USE OF LYTIC POLYSACCHARIDE MONOOXYGENASES, ENZYMATIC COMPOSITION CONTAINING SAME, AND DEGRADATION METHOD FOR PLASTIC POLYMERS

20230193218 · 2023-06-22

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to the novel activity of the enzymatic composition containing lytic polysaccharide monooxygenases (LPMOs) that are bacterial (Auxiliary Activity 10, AA10) and/or fungal (Auxiliary Activity 9, AA9) for degrading polyethylene terephthalate (PET) and related plastic polymers. The genes that encode KpLPMO10A (AA10) and AfLPMO9A (AA9) were isolated from Kitasatospora papulosa and Aspergillus fischeri microorganisms, respectively. Methods such as atomic force microscopy (AFM) and X-ray photoelectron spectroscopy (XPS) detected alterations in the superficial chemical composition and morphology of the PET found in liquid bottles when treated with LPMOs. The gentle temperature conditions used during the LPMO-PET reaction suit the use of these enzymes to help canonical enzymes (PETases) deconstruct plastics, which is beneficial for the circular economy for PET.

    Claims

    1. An enzymatic composition for use in the degradation of polyester, comprising: at least one lytic polysaccharide monooxygenase selected from an enzyme comprising the amino acid sequence having at least 60% identity with SEQ ID NO: 2, an enzyme comprising the amino acid sequence having at least 60% identity with SEQ ID NO: 5, or a mixture thereof; and a vehicle.

    2. The enzymatic composition, according to claim 1, wherein the enzyme comprising the amino acid sequence that has at least 60% identity with SEQ ID NO: 2 is present in a concentration of at least one of: between approximately 0.001% and approximately 0.100% by total weight of the composition; and between approximately 0.002% and approximately 0.005% by total weight of the composition.

    3. The enzymatic composition, according to claim 2, wherein the enzyme comprising the amino acid sequence that has at least 60% identity with SEQ ID NO: 2 is KpLPMOA10 (AA10) isolated from Kitasatospora papulosa.

    4. The enzymatic composition, according to claim 1, wherein the enzyme comprising the amino acid sequence SEQ ID NO: 5 is present in a concentration of at lest one of: between approximately 0.001% and approximately 0.100% in total weight of the composition; and between approximately 0.002% and approximately 0.005% by total weight of the composition.

    5. The enzymatic composition, according to claim 4, wherein the enzyme comprising an amino acid sequence that has at least 60% identity with SEQ ID NO: 5 is the AfLPMOA9 (AA9) isolated from Aspergillus fischeri.

    6. The enzymatic composition, according to claim 1, further comprising at least one cutinase.

    7. The enzymatic composition, according to claim 6, wherein the cutinase is a PETase.

    8. The composition, according to claim 7, wherein the PETase is in a concentration of at least one of: Between approximately 0.0005% and approximately 0.0500% in total weight of the composition; and between approximately 0.0010% and approximately 0.0025% by total weight of the composition.

    9. The enzymatic composition, further comprising: approximately 0.003% of KpLPMOA10; approximately 0.003% of AfLPMOA9; and a vehicle.

    10. The enzymatic composition, according to claim 9, further comprising 0.002% of a PETase.

    11. The enzymatic composition, according to claim 1, further compirsing use of the enzymatic coposition in the degradation of polyethylene terephthalate (PET).

    12. The enzymatic composition, according to claim 11, wherein the PET is selected from liquid bottles, food packaging, window films, X-ray films, fabric fibers, a mixture of these and any other materials mostly made of PET, without limitations.

    13. A method of PET degradation, comprising: using at least one lytic polysaccharide monooxygenase selected from an enzyme comprising an amino acid sequence having at least 60% identity with SEQ ID NO: 2, an enzyme comprising a amino acid sequence that shows at least 60% identity with SEQ ID NO: 5, or a mixture thereof.

    14. The method, according to claim 13, wherein it is carried out in an aqueous medium, wherein the aqueous medium comprises a buffer.

    15. The method according to claim 13, further comprising the addition of at least one electron-donating substance, wherein the electron-donating substance is ascorbic acid.

    16. The method according to claim 13, wherein the enzyme comprising an amino acid sequence that has at least 60% identity with SEQ ID NO: 2 is KpLPMOA10 (AA10) isolated from Kitasatospora papulosa.

    17. The method, according to claim 16, wherein KpLPMOA10 (AA10) is used in an amount ranging from at least one of: approximately 0.01 to approximately 50.00 milligrams of enzyme per gram of PET; and approximately 2.0 to approximately 20.0 milligrams of enzyme per gram of PET.

    18. The method, according to claim 13, wherein the enzyme comprising an amino acid sequence that has at least 60% identity with SEQ ID NO: 5 is AfLPMOA9 (AA9) isolated from Aspergillus fischeri.

