXId1M1 SP, siFXIe1M1 SP, siFXIg1M1 SP, siFXIh1M1SP, siFXIi1M1S and siFXIi1M1SP as shown in Table 3, respectively) were further synthesized respectively by the same methods as described in Preparation Example 1, except that (1) the sequences of the sense strand and antisense strand of Conjugate L10-siFXIf1M1S were replaced with those of the sense strands and antisense strands of the conjugates as shown in Table 3, respectively; and (2) as for Conjugates L10-siFXIa1M1SP, L10-siFXIb1M1SP, L10-siFXIc1M1 SP, L10-siFXId1M1 SP, L10-siFXIe1M1 SP, L 1 0-siFXIg1M1 SP, L 1 0-siFXIh1M1 SP and L10-siFXIi1M1SP, the first nucleotide at the 5′ terminal of their antisense strands was a 5′-phosphate nucleotide; correspondingly, during preparation of the antisense strands according to the phosphoramidite solid phase synthesis method, after the linking of the last nucleoside monomer, the monomer of Formula (CPR-I) (purchased from Suzhou GenePharma Inc. as Cat#13-2601-XX) was linked to the 5′ terminal of the antisense strand by a four-step reaction of deprotection, coupling, capping, and oxidation, so as to form a 5′-phosphate nucleotide.
##STR00057##
[0534] During the linking, the conditions of deprotection, coupling, capping and oxidation used were the same as those used in the synthesis of the sense strand. After having been completely linked, the sequence was further cleaved, deprotected, purified, desalted, and finally lyophilized to obtain the antisense strand AS.
[0535] After the conjugates had been prepared, their molecular weights were determined by the same method as in Preparation Example 1, respectively. The results showed that the measured values were in conformity with the calculated values, indicating that the synthesized siRNA conjugates were the designed target double-stranded nucleic acid sequences with the L-9 conjugation molecule and had the structure as shown by Formula (403). The siRNAs contained in these conjugates have the sequences corresponding to Conjugates L10-siFXIa1M1SP, L10-siFXIb1M1 SP, L10-siFXIc1M1 SP, L10-siFXId1M1 SP, L10-siFXIe1M1 SP, L10-siFXIg1M1 SP, L10-siFXIh1M1SP, L10-siFXIi1M1S or L10-siFXIi1M1SP as shown in Table 3.
Preparation Examples 11 to 20
Synthesis of the siRNAs of the Present Disclosure
[0536] The siRNA sequences as listed in Table 4 were synthesized by the solid phase synthesis method, respectively, and their molecular weights were determined. The sense strands and antisense strands, which were present in an equimolar ratio and complementary to one another as shown in Table 4, were dissolved in DEPC water, and then annealed to obtain the siRNAs of the present disclosure: siFXIa1M1 SP, siFXIb1M1 SP, siFXIc1M1 SP, siFXId1M1 SP, siFXIe1M1 SP, siFXIf1M1SP, siFXIg1M1SP, siFXIh1M1SP, siFXIi1M1SP, and siFXlel, as shown in Table 4.
[0537] During the preparation of the sequence siFXlel, the target sequence comprises an unmodified nucleotide. In this case, under the cleavage and deprotection conditions, after treatment with aqueous ammonia, the product was dissolved in 0.4 ml/μmol of N-methylpyrrolidone, followed by addition of 0.3 ml/μmol of triethylamine and 0.6 ml/μmol of triethylamine trihydrofluoride, based on the amount of the single-strand nucleic acid, thereby removing the 2′-TBDMS protection on ribose.
[0538] Moreover, in the case where the first nucleotide at the 5′ terminal of the antisense strand in the target sequence was a 5′-phosphate nucleotide, during preparation of the antisense strand according to the phosphoramidite solid phase synthesis method, after the linking of the last nucleoside monomer in the antisense strand, the monomer of Formula (CPR-I) (purchased from Suzhou GenePharma Inc. as Cat#13-2601-XX) was linked to the 5′ terminal of the antisense strand by a four-step reaction of deprotection, coupling, capping, and oxidation, so as to form a 5′-phosphate nucleotide.
##STR00058##
[0539] During the linking, the conditions of deprotection, coupling, capping and oxidation used were the same as those used in the synthesis of the sense strand. After having been completely linked, the sequence was further cleaved, deprotected, purified, desalted, and finally lyophilized to obtain the antisense strand AS.
Comparative Preparation Example 1
Synthesis of Comparative siRNA
[0540] The sense strand and anti sense strand of the siRNA numbered as NC in Table 4 were synthesized by the solid phase synthesis method, respectively, and their molecular weights were determined. The sense strand and antisense strand, which were present in an equimolar ratio, were dissolved in DEPC water and then annealed to obtain the comparative siRNA numbered as NC.
TABLE-US-00057 TABLE 4 siRNA sequences Preparation Example SEQ ID NO. NO. Sequence direction 5′-3′ NO Preparation siFXIa1 Sense GmsGmsGmUmAmUmUfCfUfUmUmCm 543 Example 11 M1SP strand AmAmGmCmAmAmUm Antisense PAmsUfsUmGmCmUfUmGmAmAmAmG 544 strand mAmAfUmAfCmCmCmsAmsGm Preparation siFXIb1 Sense GmsGmsCmAmUmAmAfAfCfUmAmUm 545 Example 12 M1SP strand AmAmCmAmGmCmUm Antisense PAmsGfsCmUmGmUfUmAmUmAmGmU 546 strand mUmUfAmUfGmCmCmsCmsUm Preparation siFXIc1 Sense GmsCmsUmCmAmAmGfAfAfUmGmCmC 547 Example 13 M1SP strand mAmAmGmAmAmAm Antisense PUmsUfsUmCmUmUfGmGmCmAmUmU 548 strand mCmUfUmGfAmGmCmsAmsCm Preparation siFXId1 Sense GmsCmsAmAmCmAmAfAfGfAmCmAmU 549 Example 14 M1SP strand mUmUmAmUmGmUm Antisense PAmsCfsAmUmAmAfAmUmGmUmCmU 550 strand mUmUfGmUfUmGmCmsAmsAm Preparation siFXIe1 Sense GmsAmsAmUmCmUmCfAfAfAmGmAm 551 Example 15 M1SP strand AmAmUmCmUmUmUm Antisense PAmsAfsAmGmAmUfUmUmCmUmUmU 552 strand mGmAfGmAfUmUmCmsUmsUm Preparation siFXIf1 Sense GmsUmsAmCmGmUmGfGfAfCmUmGm 541 Example 16 M1SP strand GmAmUmUmCmUmGm Antisense PCmsAfsGmAmAmUfCmCmAmGmUmC 542 strand mCmAfCmGfUmAmCmsUmsUm Preparation siFXIg1 Sense AmsUmsUmUmCmUmGfGfGfUmAmUm 553 Example 17 M1SP strand UmCmUmUmUmCmAm Antisense PUmsGfsAmAmAmGfAmAmUmAmCmC 554 strand mCmAfGmAfAmAmUmsCmsGm Preparation siFXIh1 Sense CmsAmsUmGmAmAmGfGfGfCmAmUm 555 Example 18 M1SP strand AmAmAmCmUmAmUm Antisense PAmsUfsAmGmUmUfUmAmUmGmCmC 556 strand mCmUfUmCfAmUmGmsUmsCm Preparation siFXIi1 Sense GmsGmsAmUmUmCmUfGfGfAmGmAm 559 Example 19 M1SP strand AmAmAmCmUmCmAm Antisense PUmsGfsAmGmUmUfUmUmCmUmCmC 560 strand mAmGfAmAfUmCmCmsAmsGm Preparation siFXIe1 Sense GAAUCUCAAAGAAAUCUUU 561 Example 20 strand Antisense AAAGAUUUCUUUGAGAUUC 562 strand Comparative NC Sense UmsUmsCmUmCmCmGfAfAfCmGmUmG 563 Preparation strand mUmCmAmCmGmUm Example 1 Antisense AmsCfsGmUmGmAfCmAmCmGmUmUm 564 strand CmGfGmAfGmAmAmsCmsUm
wherein, C, G, U, and A represent the base composition of a nucleotide; m represents that the nucleotide adjacent to the left side of the letter m is a methoxy modified nucleotide; f represents that the nucleotide adjacent to the left side of the letter f is a fluoro modified nucleotide; s represents the two nucleotides adjacent to both sides of the letter s are linked by a thiophosphate linkage; and P represents that the nucleotide adjacent to the right side of the letter P is a 5′-phosphate nucleotide.
