COMPOSITION FOR PREVENTING OR TREATING DISEASE CAUSED BY MUSCLE LOSS, COMPRISING AGENT INHIBITING PHF20
20230193283 · 2023-06-22
Inventors
Cpc classification
A23L33/40
HUMAN NECESSITIES
A61K9/2018
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K9/1623
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
A23V2200/316
HUMAN NECESSITIES
A61K9/0095
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A23K20/153
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A23V2200/316
HUMAN NECESSITIES
A61K9/0056
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K9/48
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A23L33/00
HUMAN NECESSITIES
Abstract
The present invention relates to a function of PHF20 (PHD finger protein 20) in a myogenic differentiation mechanism and, more particularly, to a use of a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor. The PHF20 gene expression inhibitor or the PHF20 protein activity inhibitor according to the present invention promotes muscle differentiation in vitro and in vivo, and thus can be utilized in various ways in the field of prevention, improvement or treatment of diseases caused by muscle loss.
Claims
1. A method of treating a disease caused by muscle loss, the method comprising the step of treating an individual in need thereof with a PHF20 (PHD finger protein 20) gene expression inhibitor or a PHF20 protein activity inhibitor.
2. The method of claim 1, wherein the disease caused by the muscle loss is selected from the group consisting of sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, amyotrophic lateral sclerosis, myasthenia, and cachexia.
3. The method of claim 1, wherein the PHF20 gene expression inhibitor includes at least one type selected from the group consisting of shRNA, siRNA, ribozyme, and antisense nucleotides complementary to the PHF20 gene.
4. The method of claim 3, wherein the shRNA is represented by the nucleotide sequence of SEQ ID NO: 1.
5. The method of claim 1, wherein the PHF20 gene expression inhibitor is a Yin Yang 1 (YY1) promoter activity inhibitor.
6. The method of claim 1, wherein the PHF20 gene expression inhibitor increases the expression of MyoD (myogenic differentiation marker) to promote myogenic differentiation.
7. The method of claim 1, wherein the PHF20 protein activity inhibitor includes at least one type selected from the group consisting of a compound, peptide and antibody that specifically binds to PHF20 protein.
8. The method of claim 1, wherein the individual is further treated with a YY1 promoter activity inhibitor.
9. A method of increasing muscle or inhibiting muscle loss, the method comprising PHF20 (PHD finger protein 20) gene expression inhibitor or a PHF20 protein activity inhibitor.
10. The method of claim 9, wherein the composition is a health functional food composition or feed additive composition.
11. (canceled)
Description
DESCRIPTION OF DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
BEST MODE
[0040] Hereinafter, the present invention will be described in detail.
[0041] According to an aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating a disease caused by muscle loss, the composition including a PHF20 gene expression inhibitor or PHF20 protein activity inhibitor as an active ingredient.
[0042] In addition, the present invention provides a method for treating a disease caused by muscle loss, the method including step of treating an individual in need thereof with a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor.
[0043] In the present invention, PHF20 (plant homeodomain finger protein 20, PHD finger protein 20) is a multi-domain protein and subunit of a lysine acetyltransferase complex that acetylates histone H4. PHF20 is a transcription factor, and it was first identified in glioma patients. PHF20 knockout mice die shortly after birth, and it exhibits diverse phenotypes within the skeletal and hematopoietic system. However, the detailed mechanisms of these phenotypes in PHF20 knockout mice have not been reported.
[0044] In an example of the present invention, it was confirmed that the PHF20 affects myogenic differentiation through the mechanism shown in
[0045] In a specific embodiment of the present invention, the PHF20 gene expression inhibitor is preferably a YY1 promoter activity inhibitor.
[0046] In a specific embodiment of the present invention, the PHF20 gene expression inhibitor may increase MyoD expression to promote myogenic differentiation.
[0047] In the present invention, YY1 (Yin Yang 1) refers to a transcriptional repression protein that binds to DNA through four C-terminal zinc finger domains. In skeletal muscle, treatment with rapamycin, an inhibitor of the mammalian target of rapamycin (mTOR), increases mitochondrial transcriptional regulator gene expression, thereby reducing mitochondrial gene expression and oxygen consumption. mTOR phosphorylation and its downstream targets YY1 and Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) are increased by FGF21 (fibroblast growth factor 21) treatment in C.sub.2C.sub.12 myoblasts. Activation of the mTOR-YY1-PGC1α pathway by FGF21 in myoblasts regulates intracellular ATP synthesis, oxygen consumption rate, citrate synthase activity, glycolysis, mitochondrial DNA copy number, and energy homeostasis manifested by a significant increase in the expression of major energies.
[0048] In a specific embodiment of the present invention, the disease caused by muscle loss is preferably selected from the group consisting of sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myotonic dystrophy, amyotrophic lateral sclerosis, myasthenia and cachexia, but is not limited thereto.
