MODIFIED MICROORGANISMS AND METHODS FOR PRODUCTION OF USEFUL PRODUCTS
20170356016 · 2017-12-14
Inventors
- Michelle GRADLEY (Welwyn Garden City, Hertfordshire, GB)
- Alex PUDNEY (Welwyn Garden City, Hertfordshire, GB)
- Dana HELDT (Welwyn Garden City, Hertfordshire, GB)
Cpc classification
C12Y401/02004
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
Y02P20/582
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
Non-naturally occurring microbial organisms and related methods, processes and materials are for microbial organisms that include a genetic modification which enhances production of 3-hydroxybutanal or a downstream product of 3-hydroxybutanal such as 1,3-butanediol from endogenous central metabolic intermediates such as acetyl CoA or pyruvate which are converted to acetaldehyde. Two molecules of acetaldehyde are condensed to form the 3-hydroxybutanal using an aldolase capable of accepting acetaldehyde as both the acceptor and donor in an aldol condensation. The aldolase may be a deoxyribose phosphate aldolase type enzyme, and is typically introduced into the organisms. Energetically favorable pathways produce 3-hydroxybutanal or downstream products thereof.
Claims
1. A non-naturally occurring microbial organism which includes a genetic modification in its genome which enhances production of 3-hydroxybutanal or a downstream product of 3-hydroxybutanal by the microbial organism from at least one endogenous central metabolic intermediate via a 3-hydroxybutanal synthetic pathway in which two molecules of acetaldehyde are condensed to form said 3-hydroxybutanal using an aldolase capable of accepting acetaldehyde as both the acceptor and donor in an aldol condensation.
2. (canceled)
3. A non-naturally occurring microbial organism as claimed in claim 1 wherein the genetic modification: (i) introduces a heterologous gene encoding an enzyme having an activity utilised in generation of acetaldehyde from one or more of the central metabolic intermediates; (ii) up-regulates at least one endogenous enzyme having an activity utilised in generation of acetaldehyde from one or more of the central metabolic intermediates; and/or (iii) down-regulates or inactivates an endogenous enzyme which utilises acetaldehyde as a substrate, thereby increasing production or availability to the aldolase of the acetaldehyde, thereby increasing production of the 3-hydroxybutanal from the aldolase, and/or wherein the genetic modification is either: (i) the introduction of at least one heterologous gene encoding the aldolase, or (ii) the up-regulation of at least one endogenous gene encoding the aldolase, optionally wherein the heterologous gene encodes the aldolase as a fusion protein encoding also one or more other enzymes involved in the 3-hydroxybutanal pathway.
4. A microbial organism as claimed in claim 1 wherein the genetic modification confers on the microorganism the capability to produce an increased amount of 3-hydroxybutanal or a downstream product of 3-hydroxybutanal, wherein the downstream product is obtained directly or indirectly from reduction, oxidation and\or acylation with Coenzyme A of 3-hydroxybutanal, wherein the downstream product is: (i) selected from 1,3-BDO; 2-hydroxisobutyrate, Crotyl alcohol, Crotonic acid, Butanol, Butyrate, 3-hydroxybutyrate, 3-hydroxybutylamine, Polyhydroxybutyrate, Acetone, Isopropanol, 2-methylsuccinic acid, and\or (ii) is obtained via an intermediate selected from: 3-hydroxybutyryl CoA, 2-hydroxyisobutyryl CoA, Crotonyl CoA, Crotonaldehyde, Butyryl CoA, Butanal, Acetoacetyl CoA, and acetoacetate.
5. (canceled)
6. A microbial organism as claimed in claim 1 wherein the microorganism lacks the ability to produce the downstream product in the absence of said modification.
7-8. (canceled)
9. A microbial organism as claimed in claim 3 wherein said one or more other enzymes of the aldolase fusion protein provide an activity enhancing the provision of the aldolase substrate acetaldehyde or provide an activity converting the 3-hydroxybutanal to the downstream product.
10-11. (canceled)
12. A microbial organism as claimed in claim 3 wherein the aldolase is deoxyribose phosphate aldolase (DERA).
13. (canceled)
14. A microbial organism as claimed in claim 1 wherein the downstream product is 1,3-BDO and the genetic modification causes down-regulation or inactivation of an endogenous alcohol dehydrogenase with a preference for reduction of acetaldehyde to ethanol relative to reduction of 3-hydroxybutanal to 1,3-BDO.
15. A microbial organism as claimed in claim 1 wherein the central metabolic intermediate is selected from one or both of: acetyl CoA or pyruvate.
16-17. (canceled)
18. A microbial organism as claimed in claim 1 wherein the genetic modification comprises the introduction of a heterologous gene encoding one or more of the following 3-hydroxybutanal pathway enzymes: (i) an enzyme having an activity utilised in generation of the central metabolic intermediates from feedstock; (ii) an enzyme having an activity utilised in generation of acetaldehyde from the central metabolic intermediates; (iii) an enzyme having an activity utilised in generation of the downstream product of 3-hydroxy butanal.
19. A microbial organism as claimed in claim 1 wherein acetyl CoA and pyruvate are generated in the organism by one or more of the following metabolic pathways encoded in the organism genome: the Wood-Ljungdahl pathway; the ribulose monophosphate (RuMP) pathway; the reverse TCA cycle; the serine cycle; glycolysis; the pentose phosphate pathway, the Calvin cycle, the 3-hydroxypropionate cycle; the dicarboxylate cycle/4-hydroxybutyrate cycle.
20. (canceled)
21. A microbial organism as claimed in claim 19 which is an acetogen, which has the Wood-Ljungdahl pathway naturally encoded in its genome, wherein the genetic modification confers the ability to produce 3-hydroxybutanal or the downstream product thereof or the ability to produce an increased flux of 3-hydroxybutanal or the downstream product thereof from a feedstock selected from: syngas, CO.sub.2, CO, and H.sub.2, methanol, sugar or combinations thereof, optionally wherein the genetic modification causes down-regulation or inactivation of an endogenous enzyme converting acetyl CoA to acetate, such as phosphotransacetylase or an endogenous acetate kinase.
22. A microbial organism as claimed in claim 19 which encodes in its genome one or more methyltransferase enzymes utilised in generation of the central metabolic intermediates from methanol feedstock, wherein said methyltransferase enzyme or enzymes are optionally heterologous to the microbial organism, wherein the methyltransferase enzyme or enzymes are selected from the list consisting of: methanol methyltransferase (MtaB); Corrinoid protein (MtaC); Methyltetrahydrofolate: corrinoid protein methyltransferase (MtaA); Methyltetrahydrofolate:corrinoid protein methyltransferase (AcsE); Corrinoid iron-sulfur protein (AcsD).
23.-28. (canceled)
29. A microbial organism as claimed in claim 1 wherein the genetic modification comprises the introduction of a heterologous gene or up-regulates at least one endogenous gene which encodes an enzyme activity which confers the ability to produce 3-hydroxybutanal or a downstream product thereof or the ability to produce an increased flux of 3-hydroxybutanal or a downstream product thereof from acetate, or the central metabolic intermediates acetyl CoA or pyruvate such that the 3-hydroxybutanal or a downstream product thereof accumulates and can be recovered or further converted enzymatically or chemically.
30. (canceled)
31. A microbial organism as claimed in claim 29 wherein the enzyme activity is used in the generation of acetyl CoA from acetate and is an acetyl CoA synthetase or a CoA transferase optionally selected from EC 6.2.1.1 or EC 2.8.3.8.
32. (canceled)
33. A microbial organism as claimed in claim 29 wherein the enzyme activity is a carboxylic acid reductase activity, optionally wherein the carboxylic acid reductase activity is selected from an enzyme of Table 1 or a variant of an enzyme of Table 1 capable of the reduction of acetate to acetaldehyde.
34.-35. (canceled)
36. A microbial organism as claimed in claim 29 wherein the enzyme activity is utilised in generation of acetaldehyde from acetyl CoA, optionally wherein the enzyme activity is an aldehyde dehydrogenase, optionally an acetaldehyde dehydrogenase.
37.-41. (canceled)
42. A microbial organism as claimed in claim 29 wherein the enzyme activity is utilised in generation of acetaldehyde from pyruvate, optionally wherein the enzyme activity is a pyruvate decarboxylase.
43.-46. (canceled)
47. A microbial organism as claimed in claim 42 wherein the genetic modification causes down-regulation or inactivation of an endogenous enzyme capable of converting pyruvate to lactate or other products.
48. A microbial organism as claimed in claim 29 wherein the endogenous enzyme capable of converting pyruvate to lactate or other products is an LDH or malate dehydrogenase or pyruvate formate lyase, optionally selected from 1.1.1.27 or 1.1.1.37 or 2.3.1.54.
49. A microbial organism as claimed in claim 47 wherein the genetic modification comprises the introduction of a heterologous gene or up-regulates at least one endogenous gene which encodes an enzyme activity which confers the ability to convert 3-hydroxybutanal to 1,3-BDO, optionally wherein the enzyme has alcohol dehydrogenase activity or has aldehyde reductase activity optionally classified as EC 1.1.1.-.
50.-52. (canceled)
53. A process method for producing 3-hydroxybutanal or a downstream product thereof, which process comprises culturing a microbial organism as claimed in claim 1 for a sufficient period of time to produce said 3-hydroxybutanal or the downstream product thereof.
54.-59. (canceled)
60. A process for producing a microbial organism according to claim 1, which comprises introducing said genetic modification into a parent strain.
61.-65. (canceled)
Description
FIGURES
[0204]
[0205]
[0206]
[0207] Route 1 proceeds from acetyl CoA through acetate (a natural product of acetogenic microorganisms) to acetaldehyde via carboxylic acid reductase activity, for example, EC 1.2.7.5 or EC. 1.2.99.6, ATP or ferredoxin driven or EC 1.2.1.30 or EC 1.2.1.3.
[0208] Route 2 involves direct synthesis of acetaldehyde from acetyl CoA using an aldehyde dehydrogenase (acylating), for example, acetaldehyde dehydrogenase EC 1.2.1.10.
[0209] Route 3 involves the conversion of pyruvate to acetaldehyde via acetyl CoA using enzymes such as EC 1.2.7.1 or EC 1.2.1.51 or EC 1.2.4.1 and EC 1.2.1.10.
[0210] Route 4 involves the conversion of pyruvate to acetaldehyde, directly via pyruvate decarboxylase (EC 4.1.1.1).
[0211] Route 5 involves the conversion of acetyl CoA to acetaldehyde via pyruvate using enzymes such as EC 1.2.7.1 and EC 4.1.1.1.
[0212] Route 6 involves the conversion of acetate to acetaldehyde via acetyl CoA using enzymes such as EC 6.2.1.1 or EC 2.8.3.8 and EC 1.2.1.10.
[0213] Two molecules of acetaldehyde are condensed to form 3-hydroxybutanal using an aldolase capable of accepting an aldehyde as both the acceptor and donor in an aldol condensation, for example, deoxyribose phosphate aldolase (DERA, EC 4.1.2.4). 3-Hydroxybutanal is reduced to 1,3-butanediol by an alcohol dehydrogenase or aldehyde reductase, for example, using enzymes categorised in EC 1.1.1.1, EC 1.1.1.2, EC 1.1.1.72 or EC 1.1.1.265 or EC 1.1.1.283.
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
Key.
[0221] A1: Colony 1 of A woodii carrying plasmid pEP55
A2: Colony 2 of A woodii carrying plasmid pEP55
B1: Colony 1 of A woodii carrying plasmid pEP56
B2: Colony 2 of A woodii carrying plasmid pEP56
C: Negative Control, A. woodii carrying the pEP plasmid expressing an unrelated gene
[0222]
[0223]
[0224]
[0225]
Aw=A. woodii wild type, P=A. woodii transformant harboring plasmid pUC19-Ery-pAMβ1, dLDH=double cross-over LDH knockout. SR=Single cross-over LDH knockout.
[0226]
Aw=A. woodii wild type, P=A. woodii transformant harboring plasmid pUC19-Ery-pAMβ1, dLDH=double cross-over LDH knockout. SR=Single cross-over LDH knockout.
[0227]
[0228]
EXAMPLES
[0229] Methods and Materials—Cloning, Expression and Activity Assay for Gene(s) for Engineering into Acetogens to Produce 1,3-Butanediol
[0230] The approach to construction of the 1,3-butanediol pathway in a chosen host will depend on the pathway genes already present in the host organism. Those endogenous genes considered suitable for pathway construction may be overexpressed to ensure adequate flux through the pathway to 1,3-butanediol.
[0231] Metabolic engineering steps required to generate a 1,3-butanediol production strain will depend on whether pyruvate or acetyl CoA or both are selected as the source of acetaldehyde. Subsequent conversion of acetaldehyde is common to all routes. For example, for Route 1, acetaldehyde is derived from acetyl CoA via acetate. Acetate is a natural acetogen product which can accumulate to 10 s grams per litre. For example 44 g/l was obtained from the acetogen Acetobacterium woodii growing on CO.sub.2 and H.sub.2 (Demlar, M. et al. Biotech. Bioeng. 2011, 108, 470). Overexpression of a carboxylic acid reductase, aldehyde ferredoxin oxidoreductase or other enzyme capable of acetate reduction (exemplary sequences given in Table 1) to acetaldehyde in the presence of sufficient reducing equivalents and ATP (if appropriate), allows conversion to acetaldehyde. Other than production of biomass for the fermentation, in this example it is desirable to optimise all carbon flux to acetate or acetyl CoA. Accumulation of by-products which are not required for biosynthesis, such as lactate is avoided by knockout of the respective genes e.g. lactate dehydrogenase (Example 5) overproduction of metabolites required for cell synthesis such as malate or fumarate is avoided by adequate, balanced, carbon flux to avoid bottle necks.
[0232] Direct conversion of acetyl CoA to acetaldehyde using acetaldehyde dehydrogenase (overexpression of an endogenous enzyme, or introduction of, for example eutE, Table 2) can operate in the absence of acetate accumulation (Route 2) or alongside acetate accumulation where flux is directed to acetaldehyde directly or via acetate. The route chosen may be influenced by the energetics requirement of organism which can be related to the feedstock provided. It is most preferable to convert a primary central metabolic intermediate to acetaldehyde directly. If the bioenergetics allow loss of ATP synthesis from acetyl CoA conversion to acetate, acetate accumulation can be prevented in an acetogen by knockout of one or more phosphotransacetylase (pta) or acetate kinase (ack) genes (Example 6 and 8). Furthermore, acetate accumulation may be prevented by natural regulation, or by mutation which directs flux away from acetate synthesis while maintaining Wood Ljungdahl pathway activity. For example growth of the acetogen Moorella thermoacetica (renamed from C. thermoaceticum) on CO and methanol in the presence of nitrate led to no acetate accumulation due to repression of key Wood Ljungdahl related gene expression (Seifritz, C. et al. J. Bacteriol. 1993, 175, 8008). In that example, sufficient ATP appeared to be provided from nitrate respiration. Acetyl CoA can also be converted to acetaldehyde via pyruvate (Route 5) using pyruvate synthase (EC 1.2.7.1, Table 3). In this example it is particularly desirable to avoid loss of carbon flux to products derived from pyruvate other than acetaldehyde (for example targeting of LDH may be desired), Example 5).
[0233] If pyruvate is the primary central metabolic intermediate, it is preferable to convert pyruvate to acetaldehyde directly (Route 4) via decarboxylation using example sequences in Table 4 and to optimise the flux by targeting of undesired pathways (for example LDH or pyruvate formate lyase). However, it may alternatively be preferred to allow conversion of pyruvate to acetyl CoA, Route 3 (the natural metabolic route prior to entry to the TCA cycle) or by using gene sequence examples shown in Table 3. It is desirable that the maximum amount of acetaldehyde be converted to 3-hydroxybutanal via an overexpressed endogenous or heterologous DERA (example sequences are shown in Table 6). Hence, loss to oxidation or reduction products (acetate or ethanol) should be avoided by knockout of undesired genes, for example, short chain alcohol dehydrogenases highly active on acetaldehyde, or non-acetylating acetaldehyde dehydrogenase (e.g. EC 1.2.1.5). Reduction of 3-hydroxybutanal is achieved by overexpression of an endogenous, or introduction of a heterologous alcohol dehydrogenase or aldehyde reductase which shows preference for C4 aldehydes (3-hydroxybutanal) relative to C2 aldehydes (acetaldehyde) e.g Example 9. Such examples are discussed above and example sequences shown in Table 7.
[0234] The introduction of a heterologous gene into an acetogen is described in Example 7, this method can be cross applied to the introduction of any heterologous gene, for example, a gene within a 1,3-butanediol pathway.
Example 1—Routes for Acetaldehyde and 1,3-BDO Synthesis from Central Metabolites
[0235] The overall conversion of acetyl CoA to 1,3-butanediol is accomplished in either 3 or 5 steps depending on the route taken (
[0236] The overall conversion of pyruvate to 1,3-butanediol is accomplished in 3 or 4 steps depending on the route taken (
[0237] The two steps from acetaldehyde to 1,3-butanediol are common to all 1,3,-butanediol synthetic routes.
[0238] The description of the pathways is provided as routes for acetaldehyde synthesis (Route 1,2, 3, 4, 5 and 6) and the subsequent conversion of acetaldehyde to 1,3-butanediol via the aldol condensation catalysed by DERA.
Route 1—Conversion of Acetyl CoA to Acetaldehyde Via Acetate
[0239] Acetogens naturally produce acetate in high yield from sugars, or C1 feedstocks (syngas, CO.sub.2/H.sub.2, CO.sub.2 and methanol) via conversion of acetyl CoA derived from the Wood Ljungdahl pathway. Yields are typically approximately 80% of theoretical or greater, for example, A. E. Bainotti et al., 1988. Journal of fermentation and bioengineering, 85(2), 223-229. Although it is anticipated that even higher yields may be achievable, for example, via modification of the Wood Ljungdahl pathway which converts CO.sub.2, H.sub.2, CO, or methanol to acetyl CoA or via optimisation of the growth medium. Fundamentally, in acetogens the general fate of acetyl CoA is either to go towards formation or maintenance of biomass, or synthesis of acetate which generates ATP. As the Wood Ljungdahl pathway requires an ATP, in most cases (depending on the growth conditions), acetate synthesis is required in order to balance the energy needs of the system. Acetate is a major natural product of most acetogens.
[0240] Acetate can be reduced to acetaldehyde using a carboxylic acid reductase enzyme. Such enzyme activity mainly uses either reduced ferredoxin (aldehyde ferredoxin oxidoreductase) or ATP to drive the thermodynamically unfavourable reduction of a carboxylic acid moiety and tend to be classified in EC 1.2.7.5, EC 1.2.1.30, EC 1.2.99.6. or EC 1.2.1.3. The term carboxylic acid reductase and aldehyde oxidoreductase are used interchangeably in the literature. Aldehyde dehydrogenase is also used to describe enzymes capable of carboxylic acid reduction.
