HYBRID PROTEINACEOUS MOLECULE CAPABLE OF INHIBITING AT LEAST ONE ANTIBIOTIC AND PHARMACEUTICAL COMPOSITION CONTAINING IT

Abstract

The invention relates to a hybrid proteinaceous molecule comprising at least two proteins capable of inhibiting the activity of at least one antibiotic, the proteins each having different biochemical properties and being bonded to one another. The hybrid proteinaceous molecule inhibits the activity of a least one antibiotic in order to reduce the intestinal side effects of antibiotics, such as severe diarrhoea caused by the antibiotics, and nosocomial infections secondary to parenteral antibiotic therapy.

Claims

1. A hybrid protein molecule comprising two enzymes that inhibit the activity of at least one antibiotic, one of said enzymes is a beta-lactamase and the other said enzyme is a beta-lactamase, an enzyme that inhibits an aminoglycoside, an enzyme that inhibits an fluoroquinolone, an enzyme that inhibits a macrolide, an enzyme that inhibits a tetracycline, or an enzyme that inhibits a lincosamide, said enzymes being bonded together.

2. The hybrid protein molecule according to claim 1, comprising two beta-lactamases linked together.

3. The hybrid protein molecule according to claim 1, wherein the enzyme that inhibits an aminoglycoside is a phosphotransferase, a nucleotidyltransferase or an acetyltransferase.

4. The hybrid protein molecule according to claim 1, wherein the enzyme that inhibits a fluoroquinolone is an aminoglycoside N-acetyltransferase.

5. The hybrid protein molecule according to claim 1, wherein the enzyme that inhibits a macrolide is an erythromycin esterase or an erythromycin phosphotransferase.

6. The hybrid protein molecule according to claim 1, wherein the enzyme that inhibits a tetracycline is an NADPH-dependent oxydoreductase tetracycline.

7. The hybrid protein molecule according to claim 1, wherein the enzyme that inhibits a lincosamide is a lincomycin nucleotidyltransferase.

8. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 1.

9. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 2.

10. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 3.

11. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 4.

12. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 5.

13. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 6.

14. The hybrid protein molecule according to claim 1, wherein at least one of the enzymes comprises a sequence having a sequence homology of at least 40% with SEQ ID No. 7.

15. The hybrid protein molecule according to claim 1, wherein the enzymes are fused into a single stranded protein.

16. The hybrid protein molecule according to claim 1, wherein the enzymes are linked together covalently by cross-linking.

17. A pharmaceutical composition comprising the hybrid protein molecule according to claim 1.

18. (canceled)

19. (canceled)

20. The pharmaceutical composition according to claim 17, wherein said composition is a dosage form for oral administration.

21. The pharmaceutical composition according to claim 17, further comprising at least one gastroprotective agent.

22. A method for the production of the hybrid protein molecule in accordance with claim 1 in a non-human living recombinant organism.

23. A method for reducing an intestinal side effect of at least one antibiotic comprising administering the hybrid protein molecule of claim 1 to a human or animal before, at the same time or after administration of at least one antibiotic.

24. The method of claim 23, wherein the intestinal side effect is a nosocomial infection, diarrhea, or a combination thereof.

Description

DESCRIPTION OF THE FIGURES

[0106] FIG. 1 presents a protein sequence alignment of different beta-lactamases belonging to the family of IR-TEM (Amber Class A). The alignment was performed with CLUSTALW2 software on the https://www.ebi.ac.uk/Tools/msa/clustalw2 site using the default settings. FIG. 1 shows, by the alignment of several sequences, that the IR-TEM enzymes show >90% protein identity. These enzymes are relatively well preserved and share between 80 and 99% protein sequence identity and are also well characterised (Bonnet, 2004).

[0107] FIG. 2 presents a protein sequence alignment of different beta-lactamases belonging to the family of CTX-M cefotaximases (Amber Class A). The alignment was performed on the https://www.ebi.ac.uk/Tools/msa/clustalw2 site using the default settings on the software.

[0108] FIG. 3 provides an illustration of the PCR technique used to generate the hybrid proteins. Two proteins are first amplified separately with a common sequence (at the 3′ and 5′ ends respectively) constituting a linker. The two fragments are then hybridised to the level of the complementary DNA sequence (that of the linker) and the whole is re-amplified using external primers.

[0109] FIG. 4 describes all of the constructs used to express the TEM-36 (SEQ lD1), CTXM-16 (SEQ lD2), TEM36-GGGGGG-CTXM16 (SEQ lD8), CTXM16-GGGGGG-TEM36 (SEQ lD9) and TEM36-G(EAAAK)2-CTXM16 (SEQ lD 10) proteins in Pichia pastoris. Cloning into the vector pJexpress915 was performed in Xhol/Notl using, when necessary, moderate digestion to preserve the internal Notl sites at the coding DNA sequence of CTXM16.

[0110] FIG. 5 presents the DNA fragments cloned into Xhol/Notl coding for the TEM-36 (SEQ lD1), CTXM-16 (SEQ lD2), TEM36-GGGGGG-CTXM16 (SEQ lD8), CTXM16-GGGGGG-TEM36 (SEQ lD9) and TEM36-G(EAAAK)2-CTXM16 (SEQ lD 10) proteins and that were obtained by PCR using the pJexpress915-SEQ-F and pJexpress915-SEQ-R primers and the following programme (95° C. 30 sec-25 cycles [95° C. 30 sec-53° C. 45 sec-72° C. 1 min]-72° C. 5 min-4° C.).

[0111] FIG. 6 presents the hybrid proteins and their constituent enzymes TEM-36 (SEQ lD1) and CTMX-16 (SEQ lD 2) on a 12% SDS-PAGE gel as obtained by expression and purification in Pichia pastoris and after having undergone de-glycosylation treatment by EndoHf.

[0112] FIG. 7 describes all of the constructs used to express the TEM-36 (SEQ lD1), CTXM-16 (SEQ lD2) proteins and the hybrid proteins TEM36-GGGGG-CTXM16, CTXM-16-GGGGG-TEM36 in Escherichia coli. The cloning into the pET-26b(+) vector was carried out by Ndel/Hindlll.

[0113] FIG. 8 presents DNA fragments cloned into Ndel/Hindlll in the pET-26(+) encoding TEM-36 (SEQ lD1), CTXM-16 (SEQ lD2), TEM36-GGGGG-CTXM16, CTXM16-GGGGG-TEM36 and which were obtained by PCR using the T7-F and T7-R primers and the following programme (95° C. 30 sec-25 cycles [95° C. 30 sec-55° C. 45 sec-72° C. 1 min]-72° C. 5 min-4° C.).