[0541] After the above siRNAs or conjugates of the present disclosure having been completely prepared, they were lyophilized into solid powder and stored until use. When in use, they may be reconstituted with water for injection, normal saline (NS), phosphate buffer (PB) or phosphate salt buffer (PBS) to a solution at the desired concentration.
Experimental Example 1
Inhibitory Activity In Vitro of the siRNAs of the Present Disclosure
[0542] HEK293A cells (phurchased from Nanjing Cobioer Biosciences Co., LTD) were cultured in DMEM complete media (Hyclone company) containing 10% fetal bovine serum (FBS, Hyclone company), and 0.2v % Penicillin-Streptomycin (Gibco, Invitrogen company) at 37° C. in an incubator containing 5% CO.sub.2/95% air.
[0543] According to the method described by Kumico Ui-Tei et. al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2151, plasmids for detection were constructed and co-transfected with the siRNA (siFXlel) to be evaluated into HEK293A cells; and the inhibitory activities of the siRNAs were reflected by the expression levels of the dual luciferase reporter gene. The specific steps are as follows:
[0544] [1] Construction of Plasmid for Detection
[0545] The plasmid for detection was constructed using psiCHECK™-2 (Promega™) plasmid. This plasmid contains a target sequence, i.e., siRNA target sequence. The siRNAs to be detected have the target sequence shown below. In particular, the siFXlel (prepared from Preparation Example 20) has the following target sequence:
TABLE-US-00058 (SEQ ID NO: 565) GAATCTCAAAGAAATCTTT.
[0546] The target sequence was cloned into the Xho I/Not I site of the psiCHECK™-2 plasmid.
[0547] [2] Transfection
[0548] HEK293A cells were inoculated in a 96-well plate at 8×10.sup.3 cells/well. After 16 hours, the cell growth density reached 70 to 80%. At that time, the H-DMEM complete media in the culture wells were aspirated. An 80 μlOpti-MEM medium (GIBCO company) was added to each well and further cultured for 1.5 h.
[0549] The above plasmid for detection was diluted with DEPC-treated water to give a 200 ng/μl working solution with the plasmid for detection; the siFXlel was prepared with DEPC-treated water into siRNA working solutions at the concentrations of 10 nM and 3 nM (based on the amount of siRNA), respectively.
[0550] 1A1 solution was prepared. Each portion of the 1A1 solution contains 1 μl of siRNA working solution at a concentration of 10 nM, 0.05 μlof the working solution with the plasmid for detection (containing 10 ng of plasmid for detection) and 10.sub.1A1 of Opti-MEM medium.
[0551] 1A2 solution was prepared. Each portion of the 1A2 solution contains 1 μl of siRNA working solution at a concentration of 3 nM, 0.05 μlof the working solution with the plasmid for detection (containing 10 ng of plasmid for detection) and 10.sub.1A1 of Opti-MEM medium.
[0552] 1B solution was prepared. Each portion of the 1B solution contains 0.2 .sub.1.1,1 of Lipofectamine™ 2000 and 10 μl of Opti-MEM medium.
[0553] 1C solution was prepared. Each portion of the 1C solution contains 0.05 .sub.1.1,1 of the working solution with the plasmid for detection (containing 10 ng of plasmid for detection) and 10 μl of Opti-MEM medium
[0554] One portion of the 1B solution was mixed with one portion of the 1A1 solution or one portion of the 1A2 solution, respectively. The mixed solution was incubated for 20 min at room temperature to form transfection complexes 1X1 and 1X2. One portion of the 1B solution was mixed with one portion of the 1C solution, and the mixed solution was incubated for 20 min at room temperature to form transfection complex 1X3.
[0555] The transfection complex 1X1 was added in an amount of 20 μl/well to three culture wells, respectively, and then mixed evenly to give a co-transfection mixture at a final siRNA concentration of 0.1 nM (recorded as test group 1).
[0556] The transfection complex 1X2 was added in an amount of 20 μl/well to three additional culture wells, respectively, and then mixed evenly to give a co-transfection mixture at a final siRNA concentration of 0.03 nM (recorded as test group 2).
[0557] The transfection complex 1X3 was added in an amount of 20 μl/well to three additional culture wells, respectively, to give an siRNA-free transfection mixture (recorded as the control group).
[0558] After the siRNA-containing co-transfection mixtures and the siRNA-free transfection mixture were co-transfected in the culture wells for 4 hours, each well was supplemented with 100 μl of H-DMEM complete medium containing 20% FBS. The 96-well plate was placed in a CO.sub.2 incubator and further cultured for 24 hours.
[0559] [3] Detection
[0560] The media in the culture wells were aspirated. 150 μl of the mixed solution of Dual-Gb® Luciferase reagent and H-DMEM (in a volume ratio of 1:1) was added to each well, and thoroughly blended. After incubation for 10 minutes at room temperature, 120 μl of the mixed solution was transfered to a 96-well ELISA plate. The chemiluminescence value of Firefly (Fir) in each well of the ELISA plate was read using a Synergy II multimode microplate reader (BioTek company). Then, 60 μl of Dual-Gb® Stop & Glo° reagent was added to each well of the ELISA plate, and thoroughly blended. After incubation at room temperature for 10 minutes, the chemiluminescence value of Renilla (Ren) in each well of the ELISA plate was read using the microplate reader according to the arrangement for reading Fir.