    19. The method, according to claim 18, wherein AfLPMOA10 (AA10) is used in an amount ranging from at least one of: approximately 0.01 to approximately 50.00 milligrams of enzyme per gram of PET; and approximately 2.0 to approximately 20.0 milligrams of enzyme per gram of PET.

    20. The method according to claim 13, further comprising the use of at least one cutinase, wherein the cutinase is a PETase.

    21. The method, according to claim 20, wherein PETase is used in an amount ranging from at least one of: approximately 0.005 to approximately 25.00 milligrams of PETase per gram of PET; and approximately 1.0 to approximately 10.0 milligrams of PETase per gram of PET.

    22. The method according to claim 13 wherein the method is conducted at pH values ranging from at least one of: approximately 4.0 to approximately 9.0; and approximately 5.5 to approximately 7.5.

    23. The method according to claim 13, wherein the method is conducted at a temperature ranging from at leat one of: approximately 20° C. to approximately 60° C.; and approximately 30° C. to approximately 40° C.

    24. The method according to claim 13, wherein the method is carried out in a period ranging from at least one of: approximately 5 minutes to approximately 48 hours; and approximately 60 minutes to approximately 48 hours.

    25. A method for the degradation of polyester, comprising: using at least one lytic polysaccharide monooxygenase characterized by being in the enzymatic degradation of polyester, in which said lytic polysaccharide monooxygenase degrades said polyester without the aid of one or more canonical enzymes, in which the canonical enzymes are a PETase or a mixture of PETases.

    26. The method of claim 25 wherein the lytic polysaccharide monooxygenase comprises an amino acid sequence that has at least 60% identity with SEQ ID NO: 22.

    27. The method of claim 26, wherein the lytic polysaccharide monooxygenase comprises an amino acid sequence that has at least 60% identity with SEQ ID NO: 2 obtained from Kitasatospora papulosa.

    28. The method of claim 25 wherein polysaccharide monooxygenase comprises an amino acid sequence that has at least 60% identity with SEQ ID NO: 5.

    29. The method of claim 28 wherein the lytic polysaccharide monooxygenase comprising an amino acid sequence that has at least 60% identity with SEQ ID NO: 5 obtained from Aspergillus fischeri.

    30. The method of claim 25 wherein the polyester comprises polyethylene terephthalate (PET).

    31. The method of claim 30 wherein PET is selected from liquid bottles, food packaging, window films, X-ray films, fabric fibers, a mixture of these and any other materials mostly made of PET.

    Description

    BREVE DESCRIÇÄO DAS FIGURAS

    [0041] FIG. 1 shows the expression vector for KpLMO10A (or LPMO AA10) from the Kitasatospora papulosa (A) and AfLPMO9A (or LPMO AA9) from the Aspergillus fischeri (B).

    [0042] FIG. 2 shows the protein profile of KpLPMO10A (A), AfLPMO9A (B) and lsPETase (C) obtained from two chromatographic steps.

    [0043] FIG. 3 shows images obtained by Atomic Force Microscopy of PET Mylar films treated with LPMOs. A: untreated control; B: film treated with KpLPMO10A; D: film treated with AfLPMO10A.

    [0044] FIG. 4 shows the images obtained by Atomic Force Microscopy of PET bottles treated with LPMOs. A, untreated control; B, PET treated with KpLPMO10A; C, PET treated with AfLPMO9A.

    [0045] FIG. 5 shows the spectra obtained by the XPS technique of the control (A), PET bottle post enzymatic degradation by AfLPMO9A.

    [0046] FIG. 6 shows the prediction of possible products generated by LPMOs from PET.

    [0047] FIG. 7 shows the fluorescence emission spectra of PET bottle cards treated and untreated with the enzymes of the present disclosure. (A): inner face. (B): external face. The material was excited at 340 nm.

    [0048] FIG. 8 shows the results of synergism tests between AfLPMO9A (LPMO) and lsPETase (PETase) on PET, with measurements of mono (2-hydroxyethyl) terephthalate (MHET) and terephthalic acid (TPA) release. (A) Activity of lsPETase on a block of grounded PET from bottles. (B) MHET and TPA release by lsPETase from pre-treated grounded PET with different concentrations of AfLPMO9A. (C) MHET and TPA release by lsPETase in reactions with simultaneous addition of lsPETase and AfLPMO9A in different concentrations. (D) lsPETase activity on N-acetate and N-butyrate in the absence and presence of ascorbic acid.

    [0049] FIG. 9 shows topographic images of atomic force microscopy of a juice bottle and a plastic bag, both made of HDPE, treated with AscAC (E and G, control) and in the presence of AfLPMO9A (F and H). The arrows point to erosions on the material, caused by enzymatic action.

    DETAILED DESCRIPTION

    [0050] The present disclosure describes a new use of enzymes belonging to the family of Lytic Polysaccharide Monooxygenases—LPMOs.

    [0051] When used in its isolated form, in other words, without the presence of enzymes with other functions, the enzymes of the LPMOs family are known only for their activity in the oxidation of polysaccharides, such as cellulose, hemicellulose, starch and chitin.