[0114] FIG. 9 presents hybrid proteins (TEM36-G.sub.5-CTXM16 and CTXM16-G.sub.5-TEM36) and their constituent enzymes TEM-36 (SEQ lD1) and CTXM-16 (SEQ lD 2) on a 12% SDS-PAGE gel as obtained by expression in E. coli and purification from the periplasmic fraction.

[0115] FIG. 10 presents the DNA fragments encoding the AAC-6′-lb-cr (SEQ lD4), CTXM-16 (SEQ lD2) and AAC-H6-CTXM16 obtained in the construction of the fusion AAC-H6-CTXM16 (SEQ lD 18).

[0116] FIG. 11 presents the hybrid protein AAC-H6-CTXM16 and its constituent enzymes AAC-6′-lb-cr (SEQ lD4) and CTXM-16 (SEQ lD 2) on a 12% SDS-PAGE gel as obtained after expression and purification in E. coli for AAC-6′-lb-cr and the hybrid protein and P. pastoris for CTXM-16.

[0117] FIG. 12 presents DNA fragments encoding for EreB (SEQ lD5), TEM36 (SEQ lD1) and EreB-H6-TEM36, which were obtained in the construction of the fusion EreB-H6-CTXM16 (SEQ lD 20).

DESCRIPTION OF THE LISTING OF SEQUENCES

[0118] Table 1 below summarises the listing of sequences and maps each SEQ-lD (ID No. in the table), the type of sequence, its name, its origin, its expression organism and its size.

TABLE-US-00001 TABLE 1 Identification of sequences 1 to 22 of the sequence listing Identifier ID Common (GeneBank/Swiss- Expression Type No. name Prot/UnitProtKB) Original host microorganism Length Description Protein 1 TEM36 Not available Escherichia coli E. coli./ 263 aa β-lactamase P. pastoris (aminopenicillinase) Protein 2 CTXM6 AAK32961 Escherichia coli E. coli./ 263 aa β-lactamase P. pastoris (cefotaximase) Protein 3 PC1 P00807 Staphylococcus E. coli./ 257 aa β-lactamase aureus P. pastoris (methicilli) Protein 4 AAC-6′-lb-cr ABC17627.1 Escherichia coli E. coli./ 199 aa fluroquinolone acetylating P. pastoris aminoglycoside acetyltransferase Protein 5 Ereb P05789.1 Escherichia coli E. coli./ 419 aa Erythromycine esterase P. pastoris Protein 6 TetX AAA27471.1 Bacteroides E. coli./ 388 aa Tetracycline oxydo-reductase fragilis P. pastoris NADPH-dependent Protein 7 LnuB (or Q9WVY4 Enterococcus E. coli./ 267 aa Lincomycine linB) faecium P. pastoris nucleotidylttransferase Protein 8 TEM36-G.sub.6- Not available Artificial Pichia 532 aa Fusion TEM36 and CTXM16 CTXM16 pastoris with flexible 6 Glycine liner Protein 9 CTXM16- Not available Artificial Pichia 532 aa Fusion CTXM16 and TEM36 G.sub.6-TEM36 pastoris with flexible 6 Glycine linker Protein 10 TEM36- Not available Artificial Pichia 537 aa Fusion TEM36 and G(EAAAK).sub.2- pastoris CTXM16 with rigid linker CTXM16 G(EAAAK).sub.2 Nucleotide 11 TEM36 Not available Escherichia coli E. coli./ 4158 bp Total sequence of vector P. pastoris pJexpress915 with TEM36 insert cloned in Xhol/Notl Nucleotide 12 CTXM16 AAK32961 Escherichia coli E. coli./ 900 bp Sequence of the insert P. pastoris CTXM16 cloned in Xhol/Notl Nucleotide 13 TEM36-G.sub.6- Not available Artificial Pichia 1680 bp Sequence of the insert CTXM16 pastoris TEM36-G.sub.6-CTXM16 cloned in Xhol/Notl Nucleotide 14 CTXM16- Not available Artificial Pichia 1634 bp Sequence of the insert G.sub.6-TEM36 pastoris CTXM16-G.sub.6-CTXM16 cloned in Xhol/Notl Nucleotide 15 TEM36- Not available Artificial Pichia 1648 bp Sequence of the insert G(EAAAK).sub.2- pastoris TEM36-G(EAAAK)2- CTXM16 CTXM16 cloned in Xhol/Notl Nucleotide 16 CTXM16 AAK32961 Escherichia coli E. coli 870 Insert Ndel/Hindlll coding for CTX-M16 in the vector pET26b+ Nucleotide 17 AAC-6′-lb-cr ABC17627.1 Escherichia coli E. coli 627 Insert Ndel/Hindlll coding for AAV in the vector pJ404 Nucleotide 18 AAC-H6- Not available Artificial E. coli 1416 Fusion AAC-6′-lb-cr with CTXM16 CTX-M16 with a Tag polyhistidine type linker Nucleotide 19 EreB P05789.1 Escherichia coli E. coli 1287 Insert Ndel/Hindlll coding for AAC in the vector pET26b+ Nucleotide 20 EreB-H6- Not available Artificial E. coli 2076 Fusion EreB with TEM36 TEM36 with a Tag polyhistidine type linker Protein 21 AAC-H6- Not available Artificial E. coli 468 Fusion AAC-6′-lb-cr with CTXM16 CTX-M16 with a Tag polyhistidine type linker Protein 22 EreB-H6- Not available Artificial E. coli 688 Fusion EreB with TEM36 TEM36 with a Tag polyhistidine type linker

EXAMPLE 1

Hybrid Protein Molecule Consisting of the Fusion of TEM-36 and CTX-M16 by a Flexible Linker

[0119] The first embodiment of the present invention describes the fusion of IR-TEM (SEQ lD1); (Chaibi, Sirot et al., 1999)) with a cefotaximase (SEQ lD2; (Bonnet, Dutour et al., 2001)) via a flexible polyglycine linker (6 glycine residues in this example) and giving rise to a hybrid protein (SEQ lD8) able to hydrolyse even amoxicillin in the presence of clavulanic acid as well as ceftriaxone.

