COMPOSITION INCLUDING STEM CELL-DERIVED EXOSOME, AND METHOD FOR PRODUCING SAME
20230190817 · 2023-06-22
Inventors
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
C12N5/06
CHEMISTRY; METALLURGY
A61K35/28
HUMAN NECESSITIES
C12N5/0668
CHEMISTRY; METALLURGY
International classification
A61K35/28
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
Abstract
The present invention relates to a composition including a stem cell-derived exosome, and a method for producing same. A composition according to the present invention has excellent effects in terms of anti-inflammatory effects, fibrosis inhibition, vascular endothelial cell proliferation, blood vessel formation, survival rate improvement, and protective regeneration of cardiomyocytes, and thus can be used as an agent for preventing or treating heart disease, inflammatory disease, immune disease, fibrotic disease, or vascular disease.
Claims
1-4. (canceled)
5. A method for preparing a pharmaceutical composition for alleviation, suppression, prevention, or treatment of a heart disease, the method comprising: a first culturing step of culturing induced pluripotent stem cells in a medium; a selective culturing step of separating SSEA-4 (-) cells from the cultured induced pluripotent cells and culturing same to perform differentiation into BxC stem cells; a second culturing step of culturing the BxC stem cells to perform differentiation into mesenchymal stem cells; a pretreatment step of pretreating the mesenchymal stem cells with at least one selected from the group consisting of pioglitazone, phorbol 12-myristate 13-acetate, exendin-4, hyaluronic acid, and resveratrol; a production step of culturing the pretreated mesenchymal stem cells to produce exosomes; and an isolation step of isolating exosomes from the mesenchymal stem cells or a culture thereof.
6. The method of claim 5, wherein the production step further comprises an additional culturing step of culturing the mesenchymal stem cells in presence of exosome-free fetal bovine serum (FBS).
7-10. (canceled)
11. A method for treating a heart disease in a subject in need thereof, the method comprising: administering to the subject a composition comprising at least one selected from the group consisting of BxC stem cell-derived exosomes, BxC-A1 stem cell-derived exosomes, BxC-110 stem cell-derived exosomes, BxC-G63 stem cell-derived exosomes, BxC-R11 stem cell-derived exosomes, and BxC-R56 stem cell-derived exosomes.
12. The method of claim 11, wherein the heart disease is selected from the group consisting of angina pectoris, myocardial infarction, valvular disease, cardiac failure, cardiac hypertrophy, arrhythmia, pericarditis, and endocarditis.
13. The method of claim 11, wherein the heart disease is an ischemic heart disease.
14. The method of claim 11, wherein the composition comprises BxC-R11 stem cell-derived exosomes.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
BEST MODE FOR CARRYING OUT THE INVENTION
[0228] Pharmaceutical composition, for alleviation, suppression, prevention, or treatment of a heart disease, comprising at least one selected from the group consisting of BxC stem cell-derived exosomes, BxC-A1 stem cell-derived exosomes, BxC-I10 stem cell-derived exosomes, BxC-G63 stem cell-derived exosomes, BxC-R11 stem cell-derived exosomes, and BxC-R56 stem cell-derived exosomes.
MODE FOR CARRYING OUT THE INVENTION
[0229] Below, a better understanding of the present disclosure may be obtained through the following examples which are set forth to illustrate, but are not to be construed to limit the present disclosure.
Example 1: Culturing of Induced Pluripotent Stem Cell-Derived Mesenchymal Stem Cells
[0230] Induced pluripotent stem cells (iPSCs) were cultured for 7 days in DMEM supplemented with 10% fetal bovine serum (FBS) and 10 ng/ml bFGF. Then, SSEA-4(-) cells that do not express stage-specific embryonic antigen 4 (SSEA-4) on the surface thereof were separated by FACS analysis from the cultured iPSCs to obtain progenitor cells of iPSC-derived mesenchymal stem cells. Subsequently, the separated SSEA-4(-) cells were passaged and cultured for an additional seven days in DMEM supplemented with 10% FBS and 10 ng/ml bFGF to afford BxC stem cells.
[0231] Thereafter, the BxC stem cells were further cultured in a culture medium containing high glucose DMEM (Gibco, USA), 10% FBS (HyClone, USA), and 1% MEM Non-Essential Amino Acids Solution (100X, Gibco, USA) to perform complete differentiation into iPSC-derived mesenchymal stem cells.
Example 2: Isolation and Characterization of Exosome (BxC-e) Derived from iPSC-Derived Mesenchymal Stem Cells
2-1. Isolation of BxC-e Exosome
[0232] The culture medium of the iPSC-derived mesenchymal stem cells cultured in Example 1 was harvested and centrifuged at 300xg for 10 minutes to remove remaining cells and cell debris. The supernatant thus obtained was filtered through a 0.22-.Math.m filter and subjected to centrifugation at 10,000xg and 4° C. for 70 minutes in a high-speed centrifuge.
[0233] Subsequently, the resulting supernatant was again centrifuged at 100,000xg and 4° C. for 90 minutes, using an ultracentrifuge. Afterward, the resulting supernatant was removed to obtain exosomes as a pellet. The exosomes were diluted in PBS (phosphate buffered saline) to obtain isolated iPSC-derived mesenchymal stem cell-derived exosomes (hereinafter referred to as “BxC-e exosomes”), which were used in the subsequent experiments.
2-2. Characterization of BxC-e Exosome
[0234] The BxC-e exosomes isolated in Example 2-1 were examined for size distribution using nanoparticle tracking assay (NanoSight NS300, Malvern Panalytical) and for morphology using an electron microscope.
[0235] The results are depicted in
Example 3: Isolation of Exosomes From iPSC-Derived Mesenchymal Stem Cells According to Pretreatment Substance
3-1. Isolation of Hyaluronic Acid-Pretreated Exosomes (BxC-R11e)
[0236] The iPSC-derived mesenchymal stem cells prepared in Example 1 were cultured for 24 hours in high-glucose DMEM medium supplemented with 10% fetal bovine serum, 1% MEM non-essential amino acids solution, and 40 .Math.g/ml hyaluronic acid to prepare iPSC-derived mesenchymal stem cells (BxC-R11 stem cells) pretreated with hyaluronic acid.
