KCC2 EXPRESSION ENHANCING COMPOUNDS AND USES THEREOF
20220378782 · 2022-12-01
Assignee
Inventors
Cpc classification
C07D409/12
CHEMISTRY; METALLURGY
A61K31/519
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/4525
HUMAN NECESSITIES
C07D401/12
CHEMISTRY; METALLURGY
A61K31/517
HUMAN NECESSITIES
A61K31/4709
HUMAN NECESSITIES
A61K31/704
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
C07D231/56
CHEMISTRY; METALLURGY
International classification
A61K31/496
HUMAN NECESSITIES
A61K31/4525
HUMAN NECESSITIES
A61K31/4709
HUMAN NECESSITIES
A61K31/519
HUMAN NECESSITIES
Abstract
Potassium chloride cotransporter-2 (KCC2) plays a critical role in brain function, and deficiency in KCC2 has been linked to neurological diseases, psychiatric disorders, and central nervous system injuries. In particular, Rett syndrome (RTT), a severe neurodevelopmental disorder caused by mutations in the X-linked gene Methyl CpG binding Protein 2 (MECP2), has been linked to deficits in KCC2. The disclosure reports the use of CRISPR/Cas9 genome-editing technology to generate stem cell-derived, genetically defined KCC2 reporter human neurons for large-scale compound screening. This screening platform has been utilized to identify a number of small molecule compounds that are capable of enhancing KCC2 expression in both wild-type and RTT neurons, as well as organotypical brain slices cultured from wild-type mice. These first-in class compounds may be applied as a novel therapeutic approach to restore the impaired balance between excitation and inhibition observed in neurological diseases, psychiatric disorders, and central nervous system injuries.
Claims
1. A method of treating a subject with a neurological disease, psychiatric disorder, or central nervous system injury characterized by deficient expression or function of KCC2 comprising: administering to the subject a therapeutically effective amount of a compound selected from the group consisting of Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and pharmaceutically acceptable salts thereof.
2. The method of claim 1, wherein the compound is selected from the group consisting of (E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), 2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime), resveratrol, piperine, and pharmaceutically acceptable salts thereof.
3. A method of treating a subject with an autism spectrum disorder (ASD) comprising: administering to the subject a therapeutically effective amount of a compound selected from the group consisting of Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and pharmaceutically acceptable salts thereof.
4. The method of claim 3, wherein the compound is selected from the group consisting of (E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), 2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime), resveratrol, piperine, and pharmaceutically acceptable salts thereof.
5-6. (canceled)
7. The method of claim 1, wherein the subject is a mammal.
8. The method of claim 1, wherein the subject is a human.
9. The method of a claim 1, wherein the subject is a rodent.
10. The method of claim 1, wherein the subject is a mouse.
11. A method of identifying a compound that modulates the level of potassium chloride cotransporter 2 (KCC2) in a cell, the method comprising steps of: contacting a test compound with a cell; incubating the test compound with the cell for at least 24 hours under physiological conditions; determining the expression level of KCC2 in the cell.
12. The method of claim 11, wherein the cell is a neuronal cell.
13-14. (canceled)
15. The method of claim 12, wherein the neuronal cells are human neuronal cells.
16. The method of claim 12, wherein the neuronal cells are mice neuronal cells.
17. The method of claim 12, wherein the neuronal cells are derived from embryonic stem cells or iPS cells.
18. The method of claim 12, wherein the neuronal cells are wild-type KCC2 neurons.
19-38. (canceled)
39. The method of claim 11, wherein the cells comprise a reporter gene in the KCC2 locus and the step of determining comprises the use of a reporter assay.
40. The method of claim 11, wherein the step of determining comprises the use of a luciferase reporter assay.
41. The method of claim 11, wherein the test compound is a small molecule.
42-43. (canceled)
44. The method of claim 1, wherein the neurological disease, psychiatric disorder, or central nervous system injury is selected from the group consisting of epilepsy, schizophrenia, mental retardation, stroke, Fragile-X syndrome, traumatic brain injury, and spinal cord injury.
45-56. (canceled)
57. The method of claim 1 wherein the compound is selected from the group consisting of 7,8-dihydroxyflavone, 8-(methoxymethyl)-1-methyl-3-(2-methylpropyl)-7H-purine-2,6-dione, (3Z)-2H-Indol-2-one, 6-bromo-3-[(3E)-1,3-dihydro-3-(hydroxyimino)-2H-indol-2-ylidene]-1,3-dihydro, 1-amino-5-fluoro-3-(6-(4-methylpiperazin-1-yl)-1H-benzo[d]imidazol-2-yl)quinolin-2(1H)-one, N1′-[3-fluoro-4-[[6-methoxy-7-(3-morpholinopropoxy)-4-quinolyl]oxy]phenyl]-N1-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide, (3Z)-3-(3-oxo-1,3-dihydro-2H-indol-2-ylidene)-1,3-dihydro-2H-indol-2-one, (2R)-2-[(E)-2-(1,3-benzodioxol-5-yl)ethenyl]-4-methoxy-2,3-dihydropyran-6-one, 9-hydroxyrisperidone, (2R,4bS,6aS,12bS,12cR,14aS)-5,6,6a,7,12,12b,12c,13,14,14a-decahydro-4b-hydroxy-2-(1-hydroxy-1-methylethyl)-12b,12c-dimethyl-2H-pyrano[2″,3″:5′,6′]benz[1′,2′:6,7]indeno[1,2-b]indol-3(4bH)-one, (2S)-2-[[4-[(3-fluorophenyl)methoxy]phenyl]methylamino]propanamide, 3-[(3-chloro-4-hydroxyphenyl)amino]-4-(2-nitrophenyl)-1H-pyrrol-2,5-dione, benzenepropanoic acid, N-(4-methoxybenzyl)-N′-(5-nitro-1,3-thiazol-2-yl)urea, 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid, N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide, 7-hydroxy-3-(4-hydroxyphenyl)-4H-chromen-4-one, 4′,5,7-trihydroxyisoflavone, 3,5,7-trihydroxy-2-(4-hydroxyphenyl)-4H-chromen-4-one, 3-[(4-quinolinylmethyl) amino]-N-[4-(trifluoromethoxy)phenyl]-2-thiophenecarboxamide, Isovalery-Val-Val-Sta-Ala-Sta, 2-{1-[3-(amidinothio)propyl]-1H-indol-3-yl}-3-(1-methylindol-3-yl)maleimide, 1,2-Dihydro-3H-naphtho[2,1-b]pyran-3-one, Cyclo-(L-Val-D-HyIva-D-Val-L-Lac-).sub.3, 2-ethyl-3-methyl-pentanamide, 2-(3,4-dimethoxybenzamido)-5,6-dihydro-4H-cyclopenta[b]thiophene-3-carboxamide, and pharmaceutically acceptable salts thereof.
58. The method of claim 3 wherein the compound is selected from the group consisting of 7,8-dihydroxyflavone, 8-(methoxymethyl)-1-methyl-3-(2-methylpropyl)-7H-purine-2,6-dione, (3Z)-2H-Indol-2-one, 6-bromo-3-[(3E)-1,3-dihydro-3-(hydroxyimino)-2H-indol-2-ylidene]-1,3-dihydro, 1-amino-5-fluoro-3-(6-(4-methylpiperazin-1-yl)-1H-benzo[d]imidazol-2-yl)quinolin-2(1H)-one, N1′-[3-fluoro-4-[[6-methoxy-7-(3-morpholinopropoxy)-4-quinolyl]oxy]phenyl]-N1-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide, (3Z)-3-(3-oxo-1,3-dihydro-2H-indol-2-ylidene)-1,3-dihydro-2H-indol-2-one, (2R)-2-[(E)-2-(1,3-benzodioxol-5-yl)ethenyl]-4-methoxy-2,3-dihydropyran-6-one, 9-hydroxyrisperidone, (2R,4bS,6aS,12bS,12cR,14aS)-5,6,6a,7,12,12b,12c,13,14,14a-decahydro-4b-hydroxy-2-(1-hydroxy-1-methylethyl)-12b,12c-dimethyl-2H-pyrano[2″,3″:5′,6′]benz[1′,2′:6,7]indeno[1,2-b]indol-3(4bH)-one, (2S)-2-[[4-[(3-fluorophenyl)methoxy]phenyl]methylamino]propanamide, 3-[(3-chloro-4-hydroxyphenyl)amino]-4-(2-nitrophenyl)-1H-pyrrol-2,5-dione, benzenepropanoic acid, N-(4-methoxybenzyl)-N′-(5-nitro-1,3-thiazol-2-yl)urea, 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid, N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide, 7-hydroxy-3-(4-hydroxyphenyl)-4H-chromen-4-one, 4′,5,7-trihydroxyisoflavone, 3,5,7-trihydroxy-2-(4-hydroxyphenyl)-4H-chromen-4-one, 3-[(4-quinolinylmethyl) amino]-N-[4-(trifluoromethoxy)phenyl]-2-thiophenecarboxamide, Isovalery-Val-Val-Sta-Ala-Sta, 2-{1-[3-(amidinothio)propyl]-1H-indol-3-yl}-3-(1-methylindol-3-yl)maleimide, 1,2-Dihydro-3H-naphtho[2,1-b]pyran-3-one, Cyclo-(L-Val-D-Hylva-D-Val-L-Lac-).sub.3, 2-ethyl-3-methyl-pentanamide, 2-(3,4-dimethoxybenzamido)-5,6-dihydro-4H-cyclopenta[b]thiophene-3-carboxamide, and pharmaceutically acceptable salts thereof.
59. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0109] The accompanying drawings, which constitute a part of this specification, illustrate several exemplary embodiments of the invention and together with the description, serve to explain certain principles of the invention. The embodiments disclosed in the drawings are exemplary and do not limit the scope of this disclosure.
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0126] The present disclosure provides methods, compounds, compositions, and kits focused on the identification, validation, and use of compounds to treat various neurological diseases, psychiatric disorders, and central nervous system injuries characterized by deficient expression of KCC2 (e.g., ASD, RTT, epilepsy, schizophrenia, mental retardation, stroke, Fragile-X syndrome, traumatic brain injury, and spinal cord injury). KCC2 has proven to be a critical gene for proper brain function and for the survival of the organism. Global knockout of KCC2 gene in mouse model leads to death at birth (Hubner et al., Neuron, 2001, 30, 515-24). Less severe types of KCC2-deficient animal model (KCC2 hypomorph) have been developed, in which massive brain development defect have led to behavior abnormalities (Tornberg, J. et al., Eur. J. Neurosci., 2005, 21, 1327-37). Impaired electrophysiology properties have been documented in these animals (Riekki, R. et al., J. Neurophysiol., 2008, 99, 3075-89). Since complete lack of KCC2 is incompatible with life, there has only been a few reports of rare cases of human ASD patients carrying relatively mild mutations including R952H, R1049C, R1048W, in the C-terminus regulatory region of KCC2 gene. Mutation R952H has also been described in schizophrenia patients (Merner, N. D. et al., Front. Cell. Neurosci., 2015, 9, 1-10). However, disruptions in KCC2 expression and/or function have been documented in many neurological disorders.