[0049] In the present invention, prevention refers to any action that inhibits or delays the onset of disease due to muscle loss by administration of the pharmaceutical composition according to the present invention. In addition, in the present invention, treatment refers to any action that improves or beneficially changes the symptoms of disease due to muscle loss by administration of the pharmaceutical composition according to the present invention.
[0050] In an embodiment of the present invention, the PHF20 gene expression inhibitor may include at least one type selected from the group consisting of shRNA, siRNA, ribozyme, and antisense nucleotides complementary to the PHF20 gene.
[0051] In a preferred embodiment of the present invention, the PHF20 gene expression inhibitor may be an shRNA shown by the nucleotide sequence represented by SEQ ID NO: 1, and variants of the nucleotide sequence represented by SEQ ID NO: 1 are also included within the scope of the present invention. A functional equivalent of the shRNA represented by SEQ ID NO: 1 of the present invention is a concept including variants capable of functionally the same action as the shRNA consisting of the nucleotide sequence represented by SEQ ID NO: 1, although for example, a portion of the sequence represented by SEQ ID NO: 1 was modified by deletion, substitution, or insertion.
[0052] Specifically, the shRNA may include a sequence having at least 70%, more preferably at least 80%, still more preferably at least 90%, and most preferably at least 95% sequence homology to the base sequence represented by SEQ ID NO: 1, respectively. The “% sequence homology” for a polynucleotide or amino acid is identified by comparing the comparison region with two optimally arranged sequences.
[0053] The siRNA includes a sense sequence of 15 to 30 mers selected from the base sequence of the mRNA of the PHF20 gene and an antisense sequence complementary to the sense sequence, but the sense sequence is not particularly limited thereto.
[0054] In a specific embodiment of the present invention, the PHF20 protein activity inhibitor may include at least one type selected from the group consisting of compounds, peptides and antibodies that specifically bind to PHF20 protein.
[0055] The compound includes any compound capable of specifically binding to and inhibiting the activity of the PHF20 protein.
[0056] The antibody may specifically and directly bind to the PHF20 protein to effectively inhibit the activity of the PHF20 protein. As the antibody that specifically binds to the PHF20 protein, a polyclonal antibody or a monoclonal antibody is preferably used, and the antibody may be prepared by a known method known to those skilled in the art, and commercially known antibodies may be purchased and used.
[0057] The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable additive, and the pharmaceutically acceptable additive may include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, syrup, Arabic gum, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, white sugar, etc. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
[0058] In addition, the pharmaceutical composition of the present invention may be administered in various oral or parenteral formulations during actual clinical administration. In the case of formulation, it may be prepared using commonly used fillers, extenders, binders, wetting agents, disintegrants, diluents such as surfactants, or excipients, and it is preferable to use suitable preparations known in the art. Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate, mineral oil, and the like.
[0059] The solid preparation for oral administration includes tablets, pills, powders, granules, capsules, etc., and this solid preparation is prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. In addition, the liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included.
[0060] The formulation for parenteral administration includes sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, etc. may be used. The parenteral administration may be performed using an injection method such as an external skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.
[0061] The dosage of the pharmaceutical composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate and severity of disease, and may be administered once a day or in several divided doses.
[0062] The pharmaceutical composition of the present invention may be administered to an individual by various routes.
[0063] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the prevention or treatment of diseases caused by muscle loss.
[0064] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating diseases caused by muscle loss, the composition including a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor; or a YY1 promoter activity inhibitor.
[0065] In a specific embodiment of the present invention, the YY1 promoter activity inhibitor may be siRNA, and is preferably shown by the nucleotide sequence represented by SEQ ID NO: 2.
[0066] According to another aspect of the present invention, the present invention provides a composition for increasing muscle or inhibiting muscle loss, the composition including a PHF20 gene expression inhibitor or a PHF20 protein activity inhibitor as an active ingredient.
[0067] The composition is preferably a health functional food composition or a feed additive composition, but is not limited thereto.
[0068] In the present invention, a feed additive refers to a substance added in a trace amount to a feed for nutritional or specific purposes.
[0069] When the composition for increasing muscle or inhibiting muscle loss is a health functional food composition, the PHF20 gene expression inhibitor or the PHF20 protein activity inhibitor may be added as it is, or it may be used together with other foods or food ingredients and may be used appropriately according to a conventional method. The mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the PHF20 gene expression inhibitor or PHF20 protein activity inhibitor of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the total composition. However, in the case of long-term ingestion for health and hygiene purposes or for health control, it may be less than the above range. Since there is no problem in terms of safety, the active ingredient may be used in an amount equal to or more than the range.
[0070] There is no particular limitation on the type of the health functional food. Examples of the health functional food include candies, snacks, gums, beverages, tea, drinks, alcoholic beverages and vitamin complexes, and include all health functional foods in a conventional meaning.
