ULTRASENSITIVE RNA QUANTIFICATION USING NANOPORES
20230194500 · 2023-06-22
Inventors
Cpc classification
C12Q2521/107
CHEMISTRY; METALLURGY
G01N33/48721
PHYSICS
C12Q2521/107
CHEMISTRY; METALLURGY
International classification
Abstract
Methods of quantifying a species of RNA within a sample comprising, receiving a sample comprising RNA and substantially devoid of DNA, contacting the sample with a first primer to produce a first cDNA strand, treating the sample with RNAse, contacting the sample with a second primer to produce an amplification product, treating the sample with a proteinase, passing the amplification product through a nanopore and identifying the amplification product derived from the RNA as it passes through nanopore. Methods of diagnosing a disease in a subject are also provided.
Claims
1. A method for quantifying a first species of RNA within a sample, the method comprising: a. receiving a sample comprising RNA and substantially devoid of DNA polymers; b. contacting said sample with a first primer that hybridizes to said first species of RNA under conditions sufficient for reverse transcription (RT) of said first species of RNA to cDNA, thereby producing a first cDNA strand complementary to at least a portion of said species of RNA and comprising said first primer; c. treating said sample with an RNAse enzyme thereby producing a sample comprising said first cDNA strand and substantially devoid of RNA polymers; d. contacting said sample with a second primer that hybridizes to said first cDNA strand and performing 1-5 cycles of amplification to produce amplification products with a first termini that is identical to a sequence of said first primer and a second termini that is a reverse complement to a sequence of said second primer or with a first termini that is a reverse complement of a sequence of said first primer and a second termini that is identical to a sequence of said second primer; e. treating said sample with a proteinase enzyme, wherein said enzyme comprises a net positive charge, to produce a solution substantially devoid of polypeptides other than said proteinase; f. depositing said solution within a first reservoir of a nanopore containing apparatus and passing said amplification products through said nanopore by running electrical current from said first reservoir to a second reservoir via said nanopore; and g. identifying an amplification product derived from said first RNA species as it passes through said nanopore by said amplification product's dwell time within said nanopore; thereby quantifying a species of RNA within a sample.
2. (canceled)
3. The method of claim 1, wherein said receiving comprises receiving a sample of isolated RNA or receiving a cell lysate contacted with a DNAse enzyme.
4. (canceled)
5. (canceled)
6. The method of claim 1, wherein (b) comprises contacting said sample with a reverse transcriptase and DNA nucleotides.
7. (canceled)
8. The method of claim 1, wherein said step (c) a. occurs before said step (d); or b. occurs after said step (d) and said RNAse treatment produces a sample comprising said first cDNA strand and said amplification products are substantially devoid of RNA.
9. (canceled)
10. The method of claim 1, wherein an enzyme carrying a net positive charge is an enzyme that when in a solution through which electrical current is passed migrates towards a negative pole.
11. The method of claim 1, wherein said proteinase is proteinase K.
12. The method of claim 1, wherein said treating with a proteinase is under conditions sufficient for degradation of polypeptides to single amino acids, conditions sufficient for protection of said proteinase from autolysis or both.
13. (canceled)
14. The method of claim 1, wherein said amplification product is a. at least 20 nucleotides shorter than said first cDNA strand; b. not larger than 10,000 nucleotides; or c. both.
15. The method of claim 1, wherein said first primer, said second primer or both are DNA primers, are specific to said RNA species, are 100% complementary to said RNA species or a combination thereof.
16. The method of claim 1, comprising a single cycle of amplification thereby producing on average a single amplification product for each molecule of said species of RNA.
17. (canceled)
18. The method of claim 1, wherein said amplification does not comprises integrating a detectable moiety into said amplification products, said method is devoid of a washing or isolation step after step (a) or both.
19. The method of claim 1, wherein said identifying comprises: a. detecting a change in electrical current through said nanopore; b. measuring duration of said change in electrical current, and wherein said duration is proportional to the length of said amplification product; c. differentiating said amplification product derived from said RNA from at least one of a free DNA nucleotide, a free RNA nucleotide, a free amino acid, a first cDNA strand and an off-target amplification product by dwell time within said nanopore; or d. a combination thereof.
20. (canceled)
21. (canceled)
22. The method of claim 1, further comprising in step (b) contacting said sample with a third primer that hybridizes to a second species of RNA, thereby producing a first cDNA strand complementary to at least a portion of said second species of RNA and comprising said second primer; and further comprising in step (d) contacting said sample with a fourth primer that hybridizes to said first cDNA strand complementary to at least a portion of said second species of RNA to produce amplification products with a first termini that is identical to a sequence of said third primer and a second termini that is a reverse complement to a sequence of said fourth primer or with a first termini that is a reverse complement of a sequence of said third primer and a second termini that is identical to a sequence of said fourth primer.
23. The method of claim 22, wherein amplification products derived from said first species and amplification products derived from said second species differ in length by at least 20 nucleotides and are differentiated by a difference in dwell time or wherein said method comprises quantifying at least three species of RNA within said sample, wherein each amplification product derived from an RNA species is at least 20 nucleotides in length different than any amplification product derived from a different RNA species.
24. (canceled)
25. (canceled)
26. The method of claim 1, wherein said first species of RNA comprises a point mutation and further comprising: a. contacting the amplification products with a first probe perfectly complementary to said amplification products and comprising a terminal nucleotide complementary to said point mutation and a second probe perfectly complementary to said amplification products directly adjacent to said point mutation and not complementary to the same region as said first probe; b. ligating said first probe and said second probe to produce a ligated product, such that said ligated product comprises a difference in length from said amplification products, said first probe and said second probe of at least 15 nucleotides; and c. identifying said ligated product as it passes through said nanopore.
27. The method of claim 26, wherein said second probe comprises a detectable moiety and said identifying comprises detecting said detectable moiety as it passes through said nanopore; or wherein said second probe does not comprise a detectable moiety and said identification by dwell time comprise measuring duration of a change in electrical current, and wherein said duration is proportional to the length of a nucleic acid molecule translocating through said nanopore, allowing for distinguishing said ligated product from said amplification product.
28. (canceled)
29. The method of claim 1, wherein: a. said first species of RNA is RNA of a target gene, RNA of a disease-associated gene or RNA of a gene whose expression is indicative of the presence of a disease in said sample; b. said second species of RNA is RNA of a control gene; c. said second species of RNA is RNA of a gene selected from glucose-6-phosphate dehydrogenase (G6PDH) and Ribonuclease P/MRP subunit P30 (RPP30); or d. a combination thereof.
30. (canceled)
31. (canceled)
32. (canceled)
33. (canceled)
34. A method of diagnosing a disease in a subject in need thereof, the method comprising performing the method of claim 1, wherein said sample is from said subject, said first RNA species is an mRNA of a gene associated with said disease, and detection of said first RNA species in said sample indicates said subject suffers from said disease.
35. The method of claim 34, wherein at least one of: a. detection of said first RNA species above a predetermined threshold indicates said subject suffers from said disease; b. said disease is an infectious disease and said first species of RNA is an RNA of an infectious agent; c. said disease is an infectious disease and said first species of RNA is an RNA of an infectious agent and said second RNA species is an RNA of a host cell infected by said infectious agent; d. said disease is an infectious disease and said first species of RNA is an RNA of an infectious agent and said infectious disease is SARS-CoV-2 and said first RNA species is an RNA-dependent RNA polymerase (RdRP) gene mRNA, e. said disease is characterized by the presence of a mutation and said first species of RNA is an RNA comprising said mutation; and f. said disease is a proliferative disease characterized by the presence of a pro-proliferative or antiapoptotic mutation and said first species of RNA is an RNA comprising said mutation.
36. (canceled)
37. (canceled)
38. (canceled)
39. (canceled)
40. (canceled)
41. The method of claim 34, further comprising administering a therapeutic agent that treats said disease to a subject diagnosed with said disease.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0063] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
DETAILED DESCRIPTION OF THE INVENTION
[0073] The present invention, in some embodiments, provides methods of quantifying a species of RNA within a sample. Methods of diagnosing a disease in a subject are also provided.
[0074] The invention is based at least in part on the surprising finding that RT-qNP (the method of the invention) offers several advantages over other common expression quantification techniques such as RT-qPCR. Firstly, by avoiding non-linear amplification, the method of the invention preserves the linear relation between the number of detected cDNA molecules and the number of RNA copies in the sample. PCR can suffer from bias and off-target amplification, which may hinder the accurate quantification of RNA at low copy number. Secondly, bypassing enzymatic amplification greatly simplifies the upstream sample treatment in RT-qNP. The compatibility with small sample volumes, short processing time and lack of thermal cycling are crucial factors for implementation of single-molecule biosensors in mobile and miniature devices.
