METHOD FOR BREEDING NEW GERMPLASM OF CLUBROOT-RESISTANT ORANGE-HEADING CHINESE CABBAGE

Abstract

A method for breeding a new germplasm of clubroot-resistant orange-heading Chinese cabbage includes: (1) obtaining F.sub.1 by hybridizing orange-heading Chinese cabbage as a female parent and clubroot-resistant Chinese cabbage as a male parent, obtaining F.sub.2 by selfing F.sub.1 individual plants, planting F.sub.2 populations, and extracting DNA from the individual plants of F.sub.2; (2) observing horticultural traits of F.sub.2, and performing observation and statistics of head color phenotypic traits through cutting head; (3) performing PCR amplification with DNA of F.sub.2 using a dominant orange gene marker Br530 and a clubroot-resistant marker SC2930-T/SC2930Q, and identifying a genotype of the individual plants; (4) performing a comprehensive evaluation according to the results of marker detection and the observation of horticultural traits, selecting double-site homozygous clubroot-resistant orange-heading Chinese cabbage plants, and selfing the individual plants for 2 consecutive generations; and (5) obtaining a new germplasm of clubroot-resistant orange-heading Chinese cabbage after selfing for 3 generations.

Claims

1. A method for breeding a new germplasm of clubroot-resistant orange-heading Chinese cabbage, comprising the following steps: (1) obtaining F.sub.1 by hybridizing orange-heading Chinese cabbage used as a female parent and clubroot-resistant Chinese cabbage used as a male parent, obtaining F.sub.2 by selfing F.sub.1 individual plants, planting F.sub.2 populations, and numbering individual plants of the F.sub.2 populations and extracting DNA of each plant during a seedling stage; (2) transplanting the F.sub.2 populations in a field, and observing horticultural traits and performing observation and statistics of head color phenotype traits through cutting head in a late heading stage of the F.sub.2 populations; (3) performing a PCR amplification with DNA of F.sub.2 individual plants using a dominant orange gene marker Br530 and an clubroot-resistant marker SC2930-T/SC2930Q, and identifying a genotype of the F.sub.2 individual plants; (4) performing a comprehensive evaluation according to results of the dominant orange gene marker Br530 and the clubroot-resistant marker SC2930-T/SC2930Q detected and observation results of the horticultural traits, then selecting double-site homozygous plants at both the clubroot-resistant Chinese cabbage and the orange-heading Chinese cabbage to selfbreed for 2 consecutive generations; and (5) obtaining selfing lines with stable horticultural traits and homozygous clubroot-resistant orange-heading Chinese cabbage plants by selfing double-site homozygous clubroot-resistant orange-heading Chinese cabbage plants for 3 generations.

2. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein the dominant orange gene marker Br530 is shown in SEQ ID NO: 1 as follows: TABLE-US-00008 CAGAAACATCAGGGTTGAAATCTAAACCCAGAAAATAAACCCAATATGG TATAGGTTTACCCGTGGGTACCCAAAGTATTATCTTATTTATTCTGAAG ATCATGTAAAACTCATTTATGGTTTTAACGAGAAAACTTGTAAAGTTGT TTTTGTGGTTTTAGCGGAAATTTTTCTTTTTGCGGTTTTTGGTCGGTAA TTTTATTTTGTGGCTTGGTTGGAAAACTCATTTTTGCGGTTTGCGGGAA AAATAATCTTTCTGGTTTTGACGAAAAAATTCGGTTTTACGGTTTTTGC GAGAAAATTCGGTTTAGCAGTTTTGGCAGGAAACCTCGCTTTTGCGGTT TTGGCGGAAAAACTCGTTTTTGATTTTGACGGAAAAACTTGTTTTTACG GTTTTGGGGAAACTCGGTTTTCGGCTTTGACGGGAAAACTCGATTTTTC GATTTTGGCGGGAAAACTCGATTTTGCGGTTTTGGCGGGAAAACTCGGT TTTTCTGTTTTGGCGGAAAAACCATGTTTTTCGCTTTC GGCAGTAA.

3. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein PCR-specific amplification primers for the dominant orange gene marker Br530 are as follows: TABLE-US-00009 upstream primer (F): (SEQ ID NO: 2) 5′-CAGAAACATCAGGGTTGAAATC-3′; and downstream primer (R): (SEQ ID NO: 3) 5′-TTACTGCCGAAAGCGAAA-3′.

4. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein PCR-specific amplification primers for the clubroot-resistant marker SC2930-T are as follows: TABLE-US-00010 upstream primer (F): (SEQ ID NO: 4) 5′-TAGACCTTTTTTTTGTCTTTTTTTTTACCT-3′; and downstream primer (R): (SEQ ID NO: 5) 5′-AAGGCCATAGAAATCAGGTC-3′.

5. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein PCR-specific amplification primers for the clubroot-resistant marker SC2930Q are as follows: TABLE-US-00011 upstream primer (F): (SEQ ID NO: 6) 5′-CAGACTAGACTTTTTGTCATTTAGACT-3′; and downstream primer (R): (SEQ ID NO: 7) 5′-AAGGCCATAGAAATCAGGTC-3′.

6. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein a PCR amplification system is as follows: a total volume is 10 μL, comprising 5 μL of 2×Taq Master Mix for PAGE (Dining), 1 μL of DNA, 0.5 μL of an upstream primer, 0.5 μL of a downstream primer, and a remaining amount of ddH.sub.2O.

7. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein a PCR-specific amplification procedure for the dominant orange gene marker Br530 is as follows: 95° C. for 3 min, 95° C. for 30 s 58° C. for 30 s, 72° C. for 1 min, 38 cycles, 72° C. for 10 min, 6° C., ∞.

8. The method for breeding the new germplasm of the clubroot-resistant orange-heading Chinese cabbage of claim 1, wherein a PCR-specific amplification procedure for the clubroot-resistant marker SC2930-T/SC2930Q is as follows: 94° C. for 3 min, 94° C. for 1 min, 55° C. for 1.5 min 72° C. for 2 min, 30 cycles, 72° C. for 7 min, 6° C., ∞.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to explain the technical solutions of the embodiments of the present invention more clearly, the accompanying drawings to be used in describing the embodiments will be briefly introduced below. It should be understood that, the accompanying drawings below only show some embodiments of the present invention, rather than being deemed as a limitation to the scope. For those of ordinary skills in the art, other related drawings can also be obtained based on these drawings without making creative efforts.

[0048] FIG. 1 is a flow chart of breeding of the present invention.

[0049] FIG. 2 is a flow chart of breeding of an embodiment.

[0050] FIG. 3 is amplification results of a primer Br530 in 22 samples; M represents the molecular weight standard DL2000; and the number represents the serial number of individual plants.

[0051] FIG. 4 is amplification results of a primer SC2930T in 22 samples; M represents the molecular weight standard DL2000; and the number represents the serial number of individual plants.

[0052] FIG. 5 is amplification results of a primer SC2930Q in 22 samples; M represents the molecular weight standard DL2000; and the number represents the serial number of individual plants.

[0053] FIG. 6 is an image of a head of clubroot-resistant orange-heading Chinese cabbage.

[0054] FIG. 7 is an image of a cross section of a head of clubroot-resistant orange-heading Chinese cabbage.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0055] In order to make the objectives, technical solutions and advantages of the present invention more clearly, the present invention will be further explained in detail below in combination with the accompanying drawings and embodiments. It should be understood that the specific embodiments described here are only used for explaining, rather than limiting, the present invention, that is, the described embodiments are only parts of, rather than all of, the embodiments of the present invention. Usually, the components of the embodiments of the present invention described and shown in the accompanying drawings here may be arranged and designed in various configurations.

[0056] Therefore, the detailed description of the embodiments of the present invention provided in the accompanying drawings only represent the selected embodiments of the present invention, but is not intended to limit the claimed scope of the present invention. On the basis of the embodiments of the present invention, all the other embodiments obtained by those skilled in the art without making creative efforts will fall within the protection scope of the present invention.

