INGESTIBLE SAMPLING DEVICE

Abstract

The invention relates to cell sampling devices. In particular, the present invention relates to ingestible cell sampling devices for sampling cells in a subject, and methods of use for detecting abnormalities in a subject using the same.

Claims

1. An ingestible cell sampling device comprising: i) an abrasive sponge housed within a dissolvable capsule, the dissolvable capsule comprising an exterior surface exposed to an external environment; ii) a molded cap; and iii) a string having a first end attached to the molded cap.

2. The ingestible cell sampling device of claim 1, further comprising a handle, preferably an unswallowable handle, attached to the string.

3. The ingestible cell sampling device of claim 1 or 2, wherein the abrasive sponge comprises reticulated foam.

4. The ingestible cell sampling device of any of the preceding claims, wherein the abrasive sponge is compressible.

5. The ingestible cell sampling device of claim 4, wherein the abrasive sponge is retained in a compressed state by the dissolvable capsule.

6. The ingestible cell sampling device of any of the preceding claims, wherein in an uncompressed state, the abrasive sponge comprises at least one void space.

7. The ingestible cell sampling device of claim 6, wherein the string passes through at least one void space, preferably at least one concavity.

8. The ingestible cell sampling device of any of the preceding claims, wherein the dissolvable capsule comprises one or more openings, wherein a portion of the abrasive sponge is exposed to the external environment at the one or more openings.

9. The ingestible cell sampling device of any of the preceding claims, wherein the dissolvable capsule comprises a first end and a second end, wherein: a) the first end is closed and the second end is closed; or b) the first end is closed and the second end is open.

10. The ingestible cell sampling device of claim 9, wherein the molded cap comprises a cap interior surface and a cap exterior surface, wherein the cap interior surface is in contact with the exterior surface of the capsule at the first closed end, and the cap exterior surface is in contact with the external environment.

11. The ingestible cell sampling device of claim 9, wherein the molded cap comprises a cap interior surface and a cap exterior surface, wherein the cap interior surface is in contact with the abrasive sponge.

12. The ingestible cell sampling device of claim 11, wherein the cap exterior surface is in contact with an internal surface of the capsule at the first closed end.

13. The ingestible cell sampling device of claim 11 or 12, wherein the cap interior surface is attached to the abrasive sponge by an adhesive.

14. The ingestible cell sampling device of claim 9, wherein the molded cap comprises a cap interior surface in contact with the abrasive sponge and a cap exterior surface in contact with the external environment.

15. The ingestible cell sampling device of claim 14, wherein the cap interior surface is attached to the abrasive sponge.

16. The ingestible cell sampling device of claim 15, wherein the cap interior surface is attached to the abrasive sponge by an adhesive.

17. The ingestible cell sampling device of any of the preceding claims, wherein the string is attached to the molded cap by a knot and/or an adhesive.

18. The ingestible cell sample device of any of the proceeding claims, wherein the string has one or more calibration markings.

19. The ingestible cell sampling device of any of the preceding claims, wherein the string comprises a suture.

20. The ingestible cell sampling device of any of the preceding claims, wherein the string passes through a portion of the abrasive sponge.

21. The ingestible cell sampling device of any of the preceding claims, wherein the molded cap comprises a button.

22. A system or kit for obtaining a cell sample from a subject, comprising an ingestible cell sampling device of any of the preceding claims; and further comprising one or more of: i) a container to receive an abrasive sponge comprising collected cells; ii) a cell preservative reagent, preferably a buffer reagent; iii) a microscope slide; iv) an assay plate; v) a local anesthetic treatment, preferably a local anaesthetic spray; vi) a component of a drinkable solution; preferably a pre-mixed drinkable solution; and vii) a lubricant, preferably a lubricant gel or liquid.

23. A method of obtaining a cell sample from a subject, comprising: i) orally administering an abrasive sponge housed within a dissolvable capsule of a ingestible cell sampling device of any one of claims 1-21 to the subject, and ii) withdrawing from the subject the abrasive sponge, wherein the abrasive sponge collects a cell sample from the subject during the withdrawing.

24. The method of claim 23, wherein the withdrawing is within 10 minutes of the orally administering.

25. The method of claim 23 or claim 24, wherein during the orally administering, the subject swallows the dissolvable capsule of the ingestible cell sampling device.

26. A method of characterizing a cell sample collected according to any one of claims 23-25, comprising assaying the cell sample for at least one biomarker.

27. The method of claim 26, wherein the at least one biomarker is selected comprises one or more of a protein and a nucleic acid.

28. The method of claim 26 or claim 27, wherein the at least one biomarker comprises DNA comprising at least a portion of a gene selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A , CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

29. The method of claim 28, wherein assaying the at least one biomarker comprises determining the DNA to determine the methylation state of the gene.

30. The method of any one of claims 26-29, wherein assaying the at least one biomarker comprises assaying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 of the biomarkers from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A , CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

31. The method of claim 30, wherein assaying the at least one biomarker comprises assaying the methylation state of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 genes from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A , CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK, JAM3, LRRC4, OPLAH, PDGFD, PK1A, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671.

31. The method of any one of claims 28-30, wherein assaying the at least one biomarker comprises assaying the methylation state of at least one gene selected from the group consisting of: ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4, OPLAH, PDGFD, PK1A, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671.

32. The method of any one of claims 28-30, wherein assaying the at least one biomarker comprises assaying the methylation state of at least one gene selected from the group consisting of: BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH.

33. The method of any one of claims 28-30, wherein assaying the at least one biomarker comprises assaying the methylation state of at least one gene selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

34. The method of claim 33, comprising assaying the methylation state of the group of genes consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

Description

DESCRIPTION OF THE DRAWINGS

[0099] These and other features, aspects, and advantages of the present technology will become better understood with regard to the following drawings:

[0100] FIGS. 1A-1D show various embodiments of the dissolvable capsule described herein. FIG. 1A shows a capsule having a first closed end and a second closed end. FIG. 1B shows a capsule having a first closed end and a second open end. FIG. 1C shows a capsule having a first closed end and a second closed end and multiple openings. FIG. 1D shows a capsule having a first closed end and a second open end and multiple openings.