[0075] The ability to estimate the length of each detected molecule substantially improves the signal-to-background ratio and ensures detection specificity without the need for specific labeling. This feature was used to identify cDNA from multiple genes in the same sample, enabling quantification of expression levels relative to a reference gene acting as an internal control.
[0076] Notably, the RT-qNP RNA quantification method presented is quite general and can be directly applied in many fields of biological and medical research. As an example, the method was adapted to address the acute need for high-resolution sensing of the novel SARS-CoV-2 RNA; showing that viral RNA can readily be quantified simultaneously with the human RPP30 gene used as a reference and quality control factor for the sample. Single-molecule counting of the two RNA types produces a linear relationship between the measured rate and SARS-CoV-2 RNA copy number in a range that is often encountered in clinical testing. In this case, PCR amplification was eliminated entirely, allowing direct counting of cDNA molecules. On top of the improved accuracy, the elimination of PCR amplification highly simplifies the overall biochemical assay potentially reducing the sample test time and reagents costs.
[0077] By a first aspect, there is provided a method for quantifying a first species of RNA within a sample, the method comprising: [0078] a. receiving a sample comprising RNA; [0079] b. contacting the sample with a first primer that hybridizes to the first species of RNA under conditions sufficient for reverse transcription (RT) of the first species of RNA to cDNA; [0080] c. treating the sample with an RNAse; [0081] d. contacting the sample with a second primer that hybridizes to the cDNA and producing an amplification product that is reverse complementary to the cDNA; [0082] e. treating the sample with a proteinase; [0083] f. passing the amplification product through a nanopore and [0084] g. identifying the amplification product as it passes through the nanopore;
thereby quantifying a species of RNA within a sample.
[0085] By another aspect, there is provided a method of diagnosing a disease in a subject in need thereof, the method comprising performing a method of the invention, wherein the sample is from the subject, the first RNA species is an RNA of a gene associated with the disease and detection of the first RNA species in the sample indicates the subject suffers from the disease.
[0086] By another aspect, there is provided a method of diagnosing a disease in a subject in need thereof, the method comprising: [0087] a. receiving a sample from the subject comprising RNA; [0088] b. contacting the sample with a first primer that hybridizes to a first species of RNA associated with the disease under conditions sufficient for reverse transcription (RT) of the first species of RNA to cDNA; [0089] c. treating the sample with an RNAse; [0090] d. contacting the sample with a second primer that hybridizes to the cDNA and producing an amplification product that is reverse complementary to the cDNA; [0091] e. treating the sample with a proteinase; [0092] f. passing the amplification product through a nanopore and [0093] g. identifying the amplification product as it passes through the nanopore; wherein identifying the amplification product indicates the subject suffers from the disease
thereby diagnosing a disease in a subject.
[0094] In some embodiments, the method is an in vitro method. In some embodiments, the method is a method of diagnosis. In some embodiments, the method is a method of detecting a first RNA species. In some embodiments, the quantifying is detecting. In some embodiments, the method is a method of ultrasensitive quantification. In some embodiments, the method is a method of detecting a lowly abundant RNA species.
[0095] In some embodiments, the RNA is mRNA. In some embodiments, the first RNA species is a lowly abundant RNA species in the sample. In some embodiments, the first species of RNA is RNA of a target gene. In some embodiments, the target gene is a disease-associated gene. In some embodiments, the first species of RNA is an RNA of a disease-associated gene. In some embodiments, the disease-associated gene is a disease-specific gene. In some embodiments, expression of the gene is a sample is indicative of the presence of the disease. In some embodiments, expression of the first RNA species is a sample is indicative of the presence of the disease. In some embodiments, the presence of the gene in the sample is indicative of the presence of the disease. In some embodiments, the presence of the first RNA species in the sample is indicative of the presence of the disease. In some embodiments, presence of the disease is presence of the disease in the sample. In some embodiments, presence of the disease is presence of the disease in a subject that provided the sample. In some embodiments, presence of the gene or first RNA species is presence of the gene or RNA species above a predetermined threshold.
[0096] In some embodiments, the disease is an infectious disease. In some embodiments, the first species of RNA is an RNA of an infectious agent. In some embodiments, the infectious agent is a virus. In some embodiments, the infectious agent is a bacterium. In some embodiments, the infectious agent is a parasite. In some embodiments, the infectious agent RNA is an RNA unique to the infectious agent. In some embodiments, a viral RNA is an RNA that encodes an essential viral protein. In some embodiments, the virus is SARS-CoV-2. In some embodiments, the viral RNA is an RNA of RNA-dependent RNA polymerase (RdRP). Infectious agent markers are well known in the art and any known marker may be employed. Examples of infectious agent markers include, but are not limited to, RdRP, viral spike gene/protein, viral capsid gene/protein, E gene/protein, N gene/protein, 23S rRNA, gyrB, dnaK, and recA to name but a few.
[0097] In some embodiments, the disease is a proliferative disease. In some embodiments, the proliferative disease is cancer. In some embodiments, the disease is characterized by the presence of a mutation. In some embodiments, the first species of RNA comprises the mutation. In some embodiments, the mutation is a pro-proliferative mutation. In some embodiments, the mutation is an anti-apoptotic mutation. In some embodiments, the mutation is a cancerous mutation. In some embodiments, the mutation is an oncogenic mutation. In some embodiments, disease associated gene is a cancer-associated gene. In some embodiments, cancer-associated is a cancer specific. In some embodiments, the cancer-associated gene is a cancer marker. In some embodiments, the cancer-associated mutation is a cancer inducing mutation. In some embodiments, a cancer inducing mutation is a cancer driving mutation. In some embodiments, the gene is KRAS. Examples of cancer drivers, cancer associated gene and cancer associated/causing mutations are well known in the art. Any such mutation can be screened for. Screening methods of cancer transcripts are known in the art and so long as the cancer-causing sequence is known the method of the invention can be adapted to screen for that mutation, such as is described hereinbelow. Cancer markers are well known in the art and any such marker may be employed. Examples of cancer markers include, but are not limited to KRAS, MACC1, S100A4, AFP, CA125, CA15-3, CA19-9, CEA, hCG and PSA to name but a few. Cancer driver mutations are also well known in the art and any such mutation may be investigated. Example of cancer driver mutations include, but are not limited to, KRAS G12D, KRAS G13D, BRAF D594A/E/G/HN, EGFR L858R, EGFR T790M, and P53 P72R. Cancer mutations can also be found for example in the Cancer mutations browser (intogen.org) or the Catalogue of Somatic Mutations in Cancer (COSMIC, cancer.sanger.ac.uk). In some embodiments, the mutation is in a coding region. In some embodiments, the mutation is in a transcribed region.
[0098] In some embodiments, cancer is metastatic cancer. In some embodiments the cancer is premetastatic cancer. In some embodiments, cancer is solid cancer. In some embodiments, cancer is a tumor. In some embodiments, cancer is hematopoietic cancer. In some embodiments, cancer is residual disease. In some embodiments, cancer is early detection of cancer. In some embodiments, cancer is colorectal cancer. Examples of cancer include, but are not limited to brain cancer, oral cancer, head and neck cancer, esophageal cancer, lung cancer, skin cancer, liver cancer, pancreatic cancer, bladder cancer, renal cancer, blood cancer, bladder cancer, bone cancer, breast cancer, thyroid cancer, cervical cancer, ovarian cancer, testicular cancer, retinoblastoma, gastric cancer, colorectal cancer, and uterine cancer.
[0099] In some embodiments, the sample is from a subject. In some embodiments, the subject is a subject in need of diagnosing a possible disease. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is at risk for the disease. In some embodiments, the subject has been exposed to a carrier of an infectious disease. In some embodiments, the subject is a subject during a pandemic. In some embodiments, the subject is believed to have been infected by an infectious agent. In some embodiments, the subject is in need of determining if the subject has been infected by an infectious agent. In some embodiments, the subject exhibits symptoms of being infected by an infectious agent. In some embodiments, the subject has been in a region with an outbreak of infection by the infectious agent. In some embodiments, the subject has a proliferative disease and is at risk of metastasis. In some embodiments, the subject had a proliferative disease and is at risk of relapse. In some embodiments, the diagnosis is diagnosis of residual disease. In some embodiments, diagnosis is early diagnosis. In some embodiments, diagnosis is diagnosis of a proliferative disease before development of any symptoms.
[0100] In some embodiments, the sample is a solution. In some embodiments, the sample is processed into a solution. In some embodiments, the sample is a sample devoid of DNA. In some embodiments, the sample is a sample devoid of DNA polymers. In some embodiments, the sample is a sample treated with DNAse. In some embodiments, the method further comprises treating the sample with DNAse. In some embodiments, the DNAse is a DNAse enzyme. DNAses are well known in the art and any such DNAse may be used. In some embodiments, the DNAse cleaves genomic DNA. In some embodiments, the DNAse cleaves cfDNA. In some embodiments, the DNAse cleaves mitochondrial DNA. In some embodiments, the DNAse is DNAseI. In some embodiments, the sample is a sample of isolated RNA.