[0237] After completion of the culturing, the BxC-R11 stem cells were washed and cultured for an additional 72 hours in a culture medium supplemented with 10% exosome-free FBS.
[0238] After 72 hours of incubation, the pretreated culture medium was harvested and centrifuged at 300xg for 10 minutes to remove remaining cells and cell debris. Subsequently, the supernatant was taken, filtered through a 0.22-.Math.m filter, and centrifuged at 10,000xg and 4° C. for 70 minutes, using a high-speed centrifuge. Then, the supernatant thus formed was taken and subjected to ultracentrifugation at 100,000xg and 4° C. for 90 minutes. After removal of the resulting supernatant, the exosomes in the form of a pellet were diluted in PBS to isolate hyaluronic acid-pretreated exosomes (hereinafter referred to as “BxC-R11e exosomes”), which were used in the subsequent experiments.
3-2. Isolation of Pioglitazone-Pretreated Exosomes (BxC-A1e)
[0239] The iPSC-derived mesenchymal stem cells prepared in Example 1 were cultured for 24 hours in high-glucose DMEM medium supplemented with 10% fetal bovine serum, 1% MEM non-essential amino acids solution, and 3 .Math.M pioglitazone (Sigma, USA) to prepare iPSC-derived mesenchymal stem cells (BxC-R11 stem cells) pretreated with pioglitazone.
[0240] After completion of the culturing, the BxC-A1 stem cells were washed and cultured for an additional 72 hours in a culture medium supplemented with 10% exosome-free FBS.
[0241] After 72 hours of incubation, the pretreated culture medium was harvested and centrifuged at 300xg for 10 minutes to remove remaining cells and cell debris. Subsequently, the supernatant was taken, filtered through a 0.22-.Math.m filter, and centrifuged at 10,000xg and 4° C. for 70 minutes, using a high-speed centrifuge. Then, the supernatant thus formed was taken and subjected to ultracentrifugation at 100,000xg and 4° C. for 90 minutes. After removal of the resulting supernatant, the exosomes in the form of a pellet were diluted in PBS to isolate pioglitazone-pretreated exosomes (hereinafter referred to as “BxC-A1e exosomes”), which were used in the subsequent experiments.
3-3. Isolation of Phorbol 12-Myristate 13-Acetate-Pretreated Exosomes (BxC-I10e)
[0242] The iPSC-derived mesenchymal stem cells prepared in Example 1 were cultured for 24 hours in high-glucose DMEM medium supplemented with 10% fetal bovine serum, 1% MEM non-essential amino acids solution, and 50 nM phorbol 12-myristate 13-acetate (PMA, Sigma, USA) to prepare iPSC-derived mesenchymal stem cells (BxC-I10 stem cells) pretreated with phorbol 12-myristate 13-acetate.
[0243] After completion of the culturing, the BxC-I10 stem cells were washed and cultured for an additional 72 hours in a culture medium supplemented with 10% exosome-free FBS.
[0244] After 72 hours of incubation, the pretreated culture medium was harvested and centrifuged at 300xg for 10 minutes to remove remaining cells and cell debris. Subsequently, the supernatant was taken, filtered through a 0.22-.Math.m filter, and centrifuged at 10,000xg and 4° C. for 70 minutes, using a high-speed centrifuge. Then, the supernatant thus formed was taken and subjected to ultracentrifugation at 100,000xg and 4° C. for 90 minutes. After removal of the resulting supernatant, the exosomes in the form of a pellet were diluted in PBS to isolate phorbol 12-myristate 13-acetate-pretreated exosomes (hereinafter referred to as “BxC-I10e exosomes”), which were used in the subsequent experiments.
3-4. Isolation of Exendin-4-Pretreated Exosomes (BxC-G63e)
[0245] The iPSC-derived mesenchymal stem cells prepared in Example 1 were cultured for 24 hours in high-glucose DMEM medium supplemented with 10% fetal bovine serum, 1% MEM non-essential amino acids solution, and 20 nM exendin-4 (Sigma, USA) to prepare iPSC-derived mesenchymal stem cells (BxC-G63 stem cells) pretreated with exendin-4.
[0246] After completion of the culturing, the BxC-G63 stem cells were washed and cultured for an additional 72 hours in a culture medium supplemented with 10% exosome-free FBS.
[0247] After 72 hours of incubation, the pretreated culture medium was harvested and centrifuged at 300xg for 10 minutes to remove remaining cells and cell debris. Subsequently, the supernatant was taken, filtered through a 0.22-.Math.m filter, and centrifuged at 10,000xg and 4° C. for 70 minutes, using a high-speed centrifuge. Then, the supernatant thus formed was taken and subjected to ultracentrifugation at 100,000xg and 4° C. for 90 minutes. After removal of the resulting supernatant, the exosomes in the form of a pellet were diluted in PBS to isolate exendin-4-pretreated exosomes (hereinafter referred to as “BxC-G63e exosomes”), which were used in the subsequent experiments.
3-5. Isolation of Resveratrol-Pretreated Exosomes (BxC-R56e)
[0248] The iPSC-derived mesenchymal stem cells prepared in Example 1 were cultured for 24 hours in high-glucose DMEM medium supplemented with 10% fetal bovine serum, 1% MEM non-essential amino acids solution, and 10 nM resveratrol (Sigma, USA) to prepare iPSC-derived mesenchymal stem cells (BxC-R56 stem cells) pretreated with resveratrol.
[0249] After completion of the culturing, the BxC-R56 stem cells were washed and cultured for an additional 72 hours in a culture medium supplemented with 10% exosome-free FBS.
[0250] After 72 hours of incubation, the pretreated culture medium was harvested and centrifuged at 300xg for 10 minutes to remove remaining cells and cell debris. Subsequently, the supernatant was taken, filtered through a 0.22-.Math.m filter, and centrifuged at 10,000xg and 4° C. for 70 minutes, using a high-speed centrifuge. Then, the supernatant thus formed was taken and subjected to ultracentrifugation at 100,000xg and 4° C. for 90 minutes. After removal of the resulting supernatant, the exosomes in the form of a pellet were diluted in PBS to isolate resveratrol-pretreated exosomes (hereinafter referred to as “BxC-R56e exosomes”), which were used in the subsequent experiments.