[0561] The luminescence ratio (Ratio=Ren/Fir) of each well was caculated, and the luminescence ratio ((Ratio (test) or Ratio (control)) of each test group or control group was the mean value of the Ratios of the three culture wells. Using the luminescence ratio of the control group as the reference value, the luminescence ratio of each test group was normalized to obtain the ratio R of Ratio (test)/Ratio (control), which represents the expression level, i.e., the residual activity, of the reporter gene Renilla. The inhibition rate of siRNA was (1-R)×100%.
[0562] The inhibitory activity results of siFXIe1 at different concentrations against the target sequence were as shown in Table 5.
Comparative Experimental Example 1
Inhibitory Activity In Vitro of Comparative siRNA NC
[0563] The inhibitory activity of the comparative siRNA NC in the psiCHECK system was investigated by the same method as described in Experimental Example 1 except that the siRNA to be tested was replaced with the comparative siRNA NC. The results were as shown in Table 5.
TABLE-US-00059 TABLE 5 Inhibition rate against the target sequence Inhibition rate (%) against the target sequence Preparation Example No. NO. 0.1 nM 0.03 nM Preparation Example 20 siFXIe1 72.43 35.75 Comparative Preparation NC −3.64 8.91 Example 1
[0564] The results indicated that siFXlel exhibited good concentration-dependent inhibitory activity in vitro against the target sequence at the respective concentration. In particular, the inhibition rate of siFXle1 against the target sequence at the siRNA concentration of 0.1 nM was 72.43%, showing good effect of inhibiting the expression of FXI gene.
Experimental Example 2
Measuring IC.SUB.50 .of siRNA Sequences Against FXI mRNA in the psiCHECK System
[0565] In this experimental example, IC.sub.50 values of siFXIa1M1SP, siFXIb1M1SP, siFXIc1M1SP, siFXId1M1SP, siFXIe1M1SP and siFXIi1M1SP in the psiCHECK system in vitro were investigated.
[0566] According to the method described by Kumico Ui-Tei et. al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2151, the plasmids for detection were constructed and co-transfected with the siRNAs to be detected into HepG2 cells; and the on-target activities and off-target effects of of the siRNAs were reflected by the expression levels of the dual luciferase reporter gene. The specific steps are as follows:
[1] Construction of Plasmid for Detection
[0567] The plasmid for detection was constructed using psiCHECK™-2 (Promega™) plasmid. This plasmid contains a target sequence, which was the sequence as shown in Genbank Accession No. NM_000128.3.
[0568] The target sequence was cloned into the Xho I/Not I site of the psiCHECK™-2 plasmid.
[2] Cell Culture and Transfection
[0569] HepG2 cells (phurchased from GuangZhou Jennio Biotech Co., Ltd) were cultured in DMEM complete media (Hyclone company) containing 20% fetal bovine serum (FBS, Hyclone company), and 0.2v % Penicillin-Streptomycin (Gibco, Invitrogen company) at 37° C. in an incubator containing 5% CO.sub.2/95% air.
[0570] HepG2 cells were inoculated in a 96-well plate at 8×10.sup.3 cells/well. After 16 hours, the cell growth density reached 70 to 80%. At that time, the H-DMEM complete media in the culture wells were aspirated. An 80 μl Opti-MEM medium (GIBCO company) was added to each well and further cultured for 1.5 h.
[0571] The above plasmid for detection was diluted with DEPC-treated water to give a 200 ng/μl working solution with the plasmid for detection; each of the following siRNAs was prepared with DEPC-treated water into siRNA working solutions at 10 different concentrations of 100 nM, 33.3 nM, 11.1 nM, 3.70 nM, 1.23 nM, 4.12 nM, 0.137 nM, 0.0457 nM, 0.0152 nM and 0.00508 nM, respectively. The siRNAs used are siFXIa1M1SP, siFXIb1M1SP, siFXIc1M1SP, siFXId1M1 SP, siFXIe1M1 SP and siFXli1M1 SP, respectively.
[0572] For each siRNA, 2A1 to 2A10 solutions were prepared, respectively. Each portion of the 2A1 to 2A10 solutions contains 1 μlof each of the siRNA working solutions at the above 10 concentrations, 0.05 μl of the working solution with the plasmid for detection (containing 10 ng of plasmid for detection) and 10 μl of Opti-MEM medium.
[0573] One portion of the 1B solution was mixed with one portion of the obtained 2A1 to 2A10 solutions for each siRNA, respectively. The mixed solution was incubated for 20 min at room temperature to form transfection complexes 2X1 to 2X10 for each siRNA.
[0574] The transfection complexes 2X1 to 2X10 for each siRNA were added in an amount of 20 μl/well to the culture wells, respectively, and then mixed evenly to give transfection complexes at final concentrations of about 1 nM, 0.333 nM, 0.111 nM, 0.0370 nM, 0.0123 nM, 0.00412 nM, 0.00137 nM, 0.000457 nM, 0.000152 nM, and 0.0000508 nM for each siRNA. The transfection complexes 2X1 to 2X10 for each siRNA were transfected respectively in three culture cells to give siRNA-containing co-transfection mixtures (recorded as the test groups).
[0575] The transfection complex 1X3 was added in an amount of 20 μl/well to three additional culture wells, respectively, to give an siRNA-free co-transfection mixture (recorded as the control group).
[0576] After the siRNA-containing co-transfection mixtures and the siRNA-free co-transfection mixture were transfected in the culture wells for 4 hours, each well was supplemented with 100 pi of H-DMEM complete medium containing 20% FBS. The 96-well plate was placed in a CO.sub.2 incubator and further cultured for 24 hours.
[0577] [3] Detection
[0578] The media in the culture wells were aspirated. 150 μl of the mixed solution of Dual-Gb® Luciferase reagent and H-DMEM (in a volume ratio of 1:1) was added to each well, and thoroughly blended. After incubation for 10 minutes at room temperature, 120 μl of the mixed solution was transfered to a 96-well ELISA plate. The chemiluminescence value of Firefly (Fir) in each well of the ELISA plate was read using a Synergy II multimode microplate reader (BioTek company). Then, 60 μl of Dual-Gb® Stop & Glo® reagent was added to each well of the ELISA plate, and thoroughly blended. After incubation at room temperature for 10 minutes, the chemiluminescence value of Renilla (Ren) in each well of the ELISA plate was read using the microplate reader according to the arrangement for reading Fir.