[0241] An example of a well-studied carboxylic acid reductase can be found in Nocardia iowensis which catalyzes the magnesium, ATP and NADPH-dependent reduction of carboxylic acids to their corresponding aldehydes (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). This enzyme is encoded by the car gene and was cloned and functionally expressed in E. coli (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). Expression of the npt gene product improved activity of the enzyme via post-translational modification. The npt gene encodes a specific phosphopantetheine transferase (PPTase) that converts the inactive apo-enzyme to the active holo-enzyme. The natural substrate of this enzyme is vanillic acid, and the enzyme exhibits broad acceptance of aromatic and aliphatic substrates as small as lactic acid (Venkitasubramanian et al., in Biocatalysis in the Pharmaceutical and Biotechnology Industries, ed. R. N. Patel, Chapter 15, pp. 425-440, CRC Press LLC, Boca Raton, Fla. (2006)). Activity towards acetate was not discussed. However, high activity towards lactate suggests that the enzyme is capable of accepting molecules containing as few as three carbons. Hence, this enzyme may potentially be used for acetate reduction in either its native form or as an evolved enzyme.
[0242] A further well studied enzyme is the example from Mycobacterium marinum which has a wild type substrate preference for C6 to C18 acids (Kalim Akhtar, M. et al. PNAS, 2013, 110, 87). Enzymes capable of carboxylic acid reduction may be evolved or mutated as described above to increase activity towards acetate using enzyme evolution techniques common in the art. The griC and griD genes from Streptomyces also code for a carboxylic acid reductase with diverse capability for acid reduction Suzuki et al. 2007. J. Antibiot. 60 (6) 380.
[0243] Aldehyde ferredoxin oxidoreductase enzymes use ferredoxin not ATP to drive the carboxylate reduction and are present in many acetogens and other organisms (White, H et al. Biol. Chem Hoppe Seler 1991, 372 (11) 999; White, H and Simon, H. Arch. Microbiol, 1992, 158, 81; Fraisse. L and Simon, H. Arch. Microbiol. 1988, 150, 381; (Basen et. al. 2014. PNAS, 111 (49), 17618). The carboxylic acid reducing enzyme from Moorella thermoacetica has been purified and characterised, White, H. et al. Eur. J Biochem, 1989, 184, 89. Further, using propionate reduction to propionaldehyde, the specific activity was shown to increase when the corresponding aldehyde was removed during the reaction. In the case of application of such an enzyme to this invention, the product acetaldehyde would be continuously removed by the DERA enzyme and would not be expected to accumulate significantly. Huber, C. et al. Arch. Microbiol, 1995, 64, 110.
[0244] Example genes for acetate reduction are shown in Table 1. The aldehyde oxidoreductase (AOR) genes CLJU_20110 and CLJU_20210 from Clostridium ljungdahlii are reported to reduce acetate to acetaldehyde, Kopke, M. et al. PNAS, 2010, 107, 15305. Hence, demonstrating the activity of a wild type enzyme towards the target reduction. Various authors have also described conditions under which AOR enzymes are induced in ethanologenic acetogens for synthesis of ethanol from acetate via acetaldehyde, (Mock et al. 2015, Energy conservation associated with ethanol formation from H.sub.2 and CO.sub.2 in Clostridium autoethanogenum involving electron bifurcation, J. Bacteriol. 197 (18) 2965; Nalakath, H. et al. 2015, Bioresource Technology 186, 122.). As described above, in organisms of the invention, it may be desired to target or knockout alcohol dehydrogenases responsible for ethanol production from the intermediate acetaldehyde to thereby promote synthesis of 3-hydroxybutanal from acetaldehyde catalysed by a DERA enzyme.
[0245] A further source of aldehyde ferredoxin oxidoreductase are the hyperthermophiles, Thermococcus sp. (Kesen, J. H. J. Bacteriol. 1995, 177, 4757 and Pyrococcus sp. (Basen et. al. 2014. PNAS, 111 (49), 17618 where this enzyme has been used to effectively synthesise ethanol from acetate via acetataldehyde driven by carbon monoxide. Although described mainly for oxidation of aldehydes to the corresponding acids, reduction of acetate is also mentioned. The Km values for acids appear higher than for the aldehydes, standard enzyme evolution techniques known in the art could be used to improve the enzyme's efficiency for acetate reduction. The use of aldehyde ferredoxin oxidoreductase in the aldehyde oxidation direction is further described by Kletzin, A., et al. J. Bacteriol. 1995, 177, 4817.
[0246] An aldehyde dehydrogenase (aldH) from E. coli has been shown to reduce 3-hydroxypropionic acid to the corresponding aldehyde as well as the preferred oxidation of 3-hydroxpropionaldehyde, Ji-Eun, J. et al., Appl. Microbiol. Biotechnol 2008. 81, 51. This enzyme was also shown to oxidise acetaldehyde to acetate. Hence, as these authors have shown the enzyme to be reversible, activity towards reduction of acetate would be expected.
TABLE-US-00001 TABLE 1 Examples of genes expressing enzymes for application to the reduction of acetate to acetaldehyde (Activity A). UniProt NCBI EC Gene Entry Gene ID number names Protein names Organism P23883 12934534 1.2.1.5 puuC Aldehyde Escherichia 947003 aldH dehydrogenase PuuC coli (strain b1300 (EC 1.2.1.5) (3- K12) JW1293 hydroxypropionaldehyde dehydrogenase) (Gamma-glutamyl- gamma- aminobutyraldehyde dehydrogenase) (Gamma-Glu-gamma- aminobutyraldehyde dehydrogenase) D8GIZ8 9445627 CLJU_c20110 Predicted tungsten- Clostridium containing aldehyde ljungdahlii ferredoxin (strain ATCC oxidoreductase 55383/DSM 13528/ PETC) D8GJ08 9445637 CLJU_c20210 Predicted tungsten- Clostridium containing aldehyde ljungdahlii ferredoxin (strain ATCC oxidoreductase 55383/DSM 13528/ PETC) Q2RG52 3831332 1.2.7.5 Moth_2300 Aldehyde ferredoxin Moorella oxidoreductase (EC thermoacetica 1.2.7.5) (strain ATCC 39073) Q2RKJ9 3830998 1.2.7.5 Moth_0722 Aldehyde ferredoxin Moorella oxidoreductase (EC thermoacetica 1.2.7.5) (strain ATCC 39073) Q2RM47 3831866 1.2.7.5 Moth_0154 Aldehyde ferredoxin Moorella oxidoreductase (EC thermoacetica 1.2.7.5) (strain ATCC 39073) C9QU34 12705570; 1.2.7.5 ydhV Aldehyde ferredoxin Escherichia 12873031 EcDH1_1969 oxidoreductase (EC coli (strain ECDH1 1.2.7.5) (Putative ATCC 33849/ ME8569_1617 oxidoreductase) DSM 4235/ NCIB 12045/ K12/DH1) E8Y7H0 11776942; 1.2.7.5 ydhV Aldehyde ferredoxin Escherichia 12763367 EKO11_2102 oxidoreductase (EC coli (strain KO11_14380 1.2.7.5) (Putative ATCC 55124/ oxidoreductase) KO11) B1IQ83 6068384; 1.2.7.5 EcolC_1958 Aldehyde ferredoxin Escherichia oxidoreductase (EC coli (strain 1.2.7.5) ATCC 8739/ DSM 1576/ Crooks) E0IXM3 12695599; 1.2.7.5 ydhV Aldehyde ferredoxin Escherichia 12753870 ECW_m1840 oxidoreductase (EC coli (strain WFL_09015 1.2.7.5) (Predicted ATCC 9637/ EschWD oxidoreductase) CCM 2024/ RAFT_0881 (Putative DSM 1116/ oxidoreductase) NCIMB 8666/ NRRL B-766/ W) C6EA37 8114754; 1.2.7.5 yagT (2Fe—2S)-binding domain Escherichia 8160069; B21_00248 protein (Aldehyde coli (strain B/ 8181416 ECBD_3371 ferredoxin BL21-DE3) ECD_00245 oxidoreductase, Fe—S subunit, subunit of aldehyde ferredoxin oxidoreductase) (EC 1.2.7.5) (Predicted xanthine dehydrogenase, 2Fe—2S subunit) C6EA38 8114753; 1.2.7.5 yagS Aldehyde ferredoxin Escherichia 8160070; B21_00247 oxidoreductase, FAD- coli (strain B/ 8181415 ECBD_3372 binding subunit, subunit BL21-DE3) ECD_00244 of aldehyde ferredoxin oxidoreductase (EC 1.2.7.5) (Molybdopterin dehydrogenase FAD- binding) (Predicted oxidoreductase with FAD-binding domain) C6EA39 8114752; 1.2.7.5 yagR Aldehyde ferredoxin Escherichia 8160071; B21_00246 oxidoreductase: coli (strain B/ 8181414 ECBD_3373 molybdenum cofactor- BL21-DE3) ECD_00243 binding subunit, subunit of aldehyde ferredoxin oxidoreductase (EC 1.2.7.5) (Aldehyde oxidase and xanthine dehydrogenase molybdopterin binding) (Predicted oxidoreductase with molybdenum-binding domain) C6ECT2 8113808; 1.2.7.5 ydhV Aldehyde ferredoxin Escherichia 8157240; B21_01632 oxidoreductase (EC coli (strain B/ 8183188 ECBD_1972 1.2.7.5) (Predicted BL21-DE3) ECD_01642 oxidoreductase) K3JYI2 1.2.7.5 yagR Aldehyde oxidase and Escherichia EC3006_0366 xanthine dehydrogenase coli 3006 (EC 1.2.7.5) A0A024KWW2 1.2.7.5 PGA_03435 Aldehyde ferredoxin Escherichia oxidoreductase (EC coli D6- 1.2.7.5) 113.11 A0A024LHN1 1.2.7.5 PGC_20250 Aldehyde ferredoxin Escherichia oxidoreductase (EC coli D6- 1.2.7.5) 117.29 Q56303 16548761 1.2.7.5 for Tungsten-containing Thermococcus OCC_05029 formaldehyde ferredoxin litoralis oxidoreductase (EC (strain ATCC 1.2.7.5) 51850/DSM 5473/JCM 8560/NS-C) Q6RKB1 1.2.1.—; car Carboxylic acid Nocardia 1.2.1.30 reductase (CAR) (EC iowensis 1.2.1.—) (ATP/NADPH- dependent carboxylic acid reductase) (Aryl aldehyde oxidoreductase) (EC 1.2.1.30) A1YCA5 2.7.8.7 npt 4′-phosphopantetheinyl Nocardia transferase Npt iowensis (PPTase) (EC 2.7.8.7) Q5YY80 3108003 NFA_20150 Putative carboxylic acid Nocardia reductase farcinica (strain IFM 10152) Q5YSD9 3109498 NFA_40540 Putative Nocardia phosphopantetheinyl farcinica transferase (strain IFM 10152) B1VMZ4 6209683 SGR_6790 Putative carboxylic acid Streptomyces reductase griseus subsp. griseus (strain JCM 4626/ NBRC 13350) B1VRS6 6214265 SGR_665 Putative Streptomyces phosphopantetheinyl griseus transferase subsp. griseus (strain JCM 4626/ NBRC 13350) B1VTI3 6210972; griD Arylcarboxylate Streptomyces SGR_4244 reductase component griseus subsp. griseus (strain JCM 4626/ NBRC 13350) B1VTI2 6215140; griC Arylcarboxylate Streptomyces SGR_4243 reductase component griseus subsp. griseus (strain JCM 4626/ NBRC 13350) Q51739 1468181 1.2.7.5 aor, Tungsten-containing Pyrococcus AOR_PYRFU aldehyde ferredoxin furiosus oxidoreductase (strain ATCC 43587/DSM 3638/JCM 8422/Vc1)
[0247] Additional car and npt genes and other genes coding for enzymes capable of (or involved with) carboxylic acid reduction (Activity A) can be identified based on sequence homology to those examples in Table 1.
Route 2—Conversion of Acetyl CoA to Acetaldehyde Directly
[0248] Acetaldehyde can be synthesised from acetyl CoA via the reversible enzyme acetaldehyde dehydrogenase EC 1.2.1.10.
[0249] The gene coding for this enzyme can be found in a wide range of different organisms such as: Acinetobacter sp.; Burkholderia xenovorans; E. coli; Clostridium beijerinckii, (Run-Tao, Y and Jiann-Shin, C. 1990, Appl. Environ. Microbiol. 56, 2591; Appl. Environ Microbiol, 1999, 65 (11) 4973); Clostridium kluyveri; Pseudomonas sp. (Platt, A et al. 1995, Microbiol., 141, 2223; Soonyoung, H. et al. 1999, Biochem. Biophys. Res. Comm. 256, 469) Propionibacterium sp. and Thermoanaerobacter ethanolicus.
[0250] Many acetogens also have annotated acetaldehyde dehydrogenase genes e.g. Moorella thermoacetica (Moth_1776). Acetobacterium woodii (Arch. Microbiol, 1992, 158, 132). Clostridium ljungdahlii CLJU_c11960.
[0251] The eutE gene from the eut operon also encodes for an acetaldehyde dehydrogenase. The eutE gene from Salmonella enterica has been cloned into E. coli and shown to efficiently produce acetaldehyde from growth on glucose via acetyl CoA reduction (Huilin, Z. et al. 2011. Appl. Environ. Microbiol. 77, 6441). This is an excellent demonstration of an enzyme capable of efficiently providing acetaldehyde substrate for a DERA type enzyme catalysed aldol condensation in a 1,3-butanediol pathway from acetyl CoA. 1,3-Butanediol production using eutE to deliver acetaldehyde to DERA from acetyl CoA in a 1,3-BDO pathway, is shown in Example 10.
TABLE-US-00002 TABLE 2 Examples of genes expressing enzymes for the conversion of acetyl CoA to acetaldehyde.(Activity B). UniProt NCBI EC Entry Gene ID number Gene names Protein names Organism H6LJM8 11871155 1.1.1.1; adhE Bifunctional Acetobacterium 1.2.1.10 Awo_c06310 acetaldehyde- woodii (strain CoA/alcohol ATCC 29683/ dehydrogenase DSM 1030/JCM (EC 1.1.1.1) (EC 2381/KCTC 1.2.1.10) 1655) Q79AF6 4010700 1.2.1.10; bphJ Acetaldehyde Burkholderia 1.2.1.87 Bxeno_C1122 dehydrogenase 4 xenovorans Bxe_C1188 (EC 1.2.1.10) (strain LB400) (Acetaldehyde dehydrogenase [acetylating] 4) (Propanal dehydrogenase (CoA- propanoylating)) (EC 1.2.1.87) Q143P8 4004910 1.2.1.10 Bxeno_A0903 Acetaldehyde Burkholderia Bxe_A3547 dehydrogenase 1 xenovorans (EC 1.2.1.10) (strain LB400) (Acetaldehyde dehydrogenase [acetylating] 1) Q13VU2 4002974 1.2.1.10 amnH Acetaldehyde Burkholderia Bxeno_A3259 dehydrogenase 2 xenovorans Bxe_A1151 (EC 1.2.1.10) (strain LB400) (Acetaldehyde dehydrogenase [acetylating] 2) Q13QH7 4007178 1.2.1.10 Bxeno_B0694 Acetaldehyde Burkholderia Bxe_B2326 dehydrogenase 3 xenovorans (EC 1.2.1.10) (strain LB400) (Acetaldehyde dehydrogenase [acetylating] 3) Q716S8 5294993 1.2.1.10 ald Aldehyde Clostridium dehydrogenase beijerinckii (EC 1.2.1.10) (Clostridium MP) (Coenzyme A acylating aldehyde dehydrogenase) (EC 1.2.1.10) (Coenzyme A- acylating aldehyde dehydrogenase) (EC 1.2.1.10) D8GIC3 9444813; 1.2.1.— CLJU_c11960 Predicted Clostridium 9447589 CLJU_c39730 acetaldehyde ljungdahlii (strain dehydrogenase ATCC 55383/ (EC 1.2.1.—) DSM 13528/ PETC) D8GID4 9447600 1.2.1.— CLJU_c39840 Predicted Clostridium acetaldehyde ljungdahlii (strain dehydrogenase ATCC 55383/ (EC 1.2.1.—) DSM 13528/ PETC) P77580 12932628; 1.2.1.10 mhpF mhpE Acetaldehyde Escherichia coli 945008 b0351 dehydrogenase (strain K12) JW0342 (EC 1.2.1.10) (Acetaldehyde dehydrogenase [acetylating]) A4IT43 4968078 1.2.1.10 nbaJ Acetaldehyde Geobacillus GTNG_3152 dehydrogenase thermodenitrificans (EC 1.2.1.10) (strain NG80- (Acetaldehyde 2) dehydrogenase [acetylating]) Q2RHL2 3832442 1.2.1.10 Moth_1776 Acetaldehyde Moorella dehydrogenase thermoacetica (EC 1.2.1.10) (strain ATCC (Acetaldehyde 39073) dehydrogenase [acetylating]) C8CEC3 1.2.1.10 nahO Acetaldehyde Pseudomonas dehydrogenase aeruginosa (EC 1.2.1.10) (Acetaldehyde dehydrogenase [acetylating]) P41793 1253985 eutE Ethanolamine Salmonella STM2463 utilization protein typhimurium EutE (strain LT2/ SGSC1412/ ATCC 700720)
[0252] Additional genes coding for enzymes capable of acetyl CoA conversion to acetaldehyde (Activity B) can be identified based on sequence homology to those examples in Table 2
Route 3. Conversion of Pyruvate to Acetaldehyde Via Acetyl CoA
[0253] The conversion of pyruvate to acetyl CoA can be carried out using an enzyme such as EC 1.2.7.1 (pyruvate synthase, pyruvate:ferredoxin oxidoreductase). These ferredoxin linked enzymes are particularly common in anaerobes such as the acetogens, but are also present in other aerobic or facultatively anaerobic organisms such as Hydrogenobacter thermophilus.
[0254] The pyruvate dehydrogenase complex is also a central metabolic enzyme well understood in the art which is responsible for conversion of pyruvate (for example, generated from glycolysis) to acetyl CoA for entry into the TCA cycle.
[0255] The subsequent conversion of acetyl CoA to acetaldehyde is described in Route 2.