Example 4: Characterization of Hyaluronic Acid-Pretreated Exosomes (BxC-R11e)
[0251] The BxC-R11e exosomes isolated in Example 3-1 were examined for size distribution using nanoparticle tracking assay (NanoSight NS300, Malvern Panalytical) and for morphology using an electron microscope.
[0252] The results are depicted in
Example 5: Identification of Exosome-Specific Marker on BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, and BxC-R56e Exosomes
[0253] BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, and BxC-R56e exosomes isolated in Examples 2 and 3 were examined for exosome-specific markers.
[0254] Twenty .Math.L of each of BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, and BxC-R56e exosomes was introduced into a tube to which 100 .Math.L of a MACSPlex buffer (Miltenyi Biotec, Germany) was added to form a total volume of 120 .Math.L. MACSPlex Exosome Capture Beads (Miltenyi Biotec, Germany) were resuspended by voltexing, and then added in an amount of 15 .Math.L to each tube containing the exosomes. Each tube was incubated at room temperature for 16 hours while being shaken on an orbital shaker. The addition of 500 .Math.L of a MACSPlex buffer (Miltenyi Biotec, Germany) was followed by centrifugation at 3000xg for 5 minutes. After centrifugation, 500 .Math.L of the supernatant in each tube was decanted and 5 .Math.L of MACSPlex Exosome Detection Reagent (Miltenyi Biotec, Germany) was added to each tube and mixed. Then, the tubes were incubated at room temperature for 1 hour. To each tube was added 500 .Math.L of a MACSPlex Buffer (Miltenyi Biotec, Germany), followed by centrifugation at 3000xg for 5 minutes. After removal of 500 .Math.L of the supernatant from each tube, 500 .Math.L of a MACSPlex Buffer was added again to each tube. Thereafter, the tubes were incubated for 15 minutes and centrifuged at 3000xg for 5 minutes. Following removal of 500 .Math.L of the supernatant, the expression of exosome-specific markers was examined by flow cytometry. The results are summarized in Table 1.
TABLE-US-00001 Exosome-specific marker Exosome BxC-e BxC-A1e BxC-I10e BxC-G63e BxC-R11e BxC-R56 CD9 95% 100% 100% 96% 100% 100% CD63 100% 100% 100% 100% 100% 100% CD81 100% 100% 100% 100% 100% 100%
[0255] As understood from the data of Table 1, all of BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, and BxC-R56e exosomes isolated in Examples 2 and 3 expressed exosome-specific markers at a level of 95% or higher. Accordingly, all the exosomes isolated in Examples 2 and 3 were observed to have characteristics of exosomes.
Example 6: Regenerative Effect on Cardiomyocyte
6-1. Culturing of Cardiomyocytes Differentiated From iPSC
[0256] Matrigel hESC-qualified Matrix (BD Bioscience, 354277) was diluted at a ratio of 1:100 in DMEM/F12+GlutaMAX™ (GIBCO, 10565-018) and the dilution was coated at a density of 0.5 ml/well onto 12-well cell culture plates (SPL, 30012) by incubation at 37° C. for one hour. Induced pluripotent stem cells were cultured to a confluence of 80-90 % in 75T flasks. The cells were washed twice with 5 ml of DPBS free of calcium and magnesium (HYCLONE, SH30028.02), followed by incubation with 4 ml of Tryple™ Express (1X), no phenol red (GIBCO, 12604-021) at 37° C. for 4 minutes. The cells were suspended in a DMEM/F12 + GlutaMAX™ supplement containing 10% FBS (GIBCO, 16000-044) and collected by centrifugation at 1000 rpm for 3 min. The supernatant was decanted and the cells were suspended 10 times in 1 ml of mTeSRTM1 (STEMCELL Technologies, 85850) and counted. The cells were seeded at a density of 0.5x10.sup.6/well in 1 ml of mTeSRTM1 and incubated to reach a confluence of 90-95% while the mTeSRTM1 medium was replaced every day for 2-4 days with a fresh one. The induced pluripotent stem cells with a confluence of 90-95% were cultured in 2 ml of RPMI1640 Medium (GIBCO, 11875-093) + B-27TM Supplement, minus insulin (GIBCO, A1895601) supplemented with CHIR99021 (Tocris, 4423) 6 .Math.M/ml + BMP4 (ProSpec, CYT-361) 10 ng/ml + StemBead Activin-A (Stem Culture, SBAC5) 10 ng/ml. After 48 hours of incubation, the cells were washed once with dPBS 1 ml/well and the medium was replaced with 2 ml of RPMI1640 Medium + minus insulin supplement containing XAV939 (Sigma, X3004) 10 .Math.M/ml + L-Ascorbic acid (Sigma, A5960) 50 .Math.g/ml. After 48 hours of incubation, the cells were washed once with DPBS 1 ml/well, and the medium was changed again with 2 ml RPMI1640 Medium + minus insulin supplement containing 50 .Math.g/ml ascorbic acid. After additional 48 hours of incubation, the cells were washed with dPBS 1 ml/well and then incubated in 2 ml of RPMI1640 Medium + B-27TM Supplement, minus vitamin A (GIBCO, 12587010). After 24 hours, the cultured cells were observed to beat to demonstrate complete differentiation into cardiomyocytes.
[0257] The differentiated cardiomyocytes observed to beat were seeded on 12-well plates coated at 5 ml/well per 10 cm with Matrigel hESC-qualified Matrix diluted at a ratio of 1:100 in DMEM/F12+GlutaMAX™ and incubated at 37° C. for one hour. The cells were washed twice with 5 ml of dPBS and incubated with 4 ml of Tryple at 37° C. for 4 min. The cells were harvested in DMEM/F12 supplemented with 10% FBS and centrifuged at 1000 rpm for 3 min. After removal of the supernatant, the cell pellet was suspended 10 times in 1 ml of RPMI1640 without vitamin A supplement and then counted. The cells were seeded at a population of 1x10.sup.7 cells in a 10-cm dish containing 10 ml of RPMI1640 without vitamin A supplement plus 5 .Math.M/ml Y27632. After 24 hours, the medium was changed with 10 ml of RPMI 1640 Medium, no glucose (GIBCO, 11879-020) and the cardiomyocytes were maintained for 2-4 days while checking the purity of cardiomyocytes. When the cardiomyocytes were observed to be high in yield after 2-4 days, the medium was changed with 10 ml of RPMI1640 without vitamin A supplement. The cells were used after a restoration period of 48 hours or subjected to cell cryopreservation. When the cells were used immediately, the medium was changed every 48 hours with RPMI1640 without vitamin A supplement in the subsequent viability assay.