[0579] The luminescence ratio (Ratio=Ren/Fir) of each well was caculated, and the luminescence ratio ((Ratio (test) or Ratio (control)) of each test group or control group was the mean value of the Ratios of the three culture wells. Using the luminescence ratio of the control group as the reference value, the luminescence ratio of each test group was normalized to obtain the ratio R of Ratio (test)/Ratio (control), which represents the expression level, i.e., the residual activity, of the reporter gene Renilla. The inhibition rate of siRNA was (1−R)×100%.
[0580] The dose-response curves were fitted using the function log(inhibitor) vs. response—Variable slope of Graphpad 5.0 software. The IC.sub.50 values of the siRNA targeting GSCM were calculated based on the dose-response curve. In particular, the fitted dose-response curves complied with the formula below:
wherein: [0581] Y is the ratio R, i.e., the residual activity, [0582] X is the logarithm of the concentration of transfected siRNAs, [0583] Bot is the Y value at the bottom of the steady stage, [0584] Top is the Y value at the top of the steady stage, [0585] X′ is the X value obtained by fitting at which Y is the median value between the bottom and the top, and Hill Slope is the slope of the curve by fitting at X′.
[0586] When Y=50% the corresponding X50 value was determined based on the dose-response curve and the corresponding calculation formula. The IC.sub.50 value of each siRNA was calculated to be 10{circumflex over ( )}X.sub.50.
[0587] The specific IC.sub.50 values were summarized in Table 6.
TABLE-US-00060 TABLE 6 The IC.sub.50 values of siRNAs Preparation Example No. siRNA NO. IC.sub.50 Preparation siFXIa1M1SP 0.024 nM Example 11 Preparation siFXIb1M1SP 0.078 nM Example 12 Preparation siFXIc1M1SP 0.119 nM Example 13 Preparation siFXId1M1SP 0.071 nM Example 14 Preparation siFXIe1M1SP 0.013 nM Example 15 Preparation siFXIi1M1SP 0.041 nM Example 19
[0588] As can be seen from the results of Table 6 above, the siRNAs of the present disclosure exhibited very high inhibitory activity against the target sequence 1 in vitro in HepG2 cells, with the IC.sub.50 value ranging between 0.013 and 0.119 nM.
Experimental Example 3
Measuring IC.SUB.50 .of siRNAs against FXI mRNA in HepG2 Cells
[0589] HepG2 cells were inoculated in a 24-well plate at 7×10.sup.4 cells/well. After 16 hours, the cell growth density reached 70 to 80%. At that time, the H-DMEM complete media in the culture wells were aspirated. A 500 μl Opti-MEM medium (GIBCO company) was added to each well and further cultured for 1.5 h.
[0590] Each of the following siRNAs was prepared with DEPC-treated water into siRNA working solutions at 7 different concentrations of 20 μM, 6.67 μM, 2.22 μM, 0.741 μM, 0.247 μM, 0.0823 μM and 0.0274 μM, respectively. The siRNAs used are siFXIa1M1SP, siFXIb1M1SP, siFXIc1M1 SP or siFXId1M1 SP, respectively.
[0591] For each siRNA, 3A1 to 3A7 solutions were prepared, respectively. Each portion of the 3A1 to 3A7 solutions contains, in turn, 3 μl of each of the siRNA working solutions at the above 7 concentrations and 50 μl of Opti-MEM medium.
[0592] 3B solution was prepared. Each portion of the 3B solution contains 1 μl Lipofectamine™ 2000 and 50 μlof Opti-MEM medium.
[0593] One portion of the 3B solution was mixed with one portion of the obtained 3A1 to 3A7 solutions for each siRNA, respectively. The mixed solution was incubated for 20 min at room temperature to form transfection complexes 3X1 to 3X7 for each siRNA.
[0594] One portion of the 3B solution was mixed 50 μlof Opti-MEM medium. The mixed solution was incubated for 20 min at room temperature to form transfection complex 3X8.
[0595] The transfection complexes 3X1 to 3X7 for each siRNA were added in an amount of 100 μl/well to the culture wells, respectively, and then mixed evenly to give transfection mixtures at final concentrations of about 100 nM, 33.3 nM, 11.1 nM, 3.70 nM, 1.23 nM, 0.412 nM, and 0.137 nM for each siRNA. The transfection complexes 3X1 to 3X7 for each siRNA were transfected respectively in three culture cells to give siRNA-containing transfection mixtures (recorded as the test groups).
[0596] The transfection complex 3X8 was added in an amount of 100 μl/well to three additional culture wells, respectively, to give an siRNA-free transfection mixture (recorded as the control group).
[0597] After the siRNA-containing transfection mixtures and the siRNA-free transfection mixture were transfected in the culture wells for 4 hours, each well was supplemented with 1 ml of H-DMEM complete medium containing 20% FBS. The 24-well plate was placed in a CO.sub.2 incubator and further cultured for 24 hours.
[0598] Subsequently, the total RNA in the cells of each well was extracted by using RNAVzol (purchased from Vigorous Biotechnology Beijing Co., Ltd., Cat. No. N002) according to the detailed steps described in the instructions.
[0599] For the cells of each well, 1μg of the total RNA was taken, and the reagent provided in the reverse transcription kit Goldenstar™ RT6 cDNA Synthesis Kit (purchased from Beijing Tsingke Biotechnology Co., Ltd., Cat. No. TSK301M), in which Goldenstar™ Oligo (dT).sub.17 was selected as the primer. 20 μl of a reverse transcription reaction system was prepared according to the precedures for reverse transcription in the kit instructions to reverse transcribe the total RNA of the cells in each well. Conditions for reverse transcription were as follows: each reverse transcription reaction system was placed and incubated at 50° C. for 50 minutes, then incubated at 85° C. for 5 minutes, and finally incubated at 4° C. for 30 seconds; after the reaction was completed, 80 μl of DEPC water was added to each reverse transcription reaction system to obtain a cDNA-containing solution.
[0600] For each reverse transcription reaction system, 5 μl of the aforementioned cDNA-containing solution was taken as the template, and the reagent provided in the NovoStart® SYBR qPCR SuperMix Plus kit (purchased from Novoprotein Scientific Co., Ltd., Cat. No. E096-01B) was used to prepare 20 μl of a qPCR reaction system, wherein the sequences of PCR primers used for amplifying the target gene FXI and the internal reference gene GAPDH were as shown in Table 7, and the final concentration of each primer is 0.25 μM. Each qPCR reaction system was placed on an ABI StepOnePlus Real-Time PCR instrument, and was amplified using the three-step method. The amplification procedures was pre-denaturation at 95° C. for 10 minutes, followed by denaturation at 95° C. for 30 s, and annealing at 60° C. for 30 s, and extension at 72° C. for 30 s. After repeating the aforementioned process of denaturation, annealing, and extension 40 times, a product W containing the amplified target gene FXI and internal reference gene GAPDH was obtained. The product W was then incubated at 95° C. for 15 s, 60° C. for 1 min, and 95° C. for 15 s. The melting curves of the target gene FXI and the internal reference gene GAPDH in the product W were collected respectively using a real-time fluorescent qPCR instrument, and the Ct values of the target gene FXI and the internal reference gene GAPDH were obtained.