[0127] Animal models with KCC2 deficiency develop pathological features similar to those observed in MECP2 knockout mouse including breathing irregularity (Hubner et al., Neuron, 2001, 30, 515-24), smaller body weight (Tornberg, J. et al., Eur. J. Neurosci., 2005, 21, 1327-37), and impaired learning and memory (Tornberg, J. et al., Eur. J. Neurosci., 2005, 21, 1327-37). On the other hand, NKCC1 knockout mouse model suffers from heightened anxiety, imbalance, and severe deafness (29; Flagella, M. et al., J. Biol. Chem., 1999, 274, 26946-55). These phenotypes are strikingly similar to mouse model of MECP2 duplication syndrome (Na, E. S. et al., J. Neurosci., 2012, 32, 3109-17; Samaco, R. C. et al., Nat. Genet., 2012, 44, 206-11), and to the human MECP2 duplication syndrome patient (Van Esch, H. et al., Am. J. Hum. Genet., 2005, 77, 442-53; del Gaudio, D. et al., Genet. Med., 2006, 8, 784-92). Previous work (Tang, X. et al., PNAS, 2016, 113, 751-756) has utilized iPS cell-derived human neurons to establish developmental time courses of KCC2 expression and GABA functional switch in wild-type and Rett syndrome (RTT) neurons. It was found that human RTT neurons have a severe reduction in KCC2 expression and, consequently, deficits in both GABA functional switch and glutamatergic synapse development. The findings revealed a link between KCC2 and RTT, and may provide a novel framework to understand the pathological causes of autism spectrum disorders in general.
[0128] Since the discovery of KCC2 as the main regulator of neuronal chloride homeostasis in 1999 (Rivera, C. et al., Nature, 1999, 397, 251-5), one of the first diseases that has been linked to KCC2 deficit is epilepsy (Cohen, I. et al., Science, 2002, 298, 1418-21; Woo, N. S. et al., Hippocampus, 2002, 12, 258-68). Experimental evidence has pointed out that in the epileptic brain, the constant high level of neuronal activity can lead to a significant downregulation of KCC2 level, which in turn exacerbates the system overexcitation by reducing GABAergic inhibition (85-87). In human neonatal infants before one year of age, potentiating GABAergic neurotransmission actually exacerbates the epileptic condition (Dzhala, V. I. et al., Nat. Med., 2005, 11, 1205-13). Treatment of neonatal seizure with bumetanide, a selective NKCC1 blocker, can reduce the intracellular chloride level and ameliorate seizure severity (neonatal seizure). However, bumetanide treatment has the side effect of causing hearing loss in some clinical cases. These findings highlight the contribution of GABA excitation to both normal human brain development and in neurological disorders. Reviews of recent progress in this field can be found in the following two articles (84; 2).
[0129] In the brain injury and stroke condition, the KCC2 expression level is also found to be significantly reduced around the transient focal cerebral ischemia loci (90). Without wishing to be bound by any theory, the underlying mechanism is likely to be through N-methyl-D-aspartate (NMDA)-mediated phosphorylation and internalization of KCC2 (Lee, H. H. et al., Nat. Neurosci., 2011, 14, 736-743). During the stressful period of child-birth labor, the surge of oxytocin from the maternal bloodstream can lead to a temporary increase in KCC2 expression in the fetus, effectively preventing excitotoxicity and cell death during delivery (Khazipov, R. et al., Prog. Brain Res., 2008, 170, 243-57). A rather comprehensive review of recent literature can be found in (Martin-Aragón Baudel, M. A., et al., J. Neurochem., 2017, 140, 195-209).
[0130] In the cases of neuropsychiatric disorders, a disruption in KCC2 messenger ribonucleic acid (mRNA) level has been reported in schizophrenia patients (5; 4). Differences in expression levels of specific KCC2 transcripts have also been linked to schizophrenia and affective disorders (88). Mutation in the cell adhesion molecule critical for GABAergic synapse formation, neuroligin 2 (NL2), is found in schizophrenia patients. Unexpectedly, knockdown of NL2 can lead to a significant decrease in KCC2, suggesting KCC2's participation in the pathogenesis of some genetically-defined schizophrenia cases (Sun, C. et al., Mol. Brain, 2013, 6, 1-13). Altered KCC2 expression has also been implied in mediating stress axis behaviors (Hewitt, S. A. et al., Nat. Neurosci., 2009, 12, 438-443). In two recent clinical studies, children with general autism spectrum disorders and children with Fragile-X syndrome, a specific monogenic form of autism (Hagerman, R. et al., Molecular Autism, 2010, 1, 1-14), can both be phenotypically treated with NKCC1 blocker bumetanide (76,77). Two recent research articles have described a delayed GABA functional switch in Fragile-X syndrome mouse model (He, K. et al., Endokrynol Pol., 2014, 65, 485-90), valporate acid-induced autism model (74), and the alleviation of Fragile-X syndrome-related GABA functional switch deficit in the offspring by treating mutant mouse mother with oxytocin or bumetanide (74). These findings suggest the intriguing possibility that KCC2 dysfunction may be the core symptom and molecular underpinning responsible for various neurodevelopmental and neuropsychiatric disorders.
[0131] In the spinal cord, where the onset of KCC2 expression is the earliest during CNS development, disease-related downregulation of KCC2 can lead to various neurological conditions. After spinal cord injury, KCC2 downregulation in motor neurons leads to spasticity, a condition in which certain muscles are continually contracted (6). Similar spasticity can also be observed after intrathecal brain-derived neurotrophic factor (BDNF) injection since acute BDNF application is known to down-regulate KCC2. Interestingly, later application of BDNF to mouse model of spinal cord injury restores KCC2 expression and alleviates spasticity symptoms. Along the same vein, it has also been discovered that microglia-secreted BDNF down-regulates KCC2 in sensory neurons, leading to over-excitation of sensory neurons and neuropathic pain (Coull, J. A. et al., Nature, 2005, 438, 1017-21).
[0132] Although KCC2 expression levels has been linked to multiple neurological diseases, psychiatric disorders, and central nervous system injuries, as far as the inventors are aware, no small molecule chemical compound that is capable of increasing KCC2 expression in neurons has been identified prior to the present disclosure. Therefore, enhancing KCC2 expression is a promising pharmacological avenue to treat a variety of neurological diseases, psychiatric disorders, or central nervous system injuries. Without wishing to be bound by any theory, enhancing KCC2 expression may act at least in part through restoring the foundation of proper neural network function.
[0133] In certain embodiments, methods of treating a subject with a neurological disease, psychiatric disorder, and central nervous system injury characterized by deficient expression or function of KCC2 are described. In some embodiments the neurological disease, psychiatric disorder, or central nervous system injury is selected from the group consisting of ASD, RTT, epilepsy, schizophrenia, mental retardation, stroke, Fragile-X syndrome, traumatic brain injury, and spinal cord injury. In one embodiment, the subject has ASD. In one embodiment, the subject has RTT. In certain embodiments, methods of treating a subject with a neurodevelopmental disorder are described, the methods comprising administering a KCC2 expression enhancing compound to a subject having the disorder. In one embodiment the subject has RTT. In one embodiment the subject has Fragile-X syndrome. In one embodiment the subject has Down syndrome.
[0134] In certain embodiments, treating a subject comprises the step of administering to the subject a therapeutically effective amount of a small molecule that enhances expression of KCC2. In certain embodiments, treating a subject comprises the step of administering to the subject a therapeutically effective amount of a compound selected from the group consisting of kinase inhibitor, Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, gamma-aminobutyric acid (GABA) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and pharmaceutically acceptable salts thereof. In certain embodiments, the compound is selected from the group consisting of E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), 2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime), resveratrol, piperine, and salts thereof. In certain embodiments, the compound is selected from the group consisting of, MET proto-oncogene, receptor tyrosine kinase (MET) inhibitors. In certain embodiments the compound is selected from the group of compounds listed in Table 2 and salts thereof. In certain embodiments the compound is selected from the group of compounds listed in Table 3 and salts thereof.
[0135] In some aspects, a method of identifying a compound that modulates the level of KCC2 in a cell is described. In certain embodiments, the method comprises contacting a test compound with a cell; incubating the test compound with the cell for at least 24 hours under physiological conditions; and determining the expression level of KCC2 in the cell. In some embodiments, the compound is identified as a modulator of KCC2 expression if the expression level of KCC2 in the cell differs from the expression level of KCC2 in a control cell not contacted with the test compound. In some embodiments, the compound is identified as a KCC2 expression enhancing compound (KEEC) if the expression level of KCC2 in the cell is greater than the expression level of KCC2 in a control cell not contacted with the test compound. In some embodiments, the compound is identified as a KCC2 expression repressor compound (KERC) if the expression level of KCC2 in the cell is lower than the expression level of KCC2 in a control cell not contacted with the test compound.
[0136] In certain embodiments, the cells are neuronal cells. In certain embodiments, the neuronal cells are mammalian neuronal cells. In certain embodiments, the neuronal cells are human neuronal cells. In certain embodiments, the neuronal cells are primate neuronal cells. In certain embodiments, the neuronal cells are rodent neuronal cells. In certain embodiments, the neuronal cells are mouse neuronal cells. In certain embodiments, the neuronal cells are derived from embryonic stem cells. In certain embodiments the neuronal cells are derived from induced pluripotent stem (iPS) cells. In certain embodiments the neurons comprise excitatory neurons. In certain embodiments, the neuronal cells are wild-type KCC2 neurons. In certain embodiments, the neuronal cells are RTT cultured human neurons. In certain embodiments, the neuronal cell contains a reporter gene. In certain embodiment, the reporter gene is in the KCC2 locus. In some embodiments, the reporter gene is a luciferase reporter gene. In certain embodiments the reporter gene may be optimized for expression in mammalian cells.
[0137] In certain embodiments, the test compound is a nucleic acid. In certain embodiments, the test compound is a protein or peptide. In certain embodiments, the test compound is a small molecule. In certain embodiments the small molecule can be an organic molecule, or salt thereof. In certain embodiments, the test compound is selected from the group consisting of kinase inhibitors, Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, gamma-aminobutyric acid (GABA) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and salts thereof. In certain embodiments, the test compound is selected from the group consisting of, MET proto-oncogene, receptor tyrosine kinase (MET) inhibitors.