6-2. Proliferative Effect on Cardiomyocytes
[0258] To examine the proliferative effect of exosomes on cardiomyocytes, cardiomyocytes differentiated from induced pluripotent stem cells were seeded into 96-well plates containing RPMI1640 without vitamin A supplement and incubated at 37° C. for 24 hours in a 5% CO.sub.2 incubator. After aspiration of the culture medium, the cells were washed with DPBS, added with 100 .Math.l of RPMI1640 containing BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e at a concentration of 100 .Math.g/ml, and then incubated at 37° C. for 2 days in a 5% CO.sub.2 incubator.
[0259] Thereafter, 10 .Math.l of Cell Counting Kit-8 (CCK-8, Enzo) solution was added to the cell culture which was then incubated at 37° C. for 2 hours in a 5% CO.sub.2 incubator. A color change was observed and absorbance was read at 450 nm to measure proliferation rates of vascular endothelial cells. The results are depicted in
TABLE-US-00002 CTRL e A1e G63e R11e R56e Viability (%) of cardiomyocyte 102.6 126 139 143.3 158 168.6
[0260] As can be seen in
6-3. Measurement of Viability in Cardiomyocytes Damaged By Hydrogen Peroxide
[0261] To examine the proliferative effect of exosomes on cardiomyocytes, cardiomyocytes differentiated from induced pluripotent stem cells were seeded into 96-well plates containing RPMI1640 without vitamin A supplement and incubated at 37° C. for 24 hours in a 5% CO.sub.2 incubator. The medium was changed with a medium containing 500 .Math.M hydrogen peroxide (H.sub.2O.sub.2, Sigma, USA), followed by incubation at 37° C. for 2 hours in a 5% CO.sub.2 incubator to impart oxidative stress to the cells.
[0262] After oxidative damage to the cells, the plates were washed with DPBS, added with 100 .Math.l of RPMI1640 without vitamin A supplement containing BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e exosomes at a concentration of 100 .Math.g/ml, and then incubated at 37° C. for 2 days in a 5% CO.sub.2 incubator so as to examine the proliferative effects of the exosomes on cardiomyocytes.
[0263] Thereafter, 10 .Math.l of Cell Counting Kit-8 (CCK-8, Enzo) solution was added to the cell culture which was then incubated at 37° C. for 2 hours in a 5% CO.sub.2 incubator. A color change was observed and absorbance was read at 450 nm to measure viability of vascular endothelial cells. The results are depicted in
TABLE-US-00003 CTRL H.sub.2O.sub.2 e A1e G63e R11e R56e Viability (%) of cardiomyocyte 105 60.6 107.3 113.3 121.6 137 145.7
[0264] As can be seen in
6-4. Measurement of Reactive Oxygen Species in Cardiomyocyte Damaged by Hydrogen Peroxide
[0265] The cardiomyocytes differentiated from induced pluripotent stem cells were seeded into 24-well plates containing RPMI1640 without vitamin A supplement and then incubated at 37° C. for 24 hours in a 5% CO.sub.2 incubator. The medium was changed with a medium containing 500 .Math.M hydrogen peroxide (H.sub.2O.sub.2), followed by incubation at 37° C. for 24 hours in a 5% CO.sub.2 incubator to impart oxidative stress to the cells. After oxidative damage to the cells, the medium was replaced with 300 .Math.l of a medium containing 500 .Math.M hydrogen peroxide (H.sub.2O.sub.2) and DPBS, BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e at a concentration of 100 .Math.g/ml and the cells were incubated at 37° C. for 1 day in a 5% CO.sub.2 incubator to examine the effects of the exosomes on the reactive oxygen species in the cardiomyocytes. Then, the cells were incubated in the presence of 5 .Math.M of the reactive oxygen species measuring reagent CellROX (Invitrogen, USA) and 5 .Math.M of CellTracker (Invitrogen, USA) at 37° C. for 30 min in a 5% CO.sub.2 incubator. Subsequently, the cells were washed with DPBS, fixed with 4% paraformaldehyde, added into NucBlue-containing DPBS, and then subjected to fluorescent microphotography. The fluorescence images are depicted in
TABLE-US-00004 Negative control H.sub.2O.sub.2 PBS H.sub.2O.sub.2 e H.sub.2O.sub.2 R11e Mean intensity 1.13 5.14 2.76 2.06
[0266] As is understood from the data of
6-5. Measurement of Cytotoxicity in Cardiomyocytes Damaged By Hydrogen Peroxide
[0267] To examine the protective effect of exosomes against cytotoxicity, cardiomyocytes differentiated from induced pluripotent stem cells were seeded into 24-well plates containing RPMI1640 without vitamin A supplement and incubated at 37° C. for 24 hours in a 5% CO.sub.2 incubator. Subsequently, the medium was replaced with 300 .Math.l of a medium containing 500 .Math.M hydrogen peroxide (H.sub.2O.sub.2) and DPBS, BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e at a concentration of 100 .Math.g/ml and the cells were incubated at 37° C. for 6 hours in a 5% CO.sub.2 incubator. Then, the culture medium where the cells had been cultured was transferred into 1.5-mL tube, followed by spinning the suspended cells down. The medium was transferred in an amount of 10 .Math.l to each well in 96-well plates. After an LDH solution (Cell cytotoxicity assay kit, BIOMAX, Korea) was added in an amount of 100 .Math.l to each well, incubation was carried out at room temperature for 30 min. Absorbance was read at 450 nm, and the measurements are depicted in
TABLE-US-00005 Negative control H.sub.2O.sub.2 PBS H.sub.2O.sub.2 e H.sub.2O.sub.2 A1e H.sub.2O.sub.2 I10e H.sub.2O.sub.2 G63e H.sub.2O.sub.2 R11e H.sub.2O.sub.2 R56e LDH % 100.0 121.7 72.1 92.5 107.8 107.2 84.4 75.5
[0268] As can be seen in
EXAMPLE 7: Effect on Proliferation, Survival, and Formation of Vascular Endothelial Cells
7-1. Measurement of Proliferative Effect on Vascular Endothelial Cells
[0269] To examine the proliferative effect of exosomes on vascular endothelial cells, HUVEC (human umbilical vein endothelial cells, LONZA, Switzerland), which is human umbilical cord-derived vascular endothelial cell line, was seeded into 96-well plates containing a 2% FBS-supplemented EGM-2 medium (Lonza, Switzerland) and incubated at 37° C. for 24 hours in a 5% CO.sub.2 incubator. After removal of the culture medium, the cells were washed with DPBS, added with 100 .Math.l of an FBS-free EGM-2 medium containing BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e exosomes at a concentration of 100 .Math.g/ml, and then incubated at 37° C. for 2 days in a 5% CO.sub.2 incubator.