[0101] In some embodiments, the sample is a blood sample. In some embodiments, the sample is a bodily fluid sample. Examples of bodily fluids include, but are not limited to blood, plasma, urine, feces, cerebral spinal fluid, semen, breast milk, tumor fluid and saliva. In some embodiments, the sample is a tumor sample. In some embodiments, the sample is a liquid biopsy. In some embodiments, the sample is a biopsy. In some embodiments, the sample is tissue. In some embodiments, the sample is a tissue biopsy. In some embodiments, the saliva is spit.
[0102] In some embodiments, the sample is a swab. In some embodiments, the swab is a swab of an area of the subject. In some embodiments, the area is an area at risk for infection by the infectious agent. In some embodiments, the area is an area infected by an infectious agent. In some embodiments, the area is an area of infection. In some embodiments, the area is the inside of the nose. In some embodiments, the area is in the mouth. In some embodiments, the area is in the cheek. In some embodiments, the area is in the throat. In some embodiments, the area is a wound. In some embodiments, the area is the eye. In some embodiments, the area is the anus. In some embodiments, the area is the urethra. In some embodiments, the area is the vagina. In some embodiments, the area is an ear.
[0103] In some embodiments, receiving comprising receiving a swab. In some embodiments, receiving comprising receiving a solution generated from a swab. In some embodiments, the swab is generated from swabbing an area of a subject. In some embodiments, the solution is a transfer solution in which the swab is dipped or incubated. In some embodiments, transfer solution is TE. In some embodiments, transfer solution is LB. In some embodiments, transfer solution comprises nutrients sufficient for culture of cells. In some embodiments, the culture is liquid culture. In some embodiments, the cells are bacterial cells. Transfer solution for swabs is well known in the art, and any such transfer solution may be used. In some embodiments, the sample is the solution.
[0104] In some embodiments, receiving comprises lysing cells in the solution. In some embodiments, the solution is the transfer buffer after incubation with the swab. In some embodiments, receiving comprises adding lysis solution to the transfer solution. In some embodiments, the lysing solution lyses cells. In some embodiments, the lysing solution comprises 3M guanidine. In some embodiments, the lysing solution is a hypotonic solution. In some embodiments, the lysing solution is a hypertonic solution. In some embodiments, the lysis buffer is RNA extraction lysis buffer. Lysing solutions are well known in the art, and any such lysis solution may be used.
[0105] Methods for swab collection and transfer and lysis can be found, for example in “Swab Sample Transfer for Point-Of-Care Diagnostics: Characterization of Swab Types and Manual Agitation Methods”, Panpradist et al., 2014, PLoS one; 9(9): e105786; CDC guidelines for Clinical Specimens (cdc.gov/coronavirus/2019-ncov/lab/guidelines-clinical-specimens.html) and WHO interim guidance 19 Mar. 2020: Laboratory testing for coronavirus disease (COVID-19) in suspected human cases (apps.who.int/iris/rest/bitstreams/1271387/retrieve), herein incorporated by reference in their entirety.
[0106] In some embodiments, the sample comprises cells. In some embodiments, the cells are from the subject. In some embodiments, the cells are from the swab. In some embodiments, the cells are lysed. In some embodiments, the method comprises lysing the cells. In some embodiments, the sample is a cellular lysate. In some embodiments, the method comprises contacting the cell lysate with a DNAse. In some embodiments, the receiving comprises receiving a cellular lysate and contacting the lysate with DNAse to produce a sample comprising RNA and substantially devoid of DNA.
[0107] In some embodiments, substantially devoid comprises less than 1, 0.5, 0.1, 0.01, 0.001 or 0.0001% DNA in the total of nucleic acid molecules. Each possibility represents a separate embodiment of the invention. It will be understood by a skilled artisan that a DNAse will cleave DNA polymers down to individual DNA nucleotides or dinucleotides. This is to be understood as substantially devoid of DNA. In some embodiments, substantially devoid of DNA is devoid of DNA polymers. In some embodiments, a nucleic acid polymer is a nucleic acid chain comprising at least 3 nucleotides. In some embodiments, a nucleic acid polymer is a nucleic acid chain comprising at least 2 nucleotides. In some embodiments, a nucleic acid molecule is a DNA or RNA molecule. In some embodiments, a molecule is a polymer.
[0108] In some embodiments, the primer is a DNA primer. In some embodiments, the primer is an RNA primer. In some embodiments, the first primer hybridizes to the first RNA species. In some embodiments, the first primer specifically hybridizes to the first RNA species. In some embodiments, the primer is a forward primer. In some embodiments, the primer is reverse complementary to an RNA. In some embodiments, the primer can hybridize to an RNA. In some embodiments, the primer comprises a region reverse complementary to an RNA. In some embodiments, the region of reverse complementarity is the 3′ end of the primer. In some embodiments, the primer comprises a length of at least 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 26, 28, or 30 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the primer comprises a length of at most, 20, 22, 24, 25, 26, 28, 30, 32, 34, 35, 36, 38, 40, 42, 44, 45, 46, 48, or 50 nucleotides. Each possibility represents a separate embodiment of the invention.
[0109] In some embodiments, the first primer is specific to the first RNA species. In some embodiments, specific is specific hybridization. In some embodiments, hybridization is perfect complementarity. In some embodiments, the first primer hybridizes to the first RNA species with at least 100, 99, 97, 95, 90, 85, or 80% complementarity. Each possibility represents a separate embodiment of the invention. In some embodiments, the first primer hybridizes to the first RNA species with 100% complementarity. In some embodiments, the first primer is specific to the first RNA species and to no other RNAs. In some embodiments, no other RNAs is no other RNAs in the sample. In some embodiments, no other RNAs is no other RNAs in a cell of the subject. In some embodiments, no other RNAs is no other RNAs in the infectious agent.
[0110] In some embodiments, the contacting is under conditions sufficient for reverse transcription (RT). In some embodiments, the contacting is incubating. In some embodiments, the RT is RT of the first RNA species to cDNA. In some embodiments, the RT is RT of the first RNA species to a first strand of cDNA. In some embodiments, the RT produces a first cDNA strand. In some embodiments, the first cDNA strand is complementary to the first species of RNA. In some embodiments, the first cDNA strand is complementary to at least a portion of the first RNA species. In some embodiments, the first cDNA strand comprises the first primer. In some embodiments, the first primer is the 5′ terminus of the first cDNA strand. In some embodiments, step (b) comprises contacting the sample with a reverse transcriptase. In some embodiments, step (b) comprises contacting the sample with a polymerase. In some embodiments, the polymerase is DNA polymerase. In some embodiments, the reverse transcriptase is warmstart RTx. In some embodiments, step (b) comprises contacting the sample with free DNA nucleotides.
[0111] In some embodiments, incubation is incubation under suitable conditions. In some embodiments, contacting is contacting under suitable conditions. In some embodiments, the incubating is under conditions suitable for binding of RNA from the sample to the primer. In some embodiments, the incubating is under conditions suitable for hybridization of RNA from the sample to the primer. In some embodiments, the DNAse is inactivated prior to addition of the primer. In some embodiments, the inactivation is heat inactivation. In some embodiments, the hybridization is RNA to DNA hybridization. In some embodiments, suitable conditions are conditions suitable for primer hybridization to an RNA. In some embodiments, suitable conditions are conditions suitable for RNA to DNA hybridization.
[0112] RT and RT-PCR are well known in the art. Exemplary primers are provided in Tables 1-3. Methods of designing primers for amplifying specific sequences are well known, and programs, such as Primer3 for a non-limiting example, can be employed. In some embodiments, the RT-PCR is a single round of RT-PCR. In some embodiments, the RT-PCR produces a strand of cDNA reverse complementary to an RNA. In some embodiments, the RT-PCR is done with the forward primer. In some embodiments, reverse-transcription is RT-PCR. In some embodiments, reverse-transcription comprises adding a polymerase. In some embodiments, the polymerase is Taq polymerase. Any polymerase with 5′ to 3′ polymerase activity may be used. In some embodiments, reverse-transcription comprises adding free nucleotide bases. All 4 bases, A, T, C and G are added to allow polymerization. In some embodiments, a PCR buffer is added. Kits and reagents for reverse-transcription are well known in the art an any such kits may be used, for example first strand synthesis kits can be used. Such kits often comprise a random binding agent, such as random hexamers or random primers; it will be understood that the first primer is to be used instead. This produces only a first cDNA strand that is the reverse complement of the first species of RNA and no other cDNAs. In some embodiments, the reverse-transcription reaction is a first strand synthesis reaction. Conditions for reverse-transcription including heating and cooling steps are well known. Standard reverse-transcription and/or first strand synthesis may be used. In some embodiments, the reverse-transcription produces a cDNA strand thereby preparing cDNA from a sample comprising RNA. In some embodiments, RT is a single round of RT. In some embodiments, RT produces about a 1:1 ratio of first RNA species molecules to first cDNA strand molecules.