[0071] When the composition for increasing muscle or inhibiting muscle loss is a feed additive composition, the feed additive composition of the present invention is provided as a feed by appropriately mixing it with a feed raw material, and the feed raw materials include grains, crude rice bran, vegetable oil meals, animal feed raw materials, other feed raw materials, and refined products, etc., but are not limited thereto.
MODES OF THE INVENTION
[0072] Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.
EXPERIMENTAL MATERIAL
[0073] Anti-PHF20 antibody was purchased from Cell Signaling Technology (Beverly, Mass.). Anti-β actin antibody was obtained from Sigma Aldrich (St. Louis, USA). Anti-YY1, anti-MyoD and anti-myosin heavy chain antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif.). Anti-myosin (MF20) antibody was obtained from DSHB, University of Iowa. HRP-conjugated anti-mouse, anti-rabbit and anti-goat IgG antibodies were obtained from Koma biotech (Seoul, Korea). pYY-luciferase was purchased from Panomics (California, USA). A luciferase assay system kit was purchased from Promega (Madison, USA). Tet-on advanced inducible gene expression system kit was obtained from Clontech (Takara Bio Company, USA).
Experimental Example 1. Cell Culture
[0074] 1-1. C.sub.2C.sub.12 Cell Culture and Differentiation
[0075] C.sub.2C.sub.12 cells, which are premyocytes, were cultured at 37° C. and 5% CO.sub.2 conditions using DMEM medium. The DMEM (WELGENE, Gyeongsan, Korea) medium contains 10% FBS (fetal bovine serum) (HyClone, Logan, USA) and 1% Antibiotic-Antimycotic (Gibco, Detroit, USA).
[0076] For cell differentiation, the medium was replaced with a differentiation medium (DM) and then the culture was performed, and the medium was replaced every two days. The differentiation medium contains 2% horse serum and 1% Antibiotic-Antimycotic (Gibco, Detroit, USA). The cell differentiation was initiated 24 hours after the medium change.
[0077] 1-2. C.sub.2C.sub.12/Tet-On Inducible PHF20 Cells
[0078] C.sub.2C.sub.12/Tet-On inducible PHF20 cells were prepared using C.sub.2C.sub.12 cells. Specifically, in order to prepare C.sub.2C.sub.12-TET3G myoblasts, C.sub.2C.sub.12 cells were treated with lentivirus-TET3G, and C.sub.2C.sub.12-TET3G myoblasts were obtained by selecting with G418 (1.2 mg/ml). The C.sub.2C.sub.12-TET3G cells were transiently transfected with pLVX-TRE3G-PHF20. Tet-On-inducible PHF20 cells were selected among the transiently transfected cells using puromycin (3 μg/ml). When the selected cells (C.sub.2C.sub.12/Tet-On-inducible PHF20 cells) are cultured in a medium containing doxycycline (Doxy), the expression of PHF20 is inducible.
[0079] In the following experiment, in order to induce the expression of PHF20 in C.sub.2C.sub.12 cells, it was cultured in a medium containing doxycycline at a concentration of 100 ng/ml.
Experimental Example 2. Western Blotting
[0080] The prepared cells were placed on ice, and the cells were treated with a lysis buffer to prepare a cell lysate. The lysis buffer includes 50 mM Tris-HCl (pH 7.5), 1% v/v Nonidet P-40, 120 mM NaCl, 25 mM sodium fluoride, 40 mM βphosphate, 0.1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine and 2 μM microcystin-LR. Cell lysates were centrifuged at 13,000 rpm for 30 minutes to obtain proteins. The protein was developed by SDS-PAGE using a 10.0% to 7.5% gel. The developed protein was transferred to an Immobilon-P membrane (Millipore). Thereafter, the membrane was blocked for 1 hour by treating with 1×TBS (tri-buffered saline buffer; 140 mM NaCl, 2.7 mM KCl, 250 mM Tris HCl, pH 7.4) containing 5% skim milk and 0.2% Tween-20. Then, it was treated with the diluted 1000-fold primary antibody for each protein and cultured overnight at 4° C. After the reaction, the membrane was washed with TBS. The washed membrane was treated with a 2000-fold diluted secondary antibody (horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG (Komabiotech, Seoul, Korea)) and then cultured. After culture, the membrane was washed with TBS, and protein was detected according to the manufacturer's manual.
Experimental Example 3. Real-Time Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
[0081] C.sub.2C.sub.12/Tet-On inducible PHF20 cells were seeded in 6-well plates and cultured for 24 hours. In order to induce the expression of PHF20, the C.sub.2C.sub.12/Tet-On inducible PHF20 cells were treated with doxycycline. The day after treatment with doxycycline, total RNA was extracted from the cells using a QuickGene RNA kit (Fujifilm's Life Science System, Tokyo, Japan). In addition, cDNA was synthesized from the extracted total RNA using SuPrimeScript RT Premix (GeNet Bio, Cheonan, Korea). The amplification of cDNA was performed with Prime Q-Mastermix (GeNet Bio, Cheonan, Korea) and CFX96T Real-time System (Bio-Rad, Hercules, Calif., USA). Through qRT-PCR analysis of each cDNA, duplex DNA formation was measured using SYBR green dye and the StepOne Plus real-time PCR system (Invitrogen, Carlsbad, Calif.).