[0138] In certain embodiments, the cell is incubated with a test compound for at least 1 day. The incubation time can, for example, range between 1 day and 30 days. In certain embodiments, the incubation time described herein includes independently between 1 day and 7 days, between 7 days and 14 days, between 14 days and 21 days, between 21 days and 30 days, between 1 day and 3 days, between 3 days and 6 days, between 6 days and 9 days, between 9 days and 12 days, between 12 days and 15 days, between 15 days and 18 days, between 18 days and 21 days, between 21 days and 24 days, between 24 days and 27 days, or between 27 days and 30 days, inclusive. In one embodiment, the incubation time is approximately 14 weeks.
[0139] In certain embodiments, the concentration of the test compound while contacting the cell is between 0.1 nM and 1000 μM (1 M). In certain embodiments, concentration of the test compound while contacting the cell described herein includes independently between 0.1 nM and 1 nM, between 1 nM and 10 nM, between 10 nM and 100 nM (0.1 μM), between 0.1 μM and 1 μM, between 1 μM and 10 μM between 10 μM and 100 μM, between 100 μM and 200 μM, between 200 μM and 300 μM, between 300 μM and 400 μM, between 400 μM and 500 μM, between 500 μM and 600 μM, between 600 μM and 700 μM, between 700 μM and 800 μM, between 800 μM and 900 μM, or between 900 μM and 1000 μM, inclusive. In some embodiments, the concentration is approximately 10 PM.
[0140] In some embodiments, the cells are lysed after the incubation step. In certain embodiments the cell lysate is analyzed based upon a reporter assay to determine the expression level of KCC2. In certain embodiments, the reporter assays are selected from a group consisting of β-galactosidase reporter assay, chloramphenicol acetyltransferase reporter assay, fluorescent protein reporter assay (e.g., green fluorescent protein assay, red fluorescent protein assay, cyan fluorescent protein assay), and luciferase reporter assay. In certain embodiments the luciferase is firefly luciferase, sea pansy (Renilla) luciferase, Gaussia luciferase, or NanoLuc luciferase.
[0141] In some embodiments, the cells utilized are RTT KCC2-2A-luciferase reporter neurons. The neurons may be adapted to a multi-well format. In some embodiments, the neurons are adapted to a multi-well format. In some embodiments, the neurons are adapted to a 96-well format. In some embodiments, the neurons are adapted to a 384-well format. The cells, e.g., RTT KCC2-2A-luciferase reporter neurons, are then treated with a test compound library and incubated. The cells are then lysed, and, in some embodiments the cell lysate is divided into at least two parts, and a first part is used to measure reporter signal (indicative of KCC2 translation) and a second part is used to measure number of viable cells. The reporter signal for each well may be normalized to the signal indicative of the number of viable cells for that well, and the resulting ratio may be normalized to an in-plate negative control (e.g., a well containing a test compound vehicle, such as DMSO, and not a test compound) to calculate fold change ratio. For example, in some embodiments the cells are lysed, and the cell lysate is divided into two parts to measure luciferase signal (KCC2 translation) and Cell-Titer Glow (CTG, amount of ATP). The luciferase signal is normalized to CTG for each well, and the Luc/CTG ratio is normalized to the in-plate DMSO negative control to calculate fold change ratio. Any of a variety of assays may be used to measure the number of viable cells. For example, an assay that measures an indicator of metabolically active cells, such as ATP (e.g., a Cell-Titer Glo assay), may be used. Other assays that may be used in certain embodiments include tetrazolium reduction, resazurin reduction, and protease activity assays.
[0142] In certain embodiments, compounds are identified as KCC2 expression enhancing compounds (KEEC). In certain embodiments, the compound identified is selected from a group consisting of kinase inhibitors, Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, gamma-aminobutyric acid (GABA) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and salts thereof. In certain embodiments, the compound identified is selected from a group consisting of (E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), (2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), 1-(4-methoxybenzyl)-3-(5-nitrothiazol-2-yl)urea (AR-A014418), nipecotic acid, methysticin, trifluoperazine dihydrochloride, resveratrol, piperine, luteolin (flacitran), 7,8-dihydroxyflavone, 2,3,6a,7,8,9-hexahydro-11H-[1,4]dioxino[2′,3′:4,5]benzo[1,2-e]pyrrolo[2,1-b][1,3]oxazin-11-one (CX-614 or BDP37), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime). In certain embodiments, the compound is selected from the group consisting of, MET proto-oncogene, receptor tyrosine kinase (MET) inhibitors. In addition, the molecular pathways that the identified compounds act through to enhance KCC2 expression have been elucidated. Many of the hit compounds can be grouped into one or more of the following classes of compounds: Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, gamma-aminobutyric acid (GABA) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, and ampakines.
[0143] In some embodiments a compound is selective for a particular target versus one or more other potential targets. For example, in some embodiments the IC50 of the compound for inhibiting a first target (e.g., FLT3) may be at least 10-fold lower, at least 25-fold lower, at least 50-fold lower, or at least 100-fold lower than its IC50 for inhibiting a second kinase, using a comparable assay. In some embodiments a KEEC is selective for inhibiting FLT3 as compared with MET. In some embodiments the IC50 of a FLT3 inhibitor for inhibiting MET may be at least 100 nM, at least 1 micromolar, or at least 10 micromolar. In some embodiments a FLT3 inhibitor has substantially no activity against MET.
[0144] In some embodiments, KCC2 expression enhancing compounds are validated using another assay. In certain embodiments, the compound is validated by enzyme-linked immunosorbent assay, protein immunoprecipitation, immunoelectrophoresis, protein immunostaining, or Western blot experiments. In certain embodiments the compounds are validated by experiments that quantify the level of expression of KCC2 by utilizing antibodies that specifically bind to KCC2. For example, in certain embodiments, the compound is validated by Western blot experiments. These experiments can quantify the level of gene expression of KCC2 by utilizing antibodies that specifically target KCC2. The present disclosure describes Western blot experiments performed with WT and/or RTT cultured neurons, as well as brain tissue slices prepared from rodents. In certain embodiments the rodent is a mouse. In certain embodiment, the mouse is a neonatal mouse. In some embodiments, the KEECs validated by Western blot experiments include (E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), (2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime), resveratrol, and piperine.
[0145] In some embodiments, the Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors that can be used in the present invention are described in (U.S. patent application U.S. Ser. No. 11/550,077, filed Oct. 17, 2006, and issued on Sep. 14, 2010 as U.S. Pat. No. 7,795,279; International Patent Application No. PCT/JP2013/070436, filed on Jul. 29, 2013, published as WO/2014/017659 on Jan. 30, 2014; U.S. patent application U.S. Ser. No. 11/422,413, filed Jun. 6, 2006, published as US 2006/0281788 on Dec. 14, 2006; U.S. patent application U.S. Ser. No. 11/422,379, filed Jun. 6, 2006, published as US 2006/0281771 on Dec. 14, 2006; U.S. patent application U.S. Ser. No. 10/989,766, filed Nov. 15, 2004, published as US 2005/0171171 on Aug. 4, 2005; U.S. patent application U.S. Ser. No. 10/917,578, filed Aug. 13, 2004, published as US 2005/0124637 on Jun. 9, 2005; International Patent Application No. PCT/EP2002/012076, filed on Oct. 29, 2002, published as WO/2003/037347 on May 8, 2003; U.S. patent application U.S. Ser. No. 11/192,318, filed Jul. 27, 2005, and issued on Nov. 18, 2008 as U.S. Pat. No. 7,452,993; U.S. patent application U.S. Ser. No. 11/192,341, filed Jul. 27, 2005, and issued on Apr. 22, 2008, as U.S. Pat. No. 7,361,763; International Patent Application No. PCT/GB2008/001612, filed May 9, 2008, published as WO/2008/139161 on Nov. 20, 2008).
[0146] In certain embodiments, the Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors are classified into one or more of the following classes of compounds: ureas, carboxamides, alkaloids, and benzamidazoles.
[0147] In certain embodiments, the FLT3 inhibitors are compounds of the following formula:
##STR00002##
and pharmaceutically acceptable salts, and stereochemical isomers thereof, wherein: q is 0, 1 or 2; p is 0 or 1; Q is NH, N(alkyl), O, or a direct bond; X is N, or C—CN, or CH provided that R.sub.bb is not heteroaryl or halogen; Z is NH, N(alkyl), or CH.sub.2; B is selected from: cycloalkyl, a nine to ten membered benzo-fused heteroaryl, or a nine to ten membered benzo-fused heterocyclyl, or, if R.sub.3 is present, phenyl or heteroaryl, provided that B is not thiadiazinyl; R.sub.1 and R.sub.2 are independently selected from the following:
##STR00003##
wherein n is 1, 2, 3 or 4; Y is a direct bond, O, S, NH, or N(alkyl); R.sub.a is alkoxy, phenoxy, heteroaryl optionally substituted with R.sub.5, hydroxyl, alkylamino, dialkylamino, oxazolidinonyl optionally substituted with R.sub.5, pyrrolidinonyl optionally substituted with R.sub.5, piperidinonyl optionally substituted with R.sub.5, cyclic heterodionyl optionally substituted with R.sub.5, heterocyclyl optionally substituted with R.sub.5, squaryl, —COOR.sub.y, —CONR.sub.wR.sub.x, —N(R.sub.w)CON(R.sub.y)(R.sub.x), —N(R.sub.y)CON(R.sub.w)(R.sub.x), —N(R.sub.w)C(O)OR.sub.x, —N(R.sub.w)COR.sub.y, —SR.sub.y, —SOR.sub.y, —SO.sub.2R.sub.y, —NR.sub.wSO.sub.2R.sub.y, —NR.sub.wSO.sub.2R.sub.x, —SO.sub.3R.sub.y, —OSO.sub.2NR.sub.wR.sub.x, or —SO.sub.2NR.sub.wR.sub.x; R.sub.bb is hydrogen, halogen, alkoxy, phenyl, heteroaryl, or heterocyclyl; R.sub.5 is one, two, or three substituents independently selected from: halogen, cyano, trifluoromethyl, amino, hydroxyl, alkoxy, —C(O)alkyl, —SO.sub.2alkyl, —C(O)N(alkyl).sub.2, alkyl, —C(.sub.1-4)alkyl-OH, or alkylamino; R.sub.w and R.sub.x are independently selected from: hydrogen, alkyl, alkenyl, aralkyl, or heteroaralkyl, or R.sub.w and R.sub.x may optionally be taken together to form a 5 to 7 membered ring, optionally containing a heteromoiety selected from O, NH, N(alkyl), SO, SO.sub.2, or S; R.sub.y is selected from: hydrogen, alkyl, alkenyl, cycloalkyl, phenyl, aralkyl, heteroaralkyl, or heteroaryl; and R.sub.3 is one or more substituents, optionally present, and independently selected from: alkyl, alkoxy, halogen, nitro, cycloalkyl optionally substituted with R.sub.4, heteroaryl optionally substituted with R.sub.4, alkylamino, heterocyclyl optionally substituted with R.sub.4, alkoxyether, O(cycloalkyl), pyrrolidinonyl optionally substituted with R.sub.4, phenoxy optionally substituted with —R.sub.4, —CN, —OCHF.sub.2, —OCF.sub.3, —CF.sub.3, halogenated alkyl, heteroaryloxy optionally substituted with R.sub.4, dialkylamino, —NHSO.sub.2alkyl, or —SO.sub.2alkyl; wherein R.sub.4 is independently selected from: halogen, cyano, trifluoromethyl, amino, hydroxyl, alkoxy, —C(O)alkyl, —CO.sub.2alkyl, —SO.sub.2alkyl, —C(O)N(alkyl).sub.2, alkyl, or alkylamino (see U.S. patent application Ser. No. 11/422,379, filed Jun. 6, 2006, published as US 2006/0281771 on Dec. 14, 2006).