TABLE-US-00003 TABLE 3 Examples of genes expressing enzymes for the conversion of pyruvate to acetyl CoA (Activity C). UniProt NCBI Gene Entry ID Gene names Protein names Organism H6LJ55 11873437 porB Pyruvate:ferredoxin Acetobacterium Awo_c06200 oxidoreductase, beta woodii (strain ATCC subunit PorB (EC 29683/DSM 1030/ 1.2.7.1) JCM 2381/KCTC 1655) H6LJ56 11873438 porA Pyruvate:ferredoxin Acetobacterium Awo_c06210 oxidoreductase, alpha woodii (strain ATCC subunit PorA (EC 29683/DSM 1030/ 1.2.7.1) JCM 2381/KCTC 1655) U1VQ53 BTCBT_005517 Pyruvate synthase Bacillus subunit porA (EC thuringiensis T01- 1.2.7.1) 328 U1W7V0 BTCBT_005516 Pyruvate synthase Bacillus subunit porB (EC thuringiensis T01- 1.2.7.1) 328 E5ZLB4 nifJ Pyruvate synthase Campylobacter CSU_1742 (EC 1.2.7.1) jejuni subsp. jejuni 327 A5I7E8 5187682; CBO3423 Putative subunit of Clostridium 5400580 CLC_3367 pyruvate:flavodoxin botulinum (strain oxidoreductase (EC Hall/ATCC 3502/ 1.2.7.1) NCTC 13319/Type A) A5I7E6 16691482; CBO3421 Putative subunit of Clostridium 5186833 pyruvate:flavodoxin botulinum (strain oxidoreductase (EC Hall/ATCC 3502/ 1.2.7.1) NCTC 13319/Type A) A5N1K8 5390957 porB PorB (EC 1.2.7.1) Clostridium kluyveri CKL_2996 (strain ATCC 8527/ DSM 555/NCIMB 10680) A5N1L1 5393792 porC PorC (EC 1.2.7.1) Clostridium kluyveri CKL_2999 (strain ATCC 8527/ DSM 555/NCIMB 10680) A5N1K9 5390958 porA PorA (EC 1.2.7.1) Clostridium kluyveri CKL_2997 (strain ATCC 8527/ DSM 555/NCIMB 10680) A5N1L0 5393791 porD PorD (EC 1.2.7.1) Clostridium kluyveri CKL_2998 (strain ATCC 8527/ DSM 555/NCIMB 10680) Q9LBG1 12100419; PorE Pyruvate:ferredoxin Hydrogenobacter 8773721 oxidoreductase thermophilus epsilon subunit (EC 1.2.7.1) Q9LBF7 12100415; porG Pyruvate:ferredoxin Hydrogenobacter 8773666 oxidoreductase thermophilus gamma subunit (EC 1.2.7.1) Q9LBF8 12100416; porB Pyruvate:ferredoxin Hydrogenobacter 8773723 oxidoreductase beta thermophilus subunit (EC 1.2.7.1) Q9LBF9 12100417; porA Pyruvate:ferredoxin Hydrogenobacter 8773720 oxidoreductase alpha thermophilus subunit (EC 1.2.7.1) Q9LBG0 12100418; porD Pyruvate:ferredoxin Hydrogenobacter 8773719 oxidoreductase delta thermophilus subunit (EC 1.2.7.1) P80900 9704020 porA Pyruvate synthase Methanothermobacter MTBMA_c03140 subunit PorA (EC marburgensis 1.2.7.1) (Pyruvate (strain DSM 2133/ oxidoreductase alpha 14651/NBRC chain) (POR) 100331/OCM 82/ (Pyruvic-ferredoxin Marburg) oxidoreductase (Methanobacterium subunit alpha) thermoautotrophicum) P80901 9704019 porB Pyruvate synthase Methanothermobacter MTBMA_c03130 subunit PorB (EC marburgensis 1.2.7.1) (Pyruvate (strain DSM 2133/ oxidoreductase beta 14651/NBRC chain) (POR) 100331/OCM 82/ (Pyruvic-ferredoxin Marburg) oxidoreductase (Methanobacterium subunit beta) thermoautotrophicum) P80902 9704022 porC Pyruvate synthase Methanothermobacter MTBMA_c03160 subunit PorC (EC marburgensis 1.2.7.1) (Pyruvate (strain DSM 2133/ oxidoreductase 14651/NBRC gamma chain) (POR) 100331/OCM 82/ (Pyruvic-ferredoxin Marburg) oxidoreductase (Methanobacterium subunit gamma) thermoautotrophicum) Q2RH65 3830848 Moth_1924 Pyruvate ferredoxin Moorella oxidoreductase, thermoacetica gamma subunit (EC (strain ATCC 1.2.7.1) 39073) Q2RLH9 3832620 Moth_0376 Pyruvate ferredoxin Moorella oxidoreductase, thermoacetica gamma subunit (EC (strain ATCC 1.2.7.1) 39073) Q2RI42 3832737 Moth_1591 Pyruvate ferredoxin Moorella oxidoreductase, beta thermoacetica subunit (EC 1.2.7.1) (strain ATCC 39073) Q2RH67 3830846 Moth_1922 Pyruvate ferredoxin Moorella oxidoreductase, alpha thermoacetica subunit (EC 1.2.7.1) (strain ATCC 39073) Q2RLH7 3832622 Moth_0378 Pyruvate ferredoxin MooreIla oxidoreductase, alpha thermoacetica subunit (EC 1.2.7.1) (strain ATCC 39073) Q2RH68 3830845 Moth_1921 Pyruvate ferredoxin MooreIla oxidoreductase, beta thermoacetica subunit (EC 1.2.7.1) (strain ATCC 39073) Q51804 1468831 porA PF0966 Pyruvate synthase Pyrococcus furiosus subunit PorA (EC (strain ATCC 43587/ 1.2.7.1) (Pyruvate DSM 3638/JCM oxidoreductase alpha 8422/Vc1) chain) (POR) (Pyruvic-ferredoxin oxidoreductase subunit alpha) Q51805 1468830 porB PF0965 Pyruvate synthase Pyrococcus furiosus subunit PorB (EC (strain ATCC 43587/ 1.2.7.1) (Pyruvate DSM 3638/JCM oxidoreductase beta 8422/Vc1) chain) (POR) (Pyruvic-ferredoxin oxidoreductase subunit beta) O05651 896831 porA TM_0017 Pyruvate synthase Thermotoga subunit PorA (EC maritima (strain 1.2.7.1) (Pyruvate ATCC 43589/ oxidoreductase alpha MSB8/DSM 3109/ chain) (POR) JCM 10099) (Pyruvic-ferredoxin oxidoreductase subunit alpha) O05650 896829 porC porG Pyruvate synthase Thermotoga TM_0015 subunit PorC (EC maritima (strain 1.2.7.1) (Pyruvate ATCC 43589/ oxidoreductase MSB8/DSM 3109/ gamma chain) (POR) JCM 10099) (Pyruvic-ferredoxin oxidoreductase subunit gamma) Q56317 896832 porB TM_0018 Pyruvate synthase Thermotoga subunit PorB (EC maritima (strain 1.2.7.1) (Pyruvate ATCC 43589/ oxidoreductase beta MSB8/DSM 3109/ chain) (POR) JCM 10099) (Pyruvic-ferredoxin oxidoreductase subunit beta)
[0256] Additional genes coding for enzymes capable of the conversion of pyruvate to acetyl CoA (Activity C) can be identified based on sequence homology to those examples in Table 3, or to common sequences for the pyruvate dehydrogenase complex.
Route 4. Conversion of Pyruvate to Acetaldehyde Directly
[0257] The conversion of pyruvate to acetaldehyde is well known in the art. Pyruvate decarboxylase is a homotetrameric enzyme (EC 4.1.1.1) that catalyses the decarboxylation of pyruvic acid to acetaldehyde and carbon dioxide in the cytoplasm of prokaryotes, and in the mitochondria of eukaryotes. It is also called 2-oxo-acid carboxylase, alpha-ketoacid carboxylase, and pyruvic decarboxylase. Under anaerobic conditions, this enzyme is part of the fermentation process that occurs in yeast, especially of the Saccharomyces genus, to produce ethanol by fermentation. Pyruvate decarboxylase starts this process by converting pyruvate into acetaldehyde and carbon dioxide.
[0258] The pyruvate ferredoxin oxidoreductase from Pyrococcus furiosus (Table 3) has also been shown to catalyse pyruvate decarboxylation to acetaldehyde (Ma, K. et al. 1997. PNAS, 94, 9608).
[0259] Examples 12,13 and 14 show the production of 1,3-butanediol using pyruvate decarboxylase to deliver acetaldehyde to DERA from pyruvate, in a novel, unnatural 1,3-BDO pathway. Table 4. Examples of genes expressing enzymes for application to the decarboxylation of pyruvate to acetaldehyde (Activity D).
TABLE-US-00004 Uniprot NCBI Entry GeneID Gene names Protein names Organism O82647 829444 PDC1 At4g33070 Pyruvate Arabidopsis thaliana F4I10.4 decarboxylase 1 (Mouse-ear cress) (AtPDC1) Q9FFT4 835587 PDC2 At5g54960 Pyruvate Arabidopsis thaliana MBG8.23 decarboxylase 2 (Mouse-ear cress) (AtPDC2) Q9M039 831414 PDC3 At5g01330 Pyruvate Arabidopsis thaliana T10O8.40 decarboxylase 3 (Mouse-ear cress) (AtPDC3) Q9M040 830867 PDC4 At5g01320 Pyruvate Arabidopsis thaliana T10O8.30 decarboxylase 4 (Mouse-ear cress) (AtPDC4) Q2UKV4 5991796 pdcA Pyruvate Aspergillus oryzae (strain AO090003000661 decarboxylase ATCC 42149/RIB 40) (Yellow koji mold) P51844 pdcA pdc Pyruvate Aspergillus parasiticus decarboxylase Q0CNV1 4320296 pdcA ATEG_04633 Pyruvate Aspergillus terreus (strain decarboxylase NIH 2624/FGSC A1156) P83779 3642780 PDC11 PDC1 Pyruvate Candida albicans (strain CaO19.10395 decarboxylase SC5314/ATCC MYA- CaO19.2877 2876) (Yeast) Q6FJA3 2891742 PDC1 PDC Pyruvate Candida glabrata (strain CAGL0M07920g decarboxylase ATCC 2001/CBS 138/ JCM 3761/NBRC 0622/ NRRL Y-65) (Yeast) (Torulopsis glabrata) P87208 2872690 pdcA AN4888 Pyruvate Emericella nidulans decarboxylase (strain FGSC A4/ATCC 38163/CBS 112.46/ NRRL 194/M139) (Aspergillus nidulans) P34734 PDC Pyruvate Hanseniaspora uvarum decarboxylase (Yeast) (Kloeckera apiculata) Q12629 2894295 PDC1 Pyruvate Kluyveromyces lactis KLLA0E16357g decarboxylase (strain ATCC 8585/CBS 2359/DSM 70799/ NBRC 1267/NRRL Y- 1140/WM37) (Yeast) (Candida sphaerica) P33149 PDC1 Pyruvate Kluyveromyces decarboxylase marxianus (Yeast) (Candida kefyr) Q4WXX9 3511715 pdcA Pyruvate Neosartorya fumigata AFUA_3G11070 decarboxylase (strain ATCC MYA-4609/ Af293/CBS 101355/ FGSC A1100) (Aspergillus fumigatus) P33287 3875734 cfp pdc-1 Pyruvate Neurospora crassa (strain NCU02193 decarboxylase ATCC 24698/74-OR23- (8-10 nm 1A/CBS 708.71/DSM cytoplasmic 1257/FGSC 987) filament- associated protein) (P59NC) A2Y5L9 PDC1 OsI_019612 Pyruvate Oryza sativa subsp. decarboxylase 1 indica (Rice) (PDC) A2XFI3 PDC2 OsI_010826 Pyruvate Oryza sativa subsp. decarboxylase 2 indica (Rice) (PDC) A2YQ76 PDC3 OsI_026469 Pyruvate Oryza sativa subsp. decarboxylase 3 indica (Rice) (PDC) Q0DHF6 4339066 PDC1 Pyruvate Oryza sativa subsp. Os05g0469600 decarboxylase 1 japonica (Rice) LOC_Os05g39310 (PDC) OsJ_018109 OSJNBa0052E20.2 Q10MW3 4332519 PDC2 Pyruvate Oryza sativa subsp. Os03g0293500 decarboxylase 2 japonica (Rice) LOC_Os03g18220 (PDC) Q0D3D2 4344382 PDC3 Pyruvate Oryza sativa subsp. Os07g0693100 decarboxylase 3 japonica (Rice) LOC_Os07g49250 (PDC) OsJ_024667 P51850 PDC1 Pyruvate Pisum sativum (Garden decarboxylase 1 pea) (PDC) P06169 850733 PDC1 YLR044C Pyruvate Saccharomyces L2104 decarboxylase cerevisiae (strain ATCC isozyme 1 (EC 204508/S288c) (Baker's 4.1.1.—) yeast) P16467 850825 PDC5 YLR134W Pyruvate Saccharomyces L3133 L9606.7 decarboxylase cerevisiae (strain ATCC isozyme 2 (EC 204508/S288c) (Baker's 4.1.1.—) yeast) P26263 852978 PDC6 YGR087C Pyruvate Saccharomyces decarboxylase cerevisiae (strain ATCC isozyme 3 204508/S288c) (Baker's yeast) O42873 2543400 SPAC3G9.11c Putative pyruvate Schizosaccharomyces decarboxylase pombe (strain 972/ C3G9.11c ATCC 24843) (Fission yeast) Q09737 3361478 SPAC13A11.06 Putative pyruvate Schizosaccharomyces SPAC3H8.01 decarboxylase pombe (strain 972/ C13A11.06 ATCC 24843) (Fission yeast) Q9P7P6 2542602 SPAC186.09 Probable Schizosaccharomyces pyruvate pombe (strain 972/ decarboxylase ATCC 24843) (Fission C186.09 yeast) P28516 542376 PDC1 PDC Pyruvate Zea mays (Maize) decarboxylase 1 (PDC) P06672 3188496 pdc ZMO1360 Pyruvate Zymomonas mobilis decarboxylase subsp. mobilis (strain (PDC) ATCC 31821/ZM4/ CP4)
[0260] Additional genes coding for enzymes capable of pyruvate conversion to acetaldehyde (Activity D) can be identified based on sequence homology to those examples in Table 4.
Route 5. Conversion of Acetyl CoA to Acetaldehyde Via Pyruvate
[0261] The conversion of acetyl CoA to pyruvate (Activity E) can be achieved using the reversible enzyme pyruvate ferredoxin oxidoreductase (pyruvate synthase, EC 1.2.7.1). Gene sequences coding for this enzyme are listed in Table 3.
[0262] The subsequent conversion of pyruvate to acetaldehyde is described in Route 4.
Route 6. Conversion of Acetate to Acetaldehyde Via Acetyl CoA.
[0263] The conversion of acetate to acetyl CoA can be achieved using acetyl CoA synthetase or a CoA transferase for example, EC 6.2.1.1 or EC 2.8.3.8 and subsequently converted to acetaldehyde via EC 1.2.1.10 (Route 2.). Examples of gene sequences coding for enzymes capable of the conversion of acetate to acetyl CoA are shown in Table 5.