[0113] In some embodiments, the method comprises contacting the sample with an RNAse. In some embodiments, the RNAse is an RNAse enzyme. In some embodiments, contacting the sample is treating the sample with an RNAse. In some embodiments, contacting the sample is incubating the sample with an RNAse. In some embodiments, the RNAse produces a sample substantially devoid of RNA. In some embodiments, the RNAse produces a sample comprising the first cDNA strand and substantially devoid of RNA. In some embodiments, devoid of RNA is devoid of RNA polymers. It will be understood that an RNAse will cleave RNA polymers into RNA nucleotides or dinucleotides. In some embodiments, substantially devoid is devoid. In some embodiments, substantially devoid is devoid of polymers but comprising single nucleotides. In some embodiments, substantially devoid is devoid of polymers but comprising single nucleotides or dinucleotides.
[0114] In some embodiments, step (c) occurs after step (b). In some embodiments, step (c) occurs before step (d). In some embodiments, step (c) occurs after step (d). In some embodiments, the RNAse treatment produces a sample comprising the first cDNA strand and the amplification product. In some embodiments, the RNAse treatment produces a sample comprising the first cDNA strand and the amplification product and substantially devoid of RNA. In some embodiments, step (b) and step (d) are a single step. In some embodiments, the reverse transcriptase is a DNA polymerase. In some embodiments, the first primer and second primer are added together.
[0115] In some embodiments, step (d) comprises contacting the sample with a second primer. In some embodiments, the second primer hybridizes to the first cDNA strand. In some embodiments, the second primer is specific to the first cDNA strand. In some embodiments, the second primer is reverse complementary to the first cDNA strand. In some embodiments, the second primer is homologous to a region of the first RNA species. In some embodiments, the first and second primers are a primer pair. In some embodiments, the first and second primers produce an amplicon of a given length. In some embodiments, the amplicon is the amplification product.
[0116] In some embodiments, the second primer hybridizes to the first cDNA strand with at least 100, 99, 97, 95, 90, 85, or 80% complementarity. Each possibility represents a separate embodiment of the invention. In some embodiments, the second primer hybridizes to the first cDNA strand with 100% complementarity. In some embodiments, the second primer is specific to the first cDNA strand and to no other DNAs. In some embodiments, the second primer is specific to the first cDNA strand and to no other DNAs or RNAs. In some embodiments, no other DNAs is no other cDNAs. In some embodiments, no other DNAs is no other DNAs in the sample. In some embodiments, no other DNAs is no other DNAs in a cell of the subject. In some embodiments, no other DNAs is no other DNAs in the infectious agent.
[0117] In some embodiments, producing an amplification product comprises performing amplification to produce the amplification product. In some embodiments, the amplification is PCR amplification. In some embodiments, the amplification is a single round of amplification. In some embodiments, the amplification produces about a 1:1 ratio of first cDNA strands to amplification product. In some embodiments, the amplification produces on average a single amplification product for each first cDNA strand. In some embodiments, the amplification produces on average a single amplification product for each molecule of the first RNA species. In some embodiments, the amplification is a single cycle of amplification. In some embodiments, the amplification is 1-2 rounds of amplification. In some embodiments, the amplification is 1-3 rounds of amplification. In some embodiments, the amplification is 1-4 rounds of amplification. In some embodiments, the amplification is 1-5 rounds of amplification. In some embodiments, the amplification is not more than 5 rounds of amplification.
[0118] In some embodiments, the amplification product is derived from the cDNA. In some embodiments, the amplification product is derived from the RNA. In some embodiments, the amplification product is derived from the first RNA species. In some embodiments, the amplification product comprises a first termini that is identical to a sequence of the first primer and a second termini that is a reverse complement to a sequence of the second primer. In some embodiments, a reverse complement is reverse complementary. In some embodiments, the amplification product comprises a first termini that is a reverse complement to a sequence of the first primer and a second termini that is identical to a sequence of the second primer. It will be understood that the amplification product is a PCR product produced the by first and second primers and will have a given length defined by the distance from the end of the first primer to the end of the second primer.
[0119] In some embodiments, the amplification product is shorter than the first RNA species. In some embodiments, shorter is shorter by a length sufficient to allow the first RNA species to be distinguished from the amplification product by the difference in dwell time through a nanopore. A skilled artisan will appreciate that a nanopore sensor can measure the dwell time of molecules within the nanopore, and that nucleic acid molecules dwell time will be proportional to their length. Thus, longer nucleic acids will have a longer dwell time and shorter nucleic acids a shorter dwell time. Further, the difference in length needed to distinguish between two molecules will depend on the sensitivity of the nanopore sensor and the conditions at which the molecules are passed through the nanopore. So, a skilled artisan would choose a length difference that is reliably detectable. In some embodiments, shorter is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 250, 300, 400, 500, 600, 700, 750, 800, 900 or 1000 nucleotides shorter. Each possibility represents a separate embodiment of the invention. In some embodiments, shorter is at least 20 nucleotides shorter. In some embodiments, shorter is at least 30 nucleotides shorter. In some embodiments, shorter is at least 40 nucleotides shorter. In some embodiments, shorter is at least 45 nucleotides shorter.
[0120] In some embodiments, the amplification product is at most 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the amplification product is at most 500 nucleotides. In some embodiments, the amplification product is at most 1000 nucleotides. In some embodiments, the amplification product is at least 50, 100, 150, 200, 250, 300 or 350 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the amplification product is at least 100 nucleotides. In some embodiments, the amplification product is at least 200 nucleotides. In some embodiments, the amplification product is at least 300 nucleotides. In some embodiments, the amplification product is the first amplification product. In some embodiments, the amplification product is the second amplification product.
[0121] In some embodiments, the amplification product does not comprise a detectable moiety. In some embodiments, the amplification does not comprise integrating a detectable moiety into the amplification product. In some embodiments, the amplification product is not labeled. In some embodiments, the amplification product is naked DNA. In some embodiments, the amplification product is detectable as it passes through the nanopore only do to its blocking of the nanopore. In some embodiments, blocking is blocking current through the nanopore. In some embodiments, blocking is blocking electrical charge. In some embodiments, the amplification product is not fluorescent.
[0122] In some embodiments, the method further comprises treating the sample with a proteinase. In some embodiments, a proteinase is a proteinase enzyme. In some embodiments, the proteinase is a protease. In some embodiments, the proteinase is a non-specific proteinase. In some embodiments, the proteinase cleaves proteins into amino acids. In some embodiments, the proteinase is resistant to autolysis. In some embodiments, the proteinase autolyzes. In some embodiments, the treatment with the proteinase produces a sample substantially devoid of polypeptides. In some embodiments, the treatment with the proteinase produces a sample substantially devoid of polypeptides other than the proteinase. In some embodiments, treating with a proteinase is under condition sufficient to allow proteinase activity. In some embodiments, proteinase activity comprises degradation of polypeptides to single amino acids. In some embodiments, the conditions are conditions sufficient for protection of the proteinase from autolysis. In some embodiments, proteinase is not active to autolyze.
[0123] In some embodiments, the proteinase comprises a net positive charge. In some embodiments, the proteinase is positively charged. In some embodiments, the proteinase is proteinase K. Proteinases are well known in the art and a skilled artisan can select one with the proper characteristics (e.g. charge and cleavage). In some embodiments, an enzyme carrying a net positive charge is an enzyme that when in solution through which electrical current is passed migrates toward a negative pole. Thus, it will be understood that the proteinase when applied to a nanopore apparatus will not migrate to the nanopore, but rather will be attracted to the negative pole in the first reservoir.
[0124] In some embodiments, the method is devoid of a washing step. In some embodiments, the method is devoid of an isolation step. In some embodiments, the method does not comprise a washing step. In some embodiments, the method does not comprise an isolation step. In some embodiments, the method after step (a) is devoid of or does not comprises an isolation step. Washing and isolation steps can lead to loss of product or starting material and greatly reduce the accuracy and detection threshold. Thus, not having these steps allows for a highly accuracy and ultrasensitive method of detection.