TABLE-US-00061 TABLE 7 The sequences of primers for detection Upstream Primers Downstream Primers Gene (in 5′-3′ direction) (in 5′-3′ direction) Human TCACGGCGGAATCACCATC TGTCCTATTCACTCTTGGCAGT FXI (SEQ ID NO: 566) (SEQ ID NO: 567) Human GGTCGGAGTCAACGGATTT CCAGCATCGCCCCACTTGA GAPDH (SEQ ID NO: 568) (SEQ ID NO: 569)
[0601] Relative expression levels of the target gene FXI in each of the test groups and the control group were quantitatively calculated by the Comparative Ct (ΔΔCt) method. The calculation method was described as follows: [0602] ΔCt (the test group)=Ct (target gene in the test group)−Ct (internal reference gene in the test group) [0603] ΔCt (the control group)=Ct (target gene in the control group)−ΔCt (internal reference gene in the control group) [0604] ΔΔCt (the test group)=ΔCt (the test group)−ΔCt (mean value in the control group) [0605] ΔΔCt (the control group)=ΔCt (the control group)−ΔCt (mean value in the control group)
[0606] wherein, the ΔCt (mean value in the control group) is the arithmetic mean value of the ΔCt (the control group) of each of the three culture wells in the control group. Thus, each culture well in either the test group or the control group corresponds to one ΔΔCt value.
[0607] The expression levels of FXI mRNA in the test groups were normalized based on that in the control group, wherein the expression level of FXI mRNA in the control group was defined as 100%;
[0608] Relative expression level of FXI mRNA in the test group =2.sup.−ΔΔCt(the test group)×100%.
[0609] For the siRNAs in the same test group, the mean value of the relative expression levels of FXI mRNA in the test group at each concentration was the arithmetic mean value of the relative expression levels of the three culture wells at that concentration.
[0610] The dose-response curves were fitted using the function log(inhibitor) vs. response—Variable slope of Graphpad 5.0 software. The IC.sub.50 values of each siRNA against FXI mRNA were calculated based on the dose-response curve. In particular, the dose-response curves obtained by fitting complied with the formula below:
wherein: [0611] Y is the relative expression level of FXI mRNA in each test group, [0612] X is the logarithm of the final concentration of the siRNA used in the corresponding test group, [0613] Bot is the Y value at the bottom of the steady stage,
[0614] Top is the Y value at the top of the steady stage,
[0615] X′ is the X value obtained by fitting at which Y is the median value between the bottom and the top, and HillSlope is the slope of the curve obtained by fitting at X′.
[0616] When Y=50% the corresponding X.sub.50 value was determined based on the dose-response curve and the corresponding calculation formula. The IC.sub.50 value of each siRNA was calculated to be 10{circumflex over ( )}X.sub.50 (nM).
[0617] The IC.sub.50 values of each siRNA against FXI mRNA were summarized in Table 8.
TABLE-US-00062 TABLE 8 IC.sub.50 values of siRNAs against FXI mRNA Preparation Example No. NO. IC.sub.50 Preparation siFXIa1M1SP 6.18 nM Example 2 Preparation siFXIb1M1SP 7.54 nM Example 3 Preparation siFXIc1M1SP 11.1 nM Example 4 Preparation siFXId1M1SP 1.49 nM Example 5
[0618] As can be seen from Table 8, the siRNAs of the present disclosure exhibited very high inhibitory activity against FXI mRNA in vitro in HepG2 cell lines, with the IC.sub.50 value ranging between 1.49 and 11.1 nM.
Experimental Example 4
Measuring IC.SUB.50 .of siRNAs Against FXI mRNA in Mouse Primary Hepatocytes
[0619] Mouse primary hepatocytes were extracted from fresh liver tissues of normal C57BL/6N mice. The hepatocytes in an appropriate density were inoculated in Collagen Type I-coated glass, plastic coverslip or tissue culture dish, cultured in RPMI 1460 medium containing 1×dual antibody and 10% FBS, and further cultured in an incubator containing 5% CO.sub.2/95% air at 37° C. for 30 min.
[0620] The inhibitory activity and IC.sub.50 value of the siRNA against FXI mRNA were measured by the same methods as described in Experimental Example 3 except that the siRNA to be detected was siFXIf1M1SP; the cells used were mouse primary hepatocytes; and the final siRNA concentrations included totally 8 concentrations (100 nM, 25 nM, 6.25 nM, 1.56 nM, 0.391 nM, 0.098 nM, 0.0244 nM, and 6.1×10.sup.−3 nM), respectively. The results were as shown in Table 9.
TABLE-US-00063 TABLE 9 IC.sub.50 of siRNA against FXI mRNA Preparation Example No. NO. IC.sub.50 Preparation siFXIf1M1SP 0.021 nM Example 7
[0621] As can be seen from Table 9, the siFXIf1M1SP exhibited very high inhibitory activity against FXI mRNA in vitro in mice primary hepatocytes, with the IC.sub.50 value being 0.021 nM.
Experimental Example 5
Detecting Inhibition Efficiency of siRNAs against the Expression Levels of FXI mRNA in HepG2 Cells
[0622] The inhibition rates of siRNAs against the expression levels of FXI mRNA were measured by the same method as described in Experimental Example 3 except that the siRNAs used were siFXIg1M1SP and siFXIh1M1SP; for each siRNA, the final siRNA concentrations included totally 3 concentrations (50 nM, 5 nM and 0.5 nM), respectively; and 2 culture wells were used at each concentration. The results were as shown in Table 10.
TABLE-US-00064 TABLE 10 Inhibition rates of siRNA at different concentrations against FXI mRNA Inhibition rate (%) against the expression level of FXI mRNA Preparation Example No. NO. 50 nM 5 nM 0.5 nM Preparation Example 8 siFXIg1M1SP 78.0 67.0 66.4 Preparation Example 9 siFXIh1M1SP 83.0 75.0 64.6
[0623] As can be seen from Table 10, the siRNAs of the present disclosure exhibited very high inhibitory activity in vitro in HepG2 cells; and an inhibition rate against FXI mRNA of up to 83% could be achieved at the siRNA concentration of 50 nM.
Experimental Example 6
Detecting Inhibition Efficiency of Conjugates L10-siFXIf1M1S, L10-siFXIi1M1S and L10-siFXIi1M1SP against the Expression Levels of FXI mRNA in Mice In Vivo
[0624] C57BL/6N mice (all female) were randomly divided into groups (5 mice in each group) and numbered, respectively. The conjugate to be tested (i.e., L10-siFXIf1M1S, L10-siFXIi1M1S or L10-siFXIi1M1SP) was administered subcutaneously in two different doses of 5 mg/kg and 1 mg/kg (based on the amount of siRNA) to the mice in each group, respectively. Each siRNA conjugate was administered at the concentrations of 1 mg/mL and 0.2 mg/mL in the form of 0.9 wt % NaCl aqueous solution and the administration volume of 5 mL/kg.