[0270] Thereafter, 10 .Math.l of Cell Counting Kit-8 (CCK-8, Enzo) solution was added to the culture medium which was then incubated at 37° C. for 2 hours in a 5% CO.sub.2 incubator. A color change was observed and absorbance was read at 450 nm to measure proliferative rates of the vascular endothelial cells. The results are depicted in
TABLE-US-00006 PBS e A1e I10e G63e R11e R56e Proliferation rate (%) of vascular endothelial cell 100 130 150 170 140 150 170
[0271] As can be seen in
7-2. Measurement of Viability of Vascular Endothelial Cells Damaged by Hydrogen Peroxide
[0272] HUVEC, which is human umbilical cord-derived vascular endothelial cell line, was seeded into 96-well plates containing a 2% FBS-supplemented EGM-2 medium and incubated at 37° C. for 24 hours in a 5% CO.sub.2 incubator. Subsequently, the medium was changed with a medium containing 500 .Math.M hydrogen peroxide (H.sub.2O.sub.2, Sigma, USA), followed by incubation at 37° C. for 2 hours in a 5% CO.sub.2 incubator to damage the cultured cells.
[0273] After imparting damage to the cells, the proliferative effect of the exosomes on vascular endothelial cells was examined. In this regard, the plates were washed with DPBS and added with 100 .Math.l of an FBS-free EGM-2 medium containing BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e exosomes at a concentration of 100 .Math.g/ml before incubation at 37° C. for 2 days in a 5% CO.sub.2 incubator.
[0274] Thereafter, 10 .Math.l of Cell Counting Kit-8 (CCK-8, Enzo) solution was added to the culture medium which was then incubated at 37° C. for 2 hours in a 5% CO.sub.2 incubator. A color change was observed and absorbance was read at 450 nm to measure viability of the vascular endothelial cells. The results are depicted in
TABLE-US-00007 untx H.sub.2O.sub.2 PBS e A1e I10e G63e R11e R56e Viability (%) of vascular endothelial cells 100 70 90 100 100 90 110 100
[0275] As can be seen in
7-3. Measurement of Effect on Vascularization
[0276] Using a cooled tip, matrigel (BD bioscience) thawed in ice was plated into 96-well plated cooled at -20° C. for one hour with care to avoid bubble formation, followed by incubation at 37° C. for one hour in a 5% CO.sub.2 incubator.
[0277] The human umbilical cord-derived vascular endothelial cell line HUVEC was seeded into the Matrigel-coated, 96-well plates containing an FBS-free EGM-2 medium. Subsequently, the medium was added with 100 .Math.g/ml BxC-e, BxC-R11e, BxC-A1e, BxC-I10e, BxC-G63e, or BxC-R56e exosomes while PBS was added, instead of exosomes, for a control.
[0278] Then, the cells were incubated at 37° C. within 16 hours in a 5% CO.sub.2 incubator and photographed. The images are given in
TABLE-US-00008 PBS e A1e I10e G63e R11e R56e Tube length of vascular endothelial cell 0.26 0.28 0.29 0.3 0.3 0.28 0.3
TABLE-US-00009 PBS e A1e I10e G63e R11e R56e No. of tube node of vascular endothelial cell 38 66 80 77 79 88 80
TABLE-US-00010 PBS e A1e I10e G63e R11e R56e No. of vascular endothelial cell 56 80 113 104 111 120 115
[0279] As can be seen in
Example 8: Suppressive Effect of BxC-e Exosome on Inflammatory Macrophage
[0280] The human monocyte cell line THP-1 (ATCC, USA) was seeded into a 35-mm dish containing an RPMI1640 medium (Gibco, USA) supplemented with 1% antibiotics-antimycotics (Gibco, USA), 10% FBS (HyClone), and phorbol 12-myristate 13-acetate (PMA, 200 ng/ml, Sigma, USA) and incubated at 37° C. for 2 days in a 5% CO.sub.2 incubator.
[0281] After 48 hours of incubation, the cells were observed to adhere to the dish. Subsequently, the cells were induced to differentiate into inflammatory macrophages. In this regard, the medium was aspirated and the cells were washed with DPBS (HyClone, USA) and then incubated at 37° C. for an additional 3 days in an RPMI1640 medium supplemented with lipopolysaccharides (LPS, 100 ng/ml, Sigma), recombinant human interferon-gamma (INF-y, 20 ng/ml, R&D System, USA), 1% antibiotics-antimycotics, and 10% FBS in a 5% CO.sub.2 incubator to prepare inflammatory macrophages (M1).
[0282] After 72 hours, the medium was removed and the cells were washed DPBS and incubated at 37° C. for 24 hours in an RPMI1640 medium supplemented with 1% antibiotics-antimycotics and 50 .Math.g/ml BxC-e exosomes in a 5% CO.sub.2 incubator so as to examine an anti-inflammatory effect of the exosomes. Then, 1 ml of TRIZol reagent (Invitrogen, USA) was added to the 35-mm dish to lyse the cells. The cell lysate was added with 200 .Math.l of chloroform (Sigma, USA), briefly vortexed, and centrifuged at 4° C. and 12,000 rpm for 15 min. The supernatant thus formed was transferred into a new tube and mixed with 500 .Math.l of isopropanol (Merck Millipore, USA). The tube was turned upside down 50 times, left on ice for 5 min, and centrifuged at 12,000 rpm and 4° C. for 10 min. The supernatant was removed, and 1 ml of 70% ethanol was added to the tube to resuspend the pellet, followed by centrifugation at 12,000 rpm and 4° C. for 5 min. The ethanol was aspirated, and the RNA pellet in the tube was dried before dissolution in nuclease-free water. The concentration of the RNA sample thus obtained was measured by Nanodrop absorbances at 260 nm and 280 nm and cDNA was synthesized therefrom using AccuPower CycleScript RT PreMix(dT.sub.2o) (K-2044, Bioneer, Korea).
[0283] Thereafter, TNF-a, IL-1β, and IL-6 were monitored for mRNA expression levels by real-time PCR using the synthesized cDNA and the primers of Table 11, and the results are given in
TABLE-US-00011 SEQ ID NO: Name Sequencing List (5′-> 3′) Note 1 TNF-a_primer 1 GAGCTGAACAATAGGCTGTTCCCA TNF-α forward primer 2 TNF-a_primer 2 AGAGGCTCAGCAATGAGTGACAGT TNF-α reverse primer 3 IL-1 β_primer 1 ACAGCTGGAGAGTGTAGATCC IL-1β forward primer 4 IL-1 β_primer 2 CTTGAGAGGTGCTGATGTACC IL-1β reverse primer 5 IL-6_primer 1 ACAGCCACTCACCTCTTCAG IL-6 forward primer 6 IL-6_primer 2 CCATCTTTTTCAGCCATCTTT IL-6 reverse primer
[0284] As can be seen in
TABLE-US-00012 M0 M1 PBS BxC-e Expression level of TNF-α 1.0 7.2 4.5
TABLE-US-00013 M0 M1 PBS BxC-e Expression level of IL-1β 1.0 5.4 4.0
TABLE-US-00014 M0 M1 PBS BxC-e Expression level of IL-6 1.0 4.3 2.8
[0285] The data obtained from the above experiments indicate that the BxC-e exosomes according to the present disclosure decreases levels of inflammatory cytokines expressed from inflammatory macrophages.
Experimental Example 9: Regulatory Effect of BxC-R11e Exosome on Macrophage
9-1. Inhibitory Effect on Inflammatory Macrophage
[0286] The human monocyte cell line THP-1 was seeded into a 35-mm dish containing an RPMI1640 medium supplemented with 1% antibiotics-antimycotics, 10% FBS, and PMA (200 ng/ml) and incubated at 37° C. for 2 days in a 5% CO.sub.2 incubator. After 48 hours of incubation, when the cells were observed to adhere to the dish, the cells were induced to differentiate into inflammatory macrophages. In this regard, the medium was aspirated and the cells were washed with DPBS and then incubated at 37° C. for an additional 3 days in an RPMI1640 medium supplemented with LPS (100 ng/ml), INF-y (20 ng/ml), 1% antibiotics-antimycotics, and 10% FBS in a 5% CO.sub.2 incubator. After 72 hours, the medium was removed and the cells were washed DPBS and incubated at 37° C. for 24 hours in an RPMI1640 medium supplemented with 1% antibiotics-antimycotics and 50 .Math.g/ml BxC-R11 e exosomes in a 5% CO.sub.2 incubator so as to examine an anti-inflammatory effect of the exosomes. Then, 1 ml of TRIZol reagent (Invitrogen, USA) was added to the 35-mm dish to lyse the cells. The cell lysate was added with 200 .Math.l of chloroform (Sigma, USA), briefly vortexed, and centrifuged at 4° C. and 12,000 rpm for 15 min. The supernatant thus formed was transferred into a new tube and mixed with 500 .Math.l of isopropanol (Merck Millipore, USA). The tube was turned upside down 50 times, left on ice for 5 min, and centrifuged at 12,000 rpm and 4° C. for 10 min. The supernatant was removed, and 1 ml of 70% ethanol was added to the pellet in the tube, followed by centrifugation at 12,000 rpm and 4° C. for 5 min. The ethanol was aspirated, and the RNA pellet in the tube was dried before dissolution in nuclease-free water. The concentration of the RNA sample thus obtained was measured by Nanodrop absorbances at 260 nm and 280 nm and cDNA was synthesized therefrom using AccuPower CycleScript RT PreMix(dT.sub.20) (K-2044, Bioneer, Korea).
[0287] Thereafter, TNF-a, IL-1β, and IL-6 were monitored for mRNA expression levels by real-time PCR using the synthesized cDNA and the primers of Table 11, and the results are given in
TABLE-US-00015 M0 M1 PBS R11e Expression level of TNF-α 1.0 7.2 2.0
TABLE-US-00016 M0 M1 PBS R11e Expression level of IL-1β 1.0 5.4 1.7
TABLE-US-00017 M0 M1 PBS R11e Expression level of IL-6 1.0 4.3 1.2
[0288] As can be seen in
9-2. Proliferative Effect on Regenerative Macrophage
[0289] The human monocyte cell line THP-1 was seeded into a 35-mm dish containing an RPMI1640 medium supplemented with 1% antibiotics-antimycotics, 10% FBS, and PMA (200 ng/ml) and incubated at 37° C. for 2 days in a 5% CO.sub.2 incubator. After 48 hours of incubation, the cells were observed to adhere to the dish. Subsequently, the cells were induced to differentiate into regenerative macrophages. In this regard, the medium was aspirated and the cells were washed with DPBS and then incubated at 37° C. for an additional 3 days in an RPMI1640 medium supplemented with recombinant human interleukin-4 (IL-4, 20 ng/ml, Peprotech, USA), recombinant human interleukin-13 (IL-13, 20 ng/ml, Prospec, Israel), 1% antibiotics-antimycotics, and 10% FBS in a 5% CO.sub.2 incubator. After 72 hours, the medium was removed and the cells were washed DPBS and incubated at 37° C. for 24 hours in an RPMI1640 medium supplemented with 1% antibiotics-antimycotics and 50 .Math.g/ml BxC-R11 e exosomes in a 5% CO.sub.2 incubator so as to examine an effect of the exosomes on the regenerative macrophages. Then, 1 ml of TRIZol reagent (Invitrogen, USA) was added to the 35-mm dish to lyse the cells. The cell lysate was added with 200 .Math.l of chloroform (Sigma, USA), briefly vortexed, and centrifuged at 4° C. and 12,000 rpm for 15 min. The supernatant thus formed was transferred into a new tube and mixed with 500 .Math.l of isopropanol (Merck Millipore, USA). The tube was turned upside down 50 times, left on ice for 5 min, and centrifuged at 12,000 rpm and 4° C. for 10 min. The supernatant was removed, and 1 ml of 70% ethanol was added to the pellet, followed by centrifugation at 12,000 rpm and 4° C. for 5 min. The ethanol was aspirated, and the RNA pellet in the tube was dried before dissolution in nuclease-free water. The concentration of the RNA sample thus obtained was measured by Nanodrop absorbances at 260 nm and 280 nm and cDNA was synthesized therefrom using AccuPower CycleScript RT PreMix(dT.sub.2o) (K-2044, Bioneer, Korea).
[0290] Thereafter, CD206, ARG-1, and IL-10 were monitored for mRNA expression levels by real-time PCR using the synthesized cDNA and the primers of Table 18.
TABLE-US-00018 SEQ ID NO: Name Sequencing List (5′-> 3′) Note 7 CD206_primer1 CACGATCCGACCCTTCCTTG CD206 forward primer 8 CD206_primer2 GCTTGCAGTATGTCTCCGCT CD206 reverse primer 9 ARG-1_primer1 CGGAGACCACAGTTTGGCA ARG-1 forward primer 10 ARG-1_primer2 CCTGGCACATCGGGAATCTT ARG-1 reverse primer 11 IL-10_primer1 TGAAAACAAGAGCAAGGCCG IL-10 forward primer 12 IL-10_primer2 GCCACCCTGATGTCTCAGTT IL-10 reverse primer
[0291] As can be seen in
TABLE-US-00019 M0 M2 PBS R11e Expression level of CD206 1.0 76 60
TABLE-US-00020 M0 M2 PBS R11e Expression level of ARG-1 1.0 58 41
TABLE-US-00021 M0 M2 PBS R11e Expression level of IL-10 1.0 9.3 6.5
[0292] The data obtained from the above experiments indicate that the BxC-R11 e exosomes according to the present disclosure maintain the levels of cytokine expressed from regenerative macrophages.
Experimental Example 10: Inhibitory Effect of BxC-R11e Exosome on Fibrosis of Fibroblast
10-1. Measurement of Expression Level by Real-Time PCR
[0293] The mouse embryonic fibroblast cell line CF-1 (ATCC, USA) was seeded into 6-well plates containing a high-glucose DMEM medium (Gibco, USA) supplemented with 1% antibiotics-antimycotics and 10% FBS and incubated at 37° C. for 1 day in a 5% CO.sub.2 incubator. The medium was changed with a high-glucose DMEM medium (Gibco, USA) supplemented with 20 ng/ml transforming growth factor-β1 human (TGF-β1, Sigma) and 1% antibiotics-antimycotics, followed by incubation at 37° C. for 2 days in a 5% CO.sub.2 incubator to induce fibrosis.
[0294] Then, the cells were washed with DPBS and incubated at 37° C. for 1 day in a medium containing 100 .Math.g/ml BxC-e or BxC-R11e exosomes in a 5% CO.sub.2 incubator so as to examine the inhibitory effect of the exosomes on fibrosis.
[0295] After completion of the culturing, 1 ml of TRIZol reagent (Invitrogen, USA) was added to the 35-mm dish to lyse the cells. The cell lysate was added with 200 .Math.l of chloroform (Sigma, USA), briefly vortexed, and centrifuged at 4° C. and 12,000 rpm for 15 min. The supernatant thus formed was transferred into a new tube and mixed with 500 .Math.l of isopropanol (Merck Millipore, USA). The tube was turned upside down 50 times, left on ice for 5 min, and centrifuged at 12,000 rpm and 4° C. for 10 min. The supernatant was removed, and 1 ml of 70% ethanol was added to the pellet, followed by centrifugation at 12,000 rpm and 4° C. for 5 min. The ethanol was aspirated, and the RNA pellet in the tube was dried before dissolution in nuclease-free water. The concentration of the RNA sample thus obtained was measured by Nanodrop absorbances at 260 nm and 280 nm and cDNA was synthesized therefrom using AccuPower CycleScript RT PreMix(dT.sub.2o) (K-2044, Bioneer, Korea).
[0296] Thereafter, a-SMA (Acta2) and CTGF were monitored for mRNA expression levels by real-time PCR using the synthesized cDNA and the primers of Table 22, and the results are given in
TABLE-US-00022 SEQ ID NO: Name Sequencing List (5′-> 3′) Note 13 α-SMA _primer1 CCCAGACATCAGGGAGTAATGG α-SMA forward primer 14 α-SMA _primer2 TCTATCGGATACTTCAGCGTCA α-SMA reverse primer 15 CTGF_primer1 CTTCTGCGATTTCGGCTCC CTGF forward primer 16 CTGF_primer2 TACACCGACCCACCGAAGA CTGF reverse primer
TABLE-US-00023 Ctrl TGF-β PBS e R11e Expression level of α-SMA 1.0 1.8 1.0 1.0
TABLE-US-00024 Ctrl TGF-β PBS e R11e Expression level of CTGF 1.0 1.6 1.3 1.3
[0297] As can be seen in
10-2. Measurement of Expression Level by SDS-PAGE
[0298] The mouse embryonic fibroblast cell line CF-1 (ATCC, USA) was seeded into 6-well plates containing a high-glucose DMEM medium (Gibco, USA) supplemented with 1% antibiotics-antimycotics and 10% FBS and incubated at 37° C. for 1 day in a 5% CO.sub.2 incubator. The medium was changed with a high-glucose DMEM medium (Gibco, USA) supplemented with 20 ng/ml transforming growth factor-β1 human (TGF-β1, Sigma) and 1% antibiotics-antimycotics, followed by incubation at 37° C. for 2 days in a 5% CO.sub.2 incubator to induce fibrosis.
[0299] Then, the cells were washed with DPBS and incubated at 37° C. for 1 day in a medium containing 100 .Math.g/ml BxC-e or BxC-R11 e exosomes in a 5% CO.sub.2 incubator so as to examine the inhibitory effect of the exosomes on fibrosis.
[0300] After completion of the culturing, the culture medium was aspirated and the cells were washed with DPBS, added with 0.5 ml of TryPLE(Gibco) per well in the 6-well plates, and left at 37° C. for 3 min in a 5% CO.sub.2 incubator. When the cells floated, the cell suspension was collected in a tube containing a culture medium added with FBS, and centrifuged at 5000 rpm for 3 min. The supernatant thus formed was decanted and the cell pellet was lysed with 50 .Math.l of a NP40 cell lysis buffer (FNN0021, Invitrogen) for 30 min on ice, followed by centrifugation at 4° C. and 12000 rpm for 10 min. The supernatant was collected in a new tube. After quantitation, the supernatant was diluted with a sample buffer and boiled at 100° C. for 10 min. The resulting sample was subjected to SDS-PAGE and transferred onto a membrane. Antibodies to a-SMA and CTGF were added in an amount of 1/1000 of the buffer and reacted at 4° C. for 16 hours. The membrane was washed with a TBST buffer and reacted at room temperature for 1 hour with a secondary antibody added in an amount of 1/2000 of the buffer. Then, the membrane was washed with a TBST buffer, followed by reaction with an ECL solution. Expression levels were measured using ChemiDoc and quantitated using the Multigauge program. The data are depicted in
TABLE-US-00025 Ctrl TGF-β PBS e R11e Expression level of a-SMA 1.0 1.3 1.2 0.8
TABLE-US-00026 Ctrl TGF-3 PBS e R11e Expression level of CTGF 1.0 2.3 2.0 1.6
[0301] Consistent with the data of the real-time PCR, as can be seen in
Experimental Example 11: Promotive Effect of BxC-e and BxC-R11e Exosomes on Cardiomyocytic Function
[0302] The iPSC-derive cardiomyocytes that had completely undergone differentiation were seeded into 6-well plates containing a RPMI1640 medium without vitamin A supplement and incubated at 37° C. for 1 day in a 5% CO.sub.2 incubator. Then, the cells were washed with DPBS and incubated at 37° C. for 1 day in a medium containing 100 .Math.g/ml BxC-e or BxC-R11 e exosomes in a 5% CO.sub.2 incubator so as to examine the promotive effect of the exosomes on cardiomyocytic functions.
[0303] After completion of the culturing, 1 ml of TRIZol reagent (Invitrogen, USA) was added to the 35-mm dish to lyse the cells. The cell lysate was added with 200 .Math.l of chloroform (Sigma, USA), briefly vortexed, and centrifuged at 4° C. and 12,000 rpm for 15 min. The supernatant thus formed was transferred into a new tube and mixed with 500 .Math.l of isopropanol (Merck Millipore, USA). The tube was turned upside down 50 times, left on ice for 5 min, and centrifuged at 12,000 rpm and 4° C. for 10 min. The supernatant was removed, and 1 ml of 70% ethanol was added to the pellet, followed by centrifugation at 12,000 rpm and 4° C. for 5 min. The ethanol was aspirated, and the RNA pellet in the tube was dried before dissolution in nuclease-free water. The concentration of the RNA sample thus obtained was measured by Nanodrop absorbances at 260 nm and 280 nm and cDNA was synthesized therefrom using AccuPower CycleScript RT PreMix(dT.sub.2o) (K-2044, Bioneer, Korea).
[0304] Thereafter, cTNT, hERG, Nav1.7, and MYH7 were monitored for mRNA expression levels by real-time PCR using the synthesized cDNA and the primers of Table 27, and the results are given in
TABLE-US-00027 SEQ ID NO: Name Sequencing List (5′-> 3′) Note 17 cTNT_primer1 AGTGGGAAGAGGCAGACTGA cTNT forward primer 18 cTNT_primer2 CGAACTTCTCTGCCTCCAAG cTNT reverse primer 19 hERG_primer1 CAACCTGGGCGACCAGATAG hERG forward primer 20 hERG_primer2 GGTGTTGGGAGAGACGTTGC hERG reverse primer 21 Nav1.7_primer1 GGTTTCAGCACAGATTCAGGTC Nav1.7 forward primer 22 Nav1.7_primer2 CCAGCTGAAAGTGTCAAAGCTC Nav1.7 reverse primer 23 MYH7_primer1 CTTTGCTGTTATTGCAGCCATT MYH7 forward primer 24 MYH7_primer2 AGATGCCAACTTTCCTGTTGC MYH7 reverse primer
TABLE-US-00028 Ctrl BxC-e BxC-R11 e Relative expression level of cTnT 1.0 6.67 8.65
TABLE-US-00029 Ctrl BxC-e BxC-R11 e Relative expression level of hERG 1.0 1.4 2.89
TABLE-US-00030 Ctrl BxC-e BxC-R11e Relative expression level of Nav 1.7 1.0 2.74 5.89
TABLE-US-00031 Ctrl BxC- BxC-R11e Relative expression level of MYH7 1.0 2.76 3.03
[0305] As can be seen in
INDUSTRIAL APPLICABILITY
[0306] The present disclosure relates to a composition including stem cell-derived exosomes and a method for producing same and, more specifically, to a composition that includes exosomes isolated from mesenchymal stem cells or a culture thereof and is superb in terms of anti-inflammatory activity, fibrosis inhibition, vascular endothelial cell proliferation, blood vessel formation, viability improvement, and protective regeneration of cardiomyocytes.