TABLE-US-00005 TABLE 5 Examples of genes expressing enzymes for application to the synthesis of acetyl CoA from acetate (Activity F). UniProt NCBI Gene Entry Gene ID names Protein names Organism A4SJM6 4995560 acsA Acetyl-coenzyme A Aeromonas ASA_0967 synthetase (AcCoA salmonicida synthetase) (Acs) (EC (strain A449) 6.2.1.1) (Acetate--CoA ligase) (Acyl-activating enzyme) Q9KWA3 874783 acsA Acetyl-coenzyme A Agrobacterium riorf81 synthetase (AcCoA rhizogenes synthetase) (Acs) (EC 6.2.1.1) (Acetate--CoA ligase) (Acyl-activating enzyme) Q8UBV5 1134783 acsA acs Acetyl-coenzyme A Agrobacterium Atu2745 synthetase (AcCoA tumefaciens AGR_C_4980 synthetase) (Acs) (EC (strain C58/ 6.2.1.1) (Acetate--CoA ATCC 33970) ligase) (Acyl-activating enzyme) Q758X0 4620668 ACS1 Acetyl-coenzyme A Ashbya ADR408W synthetase 1 (EC 6.2.1.1) gossypii (strain (Acetate--CoA ligase 1) ATCC 10895/ (Acyl-activating enzyme CBS 109.51/ 1) FGSC 9923/ NRRL Y-1056) (Yeast) (Eremothecium gossypii) Q750T7 4622812 ACS2 Acetyl-coenzyme A Ashbya AGL148C synthetase 2 (EC 6.2.1.1) gossypii (strain (Acetate--CoA ligase 2) ATCC 10895/ (Acyl-activating enzyme CBS 109.51/ 2) FGSC 9923/ NRRL Y-1056) (Yeast) (Eremothecium gossypii) P39062 937324 acsA Acetyl-coenzyme A Bacillus BSU29680 synthetase (AcCoA subtilis (strain synthetase) (Acs) (EC 168) 6.2.1.1) (Acetate--CoA ligase) (Acyl-activating enzyme) Q89WV5 1049589 acsA Acetyl-coenzyme A Bradyrhizobium blr0573 synthetase (AcCoA diazoefficiens synthetase) (Acs) (EC (strain JCM 6.2.1.1) (Acetate--CoA 10833/IAM ligase) (Acyl-activating 13628/NBRC enzyme) 14792/USDA 110) Q8FYQ3 1167504; acsA Acetyl-coenzyme A Brucella suis 12137575 BR1811 synthetase (AcCoA biovar 1 (strain BS1330_I1805 synthetase) (Acs) (EC 1330) 6.2.1.1) (Acetate--CoA ligase) (Acyl-activating enzyme) Q8NJN3 3644652; ACS2 Acetyl-coenzyme A Candida 3644710 CaO19.1064 synthetase 2 (EC 6.2.1.1) albicans (strain CaO19.8666 (Acetate--CoA ligase 2) SC5314/ (Acyl-activating enzyme ATCC MYA- 2) 2876) (Yeast) Q8KBY0 1006138 acsA acs Acetyl-coenzyme A Chlorobium CT1652 synthetase (AcCoA tepidum (strain synthetase) (Acs) (EC ATCC 49652/ 6.2.1.1) (Acetate--CoA DSM 12025/ ligase) (Acyl-activating TLS) enzyme) P16928 2871910 facA Acetyl-coenzyme A Emericella acuA synthetase (EC 6.2.1.1) nidulans AN5626 (Acetate--CoA ligase) (strain FGSC (Acyl-activating enzyme) A4/ATCC 38163/CBS 112.46/NRRL 194/M139) (Aspergillus nidulans) P27550 12933681; acs yfaC Acetyl-coenzyme A Escherichia 948572 b4069 synthetase (AcCoA coli (strain JW4030 synthetase) (Acs) (EC K12) 6.2.1.1) (Acetate--CoA ligase) (Acyl-activating enzyme) O60011 2896335 ACS1 Acetyl-coenzyme A Kluyveromyces KLLA0A03333g synthetase 1 (EC 6.2.1.1) lactis (strain (Acetate--CoA ligase 1) ATCC 8585/ (Acyl-activating enzyme CBS 2359/ 1) DSM 70799/ NBRC 1267/ NRRL Y-1140/ WM37) (Yeast) (Candida sphaerica) P27095 acsA acs Acetyl-coenzyme A Methanosaeta synthetase (AcCoA concilii synthetase) (Acs) (EC (Methanothrix 6.2.1.1) (Acetate--CoA soehngenii) ligase) (Acyl-activating enzyme) P9WQD1 13317276; acsA acs Acetyl-coenzyme A Mycobacterium 885479 Rv3667 synthetase (AcCoA tuberculosis MTV025.015 synthetase) (Acs) (EC (strain ATCC 6.2.1.1) (Acetate--CoA 25618/ ligase) (Acyl-activating H37Rv) enzyme) O93730 1463659 acsA acs Acetyl-coenzyme A Pyrobaculum PAE2867 synthetase (AcCoA aerophilum synthetase) (Acs) (EC (strain ATCC 6.2.1.1) (Acetate--CoA 51768/IM2/ ligase) (Acyl-activating DSM 7523/ enzyme) JCM 9630/ NBRC 100827) Q9Z3R3 1232358 acsA1 Acetyl-coenzyme A Rhizobium R00719 synthetase 1 (AcCoA meliloti (strain SMc00774 synthetase 1) (Acs 1) (EC 1021) (Ensifer 6.2.1.1) (Acetate--CoA meliloti) ligase 1) (Acyl-activating (Sinorhizobium enzyme 1) meliloti) O68040 9004945 acsA acs Acetyl-coenzyme A Rhodobacter RCAP_rc synthetase (AcCoA capsulatus c02126 synthetase) (Acs) (EC (strain ATCC 6.2.1.1) (Acetate--CoA BAA-309/ ligase) (Acyl-activating NBRC 16581/ enzyme) SB1003) Q01574 851245 ACS1 Acetyl-coenzyme A Saccharomyces YAL054C synthetase 1 (EC 6.2.1.1) cerevisiae FUN44 (Acetate--CoA ligase 1) (strain ATCC (Acyl-activating enzyme 204508/ 1) S288c) (Baker's yeast) Q8ZKF6 1255801 acs Acetyl-coenzyme A Salmonella STM4275 synthetase (AcCoA typhimurium synthetase) (Acs) (EC (strain LT2/ 6.2.1.1) (Acetate--CoA SGSC1412/ ligase) (Acyl-activating ATCC 700720) enzyme) Q82EL5 1211019 acsA Acetyl-coenzyme A Streptomyces SAV_4599 synthetase (AcCoA avermitilis synthetase) (Acs) (EC (strain ATCC 6.2.1.1) (Acetate--CoA 31267/DSM ligase) (Acyl-activating 46492/JCM enzyme) 5070/NCIMB 12804/NRRL 8165/MA- 4680) Q55404 951871 acsA acs Acetyl-coenzyme A Synechocystis sll0542 synthetase (AcCoA sp. (strain synthetase) (Acs) (EC PCC 6803/ 6.2.1.1) (Acetate--CoA Kazusa) ligase) (Acyl-activating enzyme) F1CYZ5 carA Acetate CoA-transferase Acetobacterium YdiF (EC 2.8.3.8) woodii H6LGM4 11871862 carA2 Acetate CoA-transferase Acetobacterium Awo_c15700 YdiF (EC 2.8.3.8) woodii (strain ATCC 29683/DSM 1030/JCM 2381/KCTC 1655) G6XSJ6 ATCR1_08124 Acetate CoA-transferase Agrobacterium YdiF (EC 2.8.3.8) tumefaciens CCNWGS0286 V5MSC1 17703598 U712_10415 Putative coenzyme A Bacillus transferase subunit beta subtilis PY79 (EC 2.8.3.8) V5MSQ3 17703599 U712_10420 Putative coenzyme A Bacillus transferase subunit alpha subtilis PY79 (EC 2.8.3.8) Q8FY42 1167750; BR2047 Acetate CoA-transferase Brucella suis 12137830 BS1330_I2041 YdiF (EC 2.8.3.8) biovar 1 (strain 1330) C6Q271 Ccar_0559 Acetate CoA-transferase Clostridium CcarbDRAFT_5139 YdiF (EC 2.8.3.8) carboxidivorans CLCAR_0656 P7 P76458 12930185; atoD Acetate CoA-transferase Escherichia 947525 b2221 subunit alpha (EC 2.8.3.8) coli (strain JW2215 (Acetyl- K12) CoA:acetoacetate-CoA transferase subunit alpha) P76459 12933993; atoA Acetate CoA-transferase Escherichia 946719 b2222 subunit beta (EC 2.8.3.8) coli (strain JW2216 (Acetyl-CoA:acetoacetate K12) CoA-transferase subunit beta) P37766 12931296; ydiF Acetate CoA-transferase Escherichia 946211 b1694 YdiF (EC 2.8.3.8) (Short- coli (strain JW1684 chain acyl-CoA:acetate K12) CoA-transferase) A9HGB7 5790057; GDI1530 Acetate CoA-transferase Gluconacetobacter 6975653 Gdia_2224 YdiF (EC 2.8.3.8) diazotrophicus (strain ATCC 49037/DSM 5601/PAI5) M7PTY6 G000_09783 Acetate CoA-transferase Klebsiella Kpn2146_2726 YdiF (EC 2.8.3.8) pneumoniae ATCC BAA- 2146 Q2RJ16 3833054 Moth_1259 Acetate CoA-transferase Moorella YdiF (EC 2.8.3.8) thermoacetica (strain ATCC 39073) A0QZW0 4534496 MSMEG_4168 Acetate CoA-transferase Mycobacterium MSMEI_4070 YdiF (EC 2.8.3.8) smegmatis (strain ATCC 700084/ mc(2)155) B6VK66 13861069 atoD Acetate CoA-transferase Photorhabdus PAU_01020 subunit alpha (EC 2.8.3.8) asymbiotica PA- (Acetate coa-transferase subsp. RVA1- subunit alpha (Ec 2.8.3.8) asymbiotica 4466 (Acetyl coa:acetoacetate (strain ATCC coa transferase subunit 43949/3105- alpha)) (EC 2.8.3.8) 77) (Xenorhabdus luminescens (strain 2)) B6VK67 13863234 atoA Acetate coa-transferase Photorhabdus PAU_01019 beta subunit (Acetyl- asymbiotica PA- coa:acetoacetate co subsp. RVA1- transferase beta subunit) asymbiotica 4467 (EC 2.8.3.8) (strain ATCC 43949/3105- 77) (Xenorhabdus luminescens (strain 2)) Q8Y265 1219275 RSc0471 Acetate CoA-transferase Ralstonia YdiF (EC 2.8.3.8) solanacearum (strain GMI1000) (Pseudomonas solanacearum) F6G5B4 12627030 mdcA Acetate CoA-transferase Ralstonia RSPO_c02923 YdiF (EC 2.8.3.8) solanacearum (strain Po82) Q92YU3 1235806 SMa1409 Acetate CoA-transferase Rhizobium YdiF (EC 2.8.3.8) meliloti (strain 1021) (Ensifer meliloti) (Sinorhizobium meliloti) Q92KZ4 1234998 R03304 Acetate CoA-transferase Rhizobium SMc04399 YdiF (EC 2.8.3.8) meliloti (strain 1021) (Ensifer meliloti) (Sinorhizobium meliloti) Q8ZPR5 ydiF Acetate CoA-transferase Salmonella STM1357 YdiF (EC 2.8.3.8) typhimurium (strain LT2/ SGSC1412/ ATCC 700720) E1WFM4 ydiF Acetate CoA-transferase Salmonella SL1344_1291 YdiF (EC 2.8.3.8) typhimurium (strain SL1344) U2NIA4 L581_2735 Acetate CoA-transferase Serratia YdiF (EC 2.8.3.8) fonticola AU- AP2C U2NF66 L581_4507 Acetate CoA-transferase Serratia YdiF (EC 2.8.3.8) fonticola AU- AP2C U2NBM1 L580_1393 Acetate CoA-transferase Serratia YdiF (EC 2.8.3.8) fonticola AU- P3(3) W8UTY0 CH52_04550 Acetate CoA-transferase Staphylococcus DA92_00435 YdiF (EC 2.8.3.8) aureus D3ES62 12863675 SA2981_0235 Acetate CoA-transferase Staphylococcus YdiF (EC 2.8.3.8) aureus (strain 04- 02981)
[0264] Additional genes coding for enzymes for application to the synthesis of acetyl CoA from acetate (Activity F) can be identified based on sequence homology to those examples in Table 5.
Example 2—Conversion of Acetaldehyde to 3-Hydroxybutanal
[0265] The syntheses described herein via the intermediate compound 3-hydroxybutanal. Synthesis of 3-hydroxybutanal is achieved using an enzyme capable of the aldol condensation of two molecules of acetaldehyde. This reaction is catalysed by deoxyribose phosphate aldolase (DERA, EC 4.1.2.4). This aldolase can be sourced from a wide range of microorganisms with the example from E. coli having been studied in detail for the synthesis of statin intermediates.
[0266] The NIH Genbank® database of publicly available nucleotide sequences (http://www.ncbi.nlm.nih.gov/gene) may be used to identify genes encoding proteins classified as EC 4.1.2.4. Bacterial genes annotated with EC 4.1.2.4 number 1137 as of 6 Jul. 2014; by phylum, there are 394 examples in the firmicutes, 387 in proteobacteria, 153 in actinobacteria, 50 in cyanobacteria and 153 in others. There are also 52 archaeal genes annotated with EC 4.1.2.4. These data are summarised in Table 6.
TABLE-US-00006 TABLE 6 Distribution of genes annotated with EC 4.1.2.4 in the Bacteria and Archaea identified using the NIH Genbank® database of publicly available nucleotide sequences; accessed 6th Jul. 2014. Example sequences for conversion of acetaldehyde to 3- hydroxybutanal (Activity G). Domain Phylum Order Number of genes Bacteria 1137 Firmicutes 394 Bacillales 168 Lactobacillales 110 Clostridiales 78 Thermoanaerobacterales 26 Halanaerobiales 6 Selenomonadales 4 Natranaerobiales 1 Erysipelotrichales 1 Proteobacteria 387 g-proteobacteria 276 a-proteobacteria 61 b-proteobacteria 36 d-proteobacteria 14 Actinobacteria 153 Actinomycetales 146 high GC Gram+ 7 Cyanobacteria 50 Archaea 52 UniProt NCBI Gene Entry ID Gene names Protein names Organism H6LE06 11871631; deoC4 Deoxyribose- Acetobacterium Awo_c12650 phosphate aldolase woodii (strain ATCC DeoC4 (EC 4.1.2.4) 29683/DSM 1030/ JCM 2381/KCTC 1655) H6LE04 11871629; deoC2 Deoxyribose- Acetobacterium Awo_c12630 phosphate aldolase woodii (strain ATCC DeoC2 (EC 4.1.2.4) 29683/DSM 1030/ JCM 2381/KCTC 1655) H6LF13 11870761; deoC1 deoC Deoxyribose- Acetobacterium Awo_c01090 phosphate aldolase woodii (strain ATCC (DERA) (EC 4.1.2.4) 29683/DSM 1030/ (2-deoxy-D-ribose 5- JCM 2381/KCTC phosphate aldolase) 1655) (Phosphodeoxyriboaldolase) H6LFY1 11871799; deoC5 Deoxyribose- Acetobacterium Awo_c14870 phosphate aldolase woodii (strain ATCC DeoC5 (EC 4.1.2.4) 29683/DSM 1030/ JCM 2381/KCTC 1655) H6LE05 11871630; deoC3 Deoxyribose- Acetobacterium Awo_c12640 phosphate aldolase woodii (strain ATCC DeoC3 (EC 4.1.2.4) 29683/DSM 1030/ JCM 2381/KCTC 1655) C9RDA8 8491097 deoC Deoxyribose- Ammonifex degensii Adeg_1109 phosphate aldolase (strain DSM 10501/ (DERA) (EC 4.1.2.4) KC4) (2-deoxy-D-ribose 5- phosphate aldolase) (Phosphodeoxyriboaldolase) P39121 938608 deoC dra Deoxyribose- Bacillus subtilis (strain BSU39420 phosphate aldolase 168) (DERA) (EC 4.1.2.4) (2-deoxy-D-ribose 5- phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q97IU5 1117728 deoC Deoxyribose- Clostridium CA_C1545 phosphate aldolase acetobutylicum (strain (DERA) (EC 4.1.2.4) ATCC 824/DSM 792/ (2-deoxy-D-ribose 5- JCM 1419/LMG phosphate aldolase) 5710/VKM B-1787) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q8NTC4 1021418 deoC Cgl0383 Deoxyribose- Corynebacterium cg0458 phosphate aldolase glutamicum (strain (DERA) (EC 4.1.2.4) ATCC 13032/DSM (2-deoxy-D-ribose 5- 20300/JCM 1318/ phosphate aldolase) LMG 3730/NCIMB (Phosphodeoxyriboaldolase) 10025) (Deoxyriboaldolase) P0A6L0 12934356; deoC dra thyR Deoxyribose- Escherichia coli 948902 b4381 phosphate aldolase (strain K12) JW4344 (DERA) (EC 4.1.2.4) (2-deoxy-D-ribose 5- phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) A4IR26 4967361 deoC Deoxyribose- Geobacillus GTNG_2435 phosphate aldolase thermodenitrificans (DERA) (EC 4.1.2.4) (strain NG80-2) (2-deoxy-D-ribose 5- phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q8ZXK7 1465578 deoC Deoxyribose- Pyrobaculum PAE1231 phosphate aldolase aerophilum (strain (DERA) (EC 4.1.2.4) ATCC 51768/IM2/ (2-deoxy-D-ribose 5- DSM 7523/JCM phosphate aldolase) 9630/NBRC 100827) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q8ZJV8 1256093 deoC Deoxyribose- Salmonella STM4567 phosphate aldolase typhimurium (strain (DERA) (EC 4.1.2.4) LT2/SGSC1412/ (2-deoxy-D-ribose 5- ATCC 700720) phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) P99174 1124840 deoC2 Deoxyribose- Staphylococcus SA1939 phosphate aldolase 2 aureus (strain N315) (DERA 2) (EC 4.1.2.4) (2-deoxy-D- ribose 5-phosphate aldolase 2) (Phosphodeoxyriboaldolase 2) (Deoxyriboaldolase 2) Q99Y51 3571313; deoC Deoxyribose- Streptococcus 902077 SPy_1867 phosphate aldolase pyogenes serotype M5005_Spy1585 (DERA) (EC 4.1.2.4) M1 (2-deoxy-D-ribose 5- phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q9X1P5 897566 deoC Deoxyribose- Thermotoga maritima TM_1559 phosphate aldolase (strain ATCC 43589/ (DERA) (EC 4.1.2.4) MSB8/DSM 3109/ (2-deoxy-D-ribose 5- JCM 10099) phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q72JE9 2775585 deoC Deoxyribose- Thermus TT_C0823 phosphate aldolase thermophilus (strain (DERA) (EC 4.1.2.4) HB27/ATCC BAA- (2-deoxy-D-ribose 5- 163/DSM 7039) phosphate aldolase) (Phosphodeoxyriboaldolase) (Deoxyriboaldolase) Q8ZGH4 1147807; deoC1 dra Deoxyribose- Yersinia pestis 1174165; YPO1323 phosphate aldolase 1 2764428 y2860 (DERA 1) (EC YP_1269 4.1.2.4) (2-deoxy-D- ribose 5-phosphate aldolase 1) (Phosphodeoxyriboaldolase 1) (Deoxyriboaldolase 1) A2BLE9 4781378 Hbut_0962 Deoxyribose- Hyperthermus phosphate aldolase butylicus (strain DSM (DERA) (EC 4.1.2.4) 5456/JCM 9403) C0ZUQ6 7712431 deoC, Deoxyribose- Rhodococcus RER_15930 phosphate aldolase erythropolis (strain (DERA) (EC 4.1.2.4) PR4/NBRC 100887) B4A422 deoC Deoxyribose- Salmonella enterica SNSL317_A2005 phosphate aldolase subsp. enterica (DERA) (EC 4.1.2.4) serovar Newport str. SL317 Q88264 1061480 deoC lp_0497 Deoxyribose- Lactobacillus phosphate aldolase plantarum (strain (DERA) (EC 4.1.2.4) ATCC BAA-793/ NCIMB 8826/ WCFS1) S8F6M2 7901233 TGME49_318750 Deoxyribose- Toxoplasma gondii phosphate aldolase ME49 (DERA) (EC 4.1.2.4) Q87710 3233914 deoC TK2104 Deoxyribose- Thermococcus phosphate aldolase kodakaraensis (strain (DERA) (EC 4.1.2.4) ATCC BAA-918/JCM 12380/KOD1) (Pyrococcus kodakaraensis (strain KOD1)) B9DS93 7393055 deoC SUB0952 Deoxyribose- Streptococcus uberis phosphate aldolase (strain ATCC BAA- (DERA) (EC 4.1.2.4) 854/0140J) A4WHP 5054261 deoC Deoxyribose- Pyrobaculum Pars_0301 phosphate aldolase arsenaticum (strain (DERA) (EC 4.1.2.4) DSM 13514/JCM 11321) A1RU26 4617152 deoC Deoxyribose- Pyrobaculum Pisl_1295 phosphate aldolase islandicum (strain (DERA) (EC 4.1.2.4) DSM 4184/JCM 9189) C4M5C6 3406093 EHI_121800 Deoxyribose- Entamoeba histolytica phosphate aldolase (DERA) putative A8A8B0 5593924 deoC Deoxyribose- Escherichia coli EcHS_A4616 phosphate aldolase O9:H4 (strain HS) (DERA) (EC 4.1.2.4) Q0SEY5 4218140 deoC Deoxyribose- Rhodococcus sp. RHA1_ro02094 phosphate aldolase (strain RHA1) (DERA) (EC 4.1.2.4) F8K193 11354892 Dera, Deoxyribose- Streptomyces cattleya 12650565 SCAT_3805, phosphate aldolase (strain ATCC 35852/ SCATT_37940 DSM 46488/JCM 4925/NBRC 14057/ NRRL 8057) A7FU73 5395000 deoC, Deoxyribose- Clostridium botulinum CLB_1583 phosphate aldolase (strain ATCC 19397/ Type A) B9E4U5 7273626 deoC, Deoxyribose- Clostridium kluyveri CKR_2469 phosphate aldolase (strain NBRC 12016) D8GI14 9445430 deoC Deoxyribose- Clostridium ljungdahlii CLJU_c18130 phosphate aldolase (strain ATCC 55383/ DSM 13528/PETC) E3GHB9 9881953 deoC Deoxyribose- Eubacterium limosum ELI_0052 phosphate aldolase (strain KIST612) B5Y277 6936643 deoC Deoxyribose- Klebsiella KPK_4777 phosphate aldolase pneumoniae (strain 342) Q5KY02 3184692 deoC Deoxyribose- Geobacillus GK_2499 phosphate aldolase kaustophilus (strain HTA426) Q6HK62 2856540 deoC Deoxyribose- Bacillus thuringiensis BT9727_1732 phosphate aldolase subsp. konkukian (strain 97-27) I3DVS3 deoC Deoxyribose- Bacillus methanolicus PB1_12319 phosphate aldolase PB1
[0267] Additional genes coding for enzymes capable of the condensation of two molecules of acetaldehyde (Activity G) can be identified based on sequence homology to those examples in Table 6.
Example 3—Reduction of 3-Hydroxybutanal to 1,3-Butanediol
[0268] Genes coding for enzymes capable of the reduction of an aldehyde to the corresponding alcohol (EC 1.1.1.-) are widespread in nature and with respect to this application are generally classified in EC 1.1.1.78; 1.1.1.265; 1.1.1.373; 1.1.1.1; 1.1.1.2; 1.1.1.21; 1.1.1.26; 1.1.1.31; 1.1.1.71; 1.1.1.72; 1.1.1.77 and 1.1.1.283 For this application it is desirable that aldehyde reductase or alcohol dehydrogenases enzymes (both terms refer to enzymes capable of aldehyde reduction) show preference towards a C4 aldehyde relative to a C2 aldehyde such as acetaldehyde. Alcohol dehydrogenases involved in ethanol synthesis for example, preferring acetaldehyde as a substrate would not be preferred for this application, but evolution of these well described short chain dehydrogenase or reductases using techniques well known in the art, could be used to alter the substrate preference towards longer chain aldehydes.
[0269] This reaction can be catalysed by a medium chain alcohol dehydrogenase which showed preference for alcohols of C4 or greater, for example (gene alrA) see Appl. Environ. Microbiol, 2000, 66, 5231. Further, alcohol dehydrogenases showing preference for longer chain alcohols from Acinebacter calcoaceticus NCIB 8250 and from Saccharomyces cerevisiae D273-10B are described by Wales, M and Fewson, C. Microbiol 1994, 140, 173. Although measured in the oxidative direction, the dehydrogenase also accepts 1,4-butanediol as a substrate. 2,3-butanediol is not a substrate, clearly demonstrating the desired primary alcohol as opposed to secondary alcohol specificity for application to 3-hydroxybutanal reduction.
[0270] A further excellent candidate enzyme is bcALD, GRE_2 (EC 1.1.1.265 also classified in EC 1.1.1.283) from S. cerevisiae var. uvarum W34 described by van Iersel, M. F. M et al. Appl. Environ. Microbiol. 1997. 63, 4079. This enzyme shows strong preference for butanal and derivatives with a poor preference for acetaldehyde. Kms are: acetaldehyde 158 mM; butanal 2.76 mM; 2-methylbutanal 1.85 mM; 3-methylbutanal 0.21 mM. The preference of GRE2 derived dehydrogenase for a C4 aldehyde (butanal) relative to acetaldehyde is shown in Example 9. From these data this dehydrogenase would also be expected to show selective preference for 3-hydroxybutanal relative to acetaldehyde.
[0271] Another excellent example is the GOX1615 gene from Gluconobacter oxydans (Richter, N. et al. Chembiochem. 2009, 10, 1888.). This enzyme has been characterised and shown to have very poor preference for acetaldehyde reduction compared to longer chain and hydroxysubstituted substrates. 3-Hydroxybutanal was not specifically tested in the reductive direction. However, 1,3-butanediol was tested in the undesired oxidative direction and poor activity was reported. Hence, based on the data presented it is expected that this enzyme would show the desired preference for 3-hydroxybutanal reduction compared to undesired acetaldehyde reduction also with a poor oxidative activity towards the product 1,3-butanediol. The use of GOX1615 for selective reduction of 3-hydroxybutanal to 1,3-butanediol within a novel, unnatural 1,3-BDO pathway, is shown in Example 12,13 and 14. Example 9 also confirms its predicted preference for the DERA product 3-hydroxybutanal relative to acetaldehyde.
[0272] Further examples include yqhD from E. coli which is reported as having a preference for alcohols of C3 or greater, Sulzenbacher et al., 2004. J. Mol. Biol. 342:489-502. Alcohol dehydrogenases are understood to be reversible enzymes capable of operating in a reductive or oxidative direction. Genes bdh A and bdh B (proteins bdh I and bdh II) from C. acetobutylicum code for enzymes which convert butanal into butanol (Walter et al. 1992. J. Bacteriol. 174:7149-7158. The use of bdhII (gene bdhB) butanol dehydrogenase for reduction of 3-hydroxybutanal to 1,3-butanediol within a novel, unnatural 1,3-BDO pathway, is shown in Example 12. Further, butanol dehydrogenase examples include bdh from C. saccharoperbutylacetonicum and Cbei_1722, Cbei_2181 and Cbei_2421 in C. Beijerincki (Gene announce. 2012, 194, (19) 5470.). Other gene products classified as methylglyoxal reductases (EC 1.1.1.283) in addition to GRE_2 described above, may also be candidates (Eur. J. Biochem, 1988, 171,213). Additional aldehyde reductase gene candidates in Saccharomyces cerevisiae include the aldehyde reductases GRE3, ALD2-6 and HFD1, glyoxylate reductases GOR1 and YPL113C and glycerol dehydrogenase GCY1 (Atsumi et al., Nature 451:86-89 2008).
TABLE-US-00007 TABLE 7 Examples of genes expressing enzymes for the conversion of 3-hydroxybutanal to 1,3-butanediol (Activity H). UniProt NCBI Gene Entry ID Gene names Protein names Organism Q9F1R1 alrA NADPH-dependent Acinetobacter alcohol sp. M-1 dehydrogenase (EC 1.1.1.2) Q04944 1119481 bdhA NADH-dependent Clostridium CA_C3299 butanol acetobutylicum dehydrogenase A (strain ATCC (EC 1.1.1.—) (BDH I) 824/DSM 792/ JCM 1419/LMG 5710/VKM B- 1787) Q04945 1119480 bdhB NADH-dependent Clostridium CA_C3298 butanol acetobutylicum dehydrogenase B (strain ATCC (EC 1.1.1.—) (BDH II) 824/DSM 792/ JCM 1419/LMG 5710/VKM B- 1787) Q46856 12933386; yqhD b3011 Alcohol Escherichia coli 947493 JW2978 dehydrogenase YqhD (strain K12) (EC 1.1.1.—) Q12068 854014; GRE2 NADPH-dependent Saccharomyces YOL151W methylglyoxal cerevisiae (strain reductase GRE2 (EC ATCC 204508/ 1.1.1.283) (3- S288c) (Baker's methylbutanal yeast) reductase) (EC 1.1.1.265) (Genes de respuesta a estres protein 2) (Isovaleraldehyde reductase) P00331 855349 ADH2 ADR2 Alcohol Saccharomyces YMR303C dehydrogenase 2 (EC cerevisiae (strain YM9952.05C 1.1.1.1) (Alcohol ATCC 204508/ dehydrogenase II) S288c) (Baker's (YADH-2) yeast) P0A9S1 12930229; fucO b2799 Lactaldehyde Escherichia coli 947273 JW2770 reductase (EC (strain K12) 1.1.1.77) (Propanediol oxidoreductase) P20368 3188393 adhA Alcohol Zymomonas ZMO1236 dehydrogenase 1 (EC mobilis subsp. 1.1.1.1) (Alcohol mobilis (strain dehydrogenase I) ATCC 31821/ (ADH I) ZM4/CP4) A2PYM4 bdh Butanol Clostridium dehydrogenase saccharoperbutyl acetonicum A6LU64 5292938 Cbei_1722 Iron-containing Clostridium alcohol beijerinckii dehydrogenase (strain ATCC 51743/NCIMB 8052) (Clostridium acetobutylicum) A6LVG8 5293392 Cbei_2181 Iron-containing Clostridium alcohol beijerinckii dehydrogenase (strain ATCC 51743/NCIMB 8052) (Clostridium acetobutylicum) A6LW49 5293624 Cbei_2421 Iron-containing Clostridium alcohol beijerinckii dehydrogenase (strain ATCC 51743/NCIMB 8052) (Clostridium acetobutylicum) P38715 856504 GRE3 NADPH-dependent Saccharomyces YHR104W aldose reductase cerevisiae (strain GRE3 (EC 1.1.1.21) ATCC 204508/ (NADPH-dependent S288c) (Baker's methylglyoxal yeast) reductase GRE3) (Xylose reductase) (EC 1.1.1.—) Q5FQJ0 3248904 GOX1615 Putative Gluconobacter oxidoreductase (EC oxydans (strain 1.1.1.—) 621H) (Gluconobacter suboxydans) P28811 879097 mmsB, EC 1.1.1.31 Pseudomonas PA3569 3-hydroxyisobutyrate aeruginosa dehydrogenase (strain ATCC 15692/PAO1/ 1C/PRS 101/ LMG 12228) Q5SLQ6 3168163 TTHA0237 EC 1.1.1.31 Thermus 3-hydroxyisobutyrate thermophilus dehydrogenase (strain HB8/ ATCC 27634/ DSM 579) A6LU64 5292938 Cbei_1722 Iron-containing Clostridium alcohol beijerinckii dehydrogenase. (strain ATCC 51743/NCIMB 8052) (Clostridium acetobutylicum) B3LMK7 SCRG_02216 Medium chain alcohol Saccharomyces dehydrogenase cerevisiae (strain RM11-1a) (Baker's yeast) C4QWW0 8196620 PAS_chr1- Medium chain alcohol Komagataella 1_0357 dehydrogenase pastoris (strain (NADPH) GS115/ATCC 20864) (Yeast) (Pichia pastoris) A6ZTC9 ADH7, Medium chain alcohol Saccharomyces SCY_0522 dehydrogenase cerevisiae (strain YJM789) (Baker's yeast) P27250 12934055 Ahr yjgB Aldehyde reductase Escherichia coli 948802 b4269, (strain K12) JW5761
[0273] Additional genes coding for enzymes capable of the conversion of 3-hydroxybutanal to 1,3-butanediol (Activity H) can be identified based on sequence homology to those examples in Table 7.
Example 4—Culture of Acetogen Strains for Production of 1,3-Butanediol or Other Downstream Product
[0274] For the production of downstream products of 3-hydroxybutanal such as 1,3-butanediol the recombinant acetogen strain may be cultured in a defined, semi-defined or undefined medium supplemented with syngas as the only or principle carbon and energy source is well known in the art. Examples of additional sources of energy or carbon may be nitrate, methanol or sugar. It is highly desirable to maintain anaerobic conditions as the acetogen strains of the present Example are strict anaerobes. Initial tests with the wild type organism and with genetically modified organisms before moving to a fermenter can be done in small bottles that are fitted with thick rubber stoppers and aluminium crimps employed to seal the bottles and as those skilled in the art will understand.
[0275] Suitable replicates such as triplicate cultures can be grown for each engineered strain and culture supernatants can be tested for products formed. For example, syngas composition in the media, metabolic intermediates, 1,3-butanediol and by-product(s) formed in the engineered production host can be measured as a function of time and can be analysed by methods such as High Performance Liquid Chromatography (HPLC), GC (Gas Chromatography), GC-MS (Gas Chromatography-Mass Spectroscopy) and LC-MS (Liquid Chromatography-Mass Spectroscopy) or other suitable analytical methods using routine procedures well known in the art.
[0276] Acetate, pyruvate, acetyl-Co A, 3-hydroxybutanal, 1,3-butanediol and intermediates or other desired products can be quantified by HPLC using as appropriate, a refractive index detector or UV detector or other suitable assay and detection methods well known in the art. The individual enzyme or protein activities expressed from the heterologous DNA sequences or overexpressed endogenous DNA sequences, can also be assayed using methods well known in the art.
[0277] Fermentations can be performed in continuous cultures, batch or fed-batch. All of these processes are well known in the art. Important process considerations for syngas fermentation are high biomass concentration and good gas-liquid mass transfer Bredwell et al, (1999), Biotechnol. Prog. 15:834-844. As carbon monoxide has a lower solubility in water compared to oxygen, continuously gas-sparged fermentations are recommended and can be performed in controlled fermentors with constant off-gas analysis by mass spectrometry and periodic liquid sampling and analysis discussed above. Other feedstocks such as methanol or sugar can be fed to the fermentor using traditional approaches.
Example 5. Generation of a Lactate Dehydrogenase Gene Knockout in Acetobacterium woodii
Plasmids and Primers
[0278]
TABLE-US-00008 Restriction Primer Sequence site EryFor ggGGATCCAATG BamHI ATACACCAATCA GTGC EryXbaRev ggTCTAGATTGA XbaI ACCCGTCTCCTT ACG 01For ggGAATTCatgt EcoRI (uplacdehyEco) cgatcatattga agg 01Rev aaGGATCCctta BamH1 (uplacdehyBam) aacgaccatcc 02For cctctagagtga XbaI (dwnlacdehyXba) gatgatggataa c 02Rev gcAAGCTTCTGC PstI, (dwnlacdehyPstHind) AGtcatccaaat HindIII gtgcttaacaac c 16For aaTCTAGAttag XbaI tcggtgcctgtg 16Rev ggAAGCTTtctt HindIII tacgttctacg 13b aaACTAGTggcg SpeI (LDHantiFor50) attccaacggcg at 13 aaCTCGAGctac XhoI (LDHantiRev) atctgacagact tttttcgg pAMβ1For CGATTTCCGATT — GATTGCTT pAMβ1Rev AAT CCC AAA — TGA GCC AACAG
TABLE-US-00009 Plasmid Description pUC19 ampicillin resistance, suitable for blue white cloning pTRKH2 Erythromycin resistance, replicon for gram+ and E. coli pUC19-Ery(XbaI) pUC19 vector containing the Erythromycin (pE) resistance gene in the BamHI and XbaI site pUC19-Ery-LDHup- pUC19 vector containing the Erythromycin LDHdown resistance gene in the BamHI and XbaI site and (pE01-02) the LDH upstream region cloned in EcoRI-BamHI and LDH downstream region of cloned into XbaI-HindIII pUC19-Ery-LDHk/o pUC19 vector containing the Erythromycin (pE16) resistance gene in the BamHI and XbaI site and a 728 bp fragment of the LDH gene pUC19-pAMβ1-Ery pUC19 vector containing the gram+ replicon (pEP) pAMβ1 in the EcoRI and KpnI site, Erythromycin resistance gene in the BamHI and XbaI
Media for Acetobacterium woodii
[0279] The medium was prepared using anaerobic techniques and contained under an N.sub.2—CO.sub.2 atmosphere (80:20) the following per 1000 ml:
TABLE-US-00010 KH.sub.2PO.sub.4 1.76 g K.sub.2HPO.sub.4 8.44 g NH.sub.4Cl 1.0 g cysteine hydrochloride 0.5 g MgSO.sub.4 × 6H.sub.2O 0.33 g NaCl 2.9 g yeast extract 2.0 g KHCO.sub.3 6.0 g Resazurin 0.001 g Trace element solution SL 9 1.0 ml selenite-tungstate solution 1.0 ml vitamin solution DSMZ 141 2.0 ml Carbon source 20-40 mM
[0280] Carbon source and magnesium were added after autoclaving from an anaerobe, sterile stock solution (2 M Fructose or Lactate and 0.75 M respectively).
[0281] For solid media 15 g/L agar was added and the media boiled to remove dissolved oxygen and then cooled down under a stream of gas, before autoclaving.
Vitamin Solution
[0282]
TABLE-US-00011 Biotin 2.00 mg Folic acid 2.00 mg Pyridoxine-HCl 10.00 mg Thiamine-HCl × 2H.sub.2O 5.00 mg Riboflavin 5.00 mg Nicotinic acid 5.00 mg D-Ca-pantothenate 5.00 mg Vitamin B12 0.10 mg p-Aminobenzoic acid 5.00 mg Lipoic acid 5.00 mg 1000 ml dH.sub.2O
Selenite-Tungstate Solution
[0283]
TABLE-US-00012 NaOH 0.5 g Na.sub.2SeO.sub.3 × 5H.sub.2O 3 mg Na.sub.2WO.sub.4 × 2H.sub.2O 4 mg 1000 ml dH2O
Trace Element Solution SL 9
[0284]
TABLE-US-00013 Nitrilotriacetic acid 12.8 g FeCl.sub.2 × 4H.sub.2O 2.0 g ZnCl.sub.2 0.070 g MnCl.sub.2 × 4H.sub.2O 0.1 g H.sub.3BO.sub.3 0.006 g CoCl.sub.2 × 6H.sub.2O 0.19 g CuCl.sub.2 × 2H.sub.2O 0.002 g NiCl.sub.2 × 6H.sub.2O 0.024 g Na.sub.2MoO4 × 2H.sub.2O 0.036 g
[0285] 1000 ml dH.sub.2O, Nitrilotriacetic acid was dissolved first and the pH adjusted to 6.0 with NaOH before all other Trace elements were added.
Construction of the LDH Knockout Mutant
[0286] To construct a Lactate-dehydrogenase knockout mutant two strategies were followed.
(1) Involving two cross-over recombination processes where the full length LDH gene is replaced with the Erythromycin cassette (
(2) A single recombination event leading to integration of the complete cloning plasmid and therefore interrupting the LDH gene. (
[0287] To construct the plasmids for the LDH knockout mutants of A. woodii pUC19 was used as backbone plasmid. First a erythromycin antibiotic cassette was cloned into the BamHI and XbaI restriction sites yielding the plasmid pUC19-Ery. The Erythromycin resistance cassette was amplified by PCR using gene specific primers (EryFor, EryXbaRev) and plasmid pTRKH.sub.2 as template. Functionality of the antibiotic resistance was confirmed by growth of E. coli DH10B harbouring this plasmid in the presence of 150-300 μg/ml Erythromycin.
[0288] To confirm that the plasmid does not integrate into the A. woodii genome randomly an aliquot was used to transform A. woodii. As expected no erythromycin resistance bacteria were obtained after several attempts.
[0289] For strategy (1) approximately 1000 bp flanking region upstream and downstream of the LDH gene were amplified using the gene specific primers (01For, 01Rev) for the upstream region and (02For, 02Rev) for the downstream region with genomic DNA as template. The upstream region was cloned into the EcoRI and BamHI region leading to plasmid pUC19-Ery-LDHup which was then used to clone the downstream region into XbaI and HindIII sites yielding plasmid pUC19-Ery-LDHup-LDHdown (Plasmid pE01-02). In strategy (2) a 728 bp fragment of the LDH gene generated by PCR from genomic DNA using primer 16For/16Rev, This PCR products was cloned into pUC19-Ery into XbaI and HindIII site, giving plasmid (pE16).
[0290] Plasmid pE01-02 was used to transform A. woodii. All following procedures were carried out under anaerobic conditions. 1 ml of a fresh 5 ml over-night culture was used to inoculate 10 ml media and A. woodii grown to an OD.sub.600 of approximately 0.5. Cells were spun down in hungate tubes for 10 min at 4000 rpm at 4° C. and washed twice with 10 ml ice-cold anaerobic 270 mM sucrose solution. The pellet was resuspended in 200 μL sucrose and transferred on ice into the anaerobic chamber. 4 μl of each plasmid was added to 40 μl cells, transferred to a 0.2-cm electroporation cuvette and kept on ice for 5 min. For electroporation the following settings were used: electric pulse of 10 kV, electric resistance of 400 Ω and 25 μF. Following electroporation the cells were kept on ice for another 5 min before 960 μl media was added. The transformed cells were incubated o/n at 30° C. and then transferred to 50 ml media containing the required antibiotic (20 μg/ml erythromycin). Single cross-over resistant cells grew within 48 hours. An aliquot of the liquid culture was plated on solid media with the required antibiotic (50 μg/ml erythromycin). Single colonies were obtained after 4-5 days, which were picked and grown up in 5 ml cultures in the presence of erythromycin.
[0291] For the double cross-over knockout the plasmid was cut using the restriction enzymes EcoRI and HindIII to obtain an approximately 3837 bp linear fragment containing the erythromycin gene flanked by the up and downstream LDH region. The linear fragment was gel extracted and used to transform A. woodii. The transformation of A. woodii was performed as described above. An erythromycin resistant culture was obtained after a 3-4 days. The culture were plated on solid media and colonies obtained after 5-6 days.
[0292] In both cases the colonies were screened for the presence of the erythromycin gene using primers EryFor, EryXbaRev and in the case of the double cross-over for the absence of the LDH gene using primer set 13For/Rev. In the latter case 2 colonies showed the absence of the LDH gene.
[0293] Those 2 colonies, as well as 2 colonies for the single cross-over recombination (SR) were picked and analysed for their growth on Fructose and Lactate. Two cultures of A. woodii wild type (Aw1, Aw2) and A. woodii harbouring plasmid pUC19-pAMβ1-Ery (P1, P2) were used as control strains. Plasmid pUC19-pAMβ1-Ery was constructed by cloning the gram positive replicon pAMβ1 from plasmid pTRKH.sub.2 into the EcoRI and KpnI sites of pUC19 and then cloning the Erythromycin cassette into the XbaI-BamHI site. The plasmid was then transformed into A. woodii as described before and resistance growth obtained after 2-3 days. Single colonies were picked and analyzed for the plasmid by PCR using the specific primers for the erythromycin gene (EryFor, EryXbaRev) as well for the pAMβ1 replicon (pAMβ1 For, pAMβ1 Rev).
[0294] For the growth curves 500 μl of a fresh over-night culture was used to inoculate a 50 ml anaerobe culture. Either 20 mM Fructose or 40 mM DL-Lactate ((Lactic acid) were used as a substrate. Erythromycin was prepared as a stock concentration of 2 mg/ml in water. One ml samples were taken twice a day over a period of 4 days. Of this 1 ml, 500 μl were used for OD.sub.600 measurement. The remaining 500 μl were spun down and the supernatant frozen at −20° C. for HPLC analysis.
[0295]
[0296] For HPLC analysis 10 μl samples were injected on the HPLC column Rezex ROA Organic Acid H.sup.+ (300×7.8 mm, Phenomex). The used mobile Phase was 100% 0.01N H.sub.2504. Samples were analyzed for 30 minutes with a flow rate of 0.6 ml/min.
[0297] The HPLC analysis of those cultures showed that the fructose is consumed and acetate is produced by those mutants at a similar rate and amount (
[0298] Additionally, the double cross-over knockouts are stable in contrast to the single cross-over mutants (SR). After 5 days a growth on Lactate is observed, probably due to degradation of the Erythromycin which then allows a second recombination step where the cassette is removed from the genome and a functional LDH gene is obtained. HPLC data also confirmed that Lactate is slowly utilized after 5 days by SR1 and SR2 and acetate is produced (data not shown). Those results confirm that the constructed vector can be used to generate stable knockout mutants.
Example 6. Generation of a Phosphotransacetylase (PTA) Gene Knockout in Acetobacterium woodii
Primers:
[0299]
TABLE-US-00014 EryFor ggGGATCCAATGATACACCAATCAGTGC EryXbaRev ggTCTAGATTGAACCCGTCTCCTTACG Pr1_cisFor ggACTAGTTGTTATTTGGCGATCAGC Pr4_iorRev ggCTGCAGCGCACCCATACAAAGC Pr5_PTAfrag1Rev AACATCAACATGCGGCCGCACTTACCAAATTATCTGCGTCG Pr6_PTAfrag3For AATTTGGTAAGTGCGGCCGCATGTTGATGTTATTCTCATGC
Plasmids:
[0300] pUC19 Ampicillin resistance
pTRKH.sub.2 Erythromycin resistance, replicon for gram+ and E. coli
pUC19-Ery
pUC19-Ery-ΔPTA2
Strategy
[0301] Erythromycin resistance gene was amplified from plasmid pTRKH.sub.2 using primer Ery for and EryXabRev and cloned into pUC19 yielding a non-replicative plasmid, pUC19-Ery. The PTA knock-out cassette was constructed as following: Primers Pr1_cisFor and Pr5_PTAfrag1Rev were used to amplify the upstream region of the PTA gene as well as the N-terminal part of the PTA gene from genomic A. woodii DNA. Pr4_iorRev and Pr6_PTAfrag3For were used to amplify the C-terminal part of the PTA gene as well as the downstream region. This two fragments were cloned together using SOE PCR and primers Pr1_cisFor and Pr4_iorRev. The so constructed knockout cassette harbors a modified PTA gene sequence, consisting of the N and C-terminal part of the PTA gene only. Both parts are separated by a NotI restriction site which was introduced by previous PCR round. The knockout cassette was cloned into XbaI and PstI site of pUC19-Ery, yielding plasmid pUC19-Ery-ΔPTA2
[0302] Plasmid pUC19-Ery-ΔPTA2 was used to transform A. woodii. All following procedures were carried out under anaerobic conditions. A 10 ml culture was inoculated with A. woodii and grown to an OD600 of approximately 0.5. Cells were spun down in hungate tubes for 10 min at 4000 rpm at 4° C. and washed twice with 10 ml 10 ice-cold anaerobic 270 mM sucrose solution. The pellet was resuspended in 200 μL sucrose. 4 μl of plasmid was added to 40 μl cells, transferred to a 0.2-cm electroporation cuvette and kept on ice for 5 min. For electroporation the following settings were used: electric pulse of 10 kV, electric resistance of 400 Ω and 25 μF. Following electroporation the cells were kept on ice for another 5 min. The transformed cells were recovered in media, incubated anaerobe for 6 h at 30° C. and then transferred to 50 ml of medium containing the required antibiotic (20 μg/ml erythromycin). The culture was incubated at 30° C. until growth was obtained. An aliquot of the culture was plated on solid medium. Single colonies were obtained after 5-7 days, which were picked and grown up in 10 ml cultures in the presence of erythromycin.
[0303] The cultures were genetically analyzed by specific primers to confirm the integration of the plasmid. The culture was passaged into liquid media without erythromycin to allow looping out of the plasmid and generation of a stable PTA knockout via a second recombination event. Passages were plated on solid media until such an event occurred. PTA knockout clones were screened by replica plating in the presence and absence of Erythromycin. Clones not capable of growing in the presence of Erythromycin were picked and analysed for the PTA genotype by PCR, which was confirmed.
Example 7. Heterologues Gene Expression and Protein Production in A. Woodii
Primers
[0304]
TABLE-US-00015 Pr55 gaGTCGACGCAGTATCTTAAAATTTTGTATAATAGGAATTGAAGTTAAA TTAGATGCTAAAAATTTGTAATTAAGAAGGAGTGATTACATGTTACGTC CTGTAGAAACC Pr54 TTGCATGCTCATTGTTTGCCTCCC
Strategy
[0305] The uidA (GUS) from E. coli BL21star(DE3) was amplified using gene specific primers, which included the sequence for constitutive promoters. Primer Pr55 includes the sequence from the Enterococcus faecalis Erythromycin resistance gene promoter, while primer Pr56 include the promoter sequence of the C. ljungdhalii PTA gene.
[0306] The amplified fragments were cloned into a plasmid capable of replicating in A. woodii. The replicative plasmid (pEP) carries the Erythromycin gene (described in Example 6) as well as the replicon pAMβ1. However, any other replicon suitable for A. woodii can be used. In this fashion two plasmids where generated, pEP55 carrying the uidA gene under control of the Enterococcus faecalis promoter and pEP56, carrying the uidA gene under control of the Clj promoter.
[0307] The generated plasmids were used to transform A. woodii. All following procedures were carried out under anaerobic conditions. A 10 ml culture was inoculate with A. woodii and grown to an OD600 of approximately 0.5. Cells were spun down in hungate tubes for 10 min at 4000 rpm at 4C and washed twice with 10 ml 10 ice-cold anaerobic 270 mM sucrose solution. The pellet was resuspended in 200 μL sucrose. 4 μl of plasmid was added to 40 μl cells, transferred to a 0.2-cm electroporation cuvette and kept on ice for 5 min. For electroporation the following settings were used: electric pulse of 10 kV, electric resistance of 400Ω and 25 μF. Following electroporation the cells were kept on ice for another 5 min. The transformed cells were recovered in media, incubated anaerobe for 6 h at 30 C and then transferred to 50 ml of medium containing the required antibiotic (20 μg/ml erythromycin). The cultures were incubated at 30C until growth was obtained. An aliquot of the cultures was plated on solid medium containing 20 μg/ml erythromycin. Single colonies were obtained after 5-7 days. For each transformation 2 independent colonies were picked and grown up in 10 ml cultures in the presence of erythromycin.
[0308] Functionality of uidA was established by restreaking the cultures on anaerobe selection media containing MUG (4-Methylumbelliferyl-β-D-glucopyranosiduronic acid, final concentration of 0.1 g/L) leading to a fluorescent product visible under UV-light as seen in
[0309] The same strategy described above may be applied to the introduction any other heterologous gene (such as DERA, eutE etc) during construction of a 1,3-butanediol pathway and expressing it under a strong constitutive promoter on a replicative plasmid into A. woodii. The above described reporter gene uidA can be used to confirm the expression of any other gene, when cloned in an operon. Further, the expression of uidA can be used to determine promotor strength and hence promotor selection, as the efficiency of expression is related to fluorescence intensity. To enhance genetic stability heterologous genes may be introduced into the genome.
Example 8. Generation of a Phosphotransacetylase (PTA) Mutant of Moorella thermoacetica ATCC39073 by Homologous Recombination
Introduction
[0310] The M. thermoacetica ATCC39073 genome sequence has been published (Pierce et al., 2008) and is available at the NCBI with accession number NC_007644. The KEGG map of central carbon metabolism for M. thermoacetica ATCC39073 (http://www.genome.jp/kegg-bin/show_pathway?mta01200) was used to identify two putative phosphotransacetylases (PTAs), Moth_0864 and Moth_1181 (EC 2.3.1.8); which appear to be isoenzymes and are identified as being members of the PduL superfamily of bacterial propanediol utilisation proteins, based on sequence homology. Members of the phosphate acetyl/butaryl transferase (PTA/PTB) superfamily were not identified in the M. thermoacetica ATCC39073 genome; a BLASTP search of the partial PTA from Clostridium tyrobutyricum (Zhu et al., 2005) returned no significant alignments.
Construction of Moth_0864 and Moth_1181 Knockout Plasmids
Construction of the Knockout Plasmid Backbone
[0311] The mobilisable shuttle vector pS797 is used as the backbone for construction of M. thermoacetica ATCC39073 knockout plasmids, since it already contains three of the desired genetic elements comprising the final construct; a pMB1 origin of replication for E. coli, an antibiotic selection marker (bla) and an RK4-derived conjugal origin of transfer (oriT) (Yakobson and Guiney, 1984). A thermostable (pJH.sub.1-derived) kanamycin resistance gene for M. thermoacetica ATCC39073 has previously been described in the literature (Iwasaki et al., 2013), and was synthesised without further modification using the gene sequence from the S. faecalis pJH.sub.1 kanamycin resistance gene (Genbank accession number V01547) fused to the native G3PDH promoter. Note that the knockout plasmid backbone does not include a replicon for M. thermoacetica ATCC39073, to ensure that kanamycin resistance can only be maintained in Moorella following a chromosome recombination event. Kanamycin-resistant transconjugants of M. thermoacetica ATC39073 are therefore all presumptive single crossover (SCO) chromosome mutants.
[0312] Primers APB57-65 were designed to generate knockout cassettes for Moth_0864 and Moth_1181.
TABLE-US-00016 APB # Sequence (5′-3′) Description 57 AGCTTTCGAGCGCGGA 5′ phosphorylated. Universal AC EMP R2 to splice knockout cassettes into knockout plasmids. 58 GAGTTCCATGTGGTCT SOE F1 to clone upstream ACCATAC region of chromosomal homology for Moth_0864. 59 CATGGAGGTTAAGGCT SOE R2; pair with APB58. GAGTTGACGATACACT 945 bp product. Includes GTC 13 bp overhang for assembly with APB60/61 PCR product. 60 GTCAACTCAGCCTTAA SOE 3F; to clone downstream CCTCCATGACGACCAG region of chromosomal homology for Moth_0864 knockout. Includes 11 bp overhang for assembly with APB58/59 PCR product. 61 GACGAGCAAGGCAAGA SOE 4R; pair with APB60. CCGGGATCCGACAGTA 1015 bp product. Includes ACCGTAGGTACCTTCG 25 bp 3′ overhang for EMP splicing into plasmid backbone. 62 CCAGTGATCTCTTTAT SOE F1 to clone upstream CGACCTCC region of chromosomal homology for Moth_1181 63 GGTGTGCATGTGCAAG SOE F2, pair with APB62. GACACGCACCTTTTCT 994 bp product. 3′ overhang AG for SOE splicing with APB64/65. 64 TGCGTGTCCTTGCACA SOE 3F. Clone downstream TGCACACCGATGAGG region of chromosomal homology for Moth_1181. 5′ overhang to splice with APB62/63. 65 GACGAGCAAGGCAAGA SOE 4R. Pair with APB64. CCGGGATCCGCTTCAA 994 bp product. Includes CCCAAGCTTGTAGC 25 bp 3′ overhang to EMP PCR splice into knockout plasmid backbone.
[0313] Upstream and downstream regions of approximately 1 kb flanking a 282 bp and 176 bp internal region of Moth_0864 and Moth_1189, respectively were PCR-amplified from M. thermoacetica genomic DNA with compatible overhanging ends. The two flanking regions for each gene were then assembled into a single molecule of approximately 2 kb using SOE (splicing by overlap extension) PCR. These assembled knockout cassettes were independently spliced into the knockout plasmid backbone pDH160 by EMP PCR (Ulrich et al., 2012) to generate two new constructs; pDH177 and pDH180 (Moth_0864 and Moth_1189 knockout plasmids, respectively).
Generation of Independent SCO Mutant Strains of Moth_0864 and Moth_1189 in M. thermoacetica ATCC39073
[0314] Knockout plasmids are used to independently transform E. coli conjugal donor strain S17-1 and resulting strains maintained on selective agar media containing 100 μg/ml carbenicillin. For each gene knockout, biomass equivalent to a 10 μl inoculation “loopful” from overnight growth of the conjugal donor strain and the conjugal recipient strain (the latter being wild-type M. thermoacetica ATCC39073 grown on brain-heart infusion agar (BHIA; Oxoid) supplemented with 2% (w/v) fructose (BHIAF) and incubated at 55° C.) are emulsified and spread onto BHIA. The conjugation mix is incubated for 8 hours at 37° C. and is then re-suspended in 1 ml of pre-reduced ATCC medium 1754 using a sterile spreader. The emulsified conjugation mix is diluted 10.sup.−1 to 10.sup.−6 in ATCC medium 1754 and 200 μl of each dilution is spread onto selective agar (BHIAF plus kanamycin 150 μg/ml) and incubated at 55° C. in anaerobic jars. Transconjugant Moorella colonies (presumptive SCOs) are typically recovered within 8-10 days. This is believed to be the first account of genetic transformation of Moorella sp. using conjugation.
Generation of Double Crossover (DCO) Stable Mutants of Moth_0864 and Moth_1189 in M. thermoacetica ATCC39073
[0315] The following method can be used to isolate chromosomal deletion mutants, generated from SCOs by homologous recombination following sequential passage. Single, isolated transconjugant colonies of M. thermoacetica ATCC39073 can be used to independently inoculate 20 mL aliquots of pre-reduced ATCC medium 1754 in sealed Hungate tubes and are incubated for at least 24 hours, until turbid; this is passage 1. Following incubation, 4 mL of passaged culture is added to 4 mL of 50% (v/v) pre-reduced glycerol in a sealed serum bottle and is stored at −80° C. In addition, 100 μL of passaged culture is diluted 10.sup.−1 to 10.sup.−6 in ATCC medium 1754 and 200 μl of each dilution are spread onto selective agar (BHIAF plus kanamycin 150 μg/ml) and incubated at 55° C. in anaerobic jars to isolate single colonies. Finally, 200 μl of passaged culture is used to inoculate a 20 mL aliquot of pre-reduced ATCC medium 1754 in a sealed Hungate tube and is incubated for at least 24 hours, until turbid (passage 2). Passaging of SCOs proceeds until kanamycin-sensitive colonies are isolated (see below).
[0316] Single colonies isolated from each passage (approximately 100) are replica-plated onto BHIAF with and without 150 μg/ml kanamycin and are incubated at 55° C. Kanamycin-sensitive colonies are presumptive double-crossover mutants (i.e the knockout plasmid has been lost following a second recombination event). Genomic DNA is prepared from presumptive DCO mutants and the target gene is PCR-cloned and sequenced to check for the designed deletion mutation.
REFERENCES FOR EXAMPLE 8
[0317] Iwasaki, Y., Kita, A., Sakai, S., Takaoka, K., Yano, S., Tajima, T., Kato, J., Nishio, N., [0318] Murakami, K., and Nakashimada, Y. (2013). Engineering of a functional thermostable kanamycin resistance marker for use in Moorella thermoacetica ATCC39073. FEMS Microbiol. Lett. 343, 8-12. [0319] Pierce, E., Xie, G., Barabote, R. D., Saunders, E., Han, C. S., Detter, J. C., Richardson, P., Brettin, T. S., Das, A., Ljungdahl, L. G., et al. (2008). The complete genome sequence of Moorella thermoacetica (f. Clostridium thermoaceticum). Environ. Microbiol. 10, 2550-2573. [0320] Ulrich, A., Andersen, K. R., and Schwartz, T. U. (2012). Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints. PLoS ONE 7, e53360. [0321] Yakobson, E. A., and Guiney, D. G. (1984). Conjugal transfer of bacterial chromosomes mediated by the RK2 plasmid transfer origin cloned into transposon Tn5. J. Bacteriol. 160, 451-453. [0322] Zhu, Y., Liu, X., and Yang, S.-T. (2005). Construction and characterization of pta gene-deleted mutant of Clostridium tyrobutyricum for enhanced butyric acid fermentation. Biotechnol. Bioeng. 90, 154-166.
Example 9. Enzymes for the Reduction of 3-Hydroxybutanal to 1,3-Butanediol
Introduction
[0323] This example describes the ability for selected reductases to demonstrate a preference for a C4 aldehyde (model substrate butanal and target 3-hydroxybutanal) relative to a C2 aldehyde (acetaldehyde) as discussed in Example 3; GOX1615 from Gluconobacter oxydans, BdhB from Clostridium acetobutylicum and GRE2 from Saccharomyces cerevisiae were selected for demonstration of this required principle. There follows a description of cloning, purification and enzyme assay for these three selected enzymes.
Gene and Protein Information
[0324]
TABLE-US-00017 UniProt Size of his Gene Name entry NCBI ID Organism tagged protein GOX1615 Q5FQJ0 3248904 Gluconobacter 39376.7 oxydans BdhB Q04945 1119480 Clostridium 45450 CA_C3298 acetobutylicum GRE2 Q12068 854014 Saccharomyces YOL151W cerevisiae (strain ATCC 204508/S288c
a) GOX1615
Construction of a GOX1615 Expression Plasmid
[0325] Primers Pr89 (5′-GCCATATGGCATCCGACACCATCC) and Pr90 (5′-CCGGATCCTCAGTCCCGTGCC) were used to amplify the G. oxydans GOX1615 gene; which had previously been obtained by commercial DNA synthesis and delivered on a plasmid. The amplicon was cloned into pET3a and pET14b (Novagen); with the latter construct adding an N-terminal 6-His tag to the GOX1615 coding sequence in order to facilitate purification of the enzyme by nickel-affinity chromatography.
[0326] PCR was performed using Q5 proofreading DNA polymerase (New England Biolabs) following the manufacturer's protocol and using an annealing temperature of 55° C. The resulting PCR product (1008 bp) was purified by gel extraction, and was then digested using NdeI and BamHI restriction endonucleases (New England Biolabs). Following heat inactivation of the restriction enzymes (manufacturer's protocol), the digested PCR product was ligated into pET14b and pET3a and an aliquot of the ligation mix was used to transform E. coli DH10B. Transformants were screened for presence of the GOX16515 gene by colony PCR using T7 forward and reverse primers (using a Taq polymerase with annealing at 55° C.). Two positive clones from each transformation were picked for plasmid DNA extraction and the correct constructs further confirmed by restriction digest. The positive clones were stored in 15% glycerol at −80° C. (pET14b-GOX1615: pDH358 and pDH359; pET3a-GOX1615 pDH351, pDH353). Expression plasmid pDH358 was subsequently confirmed by sequencing using primers pET3a-F and pET3a-R.
Expression and Purification of GOX1615
[0327] Plasmid pDH358 (pET14b-GOX) was used to transform E. coli BL21 Star (DE3) with the resulting strain (DH369) stored in 15% glycerol at −80° C. A single colony of DH369, and vector control strain DH228, were inoculated into 5 mL auto inducing medium (per litre: 6 g Na.sub.2HPO.sub.4, 3 g KH.sub.2PO.sub.4, 5 g Yeast extract, 5 g NaCl with 10 mL 60% v/v glycerol, 5 mL 10% w/v glucose, 25 mL 8% w/v lactose filter sterilised and added post autoclaving; Studier, F. W. 2005) in 50 mL tubes and the cultures grown overnight at 37° C. with continuous shaking at 225 rpm. 1 mL aliquots of cells were harvested by centrifugation and the cell pellets resuspended in 200 μl of Bugbuster (Novagen). After incubation at room temperature for 20 minutes, the mix was centrifuged for 5 min at 14000× g and the supernatant retained. The resulting pellet was resupended in 200 μl 50 mM Tris-HCl pH 7.0. Supernatant and pellet samples were mixed 1:1 was 2×SDS buffer, boiled for 10 min, centrifuged for 2 min at 14000×g and subsequently 5 μl of each sample was loaded on a 12% gel SDS PAGE gel to confirm presence of GOX1615 protein.
[0328] For purification of His-tagged GOX1615, 1 mL of an overnight DH369 culture grown in LB containing 100 μg/mL carbenicillin was used to inoculate 100 mL of the same medium. Cells were grown at 37° C. to an OD600 nm of 0.6-0.9. Gene expression was induced with 0.4 mM IPTG and cells incubated overnight with shaking at 200 rpm at 18° C.
[0329] The culture was harvested by centrifugation and samples were maintained at 4° C. for subsequent steps. The pellet was resuspended in 5 mL binding buffer (50 mM Na-phosphate pH 8.0, 0.5 M NaCl, 5 mM Imidazole) and sonicated on ice: 5×30 sec; amplitude 10% with a 30 sec break between pulses. The lysed cell suspension was clarified by centrifugation at 14000×g for 15 mins, 4° C. and GOX1615 purified from the cleared cell lysate by affinity purification using a HisTrap™ HP 5 mL column and AKTA start chromatography (GE Healthcare Life Sciences) system following manufacturers protocols. Purified protein was stored at −80° C.
Assay of GOX1615 Reductase Activity with C2 and C4 Substrates
[0330] Assays were performed in a volume of 1 mL directly in 1.5 mL UV cuvettes. Consumption of NAD(P)H was measured at 340 nm. The reaction was started by addition of 100 μL of substrate solution and measured over 2-5 min.
[0331] 3-Hydroxybutanal (technical grade) was purchased from BOC. Activities are therefore minimal activities when in the linear range as the standard was not pure.
[0332] The results shown below indicate the desired preference GOX1615 displays for a C4 aldehyde including 3-hydroxybutanal compared with activity towards acetaldehyde as substrate:
TABLE-US-00018 Concentration 3-hydroxybutanal Butanal Acetaldehyde Substrate (mM) (units) GOX1615, 0.15 mM NADPH, 50 mM Na-phosphate pH 7.0, 25° C. 1 0.1 9.63 0.006 5 2.49 17.7 10 3.75 23.3 0.12 20 5.28 GOX1615, 0.15 mM NADH, 50 mM Na-phosphate pH 7.0, 25° C. 10 0.37 1 unit = 1 μmol/min/mg
b) BdhB
Construction of BdhB Expression Plasmids
[0333] The bdhB gene of Clostridium acetobutylicum was obtained by commercial DNA synthesis and was independently spliced into expression vectors pET3a and pET14b; in-frame with the 3′ sequence encoding a 6-His tag of the latter, using EMP PCR. Sequenced clones pDH365, pDH366 (pET14b-BdhB) and pDH380, pDH381 (pET3a-BdhB) were used to transform E. coli DH10B and were stored in 15% Glycerol at −80 C.
Expression and Purification of BdhB
[0334] Plasmid pDH365 (pET14b-BdhB, MP1) was used to transform BL21*(DE3). The generated culture was stored in LB containing 15% glycerol at −80° C. (DH372). A 400 mL auto-inducing media (Foremedia) culture was inoculated from glycerol stock and grown for 20-24 h at 30° C., 250 rpm shaking. The culture was spun down (4000 rpm, 30 min, 4=C), the pellet was washed twice with 10 mM sodium phosphate buffer pH 7.0 and resuspended in 5 mL Binding buffer with ZnSO4 and DTT (10 mM Na-phosphate pH 7.0, 5 mM Imidazole, 0.1 mM ZnSO.sub.4, 1 mM DTT and protease inhibitors). Cells were lysed by glass beads (four cycles of 20 s, 5.5 m/s, two minutes on ice between each cycle) cell lysate was cleared by centrifugation at 4000 rpm, 15 min, 4° C. and purified using a 5 ml HisTrap column and AKTA 900 system as described previously for purification of GOX1615. All procedures were carried out under anaerobic conditions
Assay of BdhB Reductase with C2 and C4 Substrates
[0335] The activity of BdhB against acetaldehyde and butanal was measured at 25° C. at 1 ml reaction volume under anaerobic conditions. Enzyme assays were performed in 50 mM MES buffer pH 6.5 containing 1 mM DTT and 0.1 mM ZnSO4. Reactions were carried out in disposable UV cuvette sealed with a rubber stopper. Consumption of NAD(P)H was measured at 340 nm. The reaction was started by adding 100 μl of the substrate. The linear reaction was measured over a range of 10 min. The following data were obtained.
TABLE-US-00019 Concentration Butanal Acetaldehyde Substrate (mM) (units) BdhB, 0.15 mM NADH, 50 mM MES pH 6.5, 0.1 mM ZnSO.sub.4 25° C. 1 0.03 No measured activity 5 0.06 No measured activity BdhB, 0.15 mM NADPH, 50 mM MES pH 6.5, 0.1 mM ZnZnSO.sub.4 25° C. 1 0.14 No measured activity 5 0.27 No measured activity 1 unit = 1 μmol/min/mg
[0336] In a separate experiment 3-hydroxybutanal was also shown to be a substrate. At 5 mM 3-hydroxybutanal with co factor NADH the rate was 0.012 μmol/min/mg protein
c) GRE2
Construction of a GRE2 Expression Plasmid
[0337] GRE2 was PCR-amplified from Saccharomyces cerevisiae genomic DNA using a proofreading DNA polymerase and primer pair Pr91 (5′-GCCATATGTCAGTTTTCGTTTCAGG) and Pr92 (5′-CGGATCCTTATATTCTGCCCTC). The 1038 bp PCR product was purified by gel extraction and was then restriction-cloned into expression plasmids pET14b and pET3a via 5′ NdeI and 3′ BamHI enzyme cleavage sites; a method well-known in the art. The resulting ligation mixes were used to independently transform aliquots of chemically-competent E. coli DH10B. Successful clones for each ligation were identified by colony PCR and further confirmed by restriction analysis of plasmid minipreps. Resulting plasmids were assigned the following IDs: pET14b-GRE2: pDH360; pET3a-GRE2: pDH376.
Expression and Purification of GRE2
[0338] Plasmid pDH360 was used to transform E. coli BL21 Star (DE3). For protein production, the resulting strain (DH370) was used to inoculate an LB medium containing 100 μg/mL carbenicillin and incubated at 37° C. to an OD600 of 0.6-0.9. GRE2 expression was induced with 0.4 mM IPTG and incubation at 18° C. with shaking at 200 rpm for 18 hours.
[0339] Induced bacteria were recovered by centrifugation and protein purification was carried out as follows: bacteria were resuspended in 5 ml binding buffer (50 mM Na-phosphate pH 8.0, 0.5 M NaCl, 5 mM Imidazole) and sonicated on ice for 5×30 sec, amplitude 10% with a 30 sec break between pulses. Lysed bacteria were recovered by centrifugation at 15000 rpm and 4° C. An aliquot of the supernatant was kept for analysis by SDS PAGE before the remaining supernatant was loaded on a 3 or 5 mL nickel affinity column (Qiagen, NTA), which had been equilibrated with 10 column volumes of binding buffer. The flow-through was collected for analysis by SDS PAGE. Unbound protein was washed from the column with 15 ml of binding buffer and 15 ml of wash buffer (50 mM Na-phosphate pH 8.0, 0.5 M NaCl, 100 mM Imidazole). Again the flow-through was collected for SDS gel analysis. Finally bound protein was eluted with 10 ml of elution buffer (50 mM Na-phosphate pH 8.0, 0.5 M NaCl, 400 mM Imidazole). The presence of protein in eluted fractions was rapidly confirmed by Bradford assay and were then further analysed by SDS PAGE for the presence of GRE2. Enzyme-containing fractions were buffer-exchanged to 50 mM Na-phosphate pH 7.0 immediately after purification using PD10 columns. Purified enzyme was stored at 4° C. until assay.
Assay of GRE2 Reductase Activity with C2 and C4 Substrates
[0340] The activity of GRE2 against acetaldehyde and butanal was studied. Reactions were carried out 25° C. at 1 mL reaction volume. Enzyme assays were performed in disposable UV cuvette sealed with a rubber stopper. Consumption of NAD(P)H was measured at 340 nm. The reaction was started by adding 100 μl of the substrate. The linear reaction was measured over a range of 2-5 min. The following data were obtained and show the required preference for the longer chain aldehyde butanal relative to acetaldehyde. As shown for the examples above, GRE2 would be expected to be active on 3-hydroxybutanal.
TABLE-US-00020 GRE2, 0.15 mM NAD(P)H, 50 mM Na-phosphate pH 7.0, 25 C. NADPH NADH Butanal (mM) units Butanal (mM) units 1 5.5 1 0.14 2 13.8 5 0.63 5 24 10 0.84 10 21.6 20 1.35 NADPH Acetaldehyde NADH (mM) units Acetaldehyde (mM) units 10 0.57 5 0.029 40 1.64 10 0.032 1 unit = 1 μmol/min/mg
REFERENCES FOR EXAMPLE 9
[0341] Studier, F. W. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 2005 May; 41(1):207-34.
Example 10. Production of 1,3-Butanediol from Acetyl CoA (Route 2, FIG. 3)
[0342] Described below is an in vitro example of a pathway where DERA is supplied with acetaldehyde from an acetaldehyde dehydrogenase and where the DERA product 3-hydroxybutanal is reduced to 1,3-butanediol using GOX1615 reductase. Further methodology is described in Example 11 below. These data demonstrate how DERA can be supplied acetaldehyde from a preceding pathway enzyme to effect synthesis of hydroxybutanal and a downstream product (here: 1,3-butanediol).
TABLE-US-00021 UniProt Size of his Gene Name entry NCBI ID Organism tagged protein eutE P41793 1253985 Salmonella 50 KDa enterica subsp. enterica serovar Typhimurium str. LT2
Expression and Preparation of Lysates Containing EutE
[0343] E. coli BL21 Star (DE3) cells bearing either an empty pET3a vector (DH228) or a DERA:EutE fusion (DH357; Example 11 below) were inoculated as a seed culture in 5 ml LB medium (10 g/l tryptone, 5 g/l yeast extract, 10 g/L NaCl) containing 100 μg/ml carbenicillin. After overnight growth at 37° C., cultures were diluted to OD590 nm 0.1 and grown at 37° C. in 50 ml of the same medium to an OD590 nm of 0.4 to 0.6. Protein expression was then induced by adding 0.4 mM IPTG, followed by incubation at 18° C. overnight with shaking.
[0344] Following overnight growth, induced bacteria were recovered by centrifugation at 4,000 rpm for 10 min at 4° C. The pellet was then washed twice with 10 mM sodium phosphate buffer, pH 7.0 and resuspended in 2 ml of lysis buffer (10 mM sodium phosphate buffer pH 7.0 containing 1 mM DTT and protease inhibitor cocktail (SigmaFast, Sigma S8820)). Cells were lysed by sonication as described previously. The resulting lysate was clarified by a centrifugation step at 15,000×g for 5 min at 4° C. and the supernatant was recovered.
[0345] Production of 1,3-butanediol was carried out for an arbitrary 120 hours at 25° C. using the reagents shown below with a lysate volume of 1/10th the assay volume.
Reagents and Concentrations Used for the Production of 1,3-BDO from Acetyl-CoA.
[0346] Cofactor recycle was achieved using glucose and glucose dehydrogenase (GDH)
TABLE-US-00022 Reagent Concentration in assay Acetyl-coA 10 mM NADH 0.15 mM NADPH 0.15 mM GDH 0.1 mg/ml GOX1615 0.011 mg/ml Glucose 10 mM EcDERA (Sigma 91252), added where 12 mg/ml (3.6 units/mg, Sigma) indicated Buffer qs 250 μl
[0347] A control reaction comprised 10 mM acetaldehyde, 0.15 mM NADH, 0.15 mM NADPH, 0.1 mg/mL GDH and 0.011 mg/mL GOX1615 in a 10 mM sodium phosphate buffer, pH 7.0 without addition of DERA or lysate. This control confirmed that no 1,3-BDO was produced via abiotic chemical condensation of acetaldehyde to 3-hydroxybutanal Detection of 1,3-BDO, ethanol and acetaldehyde was carried out using HPLC (Phenomenex Rezex OA column organic acid H+300×7.8 mm).
Results
[0348]
TABLE-US-00023 [Acetaldehyde] [1,3 Butanediol] [Ethanol] Incubation Conditions mM mM mM DH228 (Empty Vector no eutE) + EcDERA −GOX1615 ND ND ND +GOX1615 ND ND ND DH357 (eutE-EcDERA fusion) + EcDERA −GOX1615 ND ND ND +GOX1615 ND 0.31 ND ND = None detected
[0349] The control reaction (containing 10 mM acetaldehyde alone) exhibited no detectable 1,3-butanediol.
[0350] 1,3-Butanediol was confirmed by LC/mass spectrometry. Representative mass spectrometry data are shown in
Example 11. Construction of a EutE:DERA Fusion Protein
Introduction
[0351] A fusion of heterologous pyruvate dehydrogenase (PDC) and alcohol dehydrogenase (ADHE), expressed in E. coli has been previously shown to exhibit improved ethanol production when compared to individually expressed enzymes alone, despite the fusion enzyme having a 20-fold less specific activity for ADH (Lewicka et al 2014). Substrate channeling of acetaldehyde (a cytotoxic, volatile intermediate of relevance to this invention) was attributed to the observed improvement in ethanol titre.
[0352] A functional enzyme fusion of DERA and an acetaldehyde dehydrogenase (e.g eutE), or DERA and pyruvate decarboxylase or DERA and an enzyme capable of acetate reduction for example, would be expected to work in a comparable way to improve the conversion of acetyl-CoA to 3-hydroxybutanal; (or pyruvate or acetate to 3-hydroxybutanal) either by substrate channeling of the acetaldehyde intermediate, or by locally increasing the substrate concentration around the DERA active site. In principle any component of a complete DERA pathway could be introduced as a fusion protein to optimise pathway performance.
[0353] Proteins comprising a biosynthetic pathway may also be linked by other approaches whereby the enzymes are not fused, but are retained in close proximity. For example, the localisation to a bacterial microcompartment by the use of an N-terminal targeting peptide in order to generate an “ethanol bioreactor” within the cell (Lawrence et al 2014); or the potential for use of bacterial scaffoldins to position proteins into a complex (Ding et al 2003). These techniques could equally be applied to the current invention.
Construction of a EutE:DERA Fusion
[0354] An enzyme fusion comprising the E. coli K12 DERA (GenBank: CAA26974.1) and EutE (Salmonella typhimurium LT2; GenBank: AAL21357.1) was constructed by removing the corresponding start and stop codons from an existing polycistronic expression operon using inverse PCR without the addition of a linker, with the resulting fusion enzyme found to be functional. The following method for creating enzyme fusions may be applied to one or more of the enzymes comprising a metabolic pathway containing DERA for the purpose of the synthesis of 1,3-butanediol or other chemicals.
[0355] A divergent primer pair APB142F (5′-AATCAACAGGATATTGAACAGGTGGTG; 5′ phosphorylated) and APB143R (5′-GTAGCTGCTGGCGCTCTTAC) were designed to remove the intergenic region between adjacent DERA and EutE genes (including the stop codon of the DERA coding sequence and the start codon of the downstream EutE coding sequence in plasmid pDH291, pET3a-DERA-EutE-GOX1615) by inverse PCR; such that the two coding sequences would be fused into one continuous open reading frame when the PCR product (comprising the entire expression plasmid) was re-ligated. The linear 7.8 kb APB142/APB143 inverse PCR product was purified, ligated and used to transform chemically-competent E. coli JM109. Two carbenicillin-resistant transformants were subcultured on selective media and assigned strain IDs DH337 and DH338, respectively. Strains DH356 (E. coli BL21 Star (DE3)/pDH337), DH357 (E. coli BL21 Star (DE3)/pDH338), DH301 (E. coli BL21 Star (DE3)/pDH291) and DH228 (E. coli BL21 Star/pET3a; negative control) were used to independently inoculate 6 mL of auto-inducing media (Studier 2005) with 100 μg/L carbenicillin and were incubated overnight (16-18 h) at 37° C., 225 rpm. Following incubation, biomass was recovered by centrifugation and lysed at 4×5.5 m/s in a FastPrep bead beater, using 0.1 mM acid-washed glass beads. The soluble fraction (supernatant) was recovered by centrifugation (13.4 krpm at 4° C. in a bench-top centrifuge) and proteins resolved by 10% SDS PAGE to confirm expression of the 76.76 KDa DERAE-EutE fusion protein in both strains DH356 and DH357.
[0356] The fusion protein was expressed as described in Example 10. The fusion protein was confirmed to be active with respect to both acetaldehyde dehydrogenase activity (eutE) and deoxyribose-5-P-phosphate aldolase (DERA) activity. Assays were carried out as described in Example 13 using an alcohol dehydrogenase linked assay to detect the product acetaldehyde from either acetyl CoA or deoxyribose-5-P-phosphate respectively. Measured activities were 4.2 μmol/min/mg and 5 μmol/min/mg.
REFERENCES FOR EXAMPLE 11
[0357] Ding S Y, Lamed R, Bayer E A, Himmel M E. The bacterial scaffoldin: structure, function and potential applications in the nanosciences. Genet Eng (N Y). 2003; 25:209-25. [0358] Lawrence A D, Frank S, Newnham S, Lee M J, Brown I R, Xue W F, Rowe M L, Mulvihill D P, Prentice M B, Howard M J, Warren M J. Solution structure of a bacterial microcompartment targeting peptide and its application in the construction of an ethanol bioreactor. ACS Synth Biol. 2014 Jul. 18; 3(7):454-65. [0359] Lewicka A J, Lyczakowski J J, Blackhurst G, Pashkuleva C, Rothschild-Mancinelli K, Tautvai{hacek over (s)}as D, Thornton H, Villanueva H, Xiao W, Slikas J, Horsfall L, Elfick A, French C. Fusion of pyruvate decarboxylase and alcohol dehydrogenase increases ethanol production in Escherichia coli. ACS Synth Biol. 2014 Dec. 19; 3(12):976-8
Example 12. Production of 1,3-Butanediol from Pyruvate Using Pyruvate Decarboxylase (Isolated Enzymes). Route 4, FIG. 3
Introduction
[0360] Described below are in vitro examples of a pathway where DERA is supplied acetaldehyde from pyruvate decarboxylase and where the DERA product 3-hydroxybutanal is reduced to 1,3-butanediol using GOX1615 reductase or bdhB dehydrogenase. This work provides detailed data regarding the production of 1,3-butanediol from pyruvate. Increasing pyruvate concentration provides increasing amounts of acetaldehyde supply to the DERA enzyme.
[0361] These data demonstrate how DERA can be supplied acetaldehyde from a preceding pathway enzyme to effect synthesis of hydroxybutanal and a downstream product (here: 1,3-butanediol).
1,3-Butanediol Production with Increasing Pyruvate Concentration
[0362] Acetaldehyde was supplied to the enzyme system (1 ml) via decarboxylation of pyruvate using S. cerevisiae pyruvate decarboxylase (PDC1) 0.5 U/ml (Sigma P9474). Pyruvate was added at 5, 10, 15, 20, 30 and 50 mM. The reaction also contained 12 mg E. coli deoxyribose-5-P aldolase (DERA, 3.6 units/mg, Sigma) and 0.011 mg/ml of purified GOX1615). Recycling of the cofactor NADPH (0.15 mM) was provided by glucose dehydrogenase (GDH) from Pseudomonas sp. (Sigma 19359) added at a final concentration of 0.1 mg/ml. The concentration of reactants and products were monitored by HPLC (Phenomenex Rezex OA column organic acid H+300×7.8 mm).
[0363] The reaction was incubated at 25° C. for an arbitrary 96 hours.
1,3-Butanediol Production from Increasing Concentration of Pyruvate.
TABLE-US-00024 Initial [Acetaldehyde] [Pyruvate] mM [1,3 Butanediol] mM [Ethanol] mM mM Test Reaction (PDC + DERA + GOX1615) 5 0.65 ND ND 10 1.28 ND ND 15 1.84 ND 3.06 20 2.28 1.18 3.17 30 2.56 1.60 7.64 50 4.17 1.53 14.86 Control PDC + GOX1615 (No DERA) 5 ND 1.01 3.51 10 ND 2.19 7.23 15 ND 2.84 9.86 20 ND 3.53 13.07 30 ND 5.16 22.81 50 ND 4.70 33.61 Control PDC + DERA (No GOX 1615) 5 ND ND 1.37 10 ND ND 1.73 15 ND ND 2.34 20 ND ND 3.66 30 ND ND 7.17 50 ND ND 14.70
[0364] An example using bdhB dehydrogenase is given below. The same method was used except that pyruvate was provided at 30 mM and bdhB added at 0.07 mg/ml
TABLE-US-00025 96 Hour BdhB Test reaction Incubations (PDC + DERA + GOX1615) Initial [Pyruvate] [1,3 Butanediol] [Ethanol] mM [Acetaldehyde] mM mM mM 5 1.35 ND 1.73 30 9.34 0.4 2.46 Control PDC + BdhB (No DERA) Initial [Pyruvate] [1,3 Butanediol] [Ethanol] mM [Acetaldehyde] mM mM mM 5 4.64 ND 1.14 30 32.87 ND 1.45 ND Not detected
[0365] 1,3-butanediol was confirmed in all cases by LC/mass spectrometry. Representative mass spectrometry data is shown in
1,3-Butanediol Production from 5 mM or 30 mM Pyruvate at Different DERA Concentrations
[0366] Reactions containing 5 mM or 30 mM pyruvate as substrate and GDH cofactor recycling for GOX1615 were set up as above except the amount of E. coli DERA (3.6 units/mg, Sigma) was varied at, 12, 6, 3, 1.5, 0.75 mg. Reactants and products were monitored as above.
[0367] The reaction was incubated at 25° C. for an arbitrary 96 hours.
1,3-Butanediol Production
[0368]
TABLE-US-00026 Pyruvate supplied at 5 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA mg/ml mM mM mM 0.75 4.07 0.17 ND 1.5 3.26 0.24 ND 3 1.89 0.36 ND 6 1.64 0.43 ND 12 1.35 0.53 ND Pyruvate supplied at 30 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA mg/ml mM mM mM 0.75 31.32 0.47 2.52 1.5 29.62 0.80 2.11 3 26.62 1.36 1.69 6 22.01 1.93 1.71 12 14.76 2.48 1.25 Control PDC and GOX1615 no DERA [Pyruvate] [Acetaldehyde] [1,3 Butanediol] [Ethanol] mM mM mM mM 5 4.61 ND ND 30 30.68 ND 2.14 ND = none detected
[0369] 1,3-butanediol was confirmed in all cases by LC/mass spectrometry. A representative mass spectrum is shown in
[0370] Overall, the production of ethanol as a by-product can be improved either by improvement of the DERA enzyme (e.g evolution for better kinetics) or further evolution of a selective reductase towards reduction of 1,3-butanediol.
Example 13. Production of 1,3-Butanediol from Pyruvate Using Selected DERAs from Different Microbial Sources
Introduction
[0371] This example demonstrates that DERA's from a range of microorganisms can be suitable for condensation of two molecules of acetaldehyde to the intermediate 3-hydroxybutanal as part of a novel, in vivo unnatural metabolic pathway.
Target Gene and Protein Information
[0372]
TABLE-US-00027 Size of Name UniProt entry NCBI ID Source organism protein EcDERA P0A6L0 948902 Escherichia coli 27.73 KDa AwDERA H6LF13 WP_014354523.1 Acetobacterium 23.84 KDa woodii PaDERA Q8ZXK7 1465578 Pyrobaculum 24.54 KDa aerophilum GtDERA A4IR26 WP_008879914.1 Geobacillus 23.3 KDa thermodenitrificans NG80-2
Isolation and Sequencing of a Geobacillus thermodenitrificans Strain NG80-2 DERA Homolog from Geobacillus thermodenitrificans Strain K1041
[0373] A homolog of the gene GTNG_2435 from G. thermodenitrificans strain NG80-2 (for which there is a published genome sequence) was identified, PCR cloned and sequenced from G. thermodenitrificans K1041. PCR primers APB106F (5′-ATGACGGTGAATATTGCTAAAATGATCG) and APB107R (5′-TTAATAGTCAGCGCCGCCGGTTTG) were designed based on the GNTG_2435 sequence as a template, and were used along with Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the manufacturer's recommended PCR reaction conditions to PCR-clone an approximate 672 bp product from G. thermodenitrificans K1041 genomic DNA; confirmed by agarose gel electrophoresis. The PCR product was directly ligated into cloning vector pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Scientific) according to the manufacturer's protocol for blunt-ended PCR products, with the resulting ligation mix used to transform chemically-competent E. coli DH10B, with transformants selected by incubation on Luria Agar (LA; Sigma) plus carbenicillin at a concentration of 100 μg/mL. Transformant E. coli DH10B colonies recovered following 16 hours incubation at 37° C. were replica-plated onto LA plus carbenicillin 100 μg/mL and checked for the presence of cloned APB106F/APB107R PCR product using primer pair APB106F and pJET1.2 reverse sequencing primer (Thermo Scientific) with DreamTaq DNA Polymerase (Thermo Scientific) in a colony PCR reaction; with the presence of an approximate 729 bp product in PCR-positive transformant colonies confirmed by agarose gel electrophoresis. Two of these were stored with strain IDs DH208 and DH209, respectively. Plasmids were isolated from these strains by alkaline lysis and were sequenced using pJET1.2 forward and reverse sequencing primers (Thermo Scientific) to derive the sequence of G. thermodenitrificans strain K1041 GNTG_2435 homolog. This gene was subsequently identified as encoding a putative DERA by both nucleotide sequence homology with GNTG_2435 and identification of conserved domains within the translated primary amino acid sequence using the NCBI BLAST web server. The sequence of the K1041 homolog is reproduced below:
TABLE-US-00028 ATGACGGTGAATATTGCTAAAATGATCGATCATACGTTGCTTAAGCC AGAAGCGACGGAAGAGCAAATCATTCAACTATGCGACGAAGCAAAGC AACACGGCTTCGCCTCGGTGTGCGTCAACCCAGCGTGGGTGAAAACA GCGGCACGCGAGCTTTCCGACACTGATGTCCGCGTCTGCACGGTCAT CGGCTTTCCGCTTGGGGCGACGACGCCGGAAACAAAGGCGTTTGAAA CGAACAACGCTATCGAAAACGGCGCCCGCGAAGTCGATATGGTAATC AACATCGGCGCGTTAAAAAGTGGTAACGATGAACTCGTTGAGCGCGA CATTCGTGCGGTTGTTGAGGCGGCGTCCGGGAAAGCGCTTGTGAAAG TGATCATCGAAACGGCCTTGTTGACTGATGAGGAAAAAGTGCGCGCC TGCCAATTGGCGGTGAAAGCGGGCGCCGATTACGTAAAAACGTCGAC CGGATTCTCAGGCGGCGGAGCGACGGTCGAAGACGTGGCGCTGATGC GCCGGACAGTTGGCGATAAAGCAGGTGTCAAAGCCTCAGGAGGCGTC CGCGACCGAAAAACAGCCGAAGCGATGATTGAAGCTGGGGCCACGCG CATTGGGACGAGCTCCGGGGTGGCGATCGTCAGCGGCCAAACCGGCG GCGCTGACTATTAA
Construction of Expression Vectors Containing E. coli, A. woodii, P. Aerophilum and G. thermodenitrificans Deoxyribose-5-P Aldolases (DERAs)
[0374] PaDERA was obtained by commercial DNA synthesis using the published gene sequence as a template (NCBI GID: 1465578) and was supplied on a plasmid. The G. thermodenitrificans DERA was isolated as described above. E. coli and A. woodii were directly isolated from their respective genomic DNA with primers designed using the published genome sequences as templates. Using methods well known in the art in order to generate the final expression constructs; each of the target DERAs was PCR-amplified with 5′ NdeI and 3′ BamHI restriction sites and then independently subcloned using standard restriction enzyme-based cloning methods into the corresponding sites of the pET3a expression plasmid backbone, such that they were in frame with the plasmid-encoded T7 inducible promoter.
Expression and Preparation of Lysates Containing DERAs for 1,3-Butanediol Production
[0375] Strains of E. coli BL21 Star (DE3) bearing either an empty pET3a vector or a cloned DERA from E. coli, G. thermodenitrificans, A. woodii and P. aerophilum were grown in 50 mL of commercial auto-induction medium (Formedium) containing 100 μg/ml carbenicillin, at 30° C. with shaking at 250 rpm. Following overnight growth, bacteria were lysed by bead-beating as described previously. The resulting lysates were clarified by centrifugation prior to activity assays. DERA activity for each lysate was determined in the retro aldol direction against deoxyribose-5-phosphate using a NADH linked assay for detection of the product acetaldehyde. The assay was carried out using 0.15 mM NADH, 5 mM 2-Deoxyribose 5-phosphate (Sigma: D3126) and 10 U/ml alcohol dehydrogenase (Sigma: A7011)
[0376] Lysates were diluted and reactions were run at the following volumetric and specific activities:
TABLE-US-00029 Volumetric Specific Cloned DERA activity Activity Escherichia coli 2 U/ml and 0.09 U/mg and 20 U/ml 0.9 U/mg Geobacillus 2 U/ml and 0.09 U/mg and thermodenitrificans 20 U/ml 0.9 U/mg Acetobacterium 2 U/ml and 0.09 U/mg and woodii 20 U/ml 0.9 U/mg Pyrobaculum 0.3 U/ml 0.021 U/mg aerophilum
[0377] Acetaldehyde was supplied to the enzyme system (1 mL) via decarboxylation of pyruvate using yeast pyruvate decarboxylase (PDC) 0.5 U/ml (Sigma: P9474). Pyruvate was added at 5 and 30 mM. The reaction also contained the cloned DERA at either 2, 20 or 0.3 U/ml as appropriate and 0.033 mg/ml of purified GOX1615 (Example 9). The assays were carried out in 10 mM sodium phosphate buffer, pH 7 containing 0.1 mM thiamine pyrophosphate, 1 mM MgSO.sub.4 and 1 mM DTT. Recycling of the cofactor NADPH for GOX1615 (0.15 mM) was provided by glucose dehydrogenase (GDH) from Pseudomonas sp. (Sigma: 19359) added at a final concentration of 0.1 mg/ml and 10 mM glucose. The reaction was incubated at 25° C., shaking at 250 rpm for an arbitrary 96 hr and was cooled on ice prior analysis. The concentration of reactants and products were monitored by HPLC (Phenomenex Rezex OA column organic acid H+300×7.8 mm).
[0378] A control comprised 5 and 30 mM pyruvate, 0.5 U/ml PDC, 0.15 mM NADPH, 0.1 mg/mL GDH, 10 mM glucose and 0.033 mg/ml GOX 1615 in buffer, pH 7.0 without addition of DERA lysate. This control confirmed that no 1,3-butanediol was produced via abiotic chemical condensation of acetaldehyde to 3-hydroxybutanal.
Results
[0379] 1,3-Butanediol Production (Escherichia coli DERA)
TABLE-US-00030 Pyruvate supplied at 5 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA U/ml mM mM mM 2 ND 0.23 1.86 20 ND 0.31 3.67 Pyruvate supplied at 30 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA mg/ml mM mM mM 2 23.80 0.54 5.68 20 ND 2.32 7.74 Control PDC and GOX1615 no DERA [Pyruvate] [Acetaldehyde] [1,3 Butanediol] [Ethanol] mM mM mM mM 5 3.56 ND 1.37 30 26.11 ND 5.62
1,3-Butanediol Production (Acetobacterium woodii DERA)
TABLE-US-00031 Pyruvate supplied at 5 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA U/ml mM mM mM 2 ND 0.32 1.54 20 ND 0.37 2.69 Pyruvate supplied at 30 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA mg/ml mM mM mM 2 23.4 0.95 5.31 20 ND 3.19 6.32 Control PDC and GOX1615 no DERA [Pyruvate] [Acetaldehyde] [1,3 Butanediol] [Ethanol] mM mM mM mM 5 3.56 ND 1.37 30 26.11 ND 5.62
1,3-Butanediol Production (Geobacillus thermodenitrificans DERA)
TABLE-US-00032 Pyruvate supplied at 5 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA U/ml mM mM mM 2 ND 0.64 3.00 20 ND 0.24 7.45 Pyruvate supplied at 30 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA mg/ml mM mM mM 2 ND 3.39 5.46 20 ND 2.19 14.55 Control PDC and GOX1615 no DERA [Pyruvate] [Acetaldehyde] [1,3 Butanediol] [Ethanol] mM mM mM mM 5 3.61 ND 0.82 30 26.83 ND 6.41
1,3-Butanediol Production (Pyrobaculum aerophilum DERA)
TABLE-US-00033 Pyruvate supplied at 5 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA U/ml mM mM mM 0.3 U/ml ND 1.03 3.27 Pyruvate supplied at 30 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA mg/ml mM mM mM 0.3 ND 4.36 3.25 Control PDC and GOX1615 no DERA [Pyruvate] [Acetaldehyde] [1,3 Butanediol] [Ethanol] mM mM mM mM 5 3.63 ND 1.98 30 27.6 ND 6.09 ND = none detected
[0380] 1,3-butanediol was confirmed in all cases by LC/mass spectrometry. A representative mass spectrum is shown in
Example 14. Production of 1,3-Butanediol from Pyruvate Using a Cloned Full Pathway Operon
Introduction
[0381] For exemplification of a complete 1,3-BDO biosynthetic pathway expressed as an operon, EcDERA, PDC1 and GOX1615 genes were assembled as a single polycistronic operon, under a lactose-inducible T7 promoter (in expression vector pET3a) and were actively expressed to produce 1,3-BDO in E. coli BL21 Star (DE3) cell lysate.
[0382] The aldehyde oxidoreductase (eutE) from Salmonella enterica subsp. enterica serovar Typhimurium strain LT2 (Uniprot ID: P41793, Genbank GID: 1253985) was initially used as an endogenous source of acetaldehyde substrate for EcDERA. In a later embodiment cloned PDC1 from Saccharomyces cerevisiae was used to replace eutE in this construct, as described below.
Construction of EcDERA and PDC with GOX1615 Expression Vectors
[0383] The PDC1 gene was PCR cloned from S. cerevisiae genomic DNA (SG ID S000004034 and Candy et al. 1991) with 24 bp of homology for 5′ UTR of GOX1615 in plasmid pDH384 (pET3a-EcDERA-EutE-GOX1615). The purified PCR product was then spliced into pDH384 using EMP PCR; such that PDC1 would replace the eutE coding sequence in the final construct and would also be cloned in-frame with the original ribosome-binding site; creating expression plasmid pDH527 (pET3a-EcDERA-PDC1-GOX1615).
Expression and Preparation of Lysates Containing the Expressed Operon
[0384] Cell lysates from induced strains of E. coli BL21 Star (DE3) were prepared as described in Example 13.
[0385] The assays were carried out in 10 mM sodium phosphate buffer, pH 7 containing 0.1 mM thiamine pyrophosphate, 1 mM MgSO.sub.4 and 1 mM DTT. Pyruvate was added to a final concentration of 5 mM and 30 mM. The lysate was diluted to contain units of expressed PDC, DERA and GOX 1615 as described below. The reaction was incubated at 25° C., shaking at 250 rpm for an arbitrary 96 hr and was cooled on ice prior to analysis by HPLC as described in Example 13.
[0386] The activity of the cloned DERAs was carried out using a NADH linked assay using 2-deoxyribose-5-phosphate as the substrate. The assay was carried out using 0.15 mM NADH, 5 mM 2-Deoxyribose 5-phosphate (Sigma: D3126) and 10 U/ml alcohol dehydrogenase (Sigma: A7011). The activity of PDC was carried out using a linked assay using 10 mM sodium pyruvate, 0.15 mM NADH and 10 U/ml alcohol dehydrogenase (Sigma: A7011). The activity of GOX 1615 was carried out using 10 mM butanal and 0.15 mM NADPH.
TABLE-US-00034 Volumetric Activity of each activity in pathway enzyme each reaction Specific in the reaction as appropriate Activity DERA measured 2 U/ml or 0.22 U/mg or against 2- 20 U/ml 2.2 U/mg deoxyribose-5- phosphate) PDC 0.28 U/ml or 0.03 U/mg or measured against 2.8 U/ml 0.3 U/mg pyruvate GOX1625 0.06 U/ml and 0.007 U/mg and measured against 0.6 U/ml 0.07 U/mg butanal
Results
[0387]
TABLE-US-00035 Pyruvate supplied at 5 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA U/ml mM mM mM 2 ND 0.15 2.00 20 ND 0.45 3.63 Pyruvate supplied at 30 mM [Acetaldehyde] [1,3 Butanediol] [Ethanol] DERA U/ml mM mM mM 2 ND 0.82 5.21 20 3.24 4.01 7.67 Control PDC and GOX1615 no DERA) [Pyruvate] [Acetaldehyde] [1,3 Butanediol] [Ethanol] mM mM mM mM 5 ND ND 4.05 30 ND ND 7.94 ND = none detected
[0388] 1,3-butanediol was confirmed in all cases by LC/mass spectrometry. A representative mass spectrum is shown in
[0389] These data successfully demonstrate the ability for synthesis of 1,3-butanediol from a fully cloned novel, unnatural metabolic pathway, containing the key enzyme DERA for condensation of two molecules of acetaldehyde.
REFERENCES FOR EXAMPLE 14
[0390] Candy J M, Duggleby R G, Mattick J S. Expression of active yeast pyruvate decarboxylase in Escherichia coli. J Gen Microbiol. 1991 December; 137(12):2811-5.