[0125] In some embodiments, the method comprises a dissociation step. In some embodiments, the dissociation comprises heating. In some the first cDNA strand is dissociated from the RNA species. In some embodiments, the amplification product is dissociated from the first cDNA strand. In some embodiments, one strand of the amplification product is dissociated from a second strand of the amplification product. In some embodiments, dissociation occurs before RNAse treatment. In some embodiments, the method is devoid of a dissociation step.
[0126] In some embodiments, the method comprises passing the amplification product through a nanopore. In some embodiments, the nanopore is part of a nanopore apparatus. In some embodiments, the nanopore is a solid state nanopore. In some embodiments, the nanopore is a plasmonic nanopore. In some embodiments, the nanopore is an ion-conducting nanopore. In some embodiments, the nanopore is a plasmonic nanowell. In some embodiments, the amplification product is double stranded DNA. In some embodiments, the amplification product is single stranded DNA.
[0127] The exact size of the nanopore is not essential to the performance of the method. It is sufficient that the nanopore sensor can detect the dwell time of the amplification products. In some embodiments, the nanopore comprises a diameter not greater than 1, 2, 3, 4, 5, 7, 10, 15, 20, 15, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150 nm. Each possibility represents a separate embodiment of the invention. In some embodiments, the nanopore comprises a diameter not greater than 5 nm. In some embodiments, the nanopore comprises a diameter not greater than 7 nm. In some embodiments, the nanopore comprises a diameter not greater than 20 nm. In some embodiments, the nanopore comprises a diameter not greater than 100 nm. In some embodiments, the nanopore comprises a diameter of about 3 nm. In some embodiments, the nanopore comprises a diameter of about 4 nm. In some embodiments, the nanopore comprises a diameter of about 5 nm. In some embodiments, the nanopore comprises a diameter between 0.5 and 3, 0.5 and 4, 0.5 and 5, 0.5 and 7, 0.5 and 10, 0.5 and 15, 0.5 and 20, 1 and 3, 1 and 4, 1 and 5, 1 and 7, 1 and 10, 1 and 15, 1 and 20, 3 and 4, 3 and 5, 3 and 7, 3 and 10, 3 and 15, 3 and 20, 4 and 5, 4 and 7, 4 and 10, 4 and 15, 4 and 20, 5 and 7, 5 and 10, 5 and 15, or 5 and 20 nm. Each possibility represents a separate embodiment of the invention. In some embodiments, the nanopore comprises a diameter between 3 and 4 nm. The width of a nucleic acid molecule is ˜1 nm therefore nanopores above this size are generally ideal. In some embodiments, nanopores of greater than 20 nm do not provide sufficient resolution to distinguish between amplicons of different sizes.
[0128] In some embodiments, the nanopore is part of a nanopore apparatus. In some embodiments, the nanopore is in a film. The production of nanopores in a film is well known in the art. Fabrication of nanopores in thin membranes has been shown in, for example, Kim et al., Adv. Mater. 2006, 18 (23), 3149 and Wanunu, M. et al., Nature Nanotechnology 2010, 5 (11), 807-814. Further, methods of such fabrication of films in silicon wafers, and methods of producing nanopores therein are provided herein in the Materials and Methods section. In some embodiments, the nanopore is produced with a transition electron microscope (TEM). In some embodiments, the nanopore is produced with a high-resolution aberration-corrected TEM or a noncorrected TEM. In some embodiments, the film is a membrane.
[0129] According to some embodiments, the nanopore apparatus comprises a film, and wherein the film comprises at least one nanopore. In some embodiments, the nanopore apparatus further comprises a first and a second fluidic reservoir separate by the film and connected via the nanopore. In some embodiments, the nanopore apparatus further comprises first and second electrodes configured to electrically contact fluid placed in the first reservoir and fluid placed in the second reservoir, respectively. In some embodiments, the electrodes are configured to generate an electrical current that drives an amplification product to be analyzed through the nanopore. In some embodiments, the negative electrode is placed in the first reservoir. It will be understood by a skilled artisan that negatively charged DNA will flow away from the negative electrode in the first reservoir, through the nanopore and to the positive electrode in the second reservoir. In some embodiments, the electrode in the second reservoir is a positive electrode. In some embodiments, an electrode is a pole. In some embodiments, the positively charged proteinase will stay in the first reservoir and will not pass through the nanopore.
[0130] In some embodiments, passing the amplification product comprises depositing the sample into the first reservoir of the nanopore apparatus. In some embodiments, the first reservoir comprises an ionic solution. In some embodiments, the first reservoir comprises a solution suitable for transfer through the nanopore. In some embodiments, the sample is a solution and the solution is mixed into the solution in the first reservoir. In some embodiments, the passing is by running electrical current from the first reservoir to the second reservoir via the nanopore. In some embodiments, the electoral current is run from a first electrode to a second electrode. In some embodiments, the first electrode is in the first reservoir and the second electrode is in the second reservoir.
[0131] In some embodiments, the method further comprises identifying the amplification product as it passes through the nanopore. In some embodiments, the amplification product is identified by its dwell time. It will be understood by a skilled artisan that since the dwell time is proportional to length of the molecule, the amplification product can be identified by its specific dwell time. Single nucleotides and/or amino acids will not produce a significant signal and thus will not appear as the amplification product. Similarly, two products can be distinguished by their dwell time. Thus, if the first cDNA strand were to translocate through the nanopore it could be distinguished due to its longer dwell time.
[0132] In some embodiments, the nanopore is naked in that it does not comprise a protein for facilitating transfer through the nanopore. In some embodiments, the amplification product passes through the nanopore via the electrical current generated by the electrodes. In some embodiments, the amplification product is denatured. In some embodiments, the amplification product is not denatured. In some embodiments, the nanopore apparatus further comprises a sensor or detector for detecting dwell time of molecules as they pass through the nanopore. In some embodiments, dwell time of the amplification products is measured. In some embodiments, measuring dwell time is measuring change in electrical current through the nanopore. In some embodiments, measuring dwell time is measuring change in electrical current at the nanopore. In some embodiments, identification by dwell time comprises measuring a change in electrical current through the nanopore. In some embodiments, identification by dwell time comprises measuring a change in electrical current at the nanopore. In some embodiments, sensor or detector is a current sensor or detector. In some embodiments, identification by dwell time is measuring dwell time. In some embodiments, measuring dwell time is measuring the duration of a change in electrical current. In some embodiments, the change is at the nanopore. In some embodiments, the change is through the nanopore. In some embodiments, the duration of the change is proportional to the length of the molecule passing through the nanopore. In some embodiments, the duration of the change is proportional to the length of the amplification product. In some embodiments, a longer duration is indicative of a longer molecule. In some embodiments, a shorter duration is indicative of a shorter molecule. In some embodiments, the amplification product is identified by its length.
[0133] In some embodiments, identifying the amplification product comprises differentiating the amplification product from a free DNA nucleotide. In some embodiments, identifying the amplification product comprises differentiating the amplification product from a free RNA nucleotide. In some embodiments, identifying the amplification product comprises differentiating the amplification product from a free amino acid. In some embodiments, identifying the amplification product comprises differentiating the amplification product from a first cDNA strand. In some embodiments, identifying the amplification product comprises differentiating the amplification product from the first RNA species. In some embodiments, identifying the amplification product comprises differentiating the amplification product from a off target product. If the primers were to erroneously amplify an off target, this target could still be distinguished due to its different length from the actual target amplicon. In some embodiments, identifying the amplification product comprises differentiating the amplification product from a first RNA species from an amplification product from a second RNA species.
[0134] In some embodiments, the method of the invention can also be used to simultaneously identify the presence of a second RNA species within the sample. In some embodiments, the second RNA species is a control species. In some embodiments, the second RNA is a second disease-associated RNA. By detecting the control species there is an internal control for the proper completion of all of the RT and amplification steps. Thus, even in a sample negative for the first RNA species, the control informs that the whole process is functioning and that the negative is a true negative and not a failure of the method. In some embodiments, the second RNA species is RNA of a control gene. In some embodiments, the control gene is a gene of the subject. In some embodiments, the control gene is a human gene. In some embodiments, the control gene is a gene of a healthy cell. In some embodiments, the control RNA is an RNA produced in a non-diseased cell. In some embodiments, the control RNA is an RNA produced by a non-diseased cell. In some embodiments, the control gene is a housekeeping gene. In some embodiments, the control gene is glucose-6-phosphate dehydrogenase (G6PDH). In some embodiments, the control gene is Ribonuclease P/MRP subunit P30 (RPP30). Control and housekeeping genes are well known in the art and any such gene may be used.
[0135] In some embodiments, the method further comprises contacting the sample with a third primer. In some embodiments, step (b) comprises contacting the sample with a third primer. In some embodiments, the third primer hybridizes to a second species of RNA. In some embodiments, the second primer produces a first cDNA strand complementary to the second RNA species. In some embodiments, the second primer produces a first cDNA strand complementary to at least a portion of the second RNA species. In some embodiments, the second primer produces a second first cDNA strand. In some embodiments, the first primer produces a first cDNA strand. In some embodiments, the first cDNA strand complementary to the second RNA species comprises the second primer.