[0082] The primers used in this experiment are shown in Table 1.
TABLE-US-00001 TABLE 1 Primer Sequence (5-3) mouse GAPDH forward TCCAGTATGACTCCACTC (SEQ ID NO: 4) mouse GAPDH reverse ATTTCTCGTGGTTCACAC (SEQ ID NO: 5) mouse PHF20 forward CATTGACTACGAAGAAGGGAG (SEQ ID NO: 6) mouse PHF20 reverse CTTCTCTAAAGGGCGCAGATA (SEQ ID NO: 7) mouse YY1 forward CAGAAGCAGGTGCAGATCAGA (SEQ ID NO: 8) CCCT mouse YY1 reverse GCACCACCACCCACGGAATCG (SEQ ID NO: 9) mouse MyoD forward TACAGTGGCGACTCAGATGC (SEQ ID NO: 10) mouse MyoD reverse GAGATGCGCTCCACTATGCT (SEQ ID NO: 11)
Experimental Example 4. Detection of Myosin Heavy Chain (MHC) Through Immunochemical Staining Analysis
[0083] C.sub.2C.sub.12/Tet-On inducible PHF20 cells were seeded in a 12-well plate containing sterile coverslips at a concentration of 1×10.sup.5 cells/well and cultured at 37° C. and 5% CO.sub.2 conditions. The cells of the doxycycline untreated group (−Doxy) were cultured for 24 hours without treatment with doxycycline, and the doxycycline-treated group (+Doxy) was cultured for 24 hours after replacing the medium with doxycycline-containing medium. After replacing the medium of each cultured cell with a differentiation medium, the cells were cultured for 1 day (D1) or 3 days (D3) to allow differentiation. The cells were then washed with PBS at 37° C. The washed cells were cultured in 4% paraformaldehyde for 15 minutes, fixed on coverslips, and washed twice with PBS. For blocking, coverslips were treated with 1% bovine serum albumin (BSA), and then cultured with shaking at room temperature for 1 hour. In addition, an anti-myosin (MF-20) antibody was diluted at a ratio of 1:200 and added to the cells, and the mixture was cultured with shaking at 4° C. overnight. After shaking culture, the coverslips were washed three times with PBS. FITC secondary antibody (1:1,000) (in 5% skim milk) was added and then cultured with shaking for 6 hours in the dark at room temperature. After shaking culture, the coverslips were washed three times with PBS. After replacing the medium of the washed coverslip with a mounting medium containing DAPI VECTASHIELD (St. Louis, USA), it was bound to the slide and analyzed for fluorescence.
Experimental Example 5. Luciferase Reporter Gene Analysis
[0084] C.sub.2C.sub.12/Tet-On inducible PHF20 cells were seeded in 6-well plates at a concentration of 3×10.sup.5 cells/ml. The seeded cells were transfected with 1 μg of plasmid containing YY1-luciferase according to the manufacturer's manual. Transfected cells were used for experiments after 24 hours.
[0085] Transfected cells were treated with reporter lysis buffer to lyse the cells. The reporter lysis buffer includes 25 mM Tris-phosphate, 2 mM DTT, 2 mM trans-1,2-cyclohexanediamine-N,N,Netraacetic acid, 10% (v/v) glycerol and 1% (v/v) Triton x-100. The luciferase assay substrate (Promega) was added to 20 μg of cell lysates, and they were cultured. For luciferase activity, luminescence was measured for 10 seconds using a luminometer (Duo Lumat LB 9507).
Experimental Example 6. Chromatin-Immunoprecipitation (ChiP) Analysis
[0086] Chromatin immunoprecipitation analysis was performed according to the manufacturer's manual (Upstate Biotechnology, Lake Placid, N.Y., USA). Specifically, C.sub.2C.sub.12 cells were differentiated for 3 days and was treated with formaldehyde for 7.5 minutes. Thereafter, the cells were washed twice with PBS containing a protease inhibitor and then transferred onto the ice. Cells on ice were treated with SDS-lysis buffer and cultured for 10 minutes, and the lysate was collected. The lysis buffer includes 50 mM Tris-HCl (pH 8.0), 1% SDS, 10 mM EDTA, 1 mM PMSF, 1 μg/ml aprotinin and 2 μg/ml pepstatin. The collected lysates were cultured overnight at 4° C. after treatment with primary antibody or control IgG. Thereafter, 30 μl of protein A beads (containing 500 μg/ml BSA and 200 μg/ml salmon sperm DNA) were cultured together at 4° C. for 3 hours in the culture. After culture, the DNA sample was purified using QIA quick PCR purification kit (Qiagen, Hilden, Germany) and quantified by qRT-PCT. qRT-PCT results were expressed as a percentage of the entered value. The sequence of mouse YY1 (−200/−55), a promoter-specific primer used in this experiment, is as follows.