[0101] FIG. 2 shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge housed in a compressed state within a dissolvable capsule having a first closed end and a second closed end, a spherical molded cap having an interior surface in contact with the exterior surface of the second closed end, and a suture attached to the molded cap.

[0102] FIG. 3 shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge housed in a compressed state within a dissolvable capsule having a first closed end and a second closed end, a spherical molded cap having an interior surface in contact with the exterior surface of the second closed end, and a suture attached to the molded cap. The device further includes multiple openings along the cylindrical edge of the dissolvable capsule, such that the abrasive sponge is exposed to the external environment at these openings.

[0103] FIG. 4 shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge housed in a compressed state within a dissolvable capsule having a first closed end and a second open end, a spherical molded cap having an interior surface in contact with the abrasive sponge, and a suture attached to the molded cap. The molded cap covers the second open end of the dissolvable capsule.

[0104] FIG. 5 shows an embodiment of the ingestible cell sampling device described herein. The device comprises an abrasive sponge housed in a compressed state within a dissolvable capsule having a first closed end and a second open end, a spherical molded cap having an interior surface in contact with the abrasive sponge, and a suture attached to the molded cap. The molded cap covers the second open end of the dissolvable capsule. The device further comprises multiple openings along the cylindrical edge of the dissolvable capsule.

[0105] FIGS. 6A-6D show various embodiments of the abrasive sponge described herein. FIG. 6A shows a cylindrical shaped abrasive sponge comprising a portion of material from the center removed. Approximately 25% of the material from the center of the sponge is removed. FIG. 6B shows a similar sponge wherein a larger portion of material from the center is removed. Approximately 50% of the material from the center of the sponge is removed. FIG. 6C shows a cylindrical sponge wherein multiple portions from the edge of the sponge are removed to create a pinwheel shape from the top view. FIG. 6D shows a cylindrical sponge wherein multiple portions from the edge of the sponge are removed to create a cross shape from the top view.

[0106] FIGS. 7A-7B show various views of an abrasive sponge wherein a portion (about 25%) of material from the center of the sponge is removed. The suture material passes through the abrasive sponge and attaches to the molded cap. The uncompressed diameter of the abrasive sponge is about 30 mm (FIG. 7A). A portion of material is removed from the center of the abrasive sponge, and the abrasive sponge is attached to the interior surface of the molded cap by an adhesive (FIG. 7B).

[0107] FIGS. 8A-8B show various views of an abrasive sponge wherein a portion (about 50%) of material from the center of the sponge is removed. The suture material passes through the abrasive sponge and attaches to the molded cap. The uncompressed diameter of the abrasive sponge is about 30 mm (FIG. 8A). A portion of material is removed from the center of the abrasive sponge, and the abrasive sponge is attached to the interior surface of the molded cap by an adhesive (FIG. 8B).

[0108] FIGS. 9A-9B show various views of an abrasive sponge wherein multiple portions of material from the edge of the sponge are removed. The uncompressed diameter of the abrasive sponge is about 30 mm (FIG. 9A). Multiple portions of material from the edge of the sponge are removed, to generate a sponge having a pinwheel shape from the top view (FIG. 9B).

[0109] FIGS. 10A-10B show various views of an abrasive sponge wherein multiple portions of material from the edge of the sponge are removed. The uncompressed diameter of the abrasive sponge is about 30 mm (FIG. 10A). Multiple portions of material from the edge of the sponge are removed, to generate a sponge having a cross shape from the top view (FIG. 10B).

[0110] FIGS. 11A-11D show various embodiments of methods for attaching the string to the molded cap. FIG. 11A shows an embodiment where the suture is attached to the molded cap by means of a knot. The molded cap sits on the outside of a closed end of the capsule. FIG. 11B shows an embodiment where the molded cap covers an open end of the capsule. The string is attached to the molded cap by means of a knot, and the molded cap comprises an elongated cylindrical edge, the circumference of which fits within the circumference of the open end of the capsule. FIG. 11C shows an embodiment where the molded cap is a button. The button fits within the capsule and the string is attached to the button by means of a knot. FIG. 11D shows an embodiment where the molded cap is a button. The button fits within the capsule and the string is attached to the button by means of a knot.

[0111] FIG. 12 shows multiple views of the embodiment for attachment shown in FIG. 11A. The molded cap comprises two holes through which the string is threaded (left). The knot to secure the string to the cap is tied on the inside of the molded cap (center). The molded cap fits over a closed end of the dissolvable capsule, such that the interior surface of the molded cap is in contact with the exterior surface of the closed end of the capsule (right).

[0112] FIG. 13 shows multiple views of the embodiment for attachment shown in FIG. 11B. The molded cap comprises two holes through which the string is threaded (left). The knot to secure the string to the cap is tied on the inside of the molded cap (center). The molded cap comprises an elongated cylindrical edge, the circumference of which fits within the circumference of the open end of the capsule (center, right). The exterior surface of the molded cap is in contact with the external environment.

[0113] FIG. 14 shows multiple views of the embodiment for attachment shown in FIG. 11C. The molded cap is a button. The button comprises two holes through which the string is threaded (left). The knot to secure the string to the button is tied on the inside of the molded cap (center). Alternatively or in addition, the string may be secured to the molded cap by use of an adhesive. The button fits within the capsule (right).

[0114] FIG. 15 shows multiple views of the embodiment for attachment shown in FIG. 11D. The molded cap is a button. The button comprises a bar feature molded into the cap (left). The string wraps around the bar feature, and the knot to secure the string to the button is tied on the inside of the molded cap (center). Alternatively or in addition, the string may be secured to the button (e.g., to the bar feature) by an adhesive. The button fits within the capsule (right).