[0136] In some embodiments, the method further comprises contacting the sample with a fourth primer. In some embodiments, the method further comprises in step (d) contacting the sample with a fourth primer. In some embodiments, the fourth primer hybridizes to the second first cDNA strand. In some embodiments, the fourth primer hybridizes to the first cDNA strand complementary to the second species of RNA. In some embodiments, the fourth primer produces an amplification product. In some embodiments, the fourth primer and third primer produce an amplification product. In some embodiments, the amplification product is a second amplification product. In some embodiments, the first primer and second primer produce a first amplification product.
[0137] In some embodiments, the second amplification product comprises a first termini that is identical to a sequence of the third primer and a second termini that is a reverse complement of a sequence of the fourth primer. In some embodiments, the second amplification product comprises a first termini that is a reverse complement to a sequence of the third primer and a second termini that is identical to a sequence of the fourth primer. In some embodiments, the second amplification product is derived from the second species of RNA. In some embodiments, second amplification product is derived from the second first cDNA strand. In some embodiments, the first amplification product and the second amplification produce differ in length by at least 20 nucleotides. In some embodiments, the first amplification product and the second amplification produce differ in length by at least 100 nucleotides. In some embodiments, the first amplification product and the second amplification product differ in length by an amount sufficient to allow the first amplification product to be distinguished from the second amplification product by the difference in dwell time through a nanopore. In some embodiments, a sufficient length is at least 20 nucleotides. In some embodiments, a sufficient length is at least 100 nucleotides. In some embodiments, a sufficient length is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 250, 300, 400, 500, 600, 700, 750, 800, 900 or 1000 nucleotides. Each possibility represents a separate embodiment of the invention.
[0138] The second RNA species can be distinguished from the first RNA species by designing primers that produce amplicons with different lengths. The amplification products are thus distinguishable by their different dwell times through the nanopore. Designing amplicons of a desired length is well known in the art and indeed many primer-design programs (e.g., Primer3) allow the setting of the amplicon length. Thus, a skilled artisan can easily design primers for the first RNA species and the second RNA species that produce amplification products of a different length that can be easily distinguished as they pass through the nanopore. Indeed, even larger numbers of RNA species (and thus genes) can be simultaneously analyzed so long as the amplicon size (amplification product size) is sufficiently different as to be distinguishable by dwell time.
[0139] In some embodiments, the method comprises quantifying at least two RNA species in the sample. In some embodiments, the method comprises quantifying at least three RNA species in the sample. In some embodiments, the method comprises quantifying at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 different RNA species in the sample. In some embodiments, a single RNA species is quantified using two different sets of primers that hybridizes in different regions of the RNA molecule and produce different amplification products that can be distinguished by dwell time in the nanopore. Regardless of the number of species quantified each different amplification product produced is to be of a sufficiently different length so as to distinguish each amplification product from the other amplification products.
[0140] In some embodiments, identification of the amplification product is indicative of the presence of the RNA species within the sample. In some embodiments, each instance of an amplification product passing through the nanopore is counted and the amount of the amplification product in the sample is quantified. In some embodiments, the quantity of amplification product is proportional to the quantity of RNA species. In some embodiments, the quantity of amplification product is equal to the quantity of the RNA species. In some embodiments, the presence of a single amplification product is indicative of the presence of the RNA species. In some embodiments, expression or presence of the RNA species is indicative of the presence of a disease. In some embodiments, expression or presence of the gene is indicative of the presence of a disease. In some embodiments, expression of a gene or RNA species above a predetermined threshold indicates the presence of a disease. In some embodiments, the expression or presence is in the sample. In some embodiments, detection beyond a predetermined threshold indicates the presence of a disease. In some embodiments, the predetermined threshold is zero expression.
[0141] In some embodiments, the first species of RNA comprises a mutation. In some embodiments, the mutation is a point mutation. In some embodiments, the mutation is an insertion. In some embodiments, the mutation is a deletion.
[0142] In some embodiments, the method further comprises contacting the amplification products with a first probe. In some embodiments, the first probe is complementary to the amplification product. In some embodiments, complementary is perfectly complementary. In some embodiments, the first probe is perfectly complementary to an amplification product comprising the mutation or comprising a nucleotide reverse complementary to the mutation. It will be understood by a skilled artisan that the amplification products maybe identical in sequence to the RNA (thought they are DNA and thus will have thymidine in place of uracil) or may be reverse complementary to the RNA. When reference is made to the mutation within the RNA being present in the amplification products it will be understood that this also refers to an amplification product that is reverse complementary to the RNA and comprises the reverse complement of the mutation. In some embodiments, the first probe is perfectly complementary except for the base at the position of the mutation to an amplification product that does not comprise the mutation. In some embodiments, the first probe comprises a terminal nucleotide that is complementary to the mutation. In some embodiments, the position in the first probe that is complementary to the mutation is a terminal position. In some embodiments, terminal is 3′ terminal. In some embodiments, terminal is 5′ terminal. In some embodiments, terminal is 5′ terminal. Thus, the first probe starts or ends with a base that is the same as/complementary to the mutation. In some embodiments, the mutation is a deletion and the terminus of the first probe is adjacent to the deleted sequence. In the case of a deletion the first probe will not include the mutation but rather will terminate at the mutation. In some embodiments, the first probe comprises a detectable moiety. In some embodiments, the first probe is devoid of a detectable moiety.
[0143] In some embodiments, the method further comprises contacting the amplification products with a second probe. In some embodiments, the second probe is complementary to the amplification product. In some embodiments, complementary is perfectly complementary. In some embodiments, the second probe and first probe are not complementary. In some embodiments, the first and second probes do not share common sequence. In some embodiments, the first and second probes are complementary to different region of the amplification products. In some embodiments, the second probe is complementary to a region of the amplification products directly adjacent to the mutation. In some embodiments, the first probe and second probe hybridize adjacent to one another to an amplification product that comprises the mutation. It will be understood by a skilled artisan that the first and second probes are designed such that they can be ligated one to the other only if an amplification product containing the mutation is present. In the case of a point mutation, a terminus of the first probe hybridizes only to the mutated nucleotide and not the wild-type nucleotide. The second probe hybridizes adjacent to the mutated nucleotide (or indeed the wild-type nucleotide). When the mutant base is present the end of the first probe is adjacent to the end of the second probe and they can be ligated. When the mutant base is absent the terminal nucleotide of the first probe doesn't hybridize and thus thought the second probe is still present the ligation reaction cannot occur due to the absence of a second terminus for ligation. In the case of a deletion mutation, the first and second probes each are adjacent to one side of the deleted region. Thus, when hybridizing to a mutant amplification product the two probes are adjacent and can ligate. In the case of a wild-type amplification product, both probes will hybridize but due to the intervening (not deleted) sequence, they cannot ligate. In the case of an insertion the first probe comprises the insertion sequence at a terminus. The first probe would terminate with the terminus of the insertion such that the second probe that is outside the insertion would be adjacent to the first probe and can ligate. In the absence of the insertion, much like the case of the point mutation, the terminus of the first probe is not hybridized and ligation cannot occur. In some embodiments, the second probe comprises a detectable moiety. In some embodiments, the second probe is devoid of a detectable moiety.
[0144] In some embodiments, the method further comprises ligating the first probe and second probe. In some embodiments, the ligation is ligation of first probe and second probe that are hybridized to an amplification product. In some embodiments, the amplification product is an amplification product comprising the mutation. In some embodiments, the ligation produces a ligated product. In some embodiments, the ligated product comprises the first and second probes. In some embodiments, the ligated product comprises a difference in length from the amplification products. In some embodiments, the ligated product comprises a difference in length from the first probe. In some embodiments, the ligated product comprises a difference in length from the second probe. In some embodiments, the ligated product comprises a difference in length from the RNA. In some embodiments, the difference in length is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 nucleotides. Each possibility represents a separate embodiment of the invention. In some embodiments, the difference in length is at least 15 nucleotides. In some embodiments, the difference in length is at least 20 nucleotides. In some embodiments, the difference in length is at least 100 nucleotides.