[0148] In certain embodiments, the FLT3 inhibitors are compounds of the following formula:
##STR00004##
wherein: M is substituted or unsubstituted heteroaryl, or substituted or unsubstituted aryl; N is a substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; and K is
##STR00005##
where Y is O or S; each R.sub.k is independently H, halogen, substituted or unsubstituted alkyl, —OH, substituted or unsubstituted alkoxy, —OC(O)R.sub.2, —NO.sub.2, —N(R.sub.2).sub.2, —SR.sub.2, —C(O)R.sub.2, —C(O).sub.2R.sub.2, —C(O)N(R.sub.2).sub.2, or —N(R.sub.2)C(O)R.sub.2, each R.sub.2 is independently H, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocyclyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or wherein two R.sub.2 groups are linked together by an optionally substituted alkylene; and each n is independently 0, 1, 2, 3 or 4; or an active metabolite, or a pharmaceutically acceptable prodrug, isomer, pharmaceutically acceptable salt or solvate thereof (see U.S. patent application U.S. Ser. No. 10/989,766, filed Nov. 15, 2004, published as US 2005/0171171 on Aug. 4, 2005).
[0149] In certain embodiments, M is a unsubstituted aryl and N is an unsubstituted heteroaryl. In certain embodiments, M is a substituted aryl and N is an unsubstituted heteroaryl. In certain embodiments, M is an unsubstituted aryl and N is a substituted heteroaryl. In certain embodiments, M is a substituted aryl and N is a substituted heteroaryl. In certain embodiments, M or N is a unsubstituted phenyl. In certain embodiments, M or N is a substituted phenyl. In certain embodiments, M or N is selected from: pyrrolyl, furanyl, thiophenyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, tetrazinyl, azepinyl, oxepinyl, thiepinyl, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, quinazolinyl, phenanthridinyl, dibenzofuranyl, carbazolyl, acridinyl, phenothiazinyl, phenoxazinyl and phenazinyl. In certain embodiments, M or N is a substituted thiophenyl. In certain embodiments, the FLT3 inhibitor is OSI-930:
##STR00006##
In certain embodiments, the FLT3 inhibitor is FLT inhibitor-1 (Calbiochem 343020):
##STR00007##
[0150] In certain embodiments, the FLT3 inhibitors are compounds of the following formula:
##STR00008##
[0151] in which: R.sub.1 is selected from hydrogen, halo, C.sub.1-6 alkyl, halo-substituted-C.sub.1-6 alkyl, C.sub.1-6 alkoxy, halo-substituted-C.sub.1-6 alkoxy, —OXOR.sup.5, —OXR.sup.6, —OXNR.sub.5R.sub.6, —OXONR.sub.5R.sub.6, —XR.sub.6, —XNR.sub.5R.sub.6 and —XNR.sub.7XNR.sub.7R.sub.7; wherein X is selected from a bond, C.sub.1-6 alkylene, C.sub.2-6alkenylene and C.sub.2-6 alkynylene; wherein R.sub.7 is independently selected from hydrogen or C.sub.1-6alkyl; R.sub.5 is selected from hydrogen, C.sub.1-6 alkyl and —XOR.sub.7; wherein X is selected from a bond, C.sub.1-6 alkylene, C.sub.2-6 alkenylene and C.sub.2-6 alkynylene; and R.sub.7 is independently selected from hydrogen or C.sub.1-6 alkyl; R.sub.6 is selected from hydrogen, C.sub.1-6 alkyl, C.sub.3-12 cycloalkylC.sub.0-4alkyl, C.sub.3-8heterocycloalkylC.sub.0-4alkyl, C.sub.6-10arylC.sub.0-4 alkyl and C.sub.5-10 heteroarylC.sub.0-4 alkyl; or R.sub.5 and R.sub.6 together with the nitrogen atom to which both R.sub.5 and R.sub.6 are attached form C.sub.3-8heterocycloalkyl or C.sub.5-8 heteroaryl; wherein a methylene of any heterocycloalkyl formed by R.sub.5 and R.sub.6 can be optionally replaced by —C(O)— or —S(O).sub.2—; wherein any aryl, heteroaryl, cycloalkyl or heterocycloalkyl of R.sub.6 or the combination of R.sub.5 and R.sub.6 can be optionally substituted by 1 to 3 radicals independently selected from —XNR.sub.7R.sub.7, —XOR.sub.7, —XNR.sub.7R.sub.7, —XC(O)NR.sub.7R.sub.7, —XNR.sub.7C(O)R.sub.7, —XOR, —XC(O)OR.sub.7, —XC(O)R.sub.7, C.sub.1-6 alkyl, C.sub.3-8 heterocycloalkyl, C.sub.5-10heteroaryl, C.sub.3-12cycloalkyl and C.sub.6-10arylC.sub.0-4alkyl; wherein any alkyl or alkylene of R.sub.1 can optionally have a methylene replaced by a divalent radical selected from —NR.sub.7C(O)—, —C(O)NR7-, —NR.sub.7—, —C(O)—, —O—, —S—, —S(O)— and —S(O).sub.2—; and wherein any alkyl or alkylene of R.sub.6 can be optionally substituted by 1 to 3 radicals independently selected from C.sub.5-8heteroaryl, —NR.sub.7R.sub.7, —C(O)NR.sub.7R.sub.7, —NR.sub.7C(O)R.sub.7, halo and hydroxy; wherein R.sub.7 is independently selected from hydrogen or C.sub.1-6alkyl; R.sub.2 is selected from hydrogen, C.sub.6-10aryl and C.sub.5-10heteroaryl; wherein any aryl or heteroaryl of R.sub.2 is optionally substituted with 1 to 3 radicals independently selected from —XNR.sub.7R.sub.7, —XOR.sub.7, —XOR.sub.8, —XC(O)OR.sub.7, —XC(O)R.sub.7, C.sub.1-6 alkyl, C.sub.1-6alkoxy, nitro, cyano, hydroxy, halo and halo-substituted-C.sub.1-6 alkyl; wherein X and R.sub.7 are as described above; and R.sub.8 is C.sub.6-10 arylC.sub.0-4 alkyl; R.sub.3 is selected from hydrogen and C.sub.1-6 alkyl; R.sub.4 is selected from C.sub.3-12cycloalkylC.sub.0-4 alkyl, C.sub.3-8 heterocycloalkylC.sub.0-4 alkyl, C.sub.6-10arylC.sub.0-4 alkyl and C.sub.5-10 heteroarylC.sub.0-4alkyl; wherein any alkylene of R.sub.4 can optionally have a methylene replaced by a divalent radical selected from —C(O)—, —S—, —S(O)— and —S(O).sub.2—; wherein said aryl, heteroaryl, cycloalkyl or heterocycloalkyl of R.sub.4 is optionally substituted by 1 to 3 radicals selected from halo, C.sub.1-6alkyl, C.sub.1-6 alkoxy, halo-substituted-C.sub.1-6 alkyl, halo-substituted-C.sub.1-6alkoxy, —XR.sub.9, —XOR.sub.9, —XS(O).sub.0-2R.sub.7, —XS(O).sub.0-2R.sub.9, —XC(O)R.sub.7, —XC(O)OR.sub.7, XP(O)R.sub.7R.sub.7, —XC(O)R.sub.9, —XC(O)NR.sub.7XNR.sub.7R.sub.7, —XC(O)NR.sub.7R.sub.7, —XC(O)NR.sub.7R.sub.9 and XC(O)NR.sub.7XOR.sub.7; wherein X and R.sub.7 are as described above; R.sub.9 is selected from C.sub.3-12cycloalkylC.sub.0-4 alkyl, C.sub.3-8 heterocycloalkylC.sub.0-4 alkyl, C.sub.6-10aryl and C.sub.5-10heteroaryl; wherein any aryl, heteroaryl, cycloalkyl or heterocycloalkyl of R.sub.9 is optionally substituted by 1 to 3 radicals selected from C.sub.1-6 alkyl, —XC(O)R.sub.7 and —XC(O)NR.sub.7R.sub.7; wherein X and R.sub.7 are as described above; and the pharmaceutically acceptable salts, hydrates, solvates, isomers and prodrugs thereof (see U.S. patent application U.S. Ser. No. 10/917,578, filed Aug. 13, 2004, published as US 2005/0124637 on Jun. 9, 2005).
[0152] In certain embodiments, the FLT3 inhibitors are compounds of the following formula:
##STR00009##
wherein: R.sub.1 is hydrogen; R.sub.2 is selected from the group consisting of hydrogen, halo, and S(O).sub.2NR.sub.13R.sub.14; R.sub.3 is hydrogen; R.sub.4 is hydrogen; R.sub.5 is alkyl; R.sub.6 is selected from the group consisting of hydrogen and —C(O)R.sub.10, or R.sub.5 and R.sub.6 combine to form an alkyl group consisting of —(CH.sub.2).sub.4—; R.sub.7 is alkyl; R.sub.10 is selected from the group consisting of N(R.sub.11)(CH.sub.2).sub.nR.sub.12 and —NR.sub.13R.sub.14; R.sub.11 is H; n is independently 1, 2, 3 or 4; R.sub.12 is —NR.sub.13R.sub.14; and R.sub.13 and R.sub.14 are independently alkyl or aryl, or R.sub.13 and R.sub.14 may combine to form a heterocyclo group; or a pharmaceutically acceptable salt thereof (see U.S. patent application U.S. Ser. No. 13/058,171, filed on Aug. 8, 2009, published as U.S. Pat. No. 8,993,615 on Mar. 31, 2015).