TABLE-US-00002 (forward, SEQ ID NO: 12) - mouse YY1(−200−/55): 5-CGCTGCCTTCCTCCCTCT-3, (reverse, SEQ ID NO: 13) 5-CGTCCGTGGCGATGTAGA-3
Experimental Example 7. Preparation of PHF20 Transgenic Mice
[0087] In order to prepare PHF20 transgenic mice, cDNA encoding human PHF20 was subcloned downstream of the CMV promoter of pcDNA3 vector, and WT C57BL/6 mice were transformed with the vector. As a control group, WT C57BL/6 mice were used and denoted as WT. Mouse PHF20-TG and WT were reared in an environment of 12 h/12 h long cycle, 50% to 60% humidity, and 22° C. ambient temperature. In addition, all animal experiments were performed in animal facilities in accordance with institutional guidelines. The experimental protocol was approved by the Chungnam National University (CNU-00890) review committee.
Experimental Example 8. Histological Analysis and Immunochemical Staining Analysis
[0088] Muscles collected from mice were treated with 10% formalin and then cultured overnight at 4° C. and fixed. The fixed muscle samples were embedded in paraffin blocks. A 5 μm-thick section was prepared by cutting the paraffin block. Slices from adjacent sites were additionally prepared, and slides were prepared sequentially.
[0089] For general morphological analysis, the prepared slides were stained with hematoxylin and eosin (H&E).
[0090] In addition, for immunochemical staining analysis, the slices on the slide were deparaffinized with xylene and rehydrated with ethanol. Thereafter, the slides were immersed in a peroxidase quenching solution and reacted for 10 minutes. After the reaction, the slides were washed twice with PBS for 5 minutes each, and 2 drops of reagent A were added to the slide for blocking and then cultured for 30 minutes. After culture, the slides were washed twice with PBS. The washed slides were treated with a primary antibody (anti-WIC) and cultured overnight at 4° C. The cultured slides were washed with PBS and then treated with reagent B, a biotinylated secondary antibody and cultured at room temperature for 1 hour. After the cultured slides were washed with PBS, enzyme-conjugated reagent C was dropped on the slides and washed with PBS. After washing with PBS, DAB chromophore; and a mixture of reagents D1, D2 and D3; were dropped on the slide. The signal was observed under a fluorescence microscope. After stopping the reaction with distilled water, slide images were taken with a fluorescence microscope.
Experimental Example 9. Statistical Analysis
[0091] Data are expressed as mean±S.E. Differences between groups in at least 3 experiments were analyzed using Student's t-test, and P<0.05 was considered statistically significant. Image J software (version 1.47) was also used for quantitative analysis of the results.
Example 1. Analysis of Expression of YY1 and PHF20 During Myogenic Differentiation
[0092] In order to evaluate the changes in PHF20 (PHD finger protein 20) in myogenic differentiation, YY1 (Yin Yang 1) and PHF20 mRNA and protein expression in myogenic differentiation were analyzed by qRT-PCR and Western blotting.
[0093] 1-1. PHF20
[0094] 24 hours after C.sub.2C.sub.12 cells were seeded, myogenic differentiation was inducible by replacement with differentiation medium (DM) containing 2% horse serum. PHF20 mRNA expression of cells was measured daily during myogenic differentiation by qRT-PCR. In addition, the protein expression of PHF20 and myoD was checked daily during the myogenic differentiation through western blotting. The results of analyzing PHF20 mRNA and protein expression are shown in
[0095] As shown in
[0096] 1-2. YY1
[0097] It was confirmed that YY1 expression is increased in cells overexpressing PHF20 through previous studies. Accordingly, mRNA and protein expression of YY1 were analyzed in the same manner as in Example 1-1. The results of analyzing the mRNA and protein expression of YY1 are shown in
[0098] As shown in
Example 2. Evaluation of the Effect of PHF20 Expression on the Differentiation of C.SUB.2.C.SUB.12 .Cells
[0099] The effect of PHF20 expression on myogenic differentiation was further evaluated.
[0100] 2-1. Effect of PHF20 Expression on myoD Protein Expression
[0101] After preparing C.sub.2C.sub.12 cells (Pre), they were divided into a doxycycline untreated group (−Doxy) and a treated group (+Doxy). Thereafter, the doxycycline-untreated group (−Doxy) was cultured for 24 hours without treatment with doxycycline on the prepared cells, and the doxycycline-treated group (+Doxy) was cultured for 24 hours after replacing with a medium containing doxycycline. C.sub.2C.sub.12 cells untreated or treated with doxycycline were used in the experiment and marked as Pre.