[0120] The nucleotide sequences encoding the proteins TEM-36 (SEQ lD1) and CTX-M16 (SEQ lD2) were commercially obtained by gene synthesis in an expression vector for Pichia pastoris (https://www.dna20.com/services/gene-synthesis?gclid=CPnQIp3c9r0CFaoewwodnREAlg). The nucleotide sequence of TEM-36 inserted into the expression vector corresponds to SEQ lD 11 and the nucleotide sequence of CTX-M16 inserted in the expression vector corresponds to SEQ lD 12. These sequences were then amplified by PCR (95° C. 30 sec-25 cycles [95° C. 30 sec-TM° C. 45 sec-72° C. 1 min]-72° C. 5 min-4° C.) using a high fidelity DNA polymerase (Pfu, Promega) and partially complementary primers and the protein linker constituent (GGGGGG in this example) as indicated in Table 2. TEM-36 was amplified using the pair of TEM36-F and TEM36-6G-R primers with a TM of 57° C. CTXM16 was amplified using the pair of 6G-CTXM16-F and CTXM16-R primers with a TM of 57° C. The constituent sequences of the linker GGGGGG are indicated in bold type and underlined in Table 2.

TABLE-US-00002 TABLE 2 List of primers used to construct the hybrid sequence and protein TEM-36/CTX-M16 to a rigid linker. ID SEQ Primer name No. Sepuence5′-3′ Host TEM36-F 23 GAGGGTGTCTCTCTCGAG Pichia pastoris TEM36-6G-R 24 TCCACCTCCACCTCCTCCCCAATGTTTGATTAGGGA Pichia pastoris 6G-CTXM16-F 25 GGAGGTGGAGGTGGACAGACGTCAGCCGTGCAGCAAAAG Pichia pastoris CTXM16-R 26 GCTAGGCGGCCGCTTTTACAAACCTTCAGC Pichia pastoris

[0121] The two PCR fragments thereby obtained were hybridised at a TM of 55° C. and supplemented during 5 cycles of PCR without primers (95° C. 30 sec-55° C. 45 sec-72° C. 2 min15) using a high fidelity DNA polymerase (Pfu, Promega). The complete sequence encoding the hybrid protein was re-amplified after the addition of the external primers (TEM36-F+CTXM16-R). This embodiment of fusions by PCR is schematically presented in FIG. 3.

[0122] The TEM36-GGGGGG-CTXM16 fusion thereby produced was cloned with restriction enzymes Xhol and Notl in the pJexpress915 vector (expression Pichia pastoris) (FIG. 4). The sequence of the hybrid construction was verified in both directions and corresponds to the fusion described. FIG. 5 summarises the PCR fragments obtained with the primers pJexpress915-SEQ-F and pJexpress915-SEQ-R.

[0123] The vectors pJexpress915 expressing TEM-36, CTX-M16 and the fusion TEM36-GGGGGG-CTXM16 were amplified in Escherichia coli DH10B by maintaining a Zeocine (Invitrogen) selection pressure of 25 μg/ml on salt-depleted LB medium (Yeast extract 5 g/l; Tryptone 10 g/l; NaCl 5 g/l pH=7.5). To transform Pichia pastoris, 2 μg of linearized vector with the Swa l enzyme were electroporated into 60 μl of competent cells by a shock at 1500 V. The transformed cells are taken up in 1 ml of cold Sorbitol 1 M and put into culture for 2 hours at 30° C. prior to spreading (for 200 μl) on YPD-agar medium (Yeast extract 10 g/l; Peptone 20 g/l; Dextrose 20 g/l; agar 15 g/l-Phosphate 10 mM pH=6.8) containing 100 to 400 μg/ml of Zeocin and nitrocefin (20 μg/ml).

[0124] Expression in Pichia pastoris from the vector pJexpress915 leads to a secretion of proteins of interest, which are found in the culture medium. On YPD-agar plates containing nitrocefin, the secreted beta-lactamases induce a red hydrolysis halo (λ=486 nm) around the colonies that is representative of the level of expression. After 48 hours of incubation, the transformants with the best expression for each construct was inoculated in Sterlin tube containing 5 ml of YPD and 100 μg/ml of Zeocin and grown for 48 hours at 30° C. and stirred at 200 rpm.

[0125] The pre-cultures are then inoculated in 400 ml (200 ml per baffled Erlenmeyer flask) of fresh YPD medium without antibiotic selection pressure with an initial optical density of 0.2 at 600 nm. The culture is left for 48 hours at 30° C. under stirring at 100 rpm. After centrifugation at 10,000×g for 15 minutes at 4° C., the culture medium (supernatant) is stored at 4° C. in the presence of benzamidine (1 mM final). The proteins of the culture medium are then concentrated 10 times by tangential filtration through a 10 kDa membrane (Vivaflow 10 module, Sartorius) to a volume of 40 ml, then to 10 ml by ultrafiltration on 10 kDa membrane (Centricon, Millipore). The 10 ml are injected on a size exclusion chromatography column (Superdex G75 for the TEM-36 and CTX-M16 proteins, Superdex G200 for melting; 26*60 columns GE Healthcare), and eluted in 10 mM of sodium phosphate buffer pH=7.0 by 1 ml fraction and with a flow rate of 1 ml/min.

[0126] The fractions with the highest activity on nitrocefin (VWR) and the best purity (SDS-PAGE) is combined and concentrated to about 0.1-0.5 mg/ml. The protein content of the samples is measured by BCA (Pierce), absorbance at 280 nm and verification on SDS-PAGE gel. FIG. 6 provides the results.

[0127] For CTX-M16 and the fusion, which have N-glycosylation sites, the glycosylation is verified by cleavage of the sugars with EndoHf enzyme (New EnglandBiolabs) according to the manufacturer's recommendations (overnight at 37° C. in non-denaturant conditions). The proteins produced and purified are confirmed by tryptic digestion and MALDI-TOF mass spectrometry analysis.

[0128] As indicated in FIG. 6, the TEM-36 protein is not glycosylated and its size is compatible with the expected size of 28 kDa, as opposed to the CTX-M16 proteins and the different fusions. The apparent molecular weight of the latter on SDS-PAGE gel is higher (45 kDa versus 28 kDa and >66 kDa versus 56 kDa for CTX-M16 and the fusions respectively. Cutting with EndoHf provides proteins with the expected molecular weight (28 kDa and 56 kDa for CTX-M16 and the respective fusions), thereby confirming that these proteins are glycosylated.

[0129] The purified proteins were tested on different beta-lactams (amoxicillin (Apollo Scientific), Augmentin® (GlaxoSmithKline) and Ceftriaxone (Rocéphine®, Roche)). The assays are carried out at pH-STAT (Titrino 2.5, Metrohm) in a reaction volume of 25 ml at 37° C. and pH=7.0. The substrates are prepared at 4 g/l in a 0.3 mM Tris buffer, 150 mM NaCl. The enzyme hydrolysis of the beta-lactam nuclei releases an acid and induces a drop in the pH. The principle of the assay is to compensate for the acidification by the addition of 0.1 N sodium hydroxide so as to remain at pH=7.0. In these conditions, one unit corresponds to 1 μmole of sodium hydroxide added per minute, that is, one μmole of beta-lactam hydrolysed per minute. Table 3 below lists the specific activities measured for each protein on the three substrates (mean of 6 replicates).

TABLE-US-00003 TABLE 3 Specific activities of hybrid protein TEM- 36/CTX-M16 with a flexible linker and their constituent enzymes produced and purified in Pichia pastoris Specific activity (U/mg) Substrate Proteins Amoxicillin Augmentin ® Ceftriaxone TEM-36 816 ± 90 97 ± 74 0 CTX-M16 31 ± 2 0 306 ± 44 TEM36-GGGGGG- 695 ± 98 42 ± 33 114 ± 44 CTXM16

[0130] These results show that the fusion between TEM-36 and CTX-M16 generates a hybrid protein with an activity both on an aminopenicillin even in the presence of a beta-lactamase inhibitor and a third generation cephalosporin. Since both activities are described as antagonist in the literature (Ripoll, Baquero et al., 2011), there is no known natural enzyme with such high catalytic constants on these two substrates.

EXAMPLE 2

Hybrid Protein Molecule Consisting of the Fusion of CTX-M16 and TEM-36 by a Flexible Linker

[0131] A second embodiment of the present invention describes the fusion of a cefotaximase (SEQ lD2; (Bonnet, Dutour et al., 2001)) with an lR-TEM (SEQ lD1; (Chaibi, Sirot et al., 1999)) via a flexible linker polyglycine (6 glycine residues in this example) and giving rise to a hybrid protein (SEQ lD9) able to hydrolyse amoxicillin even in the presence of clavulanic acid as well as ceftriaxone.

[0132] This embodiment is identical that described in Example 1 with the exception of the PCR primers used to amplify sequences CTXM16 and TEM-36.

[0133] CTXM-16 was amplified using a pair of primers CTX16-F and CTXM16-6G-R with a TM of 58° C. TEM-36 was amplified using the pair of primers 6G-TEM36-F and TEM36-R with a TM of 58° C. The constituent sequences of the linker GGGGGG are indicated in bold type and underlined in Table 4.

TABLE-US-00004 TABLE 4 List of primers used to construct and sequence the hybrid protein CTX-M16/TEM-36 with a flexible linker. ID SEQ Primer name No. Sepuence5′-3′ Host CTXM16-F 27 GAGGGTGTCTCTCTCGAG Pichia pastoris CTXM16-6G-R 28 TCCTCCTCCTCCTCCTCCCAAACCTTCAGCTATGATCCG Pichia pastoris TEM36-6G-F 29 GGAGGAGGAGGAGGAGGACACCCTGAGACACTTGTCAAG Pichia pastoris TEM36-R 30 TTGAGCGGCCGCCCCTCA Pichia pastoris

[0134] The two PCR fragments thereby obtained were hybridised at a TM of 55° C. and supplemented during 5 cycles of PCR without primers (95° C. 30 sec-55° C. 45 sec-72° C. 2 min15) using a high-fidelity DNA polymerase (Pfu, Promega). The complete sequence encoding the hybrid protein was re-amplified after the addition of the external primers (CTXM16-F+TEM-36-R).

[0135] The conditions used for the expression and purification of the hybrid protein CTXM16-GGGGGG-TEM36 were strictly identical to those described in Example 1. The hybrid protein thereby obtained is also glycosylated as shown in FIG. 6 and combines a persistent penicilinase activity in the presence of clavulanic acid with a cefotaximase activity.

[0136] As in the case of Example 1, no natural protein presents the specific activities described in Table 5 on both substrates amoxicillin/clavulanic acid and ceftriaxone.

TABLE-US-00005 TABLE 5 Specific activities of hybrid protein CTX- M16/TEM-36 with a rigid linker and their constituent enzymes produced and purified in Pichia pastoris Specific activity (U/mg) Substrate Proteins Amoxicillin Augmentin ® Ceftriaxone TEM-36 816 ± 90 97 ± 74 0 CTX-M16 31 ± 2 0 306 ± 44 TEM36-GGGGGG- 890 ± 83 42 ± 14 123 ± 35 CTXM16

EXAMPLE 3

Hybrid Protein Molecule Consisting of the Fusion of TEM-36 and CTX-M16 by a Rigid Linker

[0137] The third embodiment of the present invention describes the fusion of an IR-TEM (SEQ lD1; (Chaibi, Sirot et al., 1999)) with a cefotaximase (SEQ lD2; (Bonnet, Dutour et al., 2001)) via a rigid protein linker (motif G(EAAAK).sub.2 in this example) and giving rise to a hybrid protein (SEQ lD10) able to hydrolyse amoxicillin even in the presence of clavulanic acid as well as ceftriaxone.

[0138] This embodiment is identical that described in Example 1 with the exception of the PCR primers used to amplify the sequences CTXM16 and TEM-36. TEM-36 was amplified using the pair of primers TEM36-F and TEM36-G(EAAAK).sub.2 with a TM of 58° C. CTXM16 was amplified using the pair of primers CTXM16-G(EAAAK).sub.2-F and CTXM16-R with a TM of 58° C. The constituent sequences of the linker G(EAAAK).sub.2 are indicated in bold type and underlined in Table 6.

TABLE-US-00006 TABLE 6 List of primers used to construct and sequence the hybrid protein CTX-M16 and TEM-36 with a rigid linker. ID SEQ Primer name No. Sepuence5′-3′ Host TEM36-F 23 GAGGGTGTCTCTCTCGAG Pichia pastoris CTXM16-R 26 GCTAGGCGGCCGCTTTTACAAACCTTCAGC Pichia pastoris TEM36- 31 TGCTGCCTCTTTAGCGGCCGCCTCTCCCCAATGTTTGATTAGGGA Pichia G(EAAAK).sub.2-R pastoris CTXM16- 32 GCCGCTAAAGAGGCAGCAGCAAAACAGACGTCAGCCGTG Pichia G(EAAAK).sub.2-F pastoris

[0139] The two PCR fragments thereby obtained were hybridised at a TM of 55° C. and supplemented during 5 cycles of PCR without primers (95° C. 30 sec-55° C. 45 sec-72° C. 2 min15) using a high-fidelity DNA polymerase (Pfu, Promega). The complete sequence encoding for the hybrid protein was re-amplified after the addition of external primers (TEM36-F+CTXM16-R).

[0140] The conditions used for the expression and purification of the hybrid protein TEM36-G(EAAAK).sub.2-TEM36 were strictly identical those described in Example 1. The hybrid protein thereby obtained is also glycosylated (FIG. 6) and combines a persistent penicillinase activity in the presence of clavulanic acid with a cefotaximase activity.

TABLE-US-00007 TABLE 7 Specific activities of hybrid protein CTX- M16/TEM-36 with a flexible linker and their constituent enzymes produced and purified in Pichia pastoris Specific activity (U/mg) Substrate Proteins Amoxicillin Augmentin ® Ceftriaxone TEM-36 816 ± 90 97 ± 74 0 CTX-M16 31 ± 2 0 306 ± 44 TEM36-GGGGGG-  890 ± 176 34 ± 6  141 ± 55 CTXM16

[0141] As in Examples 1 and 2, no natural protein presents the specific activities described in Table 7 on both substrates amoxicillin/clavulanic acid and ceftriaxone.

EXAMPLE 4

Non-Glycosylated Hybrid Protein Molecules Consisting of the Fusion of TEM-36 and CTX-M16 (and Vice-Versa) by a Flexible Linker

[0142] The coding sequences for TEM-36 (SEQ lD1) and CTXM16 (SEQ lD2) were commercially obtained by gene synthesis (https://www.dna20.com/services/gene-synthesis?gclid=CPnQlp3c9r0CFaoewwodnREAlg) in a periplasmic expression vector for E. coli. The nucleotide sequences were obtained in phase with the reading frame encoding a periplasmic targeting peptide (MSIQHFRVALIPFFAAFCLPVFA) with an Ndel restriction site at the initiating methionine and a Hindlll restriction site after the stop codon. Gene fragments Ndel/Hindlll were then sub-cloned in the pET-26b(+) vector (Invitrogen).

[0143] As shown in FIG. 3, we created two hybrid protein molecules by overlap PCR. The nucleotide sequence of TEM-36 and CTX-M16 were amplified by PCR (95° C. 30 sec-25 cycles [95° C. 30 sec-TM° C. 45 sec-72° C. 1 min]-72° C. 5 min-4° C.) using a high-fidelity DNA polymerase (Pfu, Promega) and partially complementary primers constituting the linker protein (GGGGGG in this example). TEM-36 was amplified with a TM of 55° C. using either the primer pair T7-F and TEM36-G6-R-co or the primer pair TEM36-G6-F-co and T7-R. CTXM16 was amplified with a TM of 55° C. using the primer pair CTXM16-G6-F-co and T7-R or the primer pair CTXM16-G6-R-co and T7-F. The constituent sequences of the linker GGGGGG are indicated in bold type and underlined in Table 8.

TABLE-US-00008 TABLE 8 List of primers used to construct and sequence the hybrid protein TEM-36/CTX-M16 with a flexible linker. ID SEQ Primer name No. Sepuence5′-3′ Host T7-F 33 TAATACGACTCACTATAGGGGAAT E. coli TEM36_36G_R_co 34 TCCTCCTCCTCCTCCTCCCCAATGTTTAATCAGGCT E. coli CTXM16-G6_F_co 35 GGAGGAGGAGGAGGACAGACGTCAGCCGTGCAGCAAAAG E. coli CTXM16-G6_R_co 36 TCCTCCTCCTCCTCCTCCCAAACCTTCAGCTATGATCCG E. coli TEM36-6G-F 37 GGAGGAGGAGGAGGAGGACACCCTGAGACACTTGTCAAG E. coli T7-R 38 CTAGTTATTGCTCAGCGGTGG E. coli

[0144] The two PCR fragments thereby obtained (TEM36-G6+G6-CTXM16 and CTXM16-G6+G6-TEM36) were hybridised at a TM of 55° C. and supplemented during 5 cycles of PCR without primers (95° C. 30 sec-53° C. 45 sec-72° C. 2 min15) using a high-fidelity DNA polymerase (Pfu, Promega). The complete sequence encoding for the hybrid protein was re-amplified after the addition of external primers (T7-F+T7-R) operating at a TM of 55° C.

[0145] The fusions TEM36-GGGGGG-CTXM16 and CTX-M16-GGGGGG-TEM36 thereby produced were cloned with the Ndel and Hindlll restriction enzymes in a pET26b+ vector (expression in E. coli) (FIG. 7).

[0146] The sequences of the hybrid constructs were verified in directions and revealed that the linker of the 2 hybrid protein molecules actually consist of only 5 glycines. A more favourable nucleic rearrangement probably occurred at the time of the PCR hybridations. FIG. 8 sums up the PCR fragments obtained with the primers T7-F and T7-R.

[0147] The pET-26b(+) expression vectors expressing TEM-36 (SEQ lD1), CTX-M16 (SEQ lD2) and the fusions TEM36-G.sub.5-CTXM16 and CTXM16-G.sub.5-TEM36 were amplified in Escherichia coli DH10B by maintaining a Kanamycin (Euromedex) selection pressure at 50 μg/ml on LB medium (Yeast extract 5 g/l; Tryptone 10 g/l; NaCl 10 g/l pH=7). The expression strain BL21(DE3) pLysS was transformed with the expression vectors by heat shock. The transformed cells were spread on LB-agar medium (Yeast extract 5 g/l; Tryptone 10 g/l; NaCl 10 g/l; Agar 15 g/l pH=7) containing 50 μg/ml of Kanamycin.

[0148] The expression in E. coli from the pET-26b(+) vector leads to an addressing of the proteins of interest in the periplasmic compartment of bacteria where they are functional. The fusions created as described in Example were evaluated in 2 complementary ways: (i) by biochemically characterising the partially purified proteins and (ii) by comparing the minimum inhibitory concentrations (MIC) of different b-lactams (amoxicillin, Augmentin and Rocéphine) on the expression strains.

[0149] Purification of Hybrid Protein Molecules and Their Component in E. Coli:

[0150] The transformed bacteria are grown in 100 ml of LB+50 μg/ml of Kanamycin at 37° C. and with stirring at 200 rpm until saturation. The pre-cultures are then inoculated at 1/40.sup.th in 1 L of LB medium+50 μg/ml Kanamycin. When the OD600 nm reached a value of 0.6 (about 2 hours), the protein production is induced by the addition of 0.5 mM final IPTG and continues for 16 hours at 20° C. with stirring at 200 rpm. The cells are centrifuged at 5,000×g for 15 minutes at 4° C. and the sediment immediately taken up in an osmolysis buffer to break the outer membrane and recover the periplasma. The cells are taken up with 1 ml of buffer (Phosphate 100 mM, Sucrose 500 mM, EDTA 1 mM pH=7.0) for 120 Units of OD600 nm and incubated for several minutes with vortex homogenisation (protocol adapted from (Schlegel, Rujas et al. 2013)). After centrifugation at 12,000×g for 20 minutes at 4° C., the supernatant containing the periplasmic proteins is concentrated on Amicon Ultra (15 ml, 10 kDa, Millipore) until the volume does not exceed 10 ml. The totality of the proteins is injected on an exclusion chromatography column (Superdex G75, GE Healthcare) and the proteins are eluted in phosphate buffer (Phosphate 10 mM, NaCl 100 mM pH=7.0) per 1 ml fraction and with a flow of 1 ml/min. The fractions with the highest activity on nitrocefin (VWR) and the best purity (SDS-PAGE) are combined and concentrated to about 0.1-0.5 mg/ml. The protein content of the samples is measured by absorbance at 280 nm and verification on SDS-PAGE gel. FIG. 9 presents the partially purified proteins as obtained before biochemical characterisation.

[0151] The enzyme activities of the purified proteins were measured on different beta-lactams (amoxicillin (Apollo Scientific), Augmentin® (GlaxoSmithKline) and Ceftriaxone (Rochéphine®, Roche)) as described in the above examples and the results are compiled in Table 9 below.

TABLE-US-00009 TABLE 9 Specific activities of hybrid protein molecules TEM36-G.sub.5-CTXM16 and CTXM16-G.sub.5-TEM36 (flexible linker) and their constituent enzymes produced and purified in Escherichia coli BL21(DE3) pLysS. Specific activity (U/mg) Substrate Proteins Amoxicillin Augmentin ® Ceftriaxone TEM-36 3593 ± 87  385 ± 31  1 ± 1 CTX-M16 21 ± 1 0 158 ± 14 TEM36-GGGGGG- 633 ± 99 24 ± 5 138 ± 32 CTXM16 CTXM16-GGGGG- 566 ± 32 17 ± 5  103 ± 3142 TEM36

[0152] As in Examples 1 to 3, no natural protein presents the specific activities described in Table 9 on both substrates amoxicillin and ceftriaxone.

[0153] Resistance of Strains of E. Coli Expressing the Hybrid Protein Molecules to Various Beta-Lactams:

[0154] The transformed bacteria (expressing TEM36, CTXM16 or the fusions TEM36-G5-CTXM16 and CTXM16-G5-TEM36) or the empty strain (BL21(DE3)pLysS) are put in culture in 5 ml of LB+50 μg/ml of Kanamycin when necessary at 37° C. and stirring at 200 rpm until saturation. The pre-cultures are then inoculated at 1/40.sup.th in 5 ml of LB+50 μg/ml Kanamycin medium and when the OD600 reaches a value of 0.6 (about 2 hours), the production of protein is induced by the addition of final IPTG 1 mM and continues for 1.5 hours at 37° C. with stirring at 200 rpm.

[0155] The cells are normalised at 108 cfu/ml and diluted in cascade to 10.sup.7, 10.sup.6, 10.sup.5, 10.sup.4 cfu/ml and 5 μl of each suspension are deposited on an LB-Agar plate containing increasing concentrations of antibiotics (Amoxicillin 0, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1024 μg/ml; Augmentin 0, 1, 2, 4, 8, 16, 32, 64, 128, 256, 512 μg/ml and Rocéphine 0, 0.5, 1, 2, 4, 8, 16, 32, 64, 128, 256, 512 μg/ml).

[0156] The dishes were incubated at 37° C. overnight and the results were recorded the following day. The MICs correspond to the lowest concentration of antibiotic at which the highest inoculum doesn't grow.

[0157] The data is provided in Table 10 below.

TABLE-US-00010 TABLE 10 MICs of beta-lactam antibiotics for strains of E. coli expressing the hybrid protein molecules TEM36-G.sub.5-CTXM16 and CTXM16-G.sub.5-TEM36 (flexible linker) and their constituent enzymes. Antibiotics MIC (μg/ml) Strain Amoxicillin Augmentin Rocephine BL21(DE3)pLysS <0.5 <0.5 <0.5 BL21(DE3)pLysS + TEM36 >1024 512 <0.5 BL21(DE3)pLysS + CTXM16 >1024 4 512 BL21(DE3)pLysS + TEM36-G.sub.5- >1024 128 64 CTXM16 BL21(DE3)pLysS + CTXM16- >1024 128 128 G.sub.5-TEM36

[0158] The E. coli cells expressing the hybrid protein molecules as described in Example 4 present a multidrug resistance phenotype to aminopenicillins (with or without inhibitors such as clavulanic acid) and 3.sup.rd generation cephalosporins such as ceftriaxone. No natural bacteria strain has so far been described in the literature with such a phenotype.

EXAMPLE 5

Hybrid Protein Molecule Consisting of the Fusion of CTX-M16 and AAC-6′-lb-cr by a Poly-Histidine Linker

[0159] The nucleotide sequences encoding the CTX-M16 (SEQ lD2) and AAC-6′-lb-cr proteins (hereafter called AAC) (SEQ lD4) were commercially obtained by gene synthesis in an expression vector for E. coli, respectively pJexpress411 (KanR) and pJ404(AmpR). The nucleic sequence of CTX-M16 inserted in the vector pJexpress411 corresponds to SEQ lD16 and the nucleic sequence of AAC inserted in the vector pJ404 corresponds to SEQ lD12. These sequences were then amplified by PCR (95° C. 30 sec-25 cycles [95° C. 30 sec-TM° C. 45 sec-72° C. 1 min]-72° C. 5 min-4° C.) using a high-fidelity DNA polymerase (Pfu, Promega) and partially complementary primers constituent of the protein linker (HHHHHH in this example) as indicated in Table 11. CTX-M16 was amplified using the primer pair 6H-CTX-F and T7R with a TM of 62° C. ACC was amplified using the primer pair AAC-F_coli and AAC-6H-R with a TM of 50° C. The constituent sequences of the linker HHHHHH are indicated in bold type underlined in Table 11.

TABLE-US-00011 TABLE 11 List of primers used to construct and sequence the hybrid protein AAC-H6-CTXM16 with a polyhistidine linker. ID SEQ Primer name No. Sepuence5′-3′ Host AAC-F_coli 39 GAAGGAGATATACATATGAGCAACGCT E. coli AAC-6H-R 40 GTGGTGATGATGGTGGTGCGC E. coli H6-CTX-F 41 CACCATCATCACCACCAGACGTCAGCCGTGCAGCAAAAG E. coli T7-R 38 CTAGTTATTGCTCAGCGGTGG E. coli

[0160] The two PCR fragments thereby obtained were hybridised at a TM of 62° C. and supplemented during 5 cycles of PCR without primers (95° C. 30 sec-62° C. 45 sec-72° C. 2 min15) using a high-fidelity DNA polymerase (Pfu, Promega). The complete sequence encoding for the hybrid protein was re-amplified after addition of the external primers (AAC-F_coli+T7R). This embodiment of fusions by PCR is schematically presented in FIG. 3. The inserts encoding for AAC, CTXM16 and the fusion AAC-6H-CTXM16 were loaded on 1% agarose gel to illustrate their respective size (FIG. 10).

[0161] The fusion AAC-6H-CTXM16 thereby produced was cloned with Ndel and HinDlll restriction enzymes in the pET26b+ vector (E. coli expression) according to the principle illustrated in FIG. 7.

[0162] The sequence of the hybrid construction was verified in both directions and corresponds to the fusion described.

[0163] The pJ404-AAC expression vectors expressing AAC and pET-AAC-6H-CTXM16 expressing the fusion AAC-H6-CTXM16 were transformed in Escherichia coli BL21(DE3)pLysS by maintaining an 100 μg/ml Ampicillin (Euromedex) and 50 μg/ml Kanamycin (Euromedex) selection pressure on LB medium (Yeast extract 5 g/l; Tryptone 10 g/l; NaCl 10 g/l pH=7.5. The expression of AAC as well as the AAC-6H-CTX fusion in E. coli from vector pJ404 results in inclusion bodies for the proteins of interest.

[0164] For each protein, 1 L of LB is seeded at 1/40.sup.th from a saturated pre-culture and then grown at 37° C. with stirring at 200 rpm until an OD (600 nm) of about 0.4-0.6. The cultures are induced for 4 hours at 37° C. and 200 rpm by the addition of 0.5 mM final IPTG. At the end of production, the cells are centrifuged and the sediment is taken up at 40 ml/L of culture in lysis buffer (10 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.1% Triton X100 pH=8.0 and 0.25 mg/ml lysozyme) and then frozen at −80° C. The cells are thawed out and lysed for 45 minutes at ambient temperature in the presence of MgSO.sub.4 (20 mM) and DNAse (10 μg/ml). The lysate is centrifuged (30 min at 12,000×g at 4° C.) and the sediment containing the inclusion bodies of the proteins of interest (AAC and AAC-6H-CTXM16) is taken up in buffer A (10 mM Phosphate, 150 mM NaCl, 10 mM Imidazole, 8 M Urea pH=8.0). The proteins are purified by Nickel affinity chromatography and eluted with a gradient of buffer B (10 mM Phosphate, 150 mM NaCl, 500 mM Imidazole, 8 M Urea pH=8.0).

[0165] The fractions containing the proteins of interest are mixed, incubated for 1 hour at 4° C. in the presence of 1 mM DTT, then re-natured by 3 successive dialyses in 10 mM Phosphate buffer, 150 mM NaCl pH=8. The proteins are clarified by centrifugation then concentrated to a volume not exceeding 10 ml by ultrafiltration through a 10 kDa membrane (Centricon, Millipore). The proteins are injected onto a size exclusion chromatography column (Superdex G200; columns 26*60 GE Healthcare) and eluted in 10 mM Phosphate buffer, 150 mM NaCl pH=8.0 by 1 ml fraction with a flow of 1 ml/min.

[0166] The fractions with the highest activity on Nitrocefin (VWR) and the best purity (SDS-PAGE) are combined and concentrated to about 0.5 mg/ml. The protein content of the samples is measured by BCA (Pierce), absorbance at 280 nm and verification on SDS-PAGE gel. FIG. 11 presents the results of the purified proteins obtained.

[0167] The purified proteins were tested on different antibiotics: Ceftriaxone (RocéphineED, Roche) for the beta-lactams and kanamycin for the Aminoglycosides. The assays on ceftriaxone were carried out at pH-STAT (Titrino 2.5, Metrohm) in a reaction volume of 25 ml at 37° C. and pH=7.0. The substrates are prepared at 4 g/l in a 0.3 mM Tris buffer, 150 mM NaCl. The enzyme hydrolysis of the beta-lactam nuclei releases an acid and results in a drop in the pH. The principle of the assay is to compensate this acidification by the addition of 0.1 N sodium hydroxide so as to remain at pH=7.0. In these conditions, one unit corresponds to 1 μmol of sodium hydroxide added per minute, that is one μmol of beta-lactam hydrolyzed per minute.

[0168] The activity of acety-transferase is measured by an indirect colorimetric assay with acetyl-CoA (Sigma-Aldrich) as acetyl group donor, Kanamycin as acceptor and Elleman reagent (DTNB, Sigma-Aldrich) to titrate the CoEnzymeA reduced (—SH) molecules released during the enzyme reaction [Ref]. The reaction takes place on a microtitration plate with increasing quantities of purified enzymes, in a final volume of 200 μl and with concentrations of 500 μM Kanamycin, 500 μM AcetylCoA and 250 μM DTNB. In these experimental conditions, the ion TNB.sup.2 absorbs at 412 nm with an ε(λ=412 nm) apparent 19 000 M.sup.−1.well.sup.−1 (well of a 96 well plate filled with 200 μl) and 1 unit corresponds to one nanomole of TNB.sup.2 released per minute at 37° C.

[0169] Table 12 below sums up the specific activities measured for each protein on the three substrates (mean of 6 experiments, that is, n=6).

TABLE-US-00012 TABLE 12 Specific activities of hybrid protein AAC-H6- CTX-M16 and their constituent enzymes Specific activity (U/mg) Substrate Proteins Kanamycin Cetriaxone AAC 10.2 ± 3.2 0 CTX-M16 0 336 ± 5  AAC-6H-CTXM16 14.2 ± 2.4 270 ± 36

[0170] These results show that the fusion between AAC-6′-lb-cr and CTX-M16 generates a hybrid protein able to hydrolyze a third generation cephalosporin and inactivate an aminoglycoside by acetylation. There is no known natural enzyme capable of inactivating an antibiotic in these two classes.

EXAMPLE 6

Non-Glycosylated Hybrid Protein Molecules Consisting of the Fusion of EreB and TEM36 by a Tag Polyhistidine Type Linker

[0171] The sequences encoding for TEM-36 (SEQ lD1) and EreB (SEQ lD5) were commercially obtained by gene synthesis in an expression vector for E. coli. The gene fragments Ndel/Hindlll were then sub-cloned in the pET-26b(+) vector (Invitrogen).

[0172] According to the principle described in FIG. 3, we produced a hybrid protein molecule EreB-H6-TEM36 by overlap PCR. The nucleotide sequence of TEM-36 and EreB were amplified by PCR (95° C. 30 sec-25 cycles [95° C. 30 sec-TM° C. 45 sec-72° C. 1 min]-72° C. 5 min-4° C.) using a high-fidelity DNA polymerase (Pfu, Promega) and partially complementary primers constitutive of the protein linker (histidine tag 6 in this example). TEM-36 was amplified with a TM of 65° C. using primer pair EreB6HTEM36_coli_F and T7_R. EreB was amplified with a TM of 65° C. using the primer pair EreB_coli_F and EreB6HTEM36_R. The constituent sequences of the HHHHHH linker are indicated in bold type and underlined in Table 13.

TABLE-US-00013 TABLE 13 List of primers used to construct and sequence the hybrid protein EreB-H6-TEM-36. ID SEQ Primer name No. Sepuence5′-3′ Host EreB_coli_F 39 GATATACATATGCGTTTTGAAGAGTGG E. coli EreB6HTEM36_R 40 GTGATGGTGATGGTGGTGCTCATAAAC E. coli EreB6HTEM36_coli_F 41 CACCACCATCACCATCACCACCCGGAAACCCTGGTGAAAGTT E. coli T7-R 38 CTAGTTATTGCTCAGCGGTGG E. coli

[0173] The PCR fragments thereby obtained were hybridized at a TM of 55° C. and supplemented during 5 cycles of PCR without primers (95° C. 30 sec-55° C. 45 sec-72° C. 2 min15) using a high-fidelity DNA polymerase (Pfu, Promega). The complete sequence encoding for the hybrid protein was re-amplified after the addition of external primers (EreB_coli_F+T7-R) operating at a TM of 55° C.

[0174] The EreB-H6-TEM36 fusion thereby produced was cloned with the Ndel and Hindlll enzyme restrictions in the pET26b+ vector (expression in E. coli) (FIG. 7).

[0175] The sequence of hybrid construction was verified in both directions. FIG. 12 sums up the PCR fragments obtained with the T7-F and T7-R primers on the pET-TEM36, EreB and EreB-H6-TEM36 series.

[0176] The pET-26b(+) expression vectors expressing TEM-36 (SEQ lD1), EreB (SEQ lD2) and the fusion EreB-H6-TEM36 were amplified in Escherichia coli DH10B while maintaining a 50 μg/ml Kanamycin (Euromedex) selection pressure on LB medium (Yeast extract 5 g/l; Tryptone 10 g/l, NaCl 10 g/l pH=7). The expression strain BL21(DE3) pLysS was transformed with the expression vectors by heat shock. The transformed cells were spread on LB-agar medium (Yeast extract 5 g/l; Tryptone 10 g/l; NaCl 10 g/l; agar 15 g/l pH=7) containing 50 μg/ml of Kanamycin.

[0177] The functionality of the proteins of interest (TEM36, EreB and the fusion EreB-H6-TEM36) in E. coli was evaluated by measuring the resistance of the expression strains to different b-lactam (amoxicillin and augmentin) and macrolide (erythromycin) type antibiotics.

[0178] The transformed bacteria (expressing TEM36, EreB or EreB-H6-TEM36) or the empty strain (BL21(DE3)pLysS) are put in culture in 5 ml of LB+50 μg/ml of Kanamycin when necessary at 37° C. with stirring at 200 rpm until saturation. The pre-cultures are then inoculated at 1/40.sup.th in 5 ml of LB+50 μg/ml Kanamycin medium and when the OD600 nm reaches a value of 0.6 (about 2 hours), the production of protein is induced by the addition of 1 mM final IPTG and continued for 1.5 hours at 37° C. with stirring at 200 rpm.

[0179] The cells are normalized to 108 cfu/ml and diluted in cascade to 10.sup.7, 10.sup.6, 10.sup.5, 10.sup.4 cfu/ml and 5 μl of each suspension are deposited on an LB-agar dish containing increasing concentrations of antibiotics (Amoxicillin 0, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1024, 2048 μg/ml; Augmentin 0, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1024 μg/ml and Erythromycin 0, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1024 μg/ml).

[0180] The dishes are incubated at 37° C. over night and the results are recorded the next day. The MICs correspond to the lowest concentration of antibiotic at which the highest inoculum no longer grows.

[0181] The data are provided in Table 14 below.

TABLE-US-00014 TABLE 14 MICs of beta-lactam and macrolide antibiotics for strains of E. coli expressing the hybrid protein molecule EreB-H6-TEM36 and their constituent enzymes. Antibiotics MIC (μg/ml) Strain Amoxicillin Augmentin Erythromycin BL21(DE3)pLysS <2 <2 256 BL21(DE3)pLysS + >2048 512 256 TEM36 BL21(DE3)pLysS + EreB <2 <2 >1024 BL21(DE3)pLysS + EreB- 32 8 >1024 H6-TEM36

[0182] The E. coli cells expressing the hybrid protein molecule as described in Example 6 presents a multidrug resistance phenotype to aminopenicillins (with or without inhibitors such as clavulanic acid) and macrolides such as erythromycin. No natural bacteria strain has so far been described in the literature with such a phenotype resulting from the expression of a single protein.