[0145] In some embodiments, the identifying is identifying the ligated product as it passes through the nanopore. In some embodiments, the method further comprises identifying the ligated product as it passes through the nanopore. In some embodiments, passes through is translocates. In some embodiments, identifying as it passes through is measuring dwell time. In some embodiments, identifying as it passes through is identifying a detectable moiety on the ligated product. In some embodiments, the identifying is detecting the detectable moiety on the ligated product. In some embodiments, the probes are devoid of a detectable moiety. In some embodiments, the identifying is identifying by dwell time. In some embodiments, the identifying comprises measuring duration of a change in electrical current. In some embodiments, the duration is proportional to a length of a nucleic acid molecule translocating through the nanopore. In some embodiments, measuring the duration and associating it to a length allows for distinguishing between the ligated product and the amplification product. In some embodiments, a difference in dwell time allows for distinguishing between the ligated product and the amplification product. In some embodiments, a difference in dwell time allows for distinguishing between the ligated product and first probe. In some embodiments, a difference in dwell time allows for distinguishing between the ligated product and second probe. In some embodiments, a difference in dwell time allows for distinguishing between the ligated product and RNA.
[0146] In some embodiments, the method further comprises administering a therapeutic agent or treatment that treats the disease. In some embodiments, a therapeutic agent is administered. In some embodiments, a therapeutic treatment is administered. In some embodiments, the therapeutic agent/treatment is an agent/treatment that specifically treats the disease. In some embodiments, the administering is to a subject diagnosed with the disease. In some embodiments, the administering is to a subject that provided a sample that was identified to contain the first RNA species. In some embodiments, the administering is to a subject that provided a sample that comprised an amount of the first RNA species above a predetermined threshold. In some embodiments, the therapeutic agent is a targeted therapy and targets the gene or protein of the first RNA species. In some embodiments, the disease is a bacterial disease and the therapy is an antibiotic. In some embodiments, the disease is a viral disease and the therapy is an antiviral therapy. Antibiotics and anti-virals are well known in the art and any such therapy may be employed. Indeed, the therapy selected can be determined by a skilled physician once the subject has been correctly diagnosed. In some embodiments, the method comprises quarantining or sending to quarantine the subject that provided a sample comprising the first RNA species. In some embodiments, the therapeutic agent/treatment is an anti-proliferative agent/treatment. In some embodiments, anti-proliferative is anti-cancer. Anti-cancer agents/treatments are well known in the art and include, for example, surgery, radiation therapy, chemotherapy, and immunotherapy to name but a few.
[0147] As used herein, the term “about” when combined with a value refers to plus and minus 10% of the reference value. For example, a length of about 1000 nanometers (nm) refers to a length of 1000 nm+−100 nm.
[0148] It is noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes a plurality of such polynucleotides and reference to “the polypeptide” includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0149] In those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
[0150] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0151] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.
[0152] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0153] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Md. (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Culture of Animal Cells—A Manual of Basic Technique” by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.
[0154] Materials and Methods
[0155] Sample preparation for nanopore experiments: Either DNaseI-treated RNA extracted from human cell lines or SARS-CoV-2 RNA (control 2, MN908947.3, Twist 102024.1) was reverse transcribed with specific primers (Table 1) and either subjected to second strand synthesis or to PCR amplification (see sample preparation scheme in
TABLE-US-00001 TABLE 1 Gene-specific primers used in SARS-CoV-2 experiments. No Gene Oligo Name Sequence (5’-3’) (SEQ ID NO:) 1 Human RPP30 hRPP30_For2 AGATTTGGACCTGCGAGC (1) 2 hRPP30_Rev5 GACAATCTTCATCTCCTTCTGAT (2) 3 Viral SARS- vRdRp_For2 GGTAACTGGTATGATTTCGGT (3) 4 CoV2 RdRp vRdRp_Rev2 CTGGTCAAGGTTAATATAGGCATT (4) 5 Viral SARS- vRdRp_For3 CTCATCAGGAGATGCCAC (5) 6 CoV2 RdRp vRdRp_Rev3 GCAATTTTGTTACCATCAGTAGAT (6)
[0156] Sample preparation for RT-qPCR of cell lines: Total RNA was isolated using GeneJet RNA Purification Kit (Thermo Fisher scientific), treated with DNase I (NEB) and further purified according to the manufacturer's instructions. 50 ng of DNaseI-treated RNA was reverse transcribed with random hexamers in a reaction mix (10 mM MgCl.sub.2, 1×RT buffer, 250 μM pooled dNTPs, 1 U/μl RNAse inhibitor, and 2.5 U/μl Moloney Murine Leukemia Virus reverse transcriptase; all from Thermo Fisher Scientific) using the following procedure: incubation at 23° C. for 15 min, synthesis at 42° C. for 45 min, denaturation at 95° C. for 5 min, and cooling at 4° C. The cDNA was amplified by qPCR using SYBR Green dye (PerfeCTa SYBR Green Fastmix, Quanta Biosciences) and primers for GOI1 or G012. PCR was performed under the following conditions: 95° C. for 2 min followed by 40 cycles of 95° C. for 7 s, 60° C. for 15 s and 72° C. for 20 s.
[0157] Sample preparation for RT-qNP analysis of cell lines: 50 ng total RNA was extracted from cell line 1 and 2, and reverse transcribed with GOI specific primers for each gene separately or with a combination of desired primers in a reaction mix (10 mM MgCl.sub.2, 15 pmol of each specific primer, 1×RT buffer, 500 μM pooled dNTPs, and 200 U/μl Maxima H Minus Reverse transcriptase) at 60° C. for 30 min. The reaction was terminated at 85° C. for 5 min. Subsequently, cDNA was amplified to the specified PCR cycle using Kapa HiFi polymerase. The amplified cDNA was treated with 2 U RNase I (Thermo Fisher Scientific) at 37° C. for 30 min. Next, the sample was treated with 4 μg ProK (Thermo Fisher Scientific) and 0.2% SDS at 37° C. for 30 min.
[0158] Sample preparation for RT-qNP analysis of SARS-CoV-2 RNA and hRPP30: Either DNaseI-treated RNA, extracted from HCT116 cells, or synthetic SARS-CoV-2 RNA were reversed transcribed with specific primers (Table 1) for human RPP30 cDNA or for two amplicons within the RdRp open reading frame of SARS-CoV-2. The reaction contained 1×isothermal buffer, 6 mM MgSO4, 1.4 mM dNTPs, 0.2 μM of each primer, 3 U warmstart RTx and 6 U Bst 2.0. The reaction was carried out at 62° C. for 30 min. cDNA samples were treated with 20 U of Exonuclease I (NEB) at 37° C. for 15 min, followed by 4 U RNase I (Thermo Fisher Scientific) at 37° C. for 30 min, and finally 0.16 U of ProK (NEB) in 0.2% SDS for 30 min.
[0159] Cell Lines: A cell lines were purchased from American Type Culture Collection (ATCC; Manassas, Va.). The cells were cultured either in RPMI (cell line 1) or in DMEM (cell line 2) media supplemented with 10% fetal calf serum (FCS). These adherent cell lines were grown in flasks in a humidified incubator at 37° C. with 5% CO2 and harvested at 80% confluency for subsequent total mRNA extraction. All used cell lines were authenticated by genotyping and were confirmed to be mycoplasma-free.
[0160] Device and Nanopore Fabrication: Nanopore chips were fabricated on a 4″ silicon wafer coated with silicon dioxide (SiO.sub.2, 500 nm) and low-stress amorphous silicon nitride (SiN.sub.x, 50 nm). The SiN.sub.x was locally thinned to 8-10 nm (˜2 μm circular wells) by reactive ion etching, followed by wet etching with buffered hydrofluoric acid etching to remove the SiO.sub.2. The etched SiN.sub.x and SiO.sub.2 acted as a hard mask for subsequent anisotropic Si etching in KOH (33% m/v).
[0161] Nanopore devices were cleaned in a 2:1 solution of H.sub.2SO.sub.4:H.sub.2O.sub.2 and subsequently glued using EcoFlex™ (smooth-on) onto a custom-made Teflon insert, immersed in buffer (1 M KCl, 40 mM Tris-HCl, 1 mM EDTA, pH 7.5), and placed in a Teflon cell. The buffer was filtered using a 0.02 μm syringe filter before use. Two Ag/AgCl pellet electrodes (A-M Systems, Sequim, Wash.) were connected to an Axon Axopatch 200B patch-clamp amplifier.
[0162] Nanopores were drilled in the thinned SiN.sub.x regions using controlled breakdown of dielectric (CBD) as previously reported. An in-house voltage/current amplifier and custom LabVIEW software (National Instruments) were used for the CBD process. Pore formation was terminated when the current exceeded a pre-set threshold, which was set to ˜0.3-0.4 nA measured under 300 mV after each pulse (pulses of 8-9 V with duration of 225 ms). The pore was then expanded using alternating low voltage pulses of 1-3 V with duration of 225 ms to the desired diameter of ˜4 nm, estimated according to the open pore current and the membrane properties (
[0163] Data acquisition and GMM analysis: Prior to adding the sample, the nanopores were kept under a low probing voltage (0.15 to 0.3 V) in a buffer solution (1 M KCl, 40 mM Tris-HCl, 1 mM EDTA, pH 7.5) to obtain a stable open pore current. During the experiment, translocation events were monitored using an Axon 200B amplifier, filtered at 100 kHz and acquired using a custom LabVIEW software (National Instruments). After collecting the data, offline analysis was performed using a custom LabVIEW program to extract the dwell time (t.sub.D), current blockage (ΔI) and arrival time (t.sub.a) of each translocation event according to an electrical threshold.