    [0052] The inventors of the present disclosure found that LPMOs have polyethylene degradation activity, which is surprising in light of the activities of these enzymes described so far, demonstrating their use in the degradation of plastics, further in the degradation of polyethylene terephthalate (PET).

    [0053] Equally surprising, the inventors of the present disclosure have demonstrated that the LPMOs of the present disclosure exhibit PET-degrading activity when isolated, i.e, without the need for the concomitant use of canonical enzymes such as cutinases or PETases.

    [0054] Furthermore, the inventors of the present disclosure have demonstrated that the association of the LPMOs of the present disclosure with canonical enzymes has a surprising synergistic effect on PET degradation.

    [0055] The inventors of the present disclosure also developed a polyethylene degradation method employing the LPMOs of the present disclosure, which occurs at 30-37° C., being advantageous in relation to the other methods of enzymatic degradation of polyethylene described in the state of the art.

    [0056] The LPMOs of the present disclosure comprise an amino acid sequence that shows at least 60% identity with the sequences SEQ ID NO: 2 or SEQ ID NO: 5.

    [0057] The LPMOs of the present disclosure, comprising at least 60% identity to the sequences SEQ ID NO: 2 or SEQ ID NO: 5, can be isolated from bacteria or fungi. The bacterial LPMOs include Bacillus sp., Burkholderia sp., Caldibacillus sp., Cellvibrio sp., Enterococcus sp., Hahella sp., Jonesia sp., Listeria sp., Micromonospora sp., Nocardiopsis sp., Photorhabdus sp., Serratia sp., Teredinibacter sp., Thermobifida sp. and Vibrio sp.; more specifically, Streptomyces sp., e.g., Streptomyces ambofaciens, Streptomyces coelicolor, Streptomyces griseus, Streptomyces lividans, Streptomyces pratensis, Streptomyces atroolivaceus, Streptomyces swartbergensis, Streptomyces azureus, Streptomyces afghaniensis, Streptomyces coeruleoribdus, Streptomyces pristinaespiralis, Streptomyces coelicoflavus, Streptomyces pactum, Streptomyces qaidamensis, Streptomyces olivaceus, Streptomyces africanus, Streptomyces iakyrus, Streptomyces regalis, Streptomyces luteus, Streptomyces cyaneogriseus, Streptomyces havaiiensis, Streptomyces rubrogriseus, Streptomyces marokkonensis, Streptomyces corynorhini, Streptomyces pharetrae, Streptomyces glauscescens e Streptomyces capillispiralis; more specifically, Kitasatospora sp., e.g., Kitasatospora cheerisanensis, Kitasatospora aureofaciens, Kitasatospora aburaviensis, Kitasatospora herbaricolor, Kitasatospora misakiensis, Kitasatospora xanthocidica and Kitasatospora papulosa. Fungal LPMOs include those from Gloeophyllum sp., Heterobasidium sp., Pleurotus sp., Pestalotiopsis sp., Phanerochaete sp., Podospora sp., Lentinus sp., Miceliophythora sp., Neurospora sp., Trametes sp., Thermoascus sp., Thermothelomyces sp. and Trichoderma sp.; more specifically, Penicillium, e.g., Penicillium oxalicum, Penicillium subrubescens, Penicillium rolfsii, Penicillium brasilianum, Penicillium antarcticum, Penicillium arizonense, Penicillium steckii, Penicillium vulpinum, Penicillium expansum, Penicillium camemberti, Penicillium solitum, Penicillium coprophilum, Penicillium roqueforti, Penicillium polonicum, Penicillium freii, Penicillium rubens, Penicillium griseofulvum, Penicillium digitatum, Penicillium italicum e Penicillium nalgiovense; mais especificamente, Aspergillus sp., por exemplo, Aspergillus lentulus, Aspergillus fumigatus, Aspergillus novofumigatus, Aspergillus turcosus, Aspergillus thermomutatus, Aspergillus udagawae, Aspergillus clavatus, Aspergillus homomorphus, Aspergillus aculeatinus, Aspergillus fijiensis, Aspergillus brunneoviolaceus, Aspergillus uvacrum, Aspergillus aculeatus, Aspergillus tanneri, Aspergillus brasiliensis, Aspergillus terreus, Aspergillus tamarii, Aspergillus nidulans, Aspergillus caelatus, Aspergillus ibericus, Aspergillus piperis, Aspergillus japonicus, Aspergillus niger, Aspergillus oryzae, Aspergillus flavus, Aspergillus kawachii, Aspergillus saccharolyticus, Aspergillus neoniger, Aspergillus glaucus, Aspergillus ruber, Aspergillus tubingensis, Aspergillus leporis, Aspergillus mulundensis and Aspergillus fischeri.