[0102] In order to prepare differentiated myofibers (D1, D3, and D5), the medium of C.sub.2C.sub.12 cells untreated or treated with doxycycline was replaced with a differentiation medium and then cultured. The cultured cells were designated as D1, D3, and D5, respectively, according to the number of days of differentiation.
[0103] Each cell lysate was prepared by treating the prepared cells with a lysis buffer, and protein expression of PHF20, YY1 and MyoD was analyzed by Western blotting. The results of analyzing the protein expression of PHF20, YY1 and MyoD are shown in
[0104] As shown in
[0105] 2-2. Effect of PHF20 Expression on mRNA Expression of myoD
[0106] After extracting total RNA from C.sub.2C.sub.12 cells (Pre) and differentiated myofibers (D5) treated with doxycycline (+Doxy) or untreated (−Doxy) of Example 2-1, mRNA expression of PHF20, YY1 and MyoD were analyzed by qRT-PCR. The result of analyzing the mRNA expression is shown in
[0107] As shown in
[0108] 2-3. Effect of PHF20 Expression on Myotube Formation
[0109] In order to confirm the effect of PHF20 on myotube formation, the expression of myosin heavy chain was investigated through immunochemical staining analysis. Specifically, doxycycline-treated (+Doxy) or untreated (−Doxy) C.sub.2C.sub.12 cells (Pre) and differentiated myofibers (D1 and D3) were prepared. The prepared cells were used to perform immunochemical staining analysis using an anti-MF antibody (green). The myosin heavy chain was stained with an anti-MF antibody and displayed in green, and the cell nucleus was stained with 4′,6-diamidino-2-phenylindole (DAPI) and displayed in blue. The results of the immunochemical staining analysis are shown in
[0110] As shown in
[0111] 2-4. Effect of Inhibition of PHF20 Expression on MyoD Expression
[0112] The effect of inhibition of PHF20 expression on myoD expression was confirmed. For this, C.sub.2C.sub.12 cells (Pre) and differentiated myofibers (D1) were prepared. The prepared cells were transfected with a lentivirus expressing shRNA (shPHF20) for the PHF20 sequence shown by the nucleotide sequence represented by SEQ ID NO: 1. shRNA for the scrambled sequence shown by the nucleotide sequence represented by SEQ ID NO: 3 was used as a control group. Transfected cells were cultured for 24 hours. The cells were lysed after culture, and the cell lysate was used to perform Western blotting. The results of pre-differentiated C.sub.2C.sub.12 cells (Pre) are shown in
[0113] As shown in
Example 3. Effect of PHF20 Expression on YY1 Promoter Expression
[0114] Through Examples 1 and 2, it was confirmed that the increase in PHF20 expression during myogenic differentiation increased the YY1 expression and decreased the MyoD expression. Accordingly, the effect of PHF20 expression on muscle differentiation was additionally evaluated through YY1 promoter analysis.
[0115] 3-1. Evaluation of PHF20 Expression and YY1 Promoter Expression According to the Treatment Concentration of Doxycycline
[0116] The expression of PHF20 and YY1 promoters according to the concentration of doxycycline was examined. C.sub.2C.sub.12 cells (Pre) were transfected with the YY1-luciferase gene. The transfected cells were treated with doxycycline at different concentrations (0, 50, 100 and 500 ng/ml) and then cultured for 24 hours. After culture, Western blotting and luciferase reporter gene analysis were performed for the C.sub.2C.sub.12 cells. The Western blotting is to confirm the expression of PHF20, and the luciferase reporter gene analysis is to confirm the activity of the YY1 promoter. The results of Western blotting and analysis of the luciferase reporter gene are shown in
[0117] As shown in
[0118] 3-2. Evaluation of PHF20 and YY1 Promoter Expression According to shRNA Transfection
[0119] The expression of PHF20 and YY1 promoters following shRNA transfection was examined. Specifically, C.sub.2C.sub.12 cells (Pre) were prepared, and the prepared cells were transfected with a lentivirus expressing shRNA for a scrambled sequence (shRNA) or a PHF20 sequence (shPHF20). After the transfected cells were cultured for 24 hours, the cells were further transfected with the YY1-luciferase gene. Thereafter, the cells were lysed, and Western blotting and luciferase reporter gene analysis were performed using the cell lysate, and the results are shown in
[0120] As shown in
[0121] 3-3. Evaluation of Expression of PHF20 and YY1 Promoters According to the Period of Myogenic Differentiation
[0122] The effect of inhibition of PHF20 expression on YY1 promoter expression according to the myogenic differentiation period was analyzed. For this, YY1 promoter analysis was performed using C.sub.2C.sub.12 cells, which are premyocytes. Specifically, C.sub.2C.sub.12 cells (Pre) not treated with doxycycline were differentiated by culturing in a differentiation medium, and the cells were transfected with the YY1-luciferase gene at each differentiation time point (D1 and D3). Expressions of PHF2, YY1 and MyoD in the transfected cells were analyzed by Western blotting. In addition, the activity of the YY1 promoter was confirmed through luciferase reporter gene analysis. C.sub.2C.sub.12 cells (Pre) treated with doxycycline were tested in the same manner as above. The experimental results using the C.sub.2C.sub.12 cells not treated with doxycycline are shown in
[0123] As shown in
[0124] As shown in
[0125] These results indicate that the expression level of PHF20 is important for the regulation of myogenic differentiation through YY1 and YY1 promoters.