[0115] FIG. 16 shows multiple views of an exemplary embodiment of the ingestible cell sampling device as described herein. The device comprises dissolvable capsule having a first closed end and a second closed end. The device comprises a spherical molded cap having an exterior surface in contact with the interior surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge may be housed in a compressed state within the dissolvable capsule, such that the interior surface of the spherical molded cap is in contact with the abrasive sponge. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap comprises two holes to allow attachment of the suture, and is slightly recessed on top to account for suture thickness.

[0116] FIG. 17 shows multiple views of an exemplary embodiment of the ingestible cell sampling device as described herein. The device comprises dissolvable capsule having a first closed end and a second closed end. The device comprises a spherical molded cap having an exterior surface in contact with the interior surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge may be housed in a compressed state within the dissolvable capsule, such that the interior surface of the spherical molded cap is in contact with the abrasive sponge. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap comprises two holes to allow attachment of the suture, and is slightly recessed on top to account for suture thickness. The holes are slightly larger than the holes shown in the embodiment of FIG. 16. The larger holes for this device compared to those shown in FIG. 16 may permit different (e.g. larger) knots to be used to attach the suture to the molded cap.

[0117] FIG. 18 shows multiple views of an exemplary embodiment of the ingestible cell sampling device as described herein. The device comprises dissolvable capsule having a first closed end and a second open end. An abrasive sponge may be housed in a compressed state within the dissolvable capsule. The device comprises a spherical molded cap having an interior surface in contact with the abrasive sponge, and a suture attached to the molded cap. The exterior surface of the spherical molded cap is exposed to the external environment. The molded cap covers the second open end of the dissolvable capsule. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap comprises two holes to allow attachment of the suture, and is slightly recessed on top to account for suture thickness.

[0118] FIG. 19 shows multiple views of an exemplary embodiment of the ingestible cell sampling device as described herein. The device comprises dissolvable capsule having a first closed end and a second open end. An abrasive sponge may be housed in a compressed state within the dissolvable capsule. The device comprises a spherical molded cap having an interior surface in contact with the abrasive sponge, and a suture attached to the molded cap. The exterior surface of the molded cap is exposed to the external environment. The molded cap covers the second open end of the dissolvable capsule. Exemplary side, top, and angled views of the molded cap are shown on the right. The molded cap comprises two holes to allow attachment of the suture, and is slightly recessed on top to account for suture thickness. The holes are slightly larger than the holes shown in the embodiment of FIG. 18. The larger holes for this device compared to those shown in FIG. 18 may permit different (e.g. larger) knots to be used to attach the suture to the molded cap. FIG. 20 shows multiple views for an exemplary embodiment of a handle as described herein. The handle has a hook shape. The handle “pinches” the dissolvable capsule within a set of grippers at one end of the handle. The other end of the handle is a hook. The suture may be wound around any suitable portion of the handle. For use in a subject, the ingestible device may be removed and the suture may be unwound. The device may be ingested by the subject, while the subject or a third party holds on to the hook end of the handle.

[0119] FIG. 21 shows an exemplary embodiment of a handle as described herein. The handle comprises a cavity in which the dissolvable capsule may be placed. The suture may be wound around a separate portion of the handle, as shown. When wound, the suture may be held in place by a suitable amount of tension. The handle may comprise tabs, which may be squeezed to remove tension from the suture and allow for facile removal of the suture from the handle, without the need to unwind the entire length of the suture.

[0120] FIG. 22 shows another exemplary embodiment of a handle as described herein. The handle may be circular in shape. The handle comprises a cavity in which the dissolvable capsule may be placed. The suture may be wound around the external edge of the circular handle, such as along a slightly recessed channel extending along the outer edge of the handle. The suture may be tied in such as a position, which may be facilitated by a single hole placed in the circular handle. The suture may be untied and unwound from the circular handle to allow for the subject to ingest the device.

[0121] FIG. 23 shows another exemplary embodiment of a handle as described herein. The handle is a T-shape. The handle comprises a cavity in which the dissolvable capsule may be placed. The suture may be held in place by winding the suture around the handle.

[0122] FIG. 24 shows an exemplary embodiment of a handle as described herein. The handle comprises a flat surface on one end, and a hook shape on the opposing end. The flat surface comprises a cavity in which the dissolvable capsule may be placed. The flat surface additionally comprises a plurality of openings to provide a variety of suitable attachment sites for the suture.

[0123] FIGS. 25A-25F show exemplary assay designs for detecting biomarkers of esophageal disorders in a sample.

DETAILED DESCRIPTION OF THE INVENTION

[0124] The technology relates to cell sampling devices. In particular, the present invention relates to ingestible cell sampling devices and their use in methods for detecting various abnormalities in a subject.

[0125] The ingestible cell sampling devices described herein are advantageous in that the devices provide improved safety for use in a subject. For example, the ingestible cell sample devices described herein comprise a handle to facilitate ease of use by the subject. The handle provides a suitable surface for the user or a third party to hold onto during ingestion of the dissolvable capsule component of the device, thereby preventing loss within the subject and facilitating facile removal of the device following a suitable duration of time. As another example, the ingestible cell sampling devices described herein are designed to prevent detachment of the string from the molded cap, thus preventing loss of the device within a subject. As another example, the ingestible cell sampling devices described herein are designed to minimize the risk of the sponge detaching from the string during retrieval of the device, thus also preventing loss of the device within the subject. Furthermore, the devices described herein use materials that prevent laceration to the esophagus upon withdrawal of the device. The devices are easily swallowed by the subject, with a rapid dissolution of the capsule and expansion of the sponge, thus minimizing the total time required to collect an esophageal sample from the subject. Furthermore, the sponge comprises multiple features that enable for maximal surface area to capture sufficient tissue from a subject. Accordingly, described herein are ingestible cell sampling devices with maximal sampling capabilities having enhanced safety and tolerability for use in a subject.

[0126] In some embodiments, provided herein are ingestible cell sampling devices. The devices comprise an abrasive sponge housed within a dissolvable capsule, a molded cap, and a string attached to the molded cap.

[0127] The abrasive sponge may comprise any suitable material. Preferably, the material is capable of being compressed and retained in a compressed state by the dissolvable capsule. For example, the abrasive sponge may comprise a reticulated material. In some embodiments, the reticulated material comprises 10-35 pores per inch of material. For example, the reticulated material may comprise about 10, about 15, about 20, about 25, about 30, or about 35 pores per inch of material. The material may be any suitable porous, low-density material capable of collecting esophageal cells from a subject. For example, the abrasive sponge may comprise reticulated polyurethane. In some embodiments, the abrasive sponge comprises a reticulated polyester material. In some embodiments, the abrasive sponge comprises a reticulated polyether material.

[0128] The porosity of the abrasive sponge may be at least 80%. For example, the porosity may be at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0129] The abrasive sponge may be of any suitable size and shape. The size and shape of the sponge may depend on the size of the capsule. In some embodiments, the abrasive sponge is of a suitable size and shape to allow for compression into a capsule suitable for oral administration (e.g. ingestion), and subsequent facile removal from the esophagus and throat of a subject after dissolution of the capsule and restoration of the sponge to its uncompressed size. For example, the sponge may be cylindrical in shape. For example, the sponge may be cylindrical in shape with a diameter (e.g. the diameter of the circular portion forming the shaft of the cylinder) of about 20-400 mm in an uncompressed shape. For example, the diameter may be about 20 mm, about 25 mm, about 30 mm, about 35 mm, or about 40 mm in an uncompressed state. For example, the sponge may be cylindrical in shape with a diameter of 20 mm, 21 mm, 22 mm, 23 mm, 24 mm, 25 mm, 26 mm, 27 mm, 28 mm, 29 mm, or 30 mm in an uncompressed state.

[0130] As another example, the sponge may be spherical in shape. For example, the sponge may be spherical in shape with a diameter of about 20-40 mm in an uncompressed state. For example, the sponge may be spherical in shape with a diameter of about 20 mm, about 25 mm, about 30 mm, about 35 mm, or about 40 mm in an uncompressed state. For example, the sponge may be spherical in shape with a diameter of 20 mm, 21 mm, 22 mm, 23 mm, 24 mm, 25 mm, 26 mm, 27 mm, 28 mm, 29 mm, or 30 mm in an uncompressed state.

[0131] The abrasive sponge may be compressed to a suitable size and housed within the dissolvable capsule in a compressed state. For example, the compressed sponge may have a diameter of about 1 mm to about 15 mm. For example, the compressed sponge may have a diameter of 1 mm, 2 mm, 3 mm, 4 mm, 5 mm, 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm, 14 mm, or 15 mm in a compressed state.

[0132] In some embodiments, the dissolution of the dissolvable capsule releases the abrasive sponge from compression and allows the abrasive sponge to expand. In some embodiments, the abrasive sponge expands to its uncompressed size following dissolution of the dissolvable capsule. In some embodiments, the abrasive sponge expands to substantially the same size as its original, uncompressed size prior to packaging within the capsule. As a nonlimiting example, the abrasive sponge may expand to within 10% of the original, uncompressed size following dissolution of the dissolvable capsule. For example, the sponge may expand to within 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of the original, uncompressed size following dissolution of the dissolvable capsule. For example, the original, uncompressed size may be 30 mm and the sponge may expand to 27-30 mm following dissolution of the capsule.

[0133] In some embodiments, the uncompressed sponge is uniform in shape. For example, the uncompressed sponge may be uniformly spherical in shape. In some embodiments, the uncompressed sponge may be uniformly cylindrical in shape. In some embodiments, the uncompressed sponge may be spherical in shape with a protrusion that extends a portion of the abrasive sponge material into the dissolvable capsule. This protrusion is exemplified in FIG. 8B.

[0134] In some embodiments the abrasive sponge is formed to have concavities or indentations, or other external or internal spaces devoid of sponge material (“void spaces”), as may be provided by removing at least one portion of the abrasive sponge. As used herein in reference to a shape of an abrasive sponge, a “removed” portion of a sponge refers a void space in the shaped abrasive sponge, e.g., a portion that would be removed from a simple solid form, e.g., a sphere or cylinder, to produce the final shape comprising one or more void spaces. It is understood that an abrasive sponge may be manufactured in a final form that comprises such a void space, such that no sponge material need be physically “removed” during manufacture. In some embodiments, at least one portion of material may be removed from the center of the abrasive sponge. For example, the sponge may be cylindrical in shape and a portion of the material may be removed from the center of the sponge. As another example, the sponge may be spherical in shape and a portion of the material may be removed from the center of the abrasive sponge. For example, such embodiments are exemplified in FIGS. 6A and 6B. In some embodiments, at least one portion of material may be removed from at least one outer edge of the abrasive sponge. For example, the sponge may be cylindrical in shape and at least one portion of the material may be removed from the edge of the abrasive sponge. As another example, the sponge may be spherical in shape and at least one portion of the material may be removed from the edge of the abrasive sponge. Various embodiments are exemplified in FIGS. 6C and 6D. For example, multiple portions of material may be removed from the edge of the sponge to generate a pinwheel shape (as shown in FIG. 6C) or a cross-shape (as shown in FIG. 6D), when the sponge is viewed from the top.

[0135] Any suitable sized portion may be removed from the sponge. For example, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or more of the material may be removed from the sponge. In some embodiments, removal of a portion of the material facilitates compression of the sponge into a suitable sized capsule for ingestion by a subject. In some embodiments, removal of a portion of the material from the sponge facilitates rapid expansion of the sponge following dissolution of the dissolvable capsule. In some embodiments, removal of a portion of the material from the sponge increases the surface area of the sponge available for collecting esophageal cells in the subject.

[0136] The abrasive sponge is housed within a dissolvable capsule. Accordingly, the abrasive sponge may be compressed into a cylindrical shape to fit into the dissolvable capsule. The dissolvable capsule may comprise any suitable material. For example, the dissolvable capsule may comprise gelatin, starch, or a cellulosic material as known in the art. In some embodiments, the dissolvable may be a vegan or vegetarian capsule (e.g., exclusive of all animal products, or free of products from certain types of animals; e.g. gelatin-free capsule).

[0137] The dissolvable capsule may be made of a suitable material. In some embodiments, the dissolvable capsule comprises a suitable material that dissolves within 10 minutes of entering the stomach cavity of a subject. For example, the dissolvable capsule may dissolve approximately within 10 minutes, within 9 minutes, within 8 minutes, within 7 minutes, within 6 minutes, within 5 minutes, within 4 minutes, within 3 minutes, within 2 minutes, or within 1 minute of exposure to the stomach cavity of a subject. Preferably, the dissolvable capsule dissolves within 5 minutes of exposure to the stomach cavity of the subject.

[0138] In some embodiments, the dissolvable capsule comprises a first closed end and a second closed end. For example, a dissolvable capsule comprising a first closed end and a second open end is shown in FIG. 1A. In other embodiments, the dissolvable capsule comprises a first closed end and a second open end. For example, a dissolvable capsule comprising a first closed end and a second open end is shown in FIG. 1B.

[0139] In some embodiments, the dissolvable capsule comprises one or more openings, such that a portion of the abrasive sponge is exposed to the external environment at the one or more openings. The presence of one or more openings may facilitate a faster dissolution time of the capsule upon ingestion by a subject. In some embodiments, the dissolvable capsule comprises one opening. In some embodiments, the dissolvable capsule comprises two or more openings. Representative images of capsules containing one or more openings are shown in FIG. 1C (capsule having a first closed end and a second open end) and FIG. 1D (capsule having a first closed end and a second open end).

[0140] The one or more openings may be any suitable size and shape that allow for exposure of the abrasive sponge to the external environment without substantially diminishing the ability of the capsule to retain the sponge in a compressed state. The one or more openings may be in any suitable location on the dissolvable capsule. For example, the dissolvable capsule may comprise one or more openings on a closed end of the capsule. As another example, the dissolvable capsule may comprise one or more openings on a cylindrical edge of the capsule.

[0141] The ingestible cell sampling device further comprises a molded cap. In some embodiments, the molded cap is hemispherical in shape. In some embodiments, the molded cap is cylindrical in shape (e.g., a button). In some embodiments, the molded cap is connected to the capsule. For example, the molded cap may be connected to the capsule by an adhesive. In some embodiments, the molded cap is connected to the abrasive sponge. For example, the molded cap may be connected to the abrasive sponge by an adhesive. In some embodiments, the molded cap fits within the capsule.

[0142] In some embodiments, the cell sampling device may comprise a capsule comprising a first closed end and a second closed end, and a hemispherical molded cap may cover one of the closed ends of the capsule. For example, the molded cap may comprise an internal surface in contact with an external surface of one end of the capsule and an exterior surface in contact with the external environment (as exemplified in FIG. 2 and FIG. 3). In some embodiments, the molded cap comprises an interior surface in contact with the abrasive sponge and an exterior surface. In some embodiments, the exterior surface may be in contact with the external environment. For example, the capsule may comprise a first closed end and a second open end, and the molded cap may cover the second open end of the capsule. For example, the molded cap may comprise an elongated cylindrical edge, the circumference of which fits within the circumference of the capsule (as exemplified in FIG. 4).

[0143] In some embodiments, the molded cap comprises an interior surface in contact with the abrasive sponge and an exterior surface in contact with an internal surface of one end of the capsule. For example, the capsule may comprise a first closed end and a second closed end, and a hemispherical molded cap may comprise an interior surface in contact with the abrasive sponge and an exterior surface in contact with the internal surface of one closed end of the capsule (e.g., the molded cap is fitted within the capsule). In some embodiments, the capsule may comprise a first closed end and a second closed end, and a cylindrically shaped molded cap (e.g., a button) may be fitted inside the capsule. In such embodiments, the button may be fitted inside the capsule such that the rim of the molded cap is in contact with the capsule, the bottom surface of the molded cap is in contact with the abrasive sponge, and the top surface of the molded cap is not in direct contact with the interior surface of the capsule (as exemplified in FIG. 14 and FIG. 15). In some embodiments, the cell sampling device comprises a capsule comprising a first closed end and a second closed end, and a hemispherical molded cap may fit within the capsule. For example, the cell sampling may comprise a hemispherical molded cap having an exterior surface in contact with the interior surface of the second closed end, and a suture attached to the molded cap. An abrasive sponge may be housed in a compressed state within the dissolvable capsule, such that the interior surface of the spherical molded cap is in contact with the abrasive sponge. Such an embodiment is shown, for example, in FIG. 16 and FIG. 17.

[0144] In embodiments wherein the interior surface of the molded cap is in contact with the abrasive sponge, the interior surface of the molded cap may be attached to the abrasive sponge. For example, the interior surface of the molded cap may be attached to the abrasive sponge by an adhesive.

[0145] In embodiments where a surface of the molded cap is in contact with the capsule, the molded cap may be attached to the capsule (e.g. by an adhesive).