[0057] It should be noted that the terms “first”, “second” and other relational terms are only used to distinguish one entity or operation from another, rather than necessarily requiring or implying any such actual relationship or sequence between these entities or operations. Besides, the terms “including/comprising”, “containing” or any other variants thereof are intended to encompass non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not expressly listed, or also includes elements inherent to such process, method, article or device. Without further limitation, an element confined by the phrase “including/comprising a/an . . . ” does not exclude the presence of additional identical elements in a process, method, article or device that includes the element.

[0058] The orange-heading Chinese cabbage selfing line 13S93 in the following example is an orange-heading Chinese cabbage selfing line bred by the research group, and the plant features are yellow-green outer leaves, semi-erect plant, half-open head, medium height, cannonball shape, and orange head leaves.

[0059] The clubroot-resistant Chinese cabbage variety “Jinjin” in the following example is a commercial variety.

[0060] It should be noted that the orange-heading Chinese cabbage selfing line 13S93 and the clubroot-resistant Chinese cabbage variety “Jinjin” (as male parent and female parent respectively) are taken as examples, but the varieties are not limited to them.

[0061] The features and performances of the present invention will be further described in details in combination with the embodiments.

Example

[0062] A preferred embodiment of the present invention provides a method for breeding a new germplasm of clubroot-resistant orange-heading Chinese cabbage, including the following specific steps:

[0063] 1. F.sub.1 was obtained by hybridizing the orange-heading Chinese cabbage selfing line 13S93 taken as a female parent and the clubroot-resistant Chinese cabbage “Jinjin” taken as a male parent.

[0064] 2. F.sub.1 (15ZF4) individual plants were planted in the spring of the next year to obtain F.sub.2 by selfing, and a total of 205 plants of F.sub.2 segregation population 15ZF4-2 were planted; and the Chinese cabbage was planted in a flat field, the fertility was uniform, and the soil is alkaline soil. The Chinese cabbage seeds were sowed in the hole plate and transplanted to an open field after sowed 30 d. The plant spacing and row spacing was 45 cm and 50 cm respectively, and conventional field management was performed.

[0065] At the seedling stage of the Chinese cabbage, each individual plant was numbered by inserting a plate in the field, the DNAs of them was extracted; 750 μL of 1×CTAB extract was added to a 1.5 ml centrifuge tube, the extract composition was as follows: 2% CTAB, 100 mmol/L Tris-HCl, 20 mmol/L EDTA and 1.4 mol/L NaCl, lastly 8 μL of β-mercaptoethanol was added and shaken well; 0.2 g of fresh leaves with a main vein removed was sampled from each individual plant and then ground into powder after liquid nitrogen was added, then the extract in the 1.5 ml centrifuge tube was added to a mortar, the mixture was mixed evenly and then transferred to the centrifuge tube, and the centrifuge tube was shaken constantly; after that, the centrifuge tube was placed into a 65° C. water bath and shaken every a few minutes in the process, and the water bath lasted for 30 minutes; the centrifuge tube was taken out, an isometric phenol:chloroform:isoamylol mixture was added at a ratio of phenol:chloroform:isoamyl alcohol=25:24:1, and the centrifuge tube was shaken well for 10 min and then centrifugated at a room temperature at 12,000 r/min for 10 min; after an upper liquid phase was transferred to another centrifuge tube, an isometric chloroform:isoamylol mixture at a proportion of 24:1 was added, and the centrifuge tube was shaken well for 10 min and then centrifugated at a room temperature at 12,000 r/min for 10 min; a supernatant was collected, pre-cooled absolute ethanol was added in a volume 2 times that of the supernatant, DNA was agglomerated after mixing evenly, precipitation was performed at −20° C. for 30 min, and centrifugation was performed at 4° C. at 12,000 r/min for 10 min; after the supernatant was discarded, the precipitate was washed 2-3 times by adding 1 ml of 75% ethanol, and the precipitate was air-dried at a room temperature; the DNA was dissolved by adding 400-500 μL of TE buffer, 1.5 μL of 10 μg/L RNaseA was added until a final concentration reaches 10 μg/mL, then mixed evenly and performed at 37° C. for 30 min; after the DNA was completely dissolved, 40-50 μL of 3 mol/L NaAC solution and isometric isopropanol were added and shaken well to fully precipitate the DNA, and was performed in ice bath for 15 min; after centrifugation at 4° C. and 12,000 r/min for 10 min, the supernatant was discarded, the precipitate was washed 1-2 times by adding 1 ml of 75% ethanol, then 1,200 μL of DNA stock solution was added, and the DNA stock solution was prepared from 75% ethanol and 0.3 mol/L NaAC solution; it was confirmed by purity detection that the extracted DNA was better purified, the extracted DNA was generally diluted with 400-500 μL of sterile ddH.sub.2O and stored at 4° C. for later use.

[0066] PCR amplification was performed using primers of a dominant orange gene marker Br530 and a clubroot-resistant marker SC2930-T/SC2930Q, and genotypes of the individual plants were identified.

[0067] The PCR-specific amplification primers for the dominant orange gene marker Br530 were as follows:

TABLE-US-00005 upstream primer (F): (SEQ ID NO: 2) 5′-CAGAAACATCAGGGTTGAAATC-3′; and downstream primer (R): (SEQ ID NO: 3) 5′-TTACTGCCGAAAGCGAAA-3′.

[0068] PCR-specific amplification primers for the clubroot-resistant marker SC2930-T were as follows:

TABLE-US-00006 upstream primer (F): (SEQ ID NO: 4) 5′-TAGACCTTTTTTTTGTCTTTTTTTTTACCT-3′; and downstream primer (R): (SEQ ID NO: 5) 5′-AAGGCCATAGAAATCAGGTC-3′.

[0069] PCR-specific amplification primers for the clubroot-resistant marker SC2930Q were as follows:

TABLE-US-00007 upstream primer (F): (SEQ ID NO: 6) 5′-CAGACTAGACTTTTTGTCATTTAGACT-3′; and downstream primer (R): (SEQ ID NO: 7) 5′-AAGGCCATAGAAATCAGGTC-3′.

[0070] A PCR amplification system was as follow:

[0071] a total volume was 10 μL, including 5 μL of 2×Taq Master Mix for PAGE (Dining), 1 μL of DNA, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and the remaining amount of ddH.sub.2O.

[0072] A PCR-specific amplification procedure for the dominant orange gene marker Br530 was as follows:

[0073] 95° C. for 3 min,

[0074] 95° C. for 30 s,

[0075] 58° C. for 30 s,

[0076] 72° C. for 1 min,

[0077] 38 cycles,

[0078] 72° C. for 10 min,

[0079] 6° C.,

[0080] ∞.

[0081] A PCR-specific amplification procedure for the clubroot-resistant marker SC2930-T/SC2930Q was as follows:

[0082] 94° C. for 3 min,

[0083] 94° C. for 1 min,

[0084] 55° C. for 1.5 min,

[0085] 72° C. for 2 min,

[0086] 30 cycles,

[0087] 72° C. for 7 min,

[0088] 6° C.,

[0089] ∞.

[0090] Individual plant identification was performed on the population using the single dominant orange head marker Br530, and the results showed (FIG. 3) that there were 146 individual plants carrying the orange marker and 57 individual plants not containing orange marker. According to the chi-square test, the orange gene conformed to the Mendel's laws of inheritance at 3:1 (x.sup.2=1.026<x.sup.2 (0.05, 1)=3.84). The statistics of the head color of individual plants was performed by cutting the heads in the late heading stage of Chinese cabbage, and in the phenotypic statistics, there were 51 orange heads and 152 white heads, which conform to a separation proportion of 1:3. It was indicated that orange trait was recessive inheritance to white trait. In the screening of phenotypes by combining molecular marker with head color, 51 of 203 valid individual plants were allelic homozygous orange individual plants.

[0091] It can be known from FIG. 4 and FIG. 5 that 4 plants had no amplified bands with both primers; the results of the resistant gene identification on the population using the CRa clubroot-resistant gene primers showed that 163 individual plants contained the SC2930-Q susceptible marker, where 61 individual plants only contained the SC2930Q marker, and 102 individual plants were heterozygous disease-resistant individual plants; and 138 individual plants contained the SC2930-T disease-resistant marker, where 36 individual plants only contained the SC2930-T marker, this indicated that these individual plants contained the allelic homozygous clubroot-resistant gene CRa. According to the chi-square test, the clubroot-resistant gene conformed to the Mendel's laws of inheritance of 3:1 (x.sup.2=3.392 (x.sup.2 (0.05, 1)=3.84).

[0092] To sum up, in the F.sub.2 segregation population, 51 individual plants contained the homozygous orange head gene; 102 individual plants contained the clubroot-resistant gene, and 36 individual plants contained the homozygous clubroot-resistant gene, wherein to, 34 individual plants were clubroot-resistant orange-heading Chinese cabbage, with the individual plant numbers as 4, 5, 8, 17, 21, 39, 45, 50, 51, 54, 59, 62, 75, 76, 83, 105, 107, 119, 124, 125, 128, 134, 143, 147, 154, 155, 156, 161, 165, 168, 169, 197, 200 and 202, where 7 individual plants were homozygous clubroot-resistant orange-heading Chinese cabbage, with the individual plant numbers as 8, 17, 50, 107, 134, 155 and 168, and all the 7 individual plants were reserved for selfing in next year.

[0093] 3. In the spring of the next year, the 7 individual plants selected and reserved in the previous year were cultivated, and 7 pieces of the seeds of F.sub.2S.sub.1 population were obtained by the individual plants selfing and numbered as 17CR1 to 17CR7, respectively. The seeds of the F.sub.2S.sub.1 population (30 plants for each of 17CR1 to 17CR7, and a total of 210 plants) were sowed and planted in the field in the autumn, and their consistency of horticultural traits was observed, lastly, 10 individual plants with good heading and consistent horticultural traits were selected from each of 17CR1 to 17CR7, and they were naturally subjected to vernalization for selfing in next year.

[0094] 4. In the spring of the next year, the individual plants selected from 17CR1 to 17CR7 were cultivated, and 70 pieces of the seeds of an F.sub.2S.sub.2 population were obtained by the individual plants (70 plants) selfing and numbered as 18CR1 to 18CR70, respectively. The seeds of the F.sub.2S.sub.2 population (30 plants for each of 18CR1 to 18CR70, and a total of 2,100 plants) were sowed and planted in the field in the autumn, the consistency of horticultural traits was observed, lastly, 10 stable lines were selected, and 5 individual plants selected from each line were naturally subjected to vernalization for selfing in next year.

[0095] 5. In the spring of the next year, 10 stable lines selected from 18CR1 to 18CR70 were cultivated, with 5 individual plants for each line, and 50 pieces of seeds of an F.sub.2S3 population were obtained by the individual plants selfing and numbered as 19CR1 to 19CR50, respectively. The seeds of the F.sub.2S.sub.3 population (30 plants for each of 19CR1 to 19CR50, and a total of 1,500 plants) were planted in the field in the autumn, the consistency of horticultural traits was observed, it was found that 3 lines (19CR5, 19CR26 and 19CR38) had regular and consistent horticultural traits and carried the homozygous orange gene and clubroot-resistant gene, the phenotype of the new germplasm of 19CR26 clubroot-resistant orange-heading Chinese cabbage was as shown in FIG. 6 and FIG. 7.

[0096] The new germplasms 19CR26, etc. with the clubroot-resistant orange-heading Chinese cabbage bred in the present invention have regular horticultural traits and good heading, complete the aggregation of the two traits of orange trait and resistance to clubroot, and enrich the germplasm resource of Chinese cabbage, thereby laying a foundation for breeding new varieties of clubroot-resistant orange-heading Chinese cabbage.

[0097] Those described above are only the preferred embodiments of the present invention, rather than limiting the present invention; and any modification, equivalent alternation or improvement within the spirit and principle of the present invention will fall within the protection scope of the present invention.