[0153] In certain embodiments, the FLT3 inhibitors are compounds of the following formula:
##STR00010##
wherein L.sup.1 and L.sup.2 are independently a bond, —S(O).sub.n—, —O—, —NH—, unsubstituted C.sub.1-5 alkylene, or unsubstituted 2 to 5 membered heteroalkylene, wherein n is an integer from 0 to 2, and R.sup.1 and R.sup.2 are independently substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted aryl, with the proviso that R.sup.1 is not substituted or unsubstituted pyrrolyl, and that L.sup.1 is not unsubstituted 2 to 5 membered heteroalkylene when R.sup.1 and R.sup.2 are both unsubstituted phenyl, and that L.sup.1 is not —S(O).sub.2— when R.sup.2 is unsubstituted piperazinyl, and that R.sup.1 is not substituted or unsubstituted isoxazolyl when R.sup.2 is unsubstituted pyridinyl (see U.S. patent application U.S. Ser. No. 11/192,318, filed Jul. 27, 2005, and issued on Nov. 18, 2008 as U.S. Pat. No. 7,452,993).
[0154] In certain embodiments, the FLT3 inhibitors are compounds of the following formula:
##STR00011##
or a salt, solvate, N-oxide or tautomer thereof; wherein: a is 0 or 1; b is 0 or 1: provided that the sum of a and b is 0 or 1; T is O or NH; Ar.sup.1 is a monocyclic or bicyclic 5- to 10-membered aryl or heteroaryl group containing up to 4 heteroatoms selected from O, N and Si and being optionally substituted by one or more substituents R.sup.1; Ar.sup.2 is a monocyclic or bicyclic 5- to 10-membered aryl or heteroaryl group containing up to 4 heteroatoms selected from O.sub.1 N and S and being optionally substituted by one or more substituents R.sup.2; R.sup.1 is halogen; cyano; nitro; a group R.sup.a-R.sup.b; or a 3 to 8-membered carbocyclic or heterocyclic ring containing up to 4 heteroatoms selected from O, N and S and being optionally substituted by one or more substituents R.sup.3; R.sup.a is a bond, O, CO.sub.1X.sup.1C(X.sup.2), C(X.sup.2)X.sup.1, X.sup.1C(X.sup.2)X.sup.1, S, SO, SO.sub.2, NR.sup.C, SO.sub.2NR.sup.0 or NR.sup.0SO.sub.2; R.sup.b is: hydrogen; or a 3 to 8-membered carbocyclic or heterocyclic ring containing up to 4 heteroatoms selected from O, N and S and being optionally substituted by one or more substituents R.sup.3; or a C.sub.1-12 acyclic hydrocarbon group optionally substituted by one or more substituents selected from hydroxy; oxo; halogen; cyano; nitro; carboxy; amino; N(R.sup.C).sub.2; and 3 to 8-membered carbocyclic or heterocyclic rings containing up to 4 heteroatoms selected from O, N and S and being optionally substituted by one or more substituents R.sup.3; wherein one to three but not all of the carbon atoms of the C.sub.1-12 acyclic hydrocarbon group may optionally be replaced by O, CO, X.sup.1C(X.sup.2), C(X.sup.2)X.sup.1, X.sup.1C(X.sup.2)X.sup.1, S, SO, SO.sub.2, NR.sup.0, SO.sub.2NR.sup.C or NR.sup.0SO.sub.2; R.sup.0 is hydrogen or a C.sub.1-4 hydrocarbon group; X.sup.1 is O, S or NR.sup.C; X.sup.2 is ═O, ═S or ═NR.sup.C; R.sup.2 is halogen; cyano; nitro; or a group R.sup.a-R.sup.d; R.sup.d is hydrogen; a C.sub.1-4 alkyl group optionally substituted by one or more fluorine atoms; or a benzyl group wherein the benzene ring of the benzyl group is optionally substituted with one to three substituents selected from halogen, cyano, C.sub.1-4 alkyl and C.sub.1-4 alkoxy, and wherein the C.sub.1-4 alkyl and C.sub.1-4 alkoxy substituents on the benzene ring are each optionally substituted with one or more fluorine atoms; R.sup.3 is X.sup.2; halogen; cyano; nitro; a group R.sup.a-R.sup.e; or a 3 to 7-membered carbocyclic or heterocyclic ring containing up to 4 heteroatoms selected from O, N and S and being optionally substituted by a group R.sup.4; R.sup.e is: hydrogen; or a C.sub.1-6 acyclic hydrocarbon group optionally substituted by one or more substituents selected from hydroxy; oxo; halogen; cyano; nitro; carboxy; amino; and N(R.sup.C).sub.2; wherein one to three but not all of the carbon atoms of the C.sub.1-6 acyclic hydrocarbon group may optionally be replaced by O, S, SO, SO.sub.2, NR.sup.C, X.sup.1C(X.sup.2), C(X.sup.2)X.sup.1 or X.sup.1C(X.sup.2)X.sup.1; or a benzyl group wherein the benzene ring of the benzyl group is optionally substituted with one to three substituents selected from halogen, cyano, C.sub.1-4 alkyl and C.sub.1-4 alkoxy, and wherein the C.sub.1-4 alkyl and C.sub.1-4alkoxy groups are each optionally substituted with one or more fluorine atoms; and R.sup.4 is selected from halogen, cyano, nitro and a group R.sup.a-R.sup.d; provided that when a is O, Ar.sup.1 is other than a 2-aminopyridin-4-yl or 2-amino-pyrimidin-4-yl group wherein the 2-amino moiety is optionally substituted; and that neither Ar.sup.2—(NH).sub.b— nor Ar.sup.1—(NH).sub.a— form an optionally substituted quinoxalin-4-ylamino group; and that when a is 1 and b is 0, then Ar.sup.2 is other than a bicyclic group containing a pyrrole or pyrazole ring fused to a non-aromatic six-membered carbocyclic ring wherein the point of attachment of Ar.sup.2 is a nitrogen atom of the pyrrole or pyrazole ring; but excluding the compounds: 2,5-diphenyl-1H-imidazole-4-carboxylic acid amide and tautomers thereof; 2-(4-fluorophenyl)-5-(4-methoxyphenyl)-1H-imidazole-4-carboxylic acid amide and tautomers thereof; 2-phenyl-5-thiophen-2-yl-1H-imidazole-4-carboxylic acid amide and tautomers thereof; 2-phenyl-5-(3,4,5-trimethoxy-phenyl)-oxazole-4-carboxylic acid amide; 2,5-diphenyl-oxazole-4-carboxylic acid amide; and 2-(4-methylphenyl)-5-phenyl-oxazole-4-carboxylic acid amide (see International Patent Application No. PCT/GB2008/001612, filed May 9, 2008, published as WO/2008/139161 on Nov. 20, 2008).
[0155] In certain embodiments, the Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors are selected from a group consisting of Pacritinib, TG101209, Crenolanib, Lestautirinib, PKC412, Tandutinib, Sunitinib, a Sorafenib, Linifanib, Dovitinib (TKI-258), KW-2449, Quizartinib (AC220), Dovitinib Dilactic acid, Tandutinib, Cabozanitib (XL-184), TG101209, Amuvatinib (MP-470), and ENMD-2076. In certain embodiments, the FLT3 inhibitors are selected from a group consisting of Pacritinib, TG101209, Crenolanib, Lestautirinib, PKC412, Tandutinib, Sunitinib, Sorafenib, Linifanib, Dovitinib (TKI-258), KW-2449, Quizartinib (AC220), Dovitinib Dilactic acid, Tandutinib, Cabozanitib (XL-184), TG101209, Amuvatinib (MP-470), Foretinib (GSK1363089; XL880; EXEL-2880), OSI-930, and ENMD-2076. In certain embodiments the FLT3 inhbitor is Gilteritinib, MRX-2843, G-749, AZD2932, or JNJ-47117096.
[0156] In some embodiments a target of interest herein (e.g., a kinase, e.g., FLT3 or GSK3) is targeted for degradation based upon the proteolysis targeting chimera (PROTAC) concept (see, e.g., Carmony, K C and Kim, K, PROTAC-Induced Proteolytic Targeting, Methods Mol Biol. 2012; 832: Ch. 44). In this approach, a heterobifunctional agent is designed to contain a first domain (e.g., a small molecule) that binds to a protein of interest (e.g., FLT3), a second domain that binds to an E3 ubiquitin ligase complex (e.g., a compound that binds to cereblon (CRBN) or VHL ubiquitin ligases), and, typically, a linker to tether these domains together In some embodiments a FLT3 inhibitor is TL12-186, TL13-117, or TL13-149, the structures of which are presented below (see Huang, H T, et al., Cell Chem Biol. 2018 Jan. 18; 25(1):88-99).
##STR00012##
[0157] In some embodiments, the glycogen synthase kinase 3 (GSK3) inhibitors that can be used in the present invention are described in (U.S. patent application U.S. Ser. No. 10/360,535, filed on Feb. 6, 2003, published as US 2004/0034037 on Feb. 19, 2004; U.S. patent application U.S. Ser. No. 09/267,971, filed Mar. 12, 1999, and issued on May 2, 2000 as U.S. Pat. No. 6,057,117; U.S. patent application U.S. Ser. No. 09/336,038, filed Jun. 18, 1999, and issued on Jul. 9, 2002 as U.S. Pat. No. 6,417,185; U.S. patent application U.S. Ser. No. 09/949,035, filed on Sep. 6, 2001, published as US 2002/0156087 on May 16, 2006, and issued on May 16, 2006 as U.S. Pat. No. 7,045,519; U.S. patent application U.S. Ser. No. 10/936,470, filed on Sep. 7, 2004, published as US 2005/0137201 on Jun. 23, 2005, and issued on Nov. 4, 2008 as U.S. Pat. No. 7,446,199; U.S. patent application U.S. Ser. No. 08/948,887, filed on Oct. 10, 1997, and issued on Nov. 28, 2000, as U.S. Pat. No. 6,153,618; U.S. patent application U.S. Ser. No. 10/917,707, filed Aug. 13, 2004, and published as US 2005/0054663 on Mar. 10, 2005; U.S. patent application U.S. Ser. No. 09/738,040, filed Dec. 14, 2000, published as US 2001/0034051 on Oct. 25, 2001, and issued on Aug. 19, 2003 as U.S. Pat. No. 6,608,063; U.S. patent application U.S. Ser. No. 10/109,070, filed Mar. 28, 2002, published as US 2003/0087922 on May 8, 2003, and issued on Sep. 27, 2005 as U.S. Pat. No. 6,949,544; U.S. patent application U.S. Ser. No. 10/639,784, filed on Aug. 12, 2003, published as US 2004/0106615 on Jun. 3, 2004, and issued on Dec. 4, 2007 as U.S. Pat. No. 7,304,071; U.S. patent application U.S. Ser. No. 11/913,612, filed Nov. 5, 2007, and published as US 2008/0207594 on Aug. 28, 2008; U.S. patent application U.S. Ser. No. 10/228,621, filed Aug. 26, 2002, and published as US 2003/0008866 on Jan. 9, 2003; U.S. patent application U.S. Ser. No. 12/338,129, filed Dec. 18, 2008, published as US 2009/0118278 on May 7, 2009, and issued on Jan. 18, 2011 as U.S. Pat. No. 7,872,129; U.S. patent application U.S. Ser. No. 10/891,912, filed Jul. 13, 2004, published as US 2005/0004152 on Jan. 6, 2005, and issued on Aug. 14, 2007 as U.S. Pat. No. 7,256,190; U.S. patent application U.S. Ser. No. 12/300,056, filed Jan. 12, 2009, and published as US 2009/0142337 on Jun. 4, 2009; U.S. patent application U.S. Ser. No. 09/951,902, filed Sep. 14, 2001, published as US 2002/0147146 on Oct. 10, 2002, and issued on Aug. 24, 2004 as U.S. Pat. No. 6,780,625; U.S. patent application U.S. Ser. No. 10/493,452, filed Apr. 23, 2004, published as US 2005/0004125 on Jan. 6, 2005, and issued on Apr. 7, 2009 as U.S. Pat. No. 7,514,445; International Patent Application No. PCT/EP2011/061198, filed on Jul. 4, 2011, published as WO/2012/004217 on Jan. 12, 2012; International Patent Application No. PCT/US2003/026625, filed on Aug. 21, 2003, published as WO/2004/018455 on Mar. 4, 2004; International Patent Application No. PCT/US2001/042081, filed on Sep. 6, 2001, published as WO/2002/020495 on Mar. 14, 2002; International Patent Application No. PCT/EP2001/003640, filed on Mar. 22, 2001, published as WO/2001/070729 on Sep. 27, 2001).