[0146] The ingestible cell sampling device further comprises a string attached to the molded cap. The string may be attached to the molded cap by any suitable means, including but not limited to crimping, over-molding, adhesive, melting, wrapping, or taping. In some embodiments, the string is attached to the molded cap by an adhesive. In some embodiments, the string is attached to the molded cap by a knot. Any suitable type of knot may be used. For example, the knot may be a hitch knot. The term “hitch knot” refers to a type of knot used to tie a string to an object or to another string. The term encompasses many distinct types of hitch knots, including an alternate ring hitching, anchor bend variant, bale sling hitch, barrel hitch, becket hitch, blackwall hitch, blake's hitch, boom hitch, bottom loaded release hitch, buntline hitch, cat's paw, chain hitch, clinging clara, clove hitch, continuous ring hitching, cow hitch variant, cow hitch with toggle, cow hitch, double half hitches, Farrimond friction hitch, garda hitch, ground-line hitch, half hitch, halter hitch, highpoint hitch, highwayman's hitch, hitching tie, icicle hitch, killick hitch, knute hitch, lighterman's hitch, magnus hitch, marline hitching, marlinespike hitch, masthead knot, midshipman's hitch, munter hitch, munter friction hitch, ossel hitch, palomar knot, pile hitch, prusik knot, reverse half hitches, round hitch, round turn and two half hitches, sailor's gripping hitch, sailor's hitch, siberian hitch, single hitch, slippery hitch, snell knot, snuggle hitch, taut-line hitch, timber hitch, trilene knot, trucker's hitch, tugboat hitch, uni knot, or a wagoner's hitch knot. In some embodiments, the hitch knot is a double overhand knot.

[0147] In some embodiments, the knot may be a binding knot. The term “binding knot” refers to a type of knot used to keep an object or multiple objects together, using a string that passes at least once around them. Suitable binding knots include, for example, a boa knot, a bottle sling, a bowline knot, a constrictor knot, a corned beef knot, a granny knot, a ground-line hitch, a Miller's knot, a Packer's knot, a reef knot, a strangle knot, a surgeon's knot, a thief knot, a jamming knot, a sheet bend, or a common whipping knot. The type of knot may be selected to allow for ease of manufacturing while also providing a stable means of connecting the string to the molded cap.

[0148] The molded cap may comprise any suitable feature to enable attachment of the string to the cap. For example, the molded cap may comprise two holes through which the string can be threaded and tied into a suitable knot. The string can be threaded through the first hole, pass through the external environment, and re-enter the interior of the capsule by passing through the second hole, before a knot can be tied on the interior of the capsule. As another example, the molded cap may comprise a bar on which the string can be secured (as shown in FIG. 11D).

[0149] The string may comprise any suitable material. For example, the string may be a suture material (e.g. surgical suture material). The suture material may be made from a variety of materials, including biological materials or synthetic materials. For example, the suture material may comprise synthetic materials such as nylon, polyester, PVDF, polypropylene, or combinations thereof.

[0150] The string should be of a suitable thickness to allow for facile ingestion by the subject without causing lacerations to the throat. In some embodiments, the string has a thickness of 0.3 mm to 0.7 mm. For example, the string may have a thickness of 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm, 0.55 mm, 0.6 mm, 0.65 mm, or 0.7 mm.

[0151] The string should be of a suitable length to allow for retrieval of the device after dissolution of the dissolvable capsule in the subject. Accordingly, the string should be long enough to allow for the abrasive sponge contained within the dissolvable capsule to reach the stomach cavity of the subject, while retaining enough string for the subject or a physician to be able to grip the string to initiate retrieval of the device. For example, the string may be at least 60 cm long. In some embodiments, the string may be 60cm to 80cm long. For example, the string may be 60 cm, 61 cm, 62 cm, 63 cm, 64 cm, 65 cm, 66 cm, 67 cm, 68c cm, 69 cm, 70 cm, 71 cm, 72 cm, 73 cm, 74 cm, 75 cm, 76 cm, 77 cm, 78 cm, 79 cm, or 80 cm long.

[0152] In some embodiments, the string may comprise markings on the string to judge the amount of string that has been swallowed. Such markings would assist in determining that the dissolvable capsule has traveled to the desired area (e.g. the stomach cavity of the subject). The markings may be spaced any suitable distance apart. For example, the markings may be spaced 1-80 cm apart. For example, the markings may be placed about 1 cm, about 5 cm, about 10 cm, about 15 cm, about 20 cm, about 25 cm, about 30 cm, about 35 cm, or about 40 cm apart.

[0153] The string should have a suitable tensile strength to minimize the risk of the string breaking during ingestion and/or retrieval of the device. For example, the string should have a suitable tensile strength to allow for the string to be pulled to retrieve the device from the subject after dissolution of the dissolvable capsule. In some embodiments, the ingestible device may comprise a handle or a grip to facilitate retrieval of the device and/or prevent swallowing of the entire string. For example, the ingestible device may comprise a handle attached to the end of the string that is not attached to the moldable cap or button. For example, the ingestible device may comprise a handle or a grip on the end of the string that does not contain the capsule. The handle or grip may be of any suitable size and shape to facilitate retrieval and prevent swallowing of the string. The handle or grip may be an open shape (e.g. bar shape, T-shape, X-shape, hook shape, etc.) or a closed shape (e.g. circular or semi-circular shape, rectangular shape, triangular shape, etc.), and may be formed from the same material as the string (e.g., may be a loop or knot in the string) or may comprise different material (e.g., plastic, metal, etc.). Suitable handles are demonstrated herein, in particular in FIGS. 21, 22, 23, and 24.

[0154] In some embodiments, the handle also serves as means to store the ingestible device prior to use in a subject. For example, the handle may comprise a cavity in which the dissolvable capsule may be contained. The handle may also comprise a means to wind the string (e.g., suture) around the handle during storage.

[0155] In some embodiments, the handle pinches dissolvable capsule ingestible device within a set of grippers at one end of the handle. The handle may comprise a mechanism to loosen or unlock the grippers, thereby releasing the dissolvable capsule prior to use in a subject. In some embodiments, the other end of the handle (e.g. the end opposite to the grippers) is a hook. Such an embodiment is shown in FIG. 20.

[0156] In some embodiments, the handle comprises a flat surface containing a cavity in which the dissolvable capsule may be placed and a segment around which the suture may be wrapped. The handle may further comprise a means to release tension on the suture, thereby facilitating removal of the length of suture without the need for unwinding. Such an embodiment is shown, for example, in FIG. 21. In this particular figure, the handle comprises tabs, which may be squeezed to remove tension from the suture and allow for facile removal of the suture from the handle.

[0157] In some embodiments, the handle is circular in shape. The handle comprises a flat surface containing a cavity in which the dissolvable capsule may be placed. The suture may be wound around the external edge of the circular handle, such as along a slightly recessed channel extending along the outer edge of the handle. The suture may be tied in such as a position, which may be facilitated by a single hole placed in the circular handle. The suture may be untied and unwound from the circular handle to allow for the subject to ingest the device. Such an embodiment is shown in FIG. 22.

[0158] In some embodiments, the handle is a T-shape. The top cross section of the T may comprise a cavity in which the dissolvable capsule may be placed, whereas the perpendicular cross section may be used to wind the suture around the handle. Such an embodiment is shown, for example, in FIG. 23.

[0159] In some embodiments, the handle comprises a modified hook shape with multiple attachment sites to which the suture may be secured. FIG. 24 shows an exemplary embodiment of a handle as described herein. The handle comprises a flat surface on one end, and a hook shape on the opposing end. The flat surface comprises a cavity in which the dissolvable capsule may be placed. The flat surface additionally comprises a plurality of openings to provide a variety of suitable attachment sites for the suture.

[0160] In some embodiments, the string passes through a portion of the abrasive sponge. Accordingly, passing the string through the sponge will help secure the sponge to the molded cap, such that the sponge is not lost within the subject after dissolution of the dissolvable capsule. In some embodiments, the string passes through at least one surface of the dissolvable capsule. For example, the string may pass through the first closed end of the dissolvable capsule, through the abrasive sponge, and then attach to the molded cap. In some embodiments, the string may pass through the first closed end of the dissolvable capsule, through the abrasive sponge, through the second closed end of the dissolvable capsule, and then attach to the molded cap. The end of the string not attached to the molded cap may be attached to a handle, as described above.

[0161] Further described herein are methods for collecting cells from a subject. The methods comprise providing an ingestible cell sampling device described herein to the subject. Suitable methods for providing an ingestible cell sampling device to a subject are described in U.S. Pat. Nos. 4,735,214, 10,327,742, and 10,292,687, each of which are incorporated herein by reference in their entireties. For example, the subject may swallow the ingestible cell sampling device described herein and a suitable amount of time may pass prior to retrieving the device from the subject. For example, the subject may swallow the ingestible cell sampling device and 10 minutes or less may be allowed to pass prior to retrieval. For example, 10 minutes, 9 minutes, 8 minutes, 7 minutes, 6 minutes, 5 minutes, 4 minutes, 3 minutes, 2 minutes, or 1 minute may pass prior to retrieval. Retrieval may comprise having the subject, physician, or otherwise suitable person grab and pull on the string at a suitable rate to allow for comfortable retrieval of the device from the subject. Esophageal cells may be harvested from the abrasive sponge by any suitable means and subsequently analyzed to determine whether one or more abnormalities are present in the subject. In some embodiments, the esophageal cells may be harvested and placed in a suitable stabilization buffer prior to analysis. For example, a stabilization buffer may comprise any suitable agent or combination of agents that prevent unwanted damage to the cells (e.g. cell lysis) or damage/degradation of the nucleic acids (e.g. DNA or RNA) contained within the cell sample.

[0162] In some embodiments, esophageal cells are harvested from the abrasive sponge and analyzed to determine whether an esophageal disorder is present in the subject. Analysis may be performed by any suitable method, including protein-based tests, tissue/cell examinations (e.g., microscopy or other visual inspections), and/or nucleic acid detection assays. For example, analysis may be performed by protein-based techniques to analyze one or more biomarkers of interest. Protein-based techniques include, for example, immunohistochemistry, ELISA, western blot, flow cytometry, fluorescent in-situ hybridization (FISH), fluorescence analysis of cell sorting (FACS), mass spectrometry, etc. For example, protein-based techniques may be performed using one or more antibodies against at least one biomarker protein of interest. The biomarker protein(s) may be detected using an antibody capable of reacting with the protein(s), and subsequent visualization of the antibody. The antibody may be a polyclonal antibody or a monoclonal antibody. The use of secondary, tertiary or further antibodies may advantageously employed in order to amplify the signal and facilitate detection.

[0163] In some embodiments, esophageal cells are harvested from the abrasive sponge and examined to determine whether an esophageal disorder is present in the subject. For example, cells may be harvested from the sponge, plated on an appropriate medium, and examined by microscopy or other visual examination to determine whether characteristics indicative of an esophageal disorder are present in the cells. In some embodiments, cells may be harvested from the sponge, plated, and inspected using a microscope to determine whether one or more cancer cells are present. In some embodiments, diagnosis of an esophageal disorder may be made by visualization of a specific cell type, such as a columnar cell, which may be indicative of gastroesphageal reflux disease or complications thereof, including Barrett's Esophagus or esophageal adenocarcinoma.

[0164] In some embodiments, esophageal cells are harvested from the abrasive sponge and one or more nucleic acid detection assays are performed to determine whether an esophageal disorder is present in the subject. For example, esophageal cells may be harvested from the abrasive sponge following use in a subject, and the cells may be analyzed by one or more nucleic acid detection assays to detect levels of one or more biomarkers of an esophageal disorder. Suitable methods (e.g. nucleic acid detection assays) and biomarkers for detecting esophageal disorders are described in U.S. patent application Ser. No. 15/881,409 of Allawi, et al., filed Jan. 26, 2018, (including, e.g., ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671), and U.S. Pat. No. 10,435,755, (including, e.g., BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A; and OPLAH), both of which are incorporated herein by reference in their entireties. Exemplary assay designs for suitable biomarkers ZNF682, NDRG4, and VAV3 are discussed in more detail, below.

[0165] Exemplary nucleic acid assay designs are shown in FIG. 16A-16F. For example, esophageal cells may be harvested from the abrasive sponge and the levels of one or more biomarkers selected from ZNF682, NDRG4, and VAV3 may be determined. In some embodiments, levels of ZNF682, NDRG4, and VAV3 may be determined. In some embodiments, detecting an esophageal disorder may comprise measuring DNA methylation levels of the one or more biomarkers.

[0166] In some embodiments, the biomarker may be ZNF682. Exemplary primers and probes for ZNF682 are shown in FIG. 16A. In some embodiments, the ZNF682 forward primer may comprise 5′AGTTTATTTTGGGAAGAGTCGCG3′ (SEQ ID NO: 3), the reverse primer may comprise 5′CCATTATCCCCGCAATCGAA3′ (SEQ ID NO: 4), and the probe may comprise 5′CGCGCCGAGGGCGCGTTTTTGCGTT/3C6/3′(SEQ ID NO: 5).

[0167] In some embodiments, the biomarker may be VAV3. Exemplary primers and probes for VAV3 are shown in FIG. 16B. In some embodiments, the VAV3 forward primer may comprise 5′TCGGAGTCGAGTTTAGCGC3′ (SEQ ID NO: 8) and the reverse primer may comprise 5′CGAAATCGAAAAAACAAAAACCGC3′ (SEQ ID NO: 9). In some embodiments, VAV3 may be detected by one probe or two probes. For example, VAV3 may be detected by the probe (arm 1) 5′CGCCGAGGCGGCGTTCGCGA/3C6/3′ (SEQ ID NO: 10) and/or the probe (arm 5) 5′CCACGGACGCGGCGTTCGCGA/3C6/3′ (SEQ ID NO: 11).

[0168] In some embodiments, the biomarker may be NDRG4. Exemplary primers and probes for NDRG4 are shown in FIG. 16C. In some embodiments, the NDRG4 forward primer may comprise 5′CGGTTTTCGTTCGTTTTTTCG3′ (SEQ ID NO: 14), the reverse primer may comprise 5′CCGCCTTCTACGCGACTA3′ (SEQ ID NO: 15), and the probe may comprise 5′CCACGGACGGTTCGTTTATCG/3C6/3′ (SEQ ID NO: 16).

[0169] In some embodiments, the biomarker may be bone morphogenic protein 3 (BMP3). In some embodiments, the biomarker may be ZNF568. In some embodiments, the biomarker may be BMP3 and ZNF568.

[0170] In some embodiments, one or a group of biomarkers for analyzing a sample collected from an esophagus, e.g., for detecting esophageal disorders, may be selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, FER1L4, ANKRD13B, CD1D, CDKN2A , CHST2, CNNM1, DIO3, DOCK2, DTX1, ELMO1, FERMT3, FLI1, GRIN2D, HUNK , JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, ZNF304, and ZNF671. Biomarkers selected from this group may comprise 1 biomarker, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 biomarkers, alone or in any combination or subcombination, without limitation. For example, in certain embodiments, the biomarker or group of biomarkers is selected from the group consisting of ANKRD13B, CHST2, CNNM1, DOCK2, DTX1, FER1L4, FERMT3, FLI1, GRIN2D, JAM3, LRRC4, OPLAH, PDGFD, PKIA, PPP2R5C, QKI, SEP9, SFMBT2, SLC12A8, TBX15, TSPYL5, VAV3, ZNF304, ZNF568, and ZNF671, while in some embodiments, the biomarker or group of biomarkers is selected from the group consisting of BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH. In some embodiments, the biomarker or group of biomarkers is selected from the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4, and in certain embodiments, the group of biomarkers comprises the group consisting of NDRG4, ZNF682, VAV3, BMP3, ZNF568, and FER1L4.

[0171] In some embodiments, the one or more biomarkers are normalized against a reference marker. Suitable methods and reference markers are described in U.S. Pat. No. 10,465,248 and U.S. patent application Ser. No. 16/318,580, the entire contents of each of which are incorporated herein by reference. In some embodiments, the reference marker is selected from β-actin, ZDHHC1, and B3GALT6.

[0172] In some embodiments, the reference marker may be ZDHHC1. Exemplary primers and probes for ZDHHC1 are shown in FIG. 16D. In some embodiments, the ZDHHC1 forward primer comprises 5′GTCGGGGTCGATAGTTTACG3′ (SEQ ID NO: 19), the reverse primer comprises 5′ACTCGAACTCACGAAAACG3′ (SEQ ID NO: 20), and the probe comprises 5′CCACGGACGGACGAACGCACG/3C6/3′ (SEQ ID NO: 21).

[0173] In some embodiments, the reference marker may be B3GALT6. Exemplary primers and probes for B3GALT6 are shown in FIG. 16E. In some embodiments, the B3GALT6 forward primer comprises 5′GGTTTATTTTGGTTTTTTGAGTTTTCGG3′ (SEQ ID NO:24), the reverse primer comprises 5′TCCAACCTACTATATTTACGCGAA3′ (SEQ ID NO:25), and the probe comprises 5′CCACGGACGGCGGATTTAGGG/3C6/3′ (SEQ ID NO:26).

[0174] In some embodiments, the reference marker may be β-actin. Exemplary primers and probes for β-actin are shown in FIG. 16F. In some embodiments, the β-actin forward primer comprises 5′GTGTTTGTTTTTTTGATTAGGTGTTTAAGA3′ (SEQ ID NO:32), the reverse primer comprises 5′CTTTACACCAACCTCATAACCTTATC3′ (SEQ ID NO:33), and the probe comprises 5′GACGCGGAGATAGTGTTGTGG/3C6/3′ (SEQ ID NO:34).

[0175] All literature and similar materials cited in this application, including but not limited to, patents, patent applications, articles, books, treatises, and internet web pages are expressly incorporated by reference in their entirety for any purpose. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which the various embodiments described herein belongs. When definitions of terms in incorporated references appear to differ from the definitions provided in the present teachings, the definition provided in the present teachings shall control.

[0176] Various modifications and variations of the described compositions, methods, and uses of the technology will be apparent to those skilled in the art without departing from the scope and spirit of the technology as described. Although the technology has been described in connection with specific exemplary embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in pharmacology, biochemistry, medical science, or related fields are intended to be within the scope of the following claims.