MUTANT GLUCOSE OXIDASE (GOD) HAVING IMPROVED THERMAL STABILITY AND GENE AND APPLICATION THEREOF

Abstract

The present invention relates to the field of genetic engineering, particularly to a glucose oxidase mutant having improved thermal stability, gene and application thereof. The present invention provides several glucose oxidase GOD mutants with high catalytic efficiency and improved thermal stability, which breaks the barrier of low enzyme activity and poor stability and is suited well to meet the requirements of application to the fields of food, medicine, feed and textile industry, and has a very broad application prospect.

Claims

1. (canceled)

2. A glucose oxidase mutant having an amino acid sequence of SEQ ID NO:1 by substituting Asp at position 68 with Lys, Thr at position 274 with Phe, and Tyr at position 278 with Thr.

3. The glucose oxidase mutant of claim 2 having an amino acid sequence of SEQ ID NO:1 by substituting Asp at position 68 with Lys, Thr at position 274 with Phe, Tyr at position 278 with Thr, and Ser at position 94 with Ala.

4. The glucose oxidase mutant of claim 3 having an amino acid sequence of SEQ ID NO:1 by substituting Asp at position 68 with Lys, Thr at position 274 with Phe, Tyr at position 278 with Thr, Ser at position 94 with Ala, and Thr at position 31 with Val.

5. The glucose oxidase mutant of claim 4 having an amino acid sequence of SEQ ID NO:1 by substituting Asp at position 68 with Lys, Thr at position 274 with Phe, Tyr at position 278 with Thr, Ser at position 94 with Ala, Thr at position 31 with Val, and Gln at position 88 with Arg.

6. Gene encoding the glucose oxidase GOD mutant of claim 2.

7. (canceled)

8. (canceled)

9. The glucose oxidase mutant of claim 2 which is prepared with a method including the steps of transforming the host cell with the recombinant vector comprising the gene encoding the glucose oxidase mutant of claim 2 to obtain the recombinant strain; culturing the obtained recombinant strain to induce the expression of glucose oxidase GOD mutant; and recovering and purifying the glucose oxidase GOD mutant.

10. Application of the glucose oxidase GOD mutant of claim 2.

Description

BRIEF DESCRIPTIONS OF THE DRAWINGS

[0031] FIG. 1 shows the thermal stability of the mutant GOD-M5 and the mutants GOD-M5, GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 at 70° C. for 10 min.

[0032] FIG. 2 shows the thermal stability of the mutant GOD-M5 and the mutants GOD-M5, GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 at 80° C. for 2 min.

[0033] FIG. 3 shows the optimum temperature of the mutant GOD-M5 and the mutants GOD-M5, GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10.

EMBODIMENT

[0034] Test Materials and Reagents

[0035] 1. Strains and vectors: Pichia pastoris GS115 and expressing vector pPIC9.

[0036] 2. Enzymes and other biochemical reagents: point mutation kit and other biochemical reagents were purchased by biochemical reagent company.

[0037] 3. Medium:

[0038] LB medium: 5% yeast extract, 1% peptone, 1% NaCL, pH 7.0;

[0039] BMGY medium: 1% yeast extract, 2% peptone, 1% glycerol (V/V), 1.34% YNB, 0.00004% Biotin;

[0040] BMMY medium: 1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% Biotin, 0.5% methanol (V/V).

[0041] Suitable biology laboratory methods not particularly mentioned in the examples as below can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other kit laboratory manuals.

Example 1 Site Directed Mutagenesis

[0042] The glucose oxidase mutant GOD-M5 was obtained by the steps of substituting amino acid Glu of position 82 of the glucose oxidase GOD having the acid sequence of SEQ ID No:1 from Aspergillus niger with the amino acid Cys to obtain the mutant GOD-M1, substituting the amino acid Val of position 418 of GOD-M1 with the amino acid Glu to obtain the mutant GOD-M2, substitute amino acid Asn of position 508 of GOD-M2 with the amino acid His to obtain the mutant GOD-M3, substituting the amino acid Thr of position 32 of GOD-M3 with the amino acid Val to obtain the mutant GOD-M4, and substituting the amino acid Asp of position 313 of GOD-M4 with the amino acid Lys to obtain the mutant GOD-M5.

[0043] And, Asp of position 68 of the glucose oxidase mutant GOD-M5 was muted into Lys using the recombinant plasmid pPIC9-godm5 as the temple to the mutant GOD-M6; Thr of position 274 of the glucose oxidase GOD mutant GOD-M6 is muted into Phe, and Tyr of position 278 of the glucose oxidase GOD mutant GOD-M6 is muted into Thr to obtain the glucose oxidase mutant GOD-M7; Ser of position 94 of the glucose oxidase GOD mutant GOD-M7 is muted into Ala to obtain the glucose oxidase mutant GOD-M8; Thr of position 31 of the glucose oxidase GOD mutant GOD-M8 is muted into Val to obtain the glucose oxidase mutant GOD-M9; and Gln of position 88 of the glucose oxidase GOD mutant GOD-M9 is muted into Arg to obtain the glucose oxidase mutant GOD-M10, wherein the mutation sites were introduced by site directed mutagenesis PCR and verified by sequencing. The primers for PCR were shown in Table 1:

TABLE-US-00013 TABLE 1 The mutant specific primers Size Primers Sequences (5′.fwdarw.3′) (bp) D68KF ACGCTTACGGTAAGATCTTCGGAT 25 D68FR CTTACCGTAAGCGTTCAAGTCTTC 25 T274F/ ACTCACAAGGGTAACTTTCACAAT 41 Y278T F GTTACCGCTAAACACG T274F/ GGTAACATTGTGAAAGTTACCCTT 41 Y278T R GTGAGTTCCGAACTCG S94AF ATTGAAGACTTGAACGCTTACGGTAAGA 25 S94AR AGCGTTCAAGTCTTCAATGATAGGACCT 25 T31VF GGATTGACTGGTTTGGTTGTCGCTGCCA 25 T31VR AACCAAACCAGTCAATCCACCACCAGCA 25 Q88RF CTTGCCACTAACAATAGAACCGCTTTG 25 Q88RR TCTATTGTTAGTGGCAAGGCAGACAGTC 25

Example 2 Construction of Glucose Oxidase Engineering Strain

[0044] The PCR was performed by taking the recombinant plasmid pPIC9-godm5 as the template with the site directed mutagenesis reagent, followed by verifying by nucleic acid gel, adding 1 μL of DMT enzyme to the PCR product, mixing well and incubating at 37° C. for 1 hour. The PCR product was demethylated by 2 to 5 μL of DMT enzyme and transformed into DMT competent cells, followed by selecting monoclonal cells and verifying the positive transformants by DNA sequencing. The transformants confirmed by sequencing were used to prepare a large number of recombinant expression plasmids which were linearized with restriction endonuclease Bgl II, followed by transforming yeast GS115 competent cells by electric shock, culturing at 30° C. for 2 to 3 days, and selecting the transformants growing on MD plate for further expression experiment by referring to Pichia pastoris expression operation manual. The selected positive clones comprising the glucose oxidase mutants by color reaction on MM plate were GS115/GOD-M5, GS115/GOD-M6, GS115/GOD-M7, GS115/GOD-M8, GS115/GOD-M9 and GS115/GOD-M10 respectively.

Example 3 Preparation of Recombinant Glucose Oxidase

[0045] (1) High Expression of Glucose Oxidase in Pichia pastoris at Shake Flask Level

[0046] GS115 strain containing recombinant plasmid was inoculated into 300 mL of BMGY medium and incubated for 48 h at 30° C. and 220 rpm, followed by centrifuging at 4500 g for 5 min to remove the supernatant. The obtained precipitate was suspended for 48 hour in 200 mL of BMMY medium containing 0.5% of methanol to induce at 30° C. and 220 rpm with addition of 0.5 mL of methanol every 12 h to keep the concentration of methanol in the bacterial solution as 0.5%. After induction, the supernatant was recovered by spinning to test the activity of the enzyme and SDS page.

[0047] (2) Purification of Recombinant Glucose Oxidase

[0048] The supernatant of the recombinant glucose oxidase expressed in the shaking bottle was collected followed by being concentrated with 10 kDa membrane package while replacing the medium of the fermentation broth with 10 mM of disodium hydrogen phosphate citric acid buffer with pH of 6.5, and further purified by anion exchange column

Example 4 Analysis of the Activity of Glucose Oxidase GOD Mutant

[0049] The enzyme activity was determined by mixing 2.5 mL of o-anisidine buffer prepared by adding 0.2 mL of 1% o-anisidine to 25 mL of phosphate buffer in 0.1 M, 300 μL of 18% of glucose solution, 100 μL of 0.03% of horseradish peroxidase, and 100 μL of appropriate diluted release enzyme solution at pH6.0 to react for 3 min at 30° C., followed by adding 2 ml of H.sub.2SO.sub.4 in 2M to terminate the reaction and measuring the absorbance value at 540 nm. A unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol gluconic acid and hydrogen peroxide per unit time under given conditions.

[0050] Measuring the enzyme activity and thermal stability of glucose oxidase GOD mutant and the parent glucose oxidase mutant GODMS as below.

[0051] 1. The enzyme activities of the glucose oxidase GOD mutant purified in example 3 and the parent glucose oxidase mutant GODMS were determined by performing the enzymatic reaction at pH 6.0 and 30° C.

[0052] The specific activity of the parent glucose oxidase mutant GODMS was 366U/mg, and the activities of the mutants GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 were 301.1 U/mg, 299.3 U/mg, 197.9 U/mg, 454 U/mg and 445.3 U/mg, respectively, wherein the specific activity of GOD-M10 was 1.2 times of that of GOD-M5.

[0053] 2. Measuring the Thermal Stability of the Mutants and the Parent at 70° C. or 80° C.

[0054] The mutant glucose oxidase GOD and the parent were treated at 70° C. for 0, 2, 5, 10, 20, and 30 min respectively and 80° C. for 0, 1, 2 and 5 min respectively in 0.1 mol/L of citric acid disodium hydrogen phosphate buffer (pH 6.0), followed by measuring the relative residual enzyme activity at 30° C.

[0055] As shown in FIG. 1, the relative residual enzyme activity of GOD-M5 was 55% and the relative residual enzyme activities of the modified glucose oxidase mutants GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 were 60%, 71%, 75%, 99% and 100% after 10 min treatment at 70° C.

[0056] And, as shown in FIG. 2, the relative residual enzyme activity of GOD-M5 oxidase GOD was 35%, and the relative residual enzyme activities of GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 were 40%, 55%, 60%, 72% and 80% respectively, wherein the relative residual enzyme activity of GOD-M10 was 2 times of that of GOD-M5.

[0057] 3. Determining the Optimum Temperature of Glucose Oxidase Mutants and the Parent

[0058] The enzyme activities of GOD-M5, GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 were measured at 0, 20, 30, 40, 50, 60, 70 and 80° C. in pH of 6.0. As shown in FIG. 2, the optimum temperatures of GOD-M5, GOD-M6, GOD-M7, GOD-M8, GOD-M9 and GOD-M10 were 40° C., and more than 50% of the relative residual enzyme activity can be maintained in the range of 20° C. to 70° C.