[0164]
[0165] Optimizing conditions for synthesis and multiplex detection of cDNA targets: Extensive optimization was performed to achieve high specificity and yield of cDNA products for all target genes. G6PDH was selected as a reference gene for both GOIs, based on previous studies. The corresponding cDNA products were 123 bp G012, 360 bp GOI1 and 1231 bp G6PDH. The following optimal annealing temperatures were chosen for each cDNA: 58-70° C. for GOI1, <68° C. for G012 and <70° C. for G6PDH. The sequence of the cDNA fragments was confirmed by Sanger sequencing.
[0166] Negative control of purification-free assay and nanopore sensing: To control for translocation events arising from contaminating background molecules, such as enzymes and RNA, nanopore sensing experiments were performed on −RT samples. These samples underwent the whole process but did not contain the RT enzyme. As demonstrated in
[0167] Controls and characteristics of the cell-line samples using multiplex sensing: In all the prepared multiplexed samples from the RKO cell line, no bands were observed for either of the GOIs as expected (see
[0168] Nanopore fabrication using CBD and characterization: The solid-state nanopores fabricated in localized thin regions using controlled dielectric breakdown (CBD) as described in Zrehen, et al., “Real-time visualization and sub-diffraction limit localization of nanometer-scale pore formation by dielectric breakdown.”, Nanoscale 9, 16437-16445 (2017) herein incorporated by reference in its entirety, and were Weibull-distributed. The membrane was <10 nm thick in the area where the pore was formed. Representative noise power spectral density (PSD) and current-voltage curves are shown in
Example 1: Method for Ultrasensitive Detection
[0169] To date nanopores have not been utilized for ultralow mRNA expression level quantification from cells or from clinical samples, partly due to two main factors:
i) the inherent complexity of directly processing the biological sample (i.e. cell extract, or plasma sample) containing thousands of different molecular species including proteins, lipids and nucleic acids that could either block the pore or produce erroneous signals;
ii) due to the limited selectivity of solid-state nanopores, which relies solely on the biomolecules charge and cross-section.
[0170] In contrast, the herein disclosed method called reverse transcription quantitative nanopore sensing (RT-qNP), shown schematically in
Example 2: Single-Molecule mRNA Quantification Using Solid-State Nanopore Biosensors
[0171] In RT-qNP total RNA is extracted either from cells or any other biological source, and all subsequent steps are additive and do not entail any purification steps (
[0172]
[0173] The final step of the NP sensing method is shown in
Example 3: Nanopore Quantification of Mixtures Containing Multiple cDNAs
[0174] To characterize the ability of the method to quantify relative concentrations of cDNAs in a mixture, nanopore measurements were performed using a mixture of two cDNAs, each containing a gene of interest (GOI) and a reference gene (RG). In these experiments, the cDNA was sufficiently amplified and purified using standard procedures to allow accurate quantification of the dsDNA molecules concentrations using UV-Vis spectrometry. The size of the amplicons were as follows: GOI1 was 360 bp, G012 was 123 bp, and RG was 1231 bp.
[0175]
[0176] The ratio of event rates determined by the GMM closely matches the concentration ratio of the two cDNA species in the mixture, highlighting the robustness of the method. The event classification is accurate despite slight differences in the DNA lengths and nanopore diameter between experiments, both affecting the absolute events rate measurements. It was therefore concluded that the after GMM classification based on arrival time histograms can provide a robust estimation for relative cDNA concentration, and that relative quantification against an internal reference gene can compensate for variability between pores and experiments.
Example 4: RT-qNP Analysis of mRNA Expression Cell Lines
[0177] RT-qNP analysis was used to determine the mRNA expression levels of GOI1 and G012 relative to the reference gene (G6PDH) in two cell lines. In four separate experiments, relative populations event rates of 16-fold amplified cDNA were evaluated. Validation of multiplexed sample preparation from each cell line by gel analysis is presented in
[0178] The mean event rates for the RG, calculated from the arrival time histograms in each data set, are shown in
[0179] The results from the RT-qNP method were compared to an RT-qPCR benchmark. To quantify gene expression using RT-qPCR, a calibration curve of the threshold cycle (C.sub.T) for known concentrations of RNA was constructed (
[0180] The results in
Example 5: RT-qNP mRNA Quantification Compared with RT-qPCR
[0181] To determine how ssNP sensing at low initial RNA concentrations can benefit from limited amplification, the assay was modified to include cDNA amplification starting from 16-fold (4 cycles) down to 2-fold (1 cycle).
[0182]
Example 6: RT-qNP Analysis of SARS-CoV-2 RNA
[0183] The COVID-19 pandemic has highlighted the importance of RNA detection as a diagnostic tool. Currently, the vast majority of nucleic acid tests are based on RT-qPCR amplification of a SARS-CoV-2 gene such as RdRp or ORF-lb. Such tests are not quantitative, and their binary diagnostic outcome is based on an empirical threshold of amplification cycles (commonly 35 or 40), rather than on quantitative RNA abundance. The arbitrary nature of the diagnostic threshold, and its variability between tests that use different primers, complicates comparisons of viral load and may lead to a large number of false positives. Quantification of viral RNA against a reference gene may provide a way to overcome these challenges.
[0184] To illustrate the flexibility of RT-qNP, the method was adapted to quantify SARS-CoV-2 viral RNA against a human reference gene (RPP30) of known concentration. While the workflow remained conceptually identical to the one shown in
[0185]
[0186] RT-qNP quantification was performed over a clinically relevant concentration range of synthetic SARS-CoV-2 RNA (1,250-5,000 copies), mixed with RPP30 mRNA extracted from a fixed amount of 0.25 ng total human RNA from HCT116 colon cancer cell line.
Example 7: RT-qNP Analysis of KRAS
[0187] A proof-of-concept experiment was performed to test the ability to specifically detect KRAS mutants. Probes were designed with specific sequences that target two regions along the KRAS genomic sequence (Table 2). Specifically, to target known CRC (and other cancers) mutations in KRAS, the probes were designed to end at the mutation site. The probe (66 bp) perfectly hybridizes to the KRAS genomic DNA, but the last nucleotide only hybridizes to the point mutation. This probe can further be ligated to a biotinylated probe (19 bp) to form a longer biotinylated strand using DNA ligase. The biotinylated probe hybridizes to the sequence directly on the other side of the point mutation. Ligation thus only occurs with the first probe hybridizes to the mutated base. The biotinylating is used for a purification step with magnetic streptavidin beads. Only ligated 85 bp fragments and the 19 bp biotinylated probe are pulled out. The biotinylated DNA is analyzed using the solid-state nanopore sensor. Each translocation of the longer (the ligated DNA strand) molecule is counted and considered a copy of the KRAS mutation.
TABLE-US-00002 TABLE 2 Gene-specific primers used in KRAS experiments. No Gene Oligo Name Sequence (5’-3’) (SEQ ID NO:) 1 KRAS KRAS_Exon2_P1_WT GCAAGCAGTGTCTTGCGCAAGCAGTGT WT CTTGCTAAGCGTACGTGCTTACACTCTT GCCTACGCCAC (7) 2 KRAS Exon2 P2 comb pCAGCTCCAACTACCACAAG-biotin (8) 3 KRAS KRAS_Exon2_P1_G12D GCAAGCAGTGTCTTGCGCAAGCAGTGT G12D CTTGCTAAGCGTACGTGCTTACACTCTT GCCTACGCCAT* (9) 4 KRAS_Exon2_P2_comb pCAGCTCCAACTACCACAAG-biotin (10) 5 KRAS KRAS_Exon2_P1_G13D CCTGACATGAATCAGGCCTGACATGAAT G13D CAGGTAAGCGTACGTGCTTAAGGCACTC TTGCCTACGT* (11) 6 KRAS_Exon2_P2_G13D pCACCAGCTCCAACTACCAC-biotin (12) 7 — Quencher TAAGCACGTACGCTTA-Q (13) 8 — bit “1” F1-CGTTCTGTGACGAACG-Q (14) 9 — bit “2” F2-CCTGATTCATGTCAGG-Q (15) *The point mutation is marked in bold. **p stands for phosphate group; F1-first fluorophore; F2-second fluorophore.
[0188] As can be seen in
[0189] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.