[0625] One of the groups of mice was administered with 1 xPBS in the administration volume of 5 mL/kg and recorded as the control group.
[0626] The mice were sacrificed on day 7 after administration. The liver tissue of each of the mice was collected and kept with RNA later (Sigma Aldrich company), and the liver tissue was homogenized with a tissue homogenizer. Then the total RNA was extracted and obtained by using Trizol according to the procedures as described in the instructions.
[0627] The expression levels of FXI mRNA were measured by fluorescent qPCR and the inhibition rates against FXI mRNA were calculated by the same methods as described in Experimental Example 3, except that the extracted total RNA was reverse transcribed into cDNA by using ImProm-IITM reverse transcription kit (Promega company) according to the instructions thereof, to give a cDNA-containing solution. Next, the expression level of FXI mRNA in the liver tissue was measured by using the fluorescent qPCR kit (Beijing ComWin Biotech Co., Ltd). In this fluorescent qPCR method, mouse GAPDH (mGAPDH) gene was used as an internal reference gene, the FXI and mouse GAPDH were detected by using primers for FXI and mouse GAPDH, respectively. The sequences of the primers for detection were as shown in Table 11.
[0628] In the course of measuring the expression levels of FXI mRNA and calculating the inhibition rate against FXI mRNA, the mice in the control group of this experiment were administered with PBS; and the mice in the test groups were administered with different siRNA conjugates, respectively. The expression level of FXI mRNA in the control group was recorded as 100%; and corrsepondingly, the inhibition rate against that expression level of FXI mRNA was recorded as 0%. The test results were normalized based on the expression level of FXI mRNA in the control group, as shown in Table 12.
TABLE-US-00065 TABLE 11 The sequences of primers for detection SEQ Gene ID name Primer type Nucleotide sequence (5′.fwdarw.3′) NO. Mouse Upstream Primers GCCCTGTTAAAACTGGAATCAGC 574 FXI Downstream CGTTTCTATCTCCTTTGGAAGGC 575 Primers Mouse Upstream Primers TGCACCACCAACTGCTTAG 576 GAPDH Downstream GGATGCAGGGATGATGTTC 577 Primers
TABLE-US-00066 TABLE 12 Inhibition rates of siRNA conjugates at different concentrations against FXI mRNA Inhibition rate (%) against FXI mRNA Preparation Example No. Conjugate 1 mg/kg 5 mg/kg Preparation Example 1 L10-siFXIf1M1S 78.4 95.0 Preparation Example 9 L10-siFXIi1M1S 67.1 90.2 Preparation Example 10 L10-siFXIi1M1SP 56.8 92.1
[0629] As can be seen from Table 12, the siRNA conjugates of the present disclosure showed an inhibition rate ranging from 56.8 to 78.4% against FXI mRNA in an siRNA dose of 1 mg/kg; and an inhibition rate of up to 95.0% could be achieved at the siRNA concentration of 5 mg/kg, suggesting excellent inhibitory efficiency against FXI mRNA.
Experimental Example 7
Detecting the Inhibition of Conjugates L10-siFXIf1M1S and L10-siFXIi1M1SP against the Expression of FXI mRNA and Prolongation of the Activated
[0630] Partial Thromboplastin Time (APTT) at Different Time Points after Administration in Mice In Vivo
[0631] C57BL/6N mice (all male) were randomly divided into 7 groups (5 mice in each group) and numbered, respectively. Conjugates L10-siFXIf1M1S and L10-siFXIi1M1SP were administered to every three groups of mice, respectively. The remaning group of mice was administered with saline as the control group. The administration route is subcutaneous injection. The conjugates were administered at the concentration of 1.8 mg/ml (based on siRNA) in the form of 0.9% NaCl aqueous solution and in the dosage of 9 mg/kg. The normal saline was 0.9% NaCl aqueous solution. The administration volume was 5 mL/kg. Plasma samples were collected on days 8, 15 and 29 after administration, respectively. The groups of mice administered with the conjugates were sacrificed on day 29 after administration; and the group of mice administered with NS were sacrificed on day 8 after administration. The liver tissue of each of the mice was collected and kept with RNA later (Sigma Aldrich company), and the liver tissue was homogenized with a tissue homogenizer. Then the total RNA was extracted and obtained by using Trizol according to the procedures as described in the instructions.
[0632] The expression levels of FXI mRNA were measured by fluorescent qPCR and the inhibition rates against FXI mRNA were calculated by the same methods as described in Experimental Example 3, except that the extracted total RNA was reverse transcribed into cDNA by using ImProm-IITM reverse transcription kit (Promega company) according to the instructions thereof, to give a cDNA-containing solution. Next, the expression level of FXI mRNA in the liver tissue was measured by using the fluorescent qPCR kit (Beijing ComWin Biotech Co., Ltd). In this fluorescent qPCR method, mouse GAPDH (mGAPDH) gene was used as an internal reference gene, the FXI and mouse GAPDH were detected by using primers for FXI and mouse GAPDH, respectively. The sequences of the primers for detection were as shown in Table 11.
[0633] In the course of measuring the expression levels of FXI mRNA and calculating the inhibition rates against FXI mRNA, the mice in the control group of this experiment were administered with saline; and the mice in the test groups were administered with different siRNA conjugates, respectively, with the samples being taken at different time points after administration. The expression level of FXI mRNA in the control group was recorded as 100%; and corrsepondingly, the inhibition rate against that expression level of FXI mRNA was recorded as 0%. The test results were normalized based on the expression level of FXI mRNA in the control group, as shown in Table 13. In this table, the inhibition rate against the expression level of FXI mRNA is the arithmetic mean value of the inhibition rates against the expression levels of FXI mRNA measured in 5 mice of the same group on the corresponding days after the administration of the corresponding siRNA conjugate.
TABLE-US-00067 TABLE 13 Inhibition rates of the siRNA conjugates against FXI mRNA at different time points after single administration Inhibition rate (%) against the expression level of FXI mRNA Preparation Example No. Conjugate Day 8 Day 15 Day 29 Preparation Example 1 L10-siFXIf1M1S 91.33 92.89 90.56 Preparation Example 10 L10-siFXIi1M1SP 89.18 92.39 90.54
[0634] As can be seen from the results of Table 13, after single subcutaneous administration in mice, the siRNA conjugates of the present disclosure exhibited excellent inhibition rate against FXI mRNA in liver at different time points over a prolonged period, and showed an inhibition rate of at least 89.18% or even up to 92.89%.
[0635] Further, for the plasma samples as collected above, the APTT kit (Rayto company, Cat No. 20190402M) was used to measure the plasma APTT value of each mouse by turbidimetric assay in a semi-automatic coagulation analyzer (Rayto company, Model No. RT-2202). The specific detection method is carried out as described in the instructions of the APTT kit. By comparing the measured APTT values with that of the control group, the relative extension of APTT per mouse=(the measured value of APTT in the test group−the measured mean value of APTT in the control group)/ (the measured mean value of APTT in the control group)×100%. The measured results were as shown in Table 14. In this table, the relative extension of APTT refers to the mean value of the relative extensions of APTT measured in 5 mice of the same group on the corresponding days after the administration of the corresponding siRNA conjugate.
TABLE-US-00068 TABLE 14 Relative extension of APTT at different time points after single administration of the siRNA conjugates Relative extension of APTT (%) Preparation Example No. Conjugate Day 8 Day 15 Day 29 Preparation Example 1 L10-siFXIf1M1S 64.9 62.1 18.2 Preparation Example 10 L10-siFXIi1M1SP 42.5 42.5 51.2
[0636] As can be seen from the results of Table 14, the measured value of APTT was significantly extended in mice administered with the siRNA conjugates of the present disclosure over a prolonged period; and an extension of up to 64.9% could be achieved. Clearly, the siRNA conjugates of the present disclosure could effectively prolong the coagulation time of mice, suggesting that they have a promising prospect of application for the treatment and/or prevention of thrombotic disease and/or ischemic stroke.
Experimental Example 8
Measuring the Activities of the siRNA Conjugates of the Present Disclosure in Humanized Mice In Vivo
[0637] The humanized mice used in this experiment were purchased from Cyagen Biosciences Inc. The mice were randomly divided into groups, with 4 mice (2 male mice and 2 female mice) in each group. Conjugates L10-siFXIf1M1S, L10- siFXIalM1 SP, L10-siFXIb1M1 SP, L10-siFXIc1M1 SP, L10-siFXId1M1 SP, L10-siFXIe1M1 SP, L10-siFXIg1M1 SP, L10-siFXIh1M1 SP and L10-siFXIi1M1S were individually administered to the mice in each group; and saline was used as the control. The drug dosages for all animals were calculated according to the body weight (single administration (subcutaneously). Each conjugate was administered at the concentrations of 0.3 mg/mL (based on siRNA) in the form of 0.9 wt % NaCl aqueous solution and the administration volume of 10 mL/kg, i.e., the dosage of each conjugate being 3 mg/kg (based on siRNA). The mice were sacrificed on day 8 after administration. The plasma samples were collected. 3.2 wt % (0.109 mol/L) of sodium citrate dihydrate aqueous solution was added at the volume ratio of anticoagulant to plasma of 1:9 (v/v) to prevent blood clotting; and the plasma samples were separated by centrifugation.
[0638] About 100 mg/mouse of the left lobe of the liver was taken and kept with RNA later (Sigma Aldrich). Subsequently, the liver tissue of each mouse was homogenized with a tissue homogenizer. Then the total RNA of liver tissue of each mice was extracted and obtained by using Trizol (Thermo Fisher company) according to the procedure as described in the instructions.
[0639] According to the same method as described in Experimental Example 6, the expression levels of FXI mRNA of liver tissue in mice administered with different siRNA conjugates of the present disclosure or in the mice in the control group were measured by real-time fluorescent qPCR method, except that the sequences of the primers for amplifying the human FXI and mouse GAPDH as the internal reference gene were as shown in Table 15.
TABLE-US-00069 TABLE 15 The sequences of primers for detection SEQ ID Gene name Primer type Nucleotide sequence (5′.fwdarw.3′) NO. HumanFXI Upstream TCACGGCGGAATCACCATC 570 Primers Downstream TGTCCTATTCACTCTTGGCAGT 571 Primers Mouse Upstream AACTTTGGCATTGTGGAAGGGCTC 572 Primers GAPDH Downstream TGGAAGAGTGGGAGTTGCTGTTGA 573 Primers
[0640] The expression levels of FXI mRNA were measured and the inhibition rates against FXI mRNA were calculated by the same methods as described in Experimental Example 3. The expression level of FXI mRNA in the control group was recorded as 100%; and corrsepondingly, the inhibition rate against that expression level of FXI mRNA was recorded as 0%. The test results were normalized based on the expression level of FXI mRNA in the control group, as shown in Table 16. In this table, the inhibition rate against human FXI mRNA is the mean value of the inhibition rates against human FXI mRNA calculated in mice of the same group administered with the corresponding siRNA conjugate and the standard deviation thereof.
TABLE-US-00070 TABLE 16 The inhibition rates of the siRNA conjugates of the present disclosure against human FXI mRNA in humanized mice in vivo Preparation Inhibition rate against Example No. Conjugate NO. human FXI mRNA Preparation L10-siFXIf1M1S 76.03 ± 6.74 Example 1 Preparation L10-siFXIa1M1SP 89.23 ± 3.25 Example 2 Preparation L10-siFXIb1M1SP 81.75 ± 3.91 Example 3 Preparation L10-siFXIc1M1SP 81.25 ± 3.61 Example 4 Preparation L10-siFXId1M1SP 71.06 ± 9.62 Example 5 Preparation L10-siFXIe1M1SP 85.26 ± 4.15 Example 6 Preparation L10-siFXIg1M1SP 93.09 ± 1.96 Example 7 Preparation L10-siFXIh1M1SP 76.78 ± 5.54 Example 8 Preparation L10-siFXIi1M1S 74.25 ± 6.07 Example 9
[0641] As can be seen from the results of Table 16, the siRNA conjugates of the present disclosure exhibited good inhibitory effects against human FXI mRNA in humanized heterozygous mouse liver, and showed an inhibition rate against FXI mRNA of up to about 71 to 93%.
[0642] Further, the above each group of mice (including the mice in the test groups administered with Conjugate L10-siFXIf1M1S, L10-siFXIa1M1SP, L10-siFXIb1M1SP, L10-siFXIc1M1SP, L10-siFXId1M1SP, L10-siFXIe1M1SP, L10-siFXIg1M1SP, L10-siFXIh1M1SP or L10-siFXIi1M1S, respectively and the mice in the control group administered with saline was tested using the Human Coagulation Factor X ELISA kit (Sigma company, Lot No. 0926F2350, Article No. RAB1385-1KT) to determine plasma FXI protein concentrations.
[0643] The sample diluent (labeled as ItemE2 in the kit) in the ELISA kit was 5-fold diluted with deionized water to obtain the diluted sample diluent.
[0644] For the plasma of mice administered with Conjugate L10-siFXIa1M1SP or L10-siFXIg1M1SP, 108 μL of the diluted sample diluent was added to 12 μL of plasma to form the sample solution to be tested, which was kept until use.
[0645] For the plasma of mice administered with other conjugates or saline, 108 μL of the diluted sample diluent was added to 12 μL of plasma to obtain 10-fold diluted plasma; 45 μL of the diluted sample diluent was added to 5μL of the 10-fold diluted plasma to obtain 100-fold diluted plasma; and then 108 μL of the diluted sample diluent was added to12 μL of the 100-fold diluted plasma to obtain a 1000-fold diluted sample diluent as the sample solution to be tested, which was kept until use.
[0646] The FXI antibody detection (labeled as ItemF in the kit) in the kit was dissolved with 100 μL of the diluted sample diluent into an antibody sample, and then 75 μL of the antibody sample was taken and added to 5925 μL of the diluted sample diluent to be 80-fold diluted to form the antibody detection solution.
[0647] The streptomycin concentrate (labeled as ItemG in the kit) in the kit was 250-fold diluted with the diluted sample diluent to form Streptomycin dilution solution.
[0648] The washing buffer (labeled as ItemB in the kit) in the kit was 20-fold diluted with deionized water to form the diluted washing solution.
[0649] Solutions with 8 standard concentration gradients were provided; one of the solutions was the diluted sample diluent (which could be regarded as the standard solution at the concentration of 0 pg/mL), and the other seven solutions were standard solutions of 7 concentrations of 2500 pg/mL, 1000 pg/mL, 400 pg/mL, 160 pg/mL, 64 pg/mL, 25.6 pg/mL and 10.24 pg/mL obtained by successively diluting the standard product (labeled as Item C in the kit) in the kit with the diluted sample diluent described above.
[0650] ELISA Assay
[0651] Human Coagulation Factor X ELISA kit (SIGMA company, Cat No. RAB1385-1KT) was used. The standard wells and sample wells were arranged according to the instruction manual for use. The solutions with different standard concentration gradients or the sample solutions to be tested were individually plated in an amount of 100 μL per well, and then incubated at room temperature for 2.5 hours. After removal of the solution therefrom, 300 μL of diluted washing solution was added per well to wash the wells for 1 minute, and then the washing solution was removed. 100 μL of antibody detection solution was added per well, and then incubated at room temperature for 1 hour. After removal of the solution therefrom, 300 μL of diluted washing solution was added per well to wash the wells for 1 minute, and then the washing solution was removed. This washing procedure was repeated for three times (i.e., washing for four times in total). 100 μL of Streptomycin dilution solution was added per well, and then incubated at room temperature for 45 minutes. After removal of the solution therefrom, 300 μL of diluted washing solution was added per well to wash the wells for 1 minute, and then the washing solution was removed. This washing procedure was repeated for three times (i.e., washing for four times in total). 100 μL of TMB (labeled as ItemH in the kit) was added per well, and then incubated for 30 minutes. 50 μL of a stop solution (provided in the kit) was added per well to stop the reaction. Absorbance at 450 nm was read immediately by using a fully-automatic microplate reader (BioTek company, Biotck SYNERGY MX). The results of each test group with a particular concentration of the siRNA conjugate were compared with the control group with saline.
[0652] According to the activity results measured in the solutions with standard concentration gradients, the dose-response standard curves were fitted using the function log(inhibitor) vs. response—Variable slope of Graphpad 6.0 software. The plasma protein concentration was calculated based on the dose-response curve, and the fitted curves complied with the calculation formula below:
wherein: [0653] Y is the corresponding optical density value read at 450 nm, [0654] X is the logarithm value (ug/mL) of the concentration in the standard curve, [0655] Bot is the Y value at the bottom of the steady stage, [0656] Top is the Y value at the top of the steady stage, [0657] X′ is the X value obtained by fitting at which Y is the median value between the bottom and the top, and Hill Slope is the slope of the curve at X′.
[0658] The logarithm value X of the corresponding concentration of each sample was obtained by placing the optical density value measured in each plasma sample in the formula based on the fitted standard curve; and the plasma FXI protein concentration value of each sample administered with different siRNA conjugate={circumflex over ( )}X (μg/ mL) was calculated.
[0659] According to the plasma FXI protein concentration value, the inhibition rate against FXI protein=(the protein concentration in the control group−the protein concentration in the test group)/the protein concentration in the control group ×100% was calculated based on the protein concentration in the control group. The concentration results and inhibition rate data obtained were as shown in Table 17. In this table, the FXI protein concentration and the inhibition rate against FXI protein were the arithmetic mean value of the FXI protein concentrations and the inhibition rates against FXI protein in the same group of mice administered with the corresponding siRNA conjugate, respectively.
TABLE-US-00071 TABLE 17 Inhibitory effects of the siRNA conjugates of the present disclosure against the protein concentration in plasma Preparation FXI protein Example concentration Relative inhibition rate No. Conjugate NO. (μg/mL) (%) against FXI protein Control (Brine) 0.2597 0 group Preparation L10-siFXIf1M1S 0.0469 81.93 Example 1 Preparation L10-siFXIa1M1SP 0.0026 99.02 Example 2 Preparation L10-siFXIb1M1SP 0.0258 90.08 Example 3 Preparation L10-siFXIc1M1SP 0.0205 92.09 Example 4 Preparation L10-siFXId1M1SP 0.0417 83.94 Example 5 Preparation L10-siFXIe1M1SP 0.0166 93.61 Example 6 Preparation L10-siFXIg1M1SP 0.0017 99.34 Example 7 Preparation L10-siFXIh1M1SP 0.0447 82.80 Example 8 Preparation L10-siFXIi1M1S 0.0533 79.47 Example 9
[0660] As can be seen from the results of Table 17, the siRNA conjugates of the present disclosure all exhibited excellent effects of inhibiting the expression of human FXI protein in plasma of humanized heterozygous mice; in particular, Conjugates L10-siFXIa1M1SP and L10-siFXIg1M1SP both showed high inhibition rate against FXI protein of up to about 99%.
[0661] Some embodiments of the present disclosure are described in detail above, but the present disclosure is not limited to the specific details of the above embodiments. Various simple variations to the technical solutions of the present disclosure can be made within the scope of the technical concept of the present disclosure, and these simple variations are also within the scope of the present disclosure.
[0662] It is to be noted that each of the specific technical features described in the above embodiments can be combined in any suitable manner provided that no contradiction is caused. In order to avoid unnecessary repetition, various possible combination manners are no longer described in the present disclosure.
[0663] In addition, various different embodiments of the present disclosure may also be carried out in any combination as long as it does not deviate from the idea of the present disclosure, which should also be regarded as the disclosure of the present disclosure.
INCORPORATION BY REFERENCE
[0664] All publications, patents and patent applications mentioned in this description are incorporated herein by reference to the extent as if each publication, patent and patent application were specifically and separately incorporated herein by reference.