[0158] In certain embodiments, the GSK3 inhibitors are classified into one or more of the following classes of compounds: metal cations, marine organism derived compounds, ureas, aminopyrimidines, arylindolemaleimides, thiazoles, thiadiazolidindiones, halomethylketones, and peptides.
[0159] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00013##
or a pharmaceutically acceptable salt thereof, wherein: Ring A is an optionally substituted 5-7 membered, partially unsaturated or fully unsaturated ring having 0-3 heteroatoms independently selected from nitrogen, oxygen or sulfur, and wherein Ring A is optionally fused to an optionally substituted saturated, partially unsaturated or fully unsaturated 5-8 member ring having 0-3 heteroatoms independently selected from nitrogen, oxygen or sulfur; Ring B is an optionally substituted 5-6 membered ring having 0 to 4 heteroatoms, independently selected from nitrogen, oxygen, or sulfur, wherein said ring has a first substituent, —N(R.sup.1).sub.2, in the position adjacent to the point of attachment, and is optionally substituted by up to two additional substituents; W is selected from nitrogen or CR.sup.4 and X is selected from nitrogen or CH, wherein at least one of W and X is nitrogen; R.sup.1 is selected from R or R.sup.2; R.sup.2 is selected from —SO.sub.2R, —SO.sub.2N(R).sub.2, —CN, —C(O)R, —CO.sub.2R, or —CON(R).sub.2; R is independently selected from hydrogen or an optionally substituted group selected from C.sub.1-6 aliphatic, a 3-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or: two R groups on the same nitrogen are taken together with the nitrogen bound thereto to form a 3-7 membered heterocyclic or heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; R.sup.3 is selected from T-CN or L-R; T is a valence bond or an optionally substituted C.sub.1-6 alkylidene chain; L is a valence bond or a C.sub.1-4 alkylidene chain, wherein up to two methylene units of L are optionally, and independently, replaced by —O—, —S—, —NR—, —NRC(O)—, —NRC(O)NR—, —OC(O)NR—, —C(O)—, —CO.sub.2—, —NRCO.sub.2—, —C(O)NR—, —SO.sub.2NR—, —NRSO.sub.2—, or —NRSO.sub.2NR—; and R.sup.4 is selected from L-R, -halo, T-NO.sub.2, T-CN (see U.S. patent application U.S. Ser. No. 10/360,535, filed on Feb. 6, 2003, published as US 2004/0034037 on Feb. 19, 2004; U.S. patent application Ser. No. 09/267,971, filed Mar. 12, 1999, and issued on May 2, 2000 as U.S. Pat. No. 6,057,117).
[0160] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00014##
wherein: W and Y are each nitrogen; R.sub.2 is an optionally substituted aryl; R.sub.4 and R.sub.6 are each independently selected from the group consisting of hydrogen, a halo, and R.sub.7, wherein R.sub.7 is a monovalent radical selected from the group consisting of a lower alkyl, a cycloalkyl, an aryl, an aminoalkyl, an aminoaralkyl, an aminocycloalkylaryl, an arylcarboxamidocycloalkylaralkyl, an arylcarboxamidocycloalkylaryl, an arylcarboxamidoalkylcycloalkyl, an arylcarboxamidoaryl, an arylcarboxamidoalkyl, an arylcarboxamidoaralkyl, an arylcarboxamidoalkoxyalkyl, an aminoalkoxyalkyl, and an arylsulfonamidoaralkyl, and wherein R.sub.7 is optionally substituted; R.sub.5 is selected from the group consisting of hydrogen, carboxyl, nitro, amino, cyano, an optionally substituted lower alkyl, an optionally substituted aryl, an optionally substituted aralkyl, an optionally substituted aminoalkyl, an optionally substituted aminoaryl, an optionally substituted aminoaralkyl, an optionally substituted aminoalkoxyalkyl, an optionally substituted arylaminoalkyl, an optionally substituted arylaminoaryl, an optionally substituted arylaminoaralkyl, an optionally substituted arylalkylamino, all optionally substituted arylalkylaminoalkyl, an optionally substituted arylalkylaminoaralkyl, an optionally substituted carboxcycloamido, an optionally substituted acyloxyalkyl, an optionally substituted acyloxyaryl, an optionally substituted acyloxyaralkyl, an optionally substituted acyloxyalkylcycloalkyl, an optionally substituted acyloxyalkylaminoalkyl, and an optionally substituted sulfonylalkyl, an optionally substituted carbamylalkyl, an optionally substituted carbamylaryl, an optionally substituted carbamylaralkyl, an optionally substituted carbamylalkylamino, an optionally substituted carbamylalkylaminoalkyl, an optionally substituted carbamylalkylaminoaryl, and an optionally substituted carbamylalkylaminoaralkyl; wherein, no more than two of R.sub.4, R.sub.5, and R.sub.6 are hydrogen; and salts thereof (see U.S. patent application U.S. Ser. No. 09/336,038, filed Jun. 18, 1999, and issued on Jul. 9, 2002 as U.S. Pat. No. 6,417,185).
[0161] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00015##
wherein: W is optionally substituted carbon or nitrogen; X and Y are independently selected from the group consisting of nitrogen, oxygen, and optionally substituted carbon; A is optionally substituted aryl or heteroaryl; R.sub.1, R′.sub.1, R.sub.2, R′.sub.2, R.sub.3, R′.sub.3, R.sub.4 and R′.sub.4 are independently selected from the group consisting of hydrogen, hydroxyl, and optionally substituted loweralkyl, cycloloweralkyl, cyclicaminoalkyl, alkylaminoalkyl, loweralkoxy, amino, alkylamino, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, heteroarylcarbonyl, heteroaralkylcarbonyl, aryl and heteroaryl, and R′.sub.1, R′.sub.2, R′.sub.3 and R′.sub.4 are independently selected from the group consisting of hydrogen, and optionally substituted loweralkyl; R.sub.5 and R.sub.7 are independently selected from the group consisting of hydrogen, halo, and optionally substituted loweralkyl, cycloalkyl, alkoxy, amino, aminoalkoxy, alkylamino, aralkylamino, heteroaralkylamino, arylamino, heteroarylamino cycloimido, heterocycloimido, amidino, cycloamidino, heterocycloamidino, guanidinyl, aryl, biaryl, heteroaryl, heterobiaryl, heterocycloalkyl, and arylsulfonamido; R.sub.6 is selected from the group consisting of hydrogen, hydroxy, halo, carboxyl, nitro, amino, amido, amidino, imido, cyano, and substituted or unsubstituted loweralkyl, loweralkoxy, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, heteroarylcarbonyl, heteraralkylcarbonyl, alkylcarbonyloxy, arylcarbonyloxy, aralkylcarbonyloxy, alkylaminocarbonyloxy, arylaminocarbonyloxy, formyl, loweralkylcarbonyl, loweralkoxycarbonyl, aminocarbonyl, aminoaryl, alkylsulfonyl, sulfonamido, amrinoalkoxy, alkylamino, heteroarylamino, alkylcarbonylamino, alkylaminocarbonylamino, arylaminocarbonylamino, aralkylcarbonylamino, heteroaralkylcarbonylamino, arylcarbonylamino, heteroarylcarbonylamino cycloamido, cyclothioamido, cycloamidino, heterocycloamidino, cycloimido, heterocycloimido, guanidinyl, aryl, heteroaryl, heterocyclo, heterocycloalkyl, arylsulfonyl and arylsulfonamido; and the pharmaceutically acceptable salts thereof (see U.S. patent application U.S. Ser. No. 09/949,035, filed on Sep. 6, 2001, published as US 2002/0156087 on May 16, 2006, and issued on May 16, 2006 as U.S. Pat. No. 7,045,519).