[0126] 3-4. Confirmation of Regulation Method of YY1 Promoter by PHF20
[0127] It was confirmed how PHF20 regulates the YY1 promoter through chromatin-immunoprecipitation (ChiP) analysis. For the chromatin immunoprecipitation analysis, C.sub.2C.sub.12 cells (Pre) and differentiated myofibers (D1 and D3) were used, and primer mouse YY1 (−200/−55) was used. IgG was used as a control group. The results of chromatin immunoprecipitation analysis are shown in
[0128] As shown in
Example 4. Effect of YY1 Expression on MyoD Expression
[0129] Through Example 3, it was confirmed that PHF20 directly regulates YY1. Accordingly, the effect of the YY1 promoter expression on the downstream gene MyoD was examined in this example.
[0130] 4-1. Western Blotting
[0131] In order to examine the effect of expression of the YY1 promoter on the downstream gene MyoD, C.sub.2C.sub.12 cells (Pre) treated with doxycycline (100 ng/ml) (+Doxy) or untreated (−Doxy) were prepared. The C.sub.2C.sub.12 cells were cultured in a differentiation medium to differentiate them into muscle. On the third day of differentiation (D3), the cells were transfected with siRNA or siYY1 (SEQ ID NO: 2) and cultured for 24 hours. After culture, cell lysates were prepared. The expression of PHF20, YY1 and MyoD was analyzed by Western blotting. As a control group, C.sub.2C.sub.12 cells (Pre) treated with doxycycline (100 ng/ml) (+Doxy) or untreated (−Doxy) were used. Western blotting results are shown in
[0132] As shown in
[0133] 4-2. Immunochemical Staining Analysis
[0134] In order to confirm the effect of YY1 on myotube formation, the expression of myosin heavy chain was examined through immunochemical staining analysis. Specifically, differentiated myofibers (D1) treated with doxycycline (+Doxy) or untreated (−Doxy) were prepared. The prepared cells were transfected with siRNA or siYY1 and cultured for 24 hours. The cultured cells were used to perform immunochemical staining analysis using an anti-myosin (MF20) antibody. Myosin heavy chain was stained with an anti-myosin (MF20) antibody and displayed in green, and cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) and displayed in blue. The results of the immunochemical staining analysis are shown in
[0135] As shown in
Example 5. Evaluation of the Effect of PHF20 Expression on Myogenic Differentiation in PHF20 Transgenic Mice
[0136] 5-1. PHF20, YY1 and MHC Expression Analysis and Confirmation of Phenotype in PHF20 Transgenic Mice
[0137] Skeletal muscle tissue was isolated from PHF20 transgenic mice. The isolated skeletal muscle tissue was lysed to prepare cell lysates, and the expression of PHF20, YY1 and myosin heavy chain (MHC) was analyzed through Western blotting. The myosin heavy chain is a myogenic differentiation marker, and its expression increases as differentiation progresses. 5-month-old male WT mice were used as a control group. Western blotting results are shown in
[0138] As shown in
[0139] PHF20 transgenic mice were weighed before sacrifice for the next experiment. Thereafter, the PHF transgenic mice were dissected and the thigh muscles and muscles were observed. The weight measurement results of the PHF20 transgenic mice are shown in
[0140] As shown in
[0141] As shown in
[0142] The above results indicate that the PHF20 transgenic mice gained weight due to fat accumulation.
[0143] 5-2. Histological Analysis and Immunochemical Staining Analysis
[0144] A slide was prepared by slicing the gastrocnemius tissue of the PHF20 transgenic mouse (PHF20-TG) and the control group (WT) in a transverse direction (cross section) or longitudinal direction (longitudinal section).
[0145] Tissues of the prepared transverse or longitudinal slides were stained with hematoxylin and eosin (H&E). The result of observing the cross-section of the gastrocnemius tissue is shown in
[0146] As shown in
[0147] As shown in
[0148] In addition, the cross-sectional slides stained with hematoxylin and eosin were additionally observed, and the results are shown in
[0149] As shown in
[0150] The gastrocnemius muscle tissue of the prepared transverse or longitudinal slide was observed through immunochemical staining analysis. The results of observing the longitudinal cross-section of the gastrocnemius tissue are shown in
[0151] As shown in
[0152] As shown in
[0153] The above results confirmed that PHF20 had a negative effect on muscle development in vivo.
[0154] In sum, the above experimental results confirmed that the expression of PHF20 affects myogenic differentiation through the mechanism shown in
[0155] Hereinafter, the present invention is described in more detail through formulation examples. The formulation examples are only for illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the formulation examples.
Formulation Example 1. Preparation of Pharmaceutical Composition
[0156] 1-1. Preparation of Powders
[0157] 20 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0158] 100 mg of lactose
[0159] 10 mg of talc
[0160] The above ingredients are mixed and filled in an airtight bag to prepare powders.
[0161] 1-2. Preparation of Tablets
[0162] 20 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0163] Cornstarch 100 mg
[0164] 100 mg of lactose
[0165] 2 mg of magnesium stearate
[0166] The above ingredients are mixed, and then tablets are prepared by tableting according to a conventional method for preparing tablets.
[0167] 1-3. Preparation of Capsules
[0168] 20 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0169] 3 mg of crystalline cellulose
[0170] 14.8 mg of lactose
[0171] 0.2 mg of magnesium stearate
[0172] According to a conventional method for preparing capsules, the above ingredients are mixed and filled in a gelatin capsule to prepare capsules.
[0173] 1-4. Preparation of Injections
[0174] 10 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0175] 180 mg of mannitol
[0176] 2974 mg of sterile distilled water for injection
[0177] 26 mg disodium phosphate dihydrate
[0178] According to a conventional method for preparing injections, injections are prepared in the content of the above ingredients per 1 ampoule (2 ml).
[0179] 1-5. Preparation of Liquids
[0180] 10 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0181] 10 g of isomerized sugar
[0182] 5 g of mannitol
[0183] appropriate amount of purified water
[0184] According to a conventional method for preparing liquids, the above components are added to purified water to dissolve. Then, an appropriate amount of lemon flavor is added thereto. Then, the above components are mixed. Then, purified water is added thereto. The mixture is adjusted to 100 ml by adding purified water, and then filled in a brown bottle to sterilize to prepare liquids.
Formulation Example 2. Preparation of Food Formulations
[0185] 2-1. Preparation of Health Food
[0186] 10 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0187] appropriate amount of vitamin mixture
[0188] 70 g of vitamin A acetate
[0189] 1.0 mg of vitamin E
[0190] 0.13 mg of vitamin B1
[0191] 0.15 mg of vitamin B2
[0192] 0.5 mg of vitamin B6
[0193] 0.2 g of vitamin B12
[0194] 10 mg of vitamin C
[0195] 10 g of biotin
[0196] 1.7 mg of nicotinamide
[0197] 50 g of folic acid
[0198] 0.5 mg of calcium pantothenate
[0199] appropriate amount of mineral mixture
[0200] 1.75 mg of ferrous sulfate
[0201] 0.82 mg of zinc oxide
[0202] 25.3 mg of magnesium carbonate
[0203] 15 mg of potassium monophosphate
[0204] 55 mg of dibasic calcium phosphate
[0205] 90 mg of potassium citrate
[0206] 100 mg of calcium carbonate
[0207] 24.8 mg of magnesium chloride
[0208] The mixing ratio of the above vitamin and mineral is relatively suitable for health food in a preferred embodiment, but the mixing ratio may be arbitrarily modified. After mixing the above ingredients according to a conventional health food manufacturing method, granules are prepared and may be used for a method of preparing the health food composition according to a conventional method.
[0209] 2-2. Preparation of Health Drinks
[0210] 10 μg of PHF20 gene expression inhibitor or PHF20 protein activity inhibitor
[0211] 15 g of vitamin C
[0212] 100 g of vitamin E (powder)
[0213] 19.75 g of iron lactate
[0214] 3.5 g of zinc oxide
[0215] 3.5 g of nicotinamide
[0216] 0.2 g of vitamin A
[0217] 0.25 g of vitamin B1
[0218] 0.3 g of vitamin B2
[0219] certain amount of water
[0220] After mixing the above ingredients according to the conventional method of preparing health drink, they are stirred and heated at 85° C. for about 1 hour. The resulting solution is filtered and placed in a sterilized 2 L container. It is sealed and sterilized, and then refrigerated. It is used to prepare the health drink composition of the invention.
[0221] Although the composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demanding class, demanding country, and use.
Formulation Example 3. Preparation of Feed Additives
[0222] PHF20 gene expression inhibitor or PHF20 protein activity inhibitor 2.0%
[0223] glucose 2.0%
[0224] peptone 1.0%
[0225] yeast extract 1.0%
[0226] diphosphate 0.2%
[0227] magnesium sulfate 0.05%
[0228] cysteine 0.05%
[0229] purified water to 100%
[0230] As an excipient, defatted rice bran appropriate amount
[0231] Above, a specific part of the present invention has been described in detail, but it is apparent for those of ordinary skill in the art that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.