    [0058] The LPMOs of the present disclosure are, in an embodiment,derived from bacteria of the genus Kitasatospora sp. and fungi of the genus Aspergillus sp. The enzymes of the present disclosure may be derived from the bacterium Kitasatospora papulosa, such as the enzyme KpLPMO10A, and the filamentous fungus Aspergillus fischeri, such as the enzyme AfLPMO9A.

    [0059] The KpLPMO10A polypeptide chain consists of amino acids 39 to 224 of SEQ ID NO: 2 spanning the N-terminal histidine (H39) typical of LPMOs and H146 and Y215 related to the coordination of the metal ion, which may be a copper.

    [0060] The AfLPMO9A polypeptide chain consists of amino acids 20-247 of SEQ ID NO: 5 spanning the N-terminal histidine (H20) typical of LPMOs and H105 and Y194 possibly related to the coordination of the metal ion, which may be a copper.

    [0061] The enzymes of the present disclosure can be obtained by transforming expression vectors into cells using steps known in the art. For example, the enzymes of the present disclosure are expressed in cells of Escherichia coli containing suitable expression vectors grown in media and under suitable conditions and extracted by lysis using a suitable protocol. Then, the enzymes of the present disclosure are obtained using separation techniques such as, for example, affinity chromatography, with the protein profile of the fractions obtained being evaluated on an SDS-PAGE gel. Additional steps for purifying the enzymes of the present disclosure can be applied employing suitable techniques, such as gel filtration chromatography using a suitable column.

    [0062] In one embodiment, the present disclosure provides an enzyme composition for use in degrading polyester that comprises at least one lytic polysaccharide monooxygenase of the present disclosure (SEQ ID NO: 2 or SEQ ID NO: 5) (LPMO), and an acceptable carrier.

    [0063] An acceptable vehicle, within the scope of the present disclosure, is understood as an aqueous vehicle that maintains the enzymes of the present disclosure in suspension or solution when in adequate concentration, and may contain, in addition to water, other additives, such as preservatives, agents or buffering systems, and so forth.

    [0064] The LPMOs of the present disclosure are present in a concentration of between approximately 0.001% and approximately 0.1% by total weight of the composition of the present disclosure, and in a further embodiment between approximately 0.002% and approximately 0.005% by total weight of the composition.

    [0065] The compositions of the present disclosure contain at least one LPMO of the present disclosure, which may contain an isolated enzyme or a combination of enzymes within the context of the disclosure.

    [0066] In an embodiment, the composition of the present disclosure additionally comprises a cutinase, and in an embodiment a PETase.

    [0067] Cutinases are enzymes related to the degradation of aliphatic polyester cutin, found in the plant cuticle. All PET hydrolases (PETases) that were characterized so far belong to the cutinases family. PETases have a wider catalytic center when compared to cutinases, probably related to the accommodation of semi-aromatic crystalline polyesters. Polyesterases act preferentially in amorphous regions of PET, unlike LPMOs which act preferentially in crystalline regions on polymeric substrates where their activity has been previously reported. Therefore, the joint action of LPMO-PETase can be advantageous as reported for LPMOs-GHs.

    [0068] Polyesters and polyamides recognized by cutinases include poly(L-lactic acid) (PLA), polyethylene furanoate (PEF), polybutylene adipate-co-terephthalate (PBAT), polycaprolactone (PCL), polybutylene succinate (PBS) , polyamide 6,6 and polyethylene terephthalate (PET).

    [0069] Cutinases with PET hydrolase (PETase) activity to be used in the composition of the present disclosure can be of fungal or bacterial origin. Those of fungal origin include those originating from Humicola sp., Fusarium sp., Aspergillus sp. and Penicillium sp. Bacterial include those from Acidovorax sp., Rhizobacter sp., Pseudomonas sp., Streptomyces sp., Thermobifida sp., Saccharomonospora sp., Clostridium and Ideonela sp., especifically, Ideonela sakaiensis.

    [0070] The concentration of PETase in the composition of the present disclosure ranges from approximately 0.0005% to approximately 0.05% by total weight of the composition, and in a further embodiment from approximately 0.001 to approximately 0.0025% by total weight of the composition.

    [0071] In a second embodiment, the present disclosure provides the use of the enzyme composition of the present disclosure in the degradation of plastic polymers, and in an embodiment, polyethylene.

    [0072] According to the present disclosure, plastic waste used as a substrate for enzymatic degradation can be selected fromPEAD, PVC, PEBD, PP, PS, PC, PU, ABS, PE and PET, and in an embodiment PU, ABS, PE e PET, in a further emboidment ABS, PE e PET, in an even further emboidment PE and PET, and in a yet further emboidment PET.

    [0073] Among the waste that can be called PET, there are liquid bottles, food packaging, window films, X-ray films, fabric fibers and any other materials mostly made of PET, without limitations.

    [0074] In a third embodiment, the present disclosure provides a method of degrading PET which comprises the use of at least one lytic polysaccharide monooxygenase of the present disclosure.

    [0075] Surprisingly, the inventors of the present disclosure have identified that LPMOs can be employed alone for the deconstruction of PET.

    [0076] The PET degradation method of the present disclosure comprises adding at least one LPMO of the present disclosure in an aqueous medium containing substrate.

    [0077] The concentration of LPMO to be used depends on the origin and conditions of pH and temperature of the reaction, being initially standardized according to methods that are familiar to the person skilled in the art.

    [0078] The concentration of LPMO in the reactions of the present disclosure is between 0.01-50 milligrams of LPMO per gram of PET, and in a further embodiment 1-30 milligrams of LPMO per gram of PET, and in a yet further embodiment 2-20 milligrams of LPMO per gram of PET.

    [0079] The substrate concentration in the form of PET in the process of the present disclosure varies between 10-80% of the reaction, and in a further embodiment 20-70% of the reaction, and in a further embodiment 40-60% of the reaction, and in a yet further embodiment 30-50% of the reaction.

    [0080] In an embodiment, the aqueous medium additionally comprises a buffer solution.

    [0081] The concentration of the buffer solution is between 0.01-0.5M, and in a further embodiment 0.03-0.25M, and in a yet further embodiment 0.05-0.1M.

    [0082] In an embodiment, the PET degradation method of the present disclosure comprises an additional step, wherein an electron donating substance for LPMO is added.

    [0083] According to the present disclosure, the electron donating molecule for LPMO can be selected from ascorbic acid and mixtures thereof.

    [0084] The concentration of the electron donor molecule for LPMO varies between 0.3 mM-2 mM, and in a further embodiment 0.8-1.5 mM, and in a yet further embodiment 0.5-1 mM.

    [0085] The reaction time of the present disclosure is usually between 5 minutes and 48 hours, and in a further embodiment between 10 minutes and 48 hours, and in a further embodiment between 30 minutes and 48 hours, and and in a yet further embodiment between 60 minutes and 48 hours.

    [0086] The pH of the reaction is selected according to the origin of the LPMO used and is previously standardized, it can be between pH 4.0-9.0, and in a further embodiment between pH 5.0-8.0 and, and in a further embodiment, between pH 5.5-7.5.

    [0087] The reaction temperature is selected according to the origin of the LPMO used and is previously standardized. The reaction is conducted at temperatures between 20 and 60° C., and in a further embodiment 25 and 55° C., and in a further embodiment between 30 and 50° C. In an embodiment, the temperature employed in the method of the present disclosure is below 40° C., and in a further embodiment, below 37° C.

    [0088] In an embodiment, the method of the present disclosure additionally comprises employing a cutinase.

    [0089] The PETase concentration to be used depends on the reaction conditions, being initially standardized. The concentration of PETase in the reactions of the present disclosure can be between 0.005 and 25 milligrams of PETase per gram of PET, and in a further embodiment between 0.5 and 15 milligrams of PETase per gram of PET, and in a yet further embodiment between 1 and 10 milligrams of PETase per gram of PET.

    [0090] In the context of the disclosure, it is a composition of enzymes comprising a lytic polysaccharide monooxygenase (LPMO), with recognized ability to oxidize the crystalline portion of the glucan structure favoring the action of (hemi)cellulases on lignocellulose substrates, and /or blending with the hydrolase (PETase) for the potential degradation of plastic polymers in the depolymerisation/recycling industry.

    [0091] The following examples illustrate embodiments of the present disclosure. They do not, therefore, limit the scope of protection of the disclosure, which is exclusively defined by the claims accompanying this description.

    EXAMPLE 1

    Preparation of Expression Vector Construct for Lytic Polysaccharide Monooxygenases of the Present Disclosure

    [0092] STEP 1: The bacteria K. papulosa (DSM4643) had the genomic DNA extracted and used for amplification of the gene of interest KpLPMO10A (SEQ ID NO: 1, nucleotide 115-672), which encodes the AA10 enzyme KpLPMO10A, with primers KpF and KpR (Table 1). The amplification product was used for a new PCR reaction with the KpFpET22b and KpRpET22b primers (Table 1) for the addition of homology tails to the pET22b vector. The gene was cloned into the pET22b(+) vector immediately after the sequence encoding the peiB signal peptide.

    TABLE-US-00001 TABLE 1 Primers used for the amplification of gene KpLPMO10A Name Sequence (5’-3’) KpF CACGGTTCCGTCGTCGAC KpR GGTGAAGTTCACGTCACTGCAC KpFpET22b CTGCCCAGCCGGCGATGGCCCACGGTTCCGTCGTCGAC KpRpET22b TCAGTGGTGGTGGTGGTGGTGGGTGAAGTTCACGTCAC TGCAC

    [0093] STEP 2: The gene AfLPMO9A (SEQ ID NO: 3, nucleotide 58-741), which encodes the AA9 enzyme AfLPMO9A, was added with sequence encoding pelB (SEQ ID NO: 4, nucleotide 1-66) and had the codons optimized for expression in Escherichia coli. The peiB+AfLPMO9A was synthesized and cloned into the restriction sites for NdeI and XhoI enzymes in the pET21a(+) vector by Genscript (Piscataway).

    [0094] STEP 3: The lsPETase gene (GenBank: BBYR01000074.1), which encodes the PETase enzyme in Ideonella sakaiensis, had the codons optimized for expression in E. coli. The lsPETase was synthesized and cloned into the restriction sites for NdeI and XhoI enzymes in the pET21b(+) vector by Genscript (Piscataway).

    [0095] STEP 4: The vectors pET22b(+)-KpLPMO10A and pET21a(+)-AfLPMO9A were transformed (separately) into cells of Escherichia coli Shuffle®. The cells were cultivated in TB medium and added with IPTG to promote protein expression. KpLPMO10A (SEQ ID NO: 2, amino acid 39-224) or AfLPMO9A (SEQ ID NO: 2, amino acid 20-247) for 16 h at 18° C./250 rpm. Cells were centrifuged and lysed by osmotic shock protocol. The supernatants obtained from the lysis were loaded onto a 5 mL His-Trap affinity column (GE) for chromatography. The protein profile of fractions obtained by affinity chromatography was evaluated on SDS-PAGE gel. Fractions containing proteins of the expected size were mixed, concentrated and used for gel filtration chromatography using HiLoad Superdex G-75 16/60 column. Fractions containing pure proteins of the expected size (assessed by SDS-PAGE) were pooled, concentrated and assessed for concentration (mg protein/mL). KpLPMO10A or AfLPMO9A were treated with copper sulfate (CuSO.sub.4) for 16 hours at 4° C. Excess metal was removed using a Sephadex G-25 PD-10 column. KpLPMO10A or AfLPMO9A they were concentrated, quantified (mg of protein/mL) and used in later experiments.

    EXAMPLE 2

    Preparation of Expression Vector Construct for PET Hydrolase of the Present Disclosure

    [0096] STEP 1: The pET21b(+)-lsPETase vector was transformed into Escherichia coli BL21(DE3) cells. The cells were cultivated in LB medium and added with IPTG to promote the expression of lsPETase durante 16 h a 18° C./250 rpm. Cells were centrifuged and lysed with the aid of lysozyme and sonicator. The supernatants obtained from the lysis were loaded onto a 5 mL His-Trap affinity column (GE) for chromatography. The protein profile of fractions obtained by affinity chromatography was evaluated on SDS-PAGE gel. Fractions containing proteins of the expected size were pooled, concentrated and used for gel filtration chromatography using HiLoad Superdex G-75 16/60 column. Fractions containing pure proteins of the expected size (assessed by SDS-PAGE) were pooled, concentrated and evaluated for concentration (mg protein/mL) and used in further experiments.

    EXAMPLE 3

    Preparation of Polyester Film for Enzymatic Reactions

    [0097] STAGE 1: PET, Mylar and bottle PET were cut into dimensions of 0.6 cm×0.4 cm using scissors. Subsequently, they were washed with 1 mL of Milli-Q water using a pipette and subjected to ultrasound for 5 minutes. This procedure was performed 3 times. The plastics were dried in a N.sub.2 stream for 10-15 minutes and stored for later use.

    EXAMPLE 4

    Enzymatic Degradation of Waste Polyester Films

    [0098] STEP 1: Assays that aid the direct detection of products released by LPMOs from plastic polymers are not available. The reaction conditions initially adopted are the same used for (hemi)cellulose substrates. The enzymatic reactions were carried out in 2 mL Eppendorf tubes containing PET (Mylar or bottle PET), 0.05 M sodium phosphate buffer, pH 6.0, 20 mg of KpLPMO10A or AfLPMO9A per gram of PET. After 10 minutes at 37° C., the reactions were spiked with 1 mM ascorbic acid and incubated at 37° C., 850 rpm for 48 hours.

    [0099] The PET from the enzymatic treatment was rinsed with 0.5 mL of Milli-Q water using a pipette and subjected to ultrasound for 5 minutes. This procedure was performed 3 times. The liquid fraction of the reactions was boiled at 99° C. for 10 minutes and the material was saved for later analysis.

    EXAMPLE 5

    Characterization Measurements of the Polyester Under Study

    [0100] a. Atomic Force Microscopy

    [0101] The PET from the enzymatic treatment was submitted to analysis by atomic force microscopy using the Multimode8 model and the NanoScope V controller (Bruker, Germany) operating in PeakForce tapping mode with probes model ScanAsyst-air (Bruker, Germany) of silicon nitride with a nominal force of 0.4 Nm.sup.−1. The images obtained (3×3 μm) were treated in the Gwyddion software.

    b. X-Ray Photoelectron Spectroscopy Analysis (XPS)

    [0102] XPS spectra were obtained with a VSW HA100 spectrometer (United Kingdon) operated in constant pass energy mode, set at 44 eV. As excitation, radiation from an aluminum anode was used, which produces photons with 1486.6 eV of energy. High-resolution spectra were collected with a step close to 0.1 eV and sufficient accumulation time to have a good signal-to-noise ratio. The pressure in the analysis chamber was kept below 6×10.sup.−8 mBar during the analysis.

    [0103] The samples were fixed to a stainless steel sample holder with double-sided carbon tape and introduced into the analysis chamber.

    [0104] The electrical charge of the samples was corrected using the value of the benzene ring at 284.7 eV. The deconvolution was carried out using Gaussians. The images were obtained in the software Origin.

    [0105] The genes that code for proteins KpLPMO10A (AA10) (SEQ ID NO: 1) and AfLPMO9A (AA9) (SEQ ID NO: 2) were isolated from the bacteria Kitasatospora papulosa and from the filamentous fungi Aspergillus fischeri, respectively.

    [0106] Kitasatospora and Streptomyces have similar morphologies, but differ in cell wall composition, characterizing Kitasatospora as a distinct group within the Streptomyces. Kitasatospora proteins can be characterized as belonging to Streptomyces sp. due to the high identity of amino acid sequences between the two genera.

    [0107] KpLPMO10A, AfLPMO9A (from SEQ ID NO: 1 to SEQ ID NO: 5) and lsPETase were expressed by E. coli cells transformed with the vectors pET22b(+)-KpLPMO10A, pET21a(+)-AfLPMO9A (FIG. 1) and pET21a(+)-lsPETase, respectively and purified by two chromatographic steps (FIG. 2).

    [0108] The activity of KpLPMO10A and AfLPMO9A on PET film (Mylar) was evaluated by atomic force microscopy. Using the atomic force microscopy technique, the topography of a sample is obtained after scanning its surface with a probe, if any surface alteration is detected. Reactions conducted with KpLPMO10A (FIG. 3B) and AfLPMO9A (FIG. 3C) led to changes (erosions) on the surface of the PET film when compared to the control reaction conducted in the absence of the enzyme (FIG. 3A).

    [0109] The effect was more intense when AfLPMO9A was employed in the reaction (FIG. 3C).

    [0110] The activity of KpLPMO10A and AfLPMO9A was evaluated using PET from bottles as substrate, in the same way as it was for the PET film (Mylar). Compared to the control (FIG. 4A), reaction conducted in the absence of enzymes, KpLPMO10A (FIG. 4B) and AfLPMO9A (FIG. 4C) altered the surface of PET bottles, and the effect (of erosion or “peeling” of PET) of AfLPMO9A was more intense when compared to KpLPMO10A. The same enzyme concentration was adopted for KpLPMO10A and AfLPMO9A in both experiments.

    [0111] In view of the changes noted on the surface of PET mainly in reactions containing AfLPMO9A, the enzyme was selected for further experiments. Residual bottle PET obtained after treatment with AfLPMO9A was subjected to X-ray photoelectron spectroscopy analysis (XPS). The spectra obtained by XPS are a powerful tool to evaluate chemical alterations contained in the surface of materials, in this case, PET.

    [0112] The intensity of Cl-related peaks for various chemical states found on the PET surface are shown in FIG. 5A (Control, PET not treated with AfLPMO9A) and FIG. 5B (PET treated with AfLPMO9A) and Table 2. The deconvolution of the control sample spectra and treated with AfLPMO9A resulted in three peaks, mainly in the regions (eV): 284.7, bonds contained in benzene rings (aromatic carbons); 286.2, methylene carbon and 288.6, carboxyl ester, consistent with other studies carried out on the surface of PET. The treatment of the sample with AfLPMO9A led to a drop in the intensity of the peak corresponding to 284.7 eV and the appearance of the peak at 287.5 eV, which corresponds to the formation of double bonds between carbon and oxygen atoms (C═O) on the PET surface (Table 2).

    TABLE-US-00002 TABLE 2 Intensity of peaks related to C1 for different chemical states on the PET surface Bonds Treatment COO C═O C—O/CN CH.sub.X, C—C, C═C Energy (288.6) (287.5) (286.2) (284.7) Control 16.81 X 24.2 58.9 AfLPMO9A 14.96 3.27 26.3 55.4

    [0113] The LPMOs introduce an oxygen atom at carbon 1 (C1) or carbon 4 (C4) of the glucose molecule when cellulose is used as substrate resulting in the release of aldonic acid and ketoaldose, respectively. Furthermore, some LPMOs have been shown to be capable of releasing a mixture of both C1 and C4 oxidized products from the same substrate.

    [0114] Based on the products released by LPMOs from cellulose, FIG. 6 highlights the possible products released from PET polymer by LPMOs.

    EXAMPLE 6

    Fluorescence Assay

    [0115] Fluorescence emission spectra of PET bottle cards treated and not treated with the enzymes of the present disclosure were obtained at room temperature in a Hitachi F-4500 FL spectrophotometer, with excitation at 340 nm and collecting the emission between 360 and 550 nm. The peaks at 370 nm (excimer) and 390 nm (ground state dimer) recorded in cards treated with LPMO excited at 340 nm showed reduced emission in relation to the control treated with AscAc, indicating the occurrence of scission of the PET chain. No decrease in peak emissions of 370/390 was observed when exciting the outer face (exposed to air) of the LPMO-treated PET bottle, which agrees with the atomic force microscopy data discussed above.

    EXAMPLE 7

    PETase Synergy Assay

    [0116] The synergism between AfLPMO9A and lsPETase was evaluated by non-simultaneous or simultaneous addition of enzymes in reactions containing PET as substrate (8 mg). PET powder was obtained by grinding the PET bottle in a ball mill (Tecnal). For non-simultaneous assays, the substrate was pretreated with AfLPMO9A (0.5, 2 or 4 μM) observing the same conditions highlighted in “Enzymatic Assays—LPMO”. The supernatant was boiled and the residual PET was washed with Milli-Q water and sonicated three times (10 min each). Then, lsPETase (0.05 μM) was added to the supernatant or residual PET and the reactions were carried out in 0.05 M sodium phosphate buffer, pH 7.2, at 30° C./400 rpm/120 h. In simultaneous assays, AfLPMO9A and lsPETase were added simultaneously in reactions containing powdered PET. The AfLPMO9A concentration varied (0.05-4 μM) while the lsPETase concentration was kept fixed (0.05 μM) in 0.05 M sodium phosphate buffer, pH 6.0, 37° C./850 rpm/120 h.

    [0117] The supernatants were boiled at 99° C. for 5 min, dried in SpeedVac concentrators (Eppendorf) and resuspended in a mixture of 20% methanol: 80% DMSO. The concentration of mono (2-hydroxyethyl) terephthalate (MHET) and terephthalic acid (TPA) released by lsPETase was determined by HPLC. Reactions only with lsPETase were used as controls for non-simultaneous and simultaneous assays. All reactions were performed in a volume of 600 uL, in triplicate. The lsPETase concentration adopted in all synergy assays was set at 0.05 μM.

    [0118] In non-simultaneous synergy assays, PET powder was pretreated with AfLPMO9A +AscAc (pH 6.0/37° C./48 h), washed/sonicated three times and added with lsPETase (pH 7.2/30° C./120 h). Pretreatment with 0.5, 2 and 4 μM AfLPMO9A+AscAc improved MHET release by 20, 16 and 23%, respectively, and TPA by 34, 64 and 49%, respectively, by lsPETse.

    [0119] Synergy between AfLPMO9A and lsPETase was also found when the substrate was first treated with 0.5, 2 or 4 μM of AfLPMO9A in the absence of AscAc, in agreement with atomic force microscopy data regarding LPMO modification of PET, even without the addition of the electron donor. However, the improvement in MHET and TPA release was lower than that achieved in the AscAc reactions: 9-24% and 18-40%, respectively, revealing the importance of free electron donors in the reaction to promote AtLPMO9A activity.

    [0120] In addition to the substrate, supernatants from reactions with AfLPMO9A were boiled and added with lsPETase, but neither MHET nor TPA were detected in this condition.

    [0121] Given the similar activity of lsPETase at pH 7.2/30° C. (1.709+0.06 U/mg protein) and pH 6.0/37° C. (1.969+0.02 U/mg protein) using α-naphthyl acetate (N-ace) as substrate, the posterior condition was adopted in the synergy tests with the simultaneous addition of lsPETase and AtLPMO9A. Reactions with lsPETase and AfLPMO9A in a 1:1 ratio (without AscAc) resulted in a slight improvement of MHET (10%) and TPA (8%). The successive addition of AfLPMO9A at 1:10, 1:15, 1:20 and 1:35 decreased lsPETase activity.

    [0122] The addition of AscAc to lsPETase affected its activity on PET and naphthyl esters, which can be attributed to a drop in reaction pH from 6.0 to 4.9. However, a 20% improvement in MHET and TPA concentration was recorded after addition of AfLPMO9A 1:1 in this condition.

    EXAMPLE 8

    Testing AfLPMO9A Activity on Other Substrates

    [0123] Further to the PET, high (HDPE) and low density (LDPE) polyethylenes were evaluated as substrates for AfLPMO9A activity.

    [0124] The surface modification caused by AfLPMO9A on juice bottle and plastic bag, both made of HDPE, is evident in comparison to controls with AscAc. Erosion was more subtle than that caused in a PET bottle and better verified in topographic images of atomic force microscopy 1×1 μm, which was confirmed by the mean diameter (34 and 17 nm) and depth (4.8 and 4.4 nm) of the eroded areas in the juice bottle and plastic bag, respectively. No LDPE activity was detected under the tested conditions.