[0162] In certain embodiments, the GSK3 inhibitors are compounds of formula (A):
##STR00016##
wherein X.sup.1 and X.sup.2 are independently N or CR.sub.3 and preferably X.sup.1 is N or CH and X.sup.2 is CH; R.sup.1 and R.sup.2 are independently H, —C.sub.1-C.sub.6 alkyl, optionally substituted, or —CO—C.sub.1-C.sub.6 alkyl, optionally substituted, wherein the substituents are independently selected from one or more of halo, CN, OH, O—C.sub.1-C.sub.6alkyl; COOH, COO—C.sub.1-C.sub.6 alkyl, —CONH.sub.2, —CONH(C.sub.1-C.sub.6)alkyl, —CON(C.sub.1-C.sub.6 alkyl).sub.2, aryl, heteroaryl or combinations thereof; each R.sup.3 and R.sup.4 is independently selected from C.sub.1-C.sub.6 alkyl, —C.sub.2-C.sub.6alkenyl; —C.sub.2-C.sub.6 alkynyl; —C.sub.3-C.sub.10 cycloalkyl, —C.sub.3-C.sub.10 heterocyclyl, aryl with 6 to 10 carbon atoms, heteroaryl with 5 to 10 ring atoms; each optionally substituted; halo, e.g. F, Cl, Br or I; —NO.sub.2, —CN, —OR.sup.1; COOR.sup.1 or —NR.sup.1R.sup.2; wherein R.sup.1 and R.sup.2 are as defined above; and wherein alkyl, alkenyl or alkynyl is optionally substituted with one or more of halo, —NO.sub.2, —CN, —OR.sup.1, COOR.sup.1, —OCOR.sup.1, —NR.sup.1R.sup.2, —NR.sup.1COR.sup.2, —NR.sup.1OCOR.sup.2, —NR.sub.1CONR.sup.1R.sup.2, —SR.sup.1, SOR.sup.1, —SO.sub.2R.sup.1, —SONR.sup.1R.sup.2, SO.sub.2NR.sup.1R.sup.2 or —NR.sup.1SO.sub.2NR.sup.1NR.sup.2; or combinations thereof, wherein R.sup.1 and R.sup.2 are as defined above; wherein cycloalkyl, heterocyclyl, aryl or heteroaryl is optionally substituted with one or more of C.sub.1-C.sub.6 alkyl, halo, —NO.sub.2, —CN, —OR.sup.1, COOR.sup.1, —OCOR.sup.1, —NR.sup.1R.sup.2, NR.sup.1COR.sup.2, —NR.sup.1OCOR.sub.2, —NR.sup.1CONR.sup.1R.sup.2, —SR.sup.1, SOR.sup.1, —SO.sub.2R.sup.1, —SONR.sup.1R.sup.2, SO.sub.2NR.sup.1R.sup.2 or —NR.sup.1SO.sub.2NR.sup.1NR.sup.2; or combinations thereof, wherein R.sup.1 and R.sup.2 are as defined above; or wherein two R.sup.3 or two R.sup.4 may together form a ring; n=0-3, preferably 0-1 and more preferably 0; m=0-3, preferably 0, 1 or 2 and more preferably 1 or 2; or an optical isomer or a salt thereof (see U.S. patent application U.S. Ser. No. 11/913,612, filed Nov. 5, 2007, and published as US 2008/0207594 on Aug. 28, 2008).
[0163] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00017##
wherein R.sup.5 and R.sup.6 are independently H, —C.sub.1-C.sub.6 alkyl, optionally substituted, or —CO—C.sub.1-C.sub.6 alkyl, optionally substituted, wherein the substituents are independently selected from one or more of halo, CN, OH, O—C.sub.1-C.sub.6 alkyl; COOH, COOC.sub.1-C.sub.6 alkyl, —CONH.sub.2, —CONH(C.sub.1-C.sub.6alkyl), —CON(C.sub.1-C.sub.6 alkyl).sub.2, aryl, heteroaryl or combinations thereof; each R.sup.7 and R.sup.8 is independently selected from C.sub.1-C.sub.6 alkyl, —C.sub.2-C.sub.6alkenyl; C.sub.2-C.sub.6 alkynyl; C.sub.3-C.sub.10 cycloalkyl, —C.sub.3-C.sub.10 heterocyclyl, aryl with 6 to 10 carbon atoms, heteroaryl with 5 to 10 ring atoms, each optionally substituted; halo, e.g. F, Cl, Br or I; —NO.sub.2, —CN, —OR.sup.1; COOR.sub.1; or NR.sup.1R.sup.2, wherein R.sup.1 and R.sup.2 are as defined in formula (A), wherein alkyl, alkenyl or alkynyl is optionally substituted with one or more of oxo, halo, —NO.sub.2. —CN, —OR.sup.1, COOR.sup.1, —OCOR.sup.1, —NR.sup.1R.sup.2, NR.sup.1COR.sup.2, —NR.sup.1OCOR.sup.2, —NR.sup.1CONR.sup.1R.sub.2, —SR.sup.1, SOR.sup.1, —SO.sub.2R.sup.1, —SONR.sup.1R.sup.2, SO.sub.2NR.sup.1R.sup.2 or —NR.sup.1SO.sub.2NR.sup.1NR.sup.2 or combinations thereof, wherein R.sup.1 and R.sup.2 are as defined in formula (A); wherein cycloalkyl, heterocyclyl, aryl or heteroaryl is optionally substituted with one or more of C.sub.1-C.sub.6 alkyl, oxo, halo, —NO.sub.2. —CN, —OR.sup.1, COOR.sup.1, —OCOR.sup.1, —NR.sup.1R.sup.2, NR.sup.1COR.sup.2, —NR.sup.1OCOR.sup.2, —NR.sup.1CONR.sup.1R.sup.2, —SR.sup.1, SOR.sup.1, —SO.sub.2R.sup.1, —SONR.sup.1R.sup.2, SO.sub.2NR.sup.1R.sup.2 or —NR.sup.1SO.sub.2NR.sup.1NR.sup.2 or combinations thereof, wherein R.sup.1 and R.sup.2 are as defined in formula (A); or two R.sup.7 or two R.sup.8 may together form a ring; n=0-3, preferably 0-1 and more preferably 0; m=0-3, preferably 0-1 and more preferably 1, or an optical isomer or a salt thereof (see U.S. patent application U.S. Ser. No. 11/913,612, filed Nov. 5, 2007, and published as US 2008/0207594 on Aug. 28, 2008).
[0164] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00018##
wherein Y is —[C(R.sup.9).sub.2].sub.r, each R.sup.9 is independently H, F or CH.sub.3, and r is 0-3, and Ar1 and Ar2 are aromatic or heteroaromatic rings optionally substituted with at least one R.sup.7 wherein each R.sup.7 is independently selected from C.sub.1-C.sub.5 alkyl, optionally halogenated; halo, e.g. F, Cl, Br or I; —NO.sub.2, —CN, —OR.sup.5; —COOR.sup.5; —OCOR.sup.5; —NR.sup.5R.sup.6 and —NR.sup.5COR.sup.6 and wherein R.sup.5 and R.sup.6 are independently H, C.sub.1-C.sub.5 alkyl, optionally halogenated, or —CO—C.sub.1-C.sub.5 alkyl (see U.S. patent application U.S. Ser. No. 11/913,612, filed Nov. 5, 2007, and published as US 2008/0207594 on Aug. 28, 2008).
[0165] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00019##
a pharmaceutically acceptable addition salt or a stereochemically isomeric form thereof, wherein the moiety
##STR00020##
represents a radical of formula
##STR00021##
R.sup.1 is hydrogen; aryl formyl; C.sub.1-6 alkylcarbonyl; C.sub.1-6 alkyl; C.sub.1-6 alkyloxycarbonyl; C.sub.1-6 alkyl substituted with formyl, C.sub.1-6 alkylcarbonyl, C.sub.1-6 alkyloxycarbonyl, C.sub.1-6 alkylcarbonyloxy; C.sub.1-C.sub.6alkyloxyC.sub.1-6 alkylcarbonyl optionally substituted with C.sub.1-6 alkyloxycarbonyl; X is —NR.sup.1—; —NH—NH—; —N—N—; —O—; —C(═O)—; —C(═S)—; —O—C(═O)—; —C(═O)—O—; —O—C(═O)—C.sub.1-6 alkyl-; —C(═O)—O—C.sub.1-6 alkyl-; —O—C.sub.1-6 alkyl-C(═O)—; C(═O)—C.sub.1-6 alkyl-O—; —O—C(═O)—NR.sup.1—; —NR.sup.1—C(═O)—O—; —O—C(═O)—C(═O)—; —C(═O)—NR.sup.1—, —NR.sup.1—C(═O)—; —C(═S)—NR.sup.1—, —NR.sup.1—C(═S)—; NR.sup.1—C(═O)—NR.sup.1—; —NR.sup.1—C(═)S—NR.sup.1—; —NR.sup.1—S(═O)—NR.sup.1; NR.sup.1—S(═O).sub.2—NR.sup.1—; —C.sub.1-6 alkyl-C(═O)—NR.sup.1—; —O—C.sub.1-6 alkyl-C(═O)—NR.sup.1—; —C.sub.1-6 alkyl-O—C(═O)—NR.sup.1—; —C.sub.1-6 alkyl-; —O—C.sub.1-6 alkyl-; —C.sub.1-6 alkyl-O—; —NR.sup.1—C.sub.1-6 alkyl-; —C.sub.1-6alkyl-NR.sup.1—; —NR.sup.1—C.sub.1-6 alkyl-NR.sup.1—; —NR.sup.1—C.sub.1-6 alkyl-C.sub.3-7cycloalkyl-; —C.sub.2-6 alkenyl-; —C.sub.2-6 alkynyl-; —O—C.sub.2-6 alkenyl-; —C.sub.2-6 alkenyl-O—; —NR.sup.1—C.sub.2-6 alkenyl-; —C.sub.2-6 alkenyl-NR.sup.1—; —NR.sup.1—C.sub.2-6 alkenyl-NR.sup.1—; —NR.sup.1—C.sub.2-6 alkenyl-C.sub.3-7 cycloalkyl-; —O—C.sub.2-6alkynyl-; —C.sub.2-6 alkynyl-O—; —NR.sub.1—C.sub.2-6 alkynyl-; —C.sub.2-6 alkynyl-NR.sup.1—; —NR.sup.1—C.sub.2-6alkynyl-NR.sup.1—; —NR.sup.1—C.sub.2-6 alkynyl-C.sub.3-7cycloalkyl-; —O—C.sub.1-6 alkyl-O—; —O—C.sub.2-6alkenyl-O—; —O—C.sub.2-6 alkynyl-O—; —CHOH—; —S—; —S(═O)—; —S(═O).sub.2—; S(═O)—NR.sup.1—; —S(═O).sub.2—NR.sup.1—; —NR.sup.1—S(═O)—; —NR.sup.1—S(═O).sub.2—; —S—C.sub.1-6alkyl-; —C.sub.1-6 alkyl-S—; —S—S.sub.2-6alkenyl-; —C.sub.2-6 alkenyl-S—; —S—C.sub.2-6 alkynyl-; —C.sub.2-6alkynyl-S—; —O—C.sub.1-6 alkyl-S(═O).sub.2— or a direct bond; Z is a direct bond, —O—; —S—; —C(═O)—; —C(═O)—O—; —O—C(═O)—; —C(═S)—; —S(═O)—; —S(═O).sub.2—; NR.sup.1—; —NR.sup.1—C(═O)—; —O—C(═O)—NR.sup.1—; —NR.sup.1C(═O)—O—; —NR.sup.1—C(═S)—; —S(═O)—NR.sup.1—; —S(═O).sub.2—NR.sup.1—; —NR.sup.1—S(═O)—; —NR.sup.1—S(═O).sub.2—; —NR.sup.1—(C═O)—NR.sup.1—; —NR.sup.1—C(═S)—NR.sup.1—; —NR.sup.1—S(═O)═NR.sup.1—; —NR.sup.1—S(═O).sub.2—NR.sup.1—; R.sup.2 is hydrogen, C.sub.1-10alkyl, C.sub.2-10 alkenyl, C.sub.2-10 alkynyl, R.sup.20, each of said groups representing R.sup.2 may optionally be substituted where possible with one or more substituents each independently being selected from —S; —O; R.sup.15; hydroxy; halo; nitro; cyano; R.sup.15—O—; SH; R.sup.15—S—; formyl; carboxyl; R.sup.15—C(═O)—; R.sup.15—O—C(═O)—; R.sup.15—C(═O)—O—; R.sup.15—O—C(═O)—O—; —SO.sub.3H; R.sup.15—S(═O)—; R.sup.15—S(═O)—; R.sup.5R.sup.6N; R.sup.5R.sup.6N—C.sub.1-6alkyl; R.sup.5R.sup.6N—C.sub.3-7 cycloalkyl; R.sup.5R.sup.6N—C.sub.1-6 alkyloxy; R.sup.5R.sup.6N—C(═O)—; R.sup.5R.sup.6N—C(═S)—; R.sup.5R.sup.6N—C(═O)—NH—; R.sup.5R.sup.6N—C(═S)—NH—; R.sup.5R.sup.6N—S(═O).sub.n—; R.sup.5R.sup.6N—S(═O).sub.n—NH—; R.sup.15—C(═S)—; R.sup.15—C(═O)—NH—; R.sup.15—O—C(═O)—NH—; R.sup.15—S(═O), —NH—; R.sup.15—O—S(═O).sub.n—NH—; R.sup.15—C(═S)—NH—; R.sup.15—O—C(═S)—NH—; R.sup.17R.sup.18N—Y.sub.1a; R.sup.17R.sup.18N—Y.sub.2—NR.sup.16—Y.sub.1—; R.sup.15—Y.sub.2—NR.sup.19—Y.sub.1—; H—Y.sub.2—NR.sup.19—Y.sub.1—; R.sup.3 is hydrogen; halo; C.sub.1-6 alkyl; cyano; or polyhaloC.sub.1-6 alkyl; R.sup.4 is a monocyclic, bicyclic or tricyclic saturated heterocycle; a monocyclic, bicyclic or tricyclic partially saturated heterocycle or a monocyclic, bicyclic or tricyclic aromatic heterocycle, each of said heterocycles optionally being substituted where possible with one or more substituents each independently being selected from ═S; ═O; R.sup.15; hydroxy; halo; nitro; cyano; R.sup.15—O—; SH; R.sup.15—S—; formyl; carboxyl; R.sup.15—C(═O)—; R.sup.15—O—C(═O)—; R.sup.15—C(═O)—O—; R.sup.15—O—C(═O)—O—; —SO.sub.3H; R.sup.15—S(═O)—; R.sup.15—S(═O).sub.2—; R.sup.5R.sup.6N; R.sup.5R.sup.6NC.sub.1-6 alkyl; R.sup.5R.sup.6NC.sub.3-7cycloalkyl; R.sup.5R.sup.6NC.sub.1-6 alkyloxy; R.sup.5R.sup.6N—C(═O)—; R.sup.5R.sup.6N—C(═S)—; R.sup.5R.sup.6N—C(═O)—NH—; R.sup.5R.sup.6N—C(═S)—NH—; R.sup.5R.sup.6N—S(═O).sub.n—; R.sup.5R.sup.6N—S(═O).sub.n—NH—; R.sup.15—C(═S)—; R.sup.15—C(═O)—NH—; R.sup.15—O—C(═O)—NH—; R.sup.15—S(═O).sub.n—NH—; R.sup.15—O—S(═O).sub.n—NH—; R.sup.15—C(═S)—NH—; R.sub.15—O—C(═S)—NH—; R.sup.17R.sup.18N—Y.sub.1a; R.sup.17R.sup.18N—Y.sub.2—NR.sup.16—Y.sub.1—; R.sup.15—Y.sub.2—NR.sup.19—Y.sub.1—; H—Y.sub.2NR.sup.19—Y.sub.1—; R.sup.5 and R.sup.6 each independently are hydrogen, R.sup.8, —Y.sub.1—NR.sup.9—Y.sub.2—NR.sup.10R.sup.11, —Y.sub.1—NR.sup.9—Y.sub.1—R.sup.8, —Y.sub.1—NR.sup.9R.sup.10, or R.sup.5 and R.sup.6 may together with the nitrogen to which they are attached form a saturated or partially saturated monocyclic 3 to 8 membered heterocycle or an aromatic 4 to 8 membered monocyclic heterocycle, each of said heterocycles may optionally be substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14, or each of said heterocycles may optionally be fused with a benzene ring, said benzene ring being optionally substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14; R.sup.7 is C.sub.1-6 alkyl, C.sub.1-6 alkyloxy, amino, mono- or di(C.sub.1-6 alkyl)amino or polyhaloC.sub.1-6 alkyl; R.sup.8 is C.sub.1-6 alkyl; C.sub.2-6 alkenyl; C.sub.2-6alkynyl; a monocyclic, bicyclic or tricyclic saturated carbocycle; a monocyclic, bicyclic or tricyclic partially saturated carbocycle; a monocyclic, bicyclic or tricyclic aromatic carbocycle; a monocyclic, bicyclic or tricyclic saturated heterocycle; a monocyclic, bicyclic or tricyclic partially saturated heterocycle; a monocyclic, bicyclic or tricyclic aromatic heterocycle; C.sub.1-6 alkyl substituted with a monocyclic, bicyclic or tricyclic saturated carbocycle or with a monocyclic, bicyclic or tricyclic partially saturated carbocycle or with a monocyclic, bicyclic or tricyclic aromatic carbocycle or with a monocyclic, bicyclic or tricyclic saturated heterocycle or with a monocyclic, bicyclic or tricyclic partially saturated heterocycle or with a monocyclic, bicyclic or tricyclic aromatic heterocycle; each of said groups representing R.sup.8 may optionally be substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14; R.sup.9, R.sup.10 and R.sup.11 each independently are hydrogen or R.sup.8, or any two of R.sup.9, R.sup.10 and R.sup.11 may together be C.sub.1-6 alkanediyl or C.sub.2-6 alkenediyl thereby forming a saturated or partially saturated monocyclic 3 to 8 membered heterocycle or an aromatic 4 to 8 membered monocyclic heterocycle together with the nitrogen atoms to which they are attached, each of said heterocycles may optionally be substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14; R.sup.12, R.sup.13 and R.sup.14 each independently are hydrogen; R.sup.15; hydroxy; halo; nitro; cyano; R.sup.15—O—; SH; R.sup.15—S—; formyl; carboxyl; R.sup.15—C(═O)—; R.sup.15—O—C(═O)—; R.sup.15—C(═O)—O—; R.sup.15—O—C(═O)—O—; —SO.sub.3H; R.sup.15—S(═O)—; R.sup.15—S(═O).sub.2; R.sub.15R.sup.16N—S(═O); R.sup.15R.sup.16N—S(═O).sub.2; R.sup.17R.sup.18N—Y.sub.1; R.sup.17R.sup.18N—Y.sub.2—NR.sup.16—Y.sub.1—; R.sup.15—Y.sub.2—NR.sup.19—Y.sub.1—; H—Y.sub.2NR.sup.19—Y.sub.1—; oxo, or any two of R.sup.12, R.sup.13 and R.sup.14 may together be C.sub.1-6 alkanediyl or C.sub.2-6 alkenediyl thereby forming a saturated or partially saturated monocyclic 3 to 8 membered carbo- or heterocycle or an aromatic 4 to 8 membered monocyclic carbo- or heterocycle together with the atoms to which they are attached, or any two of R.sup.12, R.sup.13 and R.sup.14 may together be —O—(CH.sub.2).sub.r—O— thereby forming a saturated, partially saturated or aromatic monocyclic 4 to 8 membered carbo or heterocycle together with the atoms to which they are attached; R.sup.15 is C.sub.1-6 alkyl, a monocyclic, bicyclic or tricyclic saturated heterocycle; C.sub.1-6 alkyl substituted with a monocyclic, bicyclic or tricyclic saturated carbocycle or with a monocyclic, bicyclic or tricyclic aromatic carbocycle; R.sup.16, R.sup.17, R.sup.18 and R.sup.19 each independently are hydrogen or R.sup.15, or R.sup.17 and R.sup.18, or R.sup.15 and R.sup.19 may together be C.sub.1-6 alkanediyl or C.sub.2-6 alkenediyl thereby forming a saturated or partially saturated monocyclic 3 to 8 membered heterocycle or an aromatic 4 to 8 membered monocyclic heterocycle, each of said heterocycles may optionally be substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14; or R.sup.17 and R.sup.18 together with R.sup.16 may be C.sub.1-6alkanediyl or C.sub.2-6 alkenediyl thereby forming a saturated or partially saturated monocyclic 3 to 8 membered heterocycle or an aromatic 4 to 8 membered monocyclic heterocycle together with the nitrogen atoms to which they are attached, each of said heterocycles may optionally be substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14; R.sup.20 is a monocyclic, bicyclic or tricyclic saturated carbocycle; a monocyclic, bicyclic or tricyclic partially saturated carbocycle; a monocyclic, bicyclic or tricyclic aromatic carbocycle; a monocyclic, bicyclic or tricyclic saturated heterocycle; a monocyclic, bicyclic or tricyclic partially saturated heterocycle; a monocyclic, bicyclic or tricyclic aromatic heterocycle; R.sup.21 is a monocyclic, bicyclic or tricyclic saturated carbocycle; a monocyclic, bicyclic or tricyclic partially saturated carbocycle; a monocyclic, bicyclic or tricyclic aromatic carbocycle; a monocyclic, bicyclic or tricyclic saturated heterocycle; a monocyclic, bicyclic or tricyclic partially saturated heterocycle; a monocyclic, bicyclic or tricyclic aromatic heterocycle, each of said carbocycles or heterocycles representing R.sup.21 may optionally be substituted with one or more substituents selected from R.sup.12, R.sup.13 and R.sup.14; Y.sub.1a is —Y.sub.3S(═O)Y.sub.4; —Y.sub.3—S(═O).sub.2—Y.sub.4—, —Y.sub.3—C(═O)—Y.sub.4, —Y.sub.3—C(═S)—Y.sub.4, —Y.sub.3—O—Y.sub.4—, —Y.sub.3—S—Y.sub.4—, Y.sub.3OC(═O)Y.sub.4— or —Y.sub.3—C(═O)—O—Y.sub.4—; Y.sub.1 or Y.sub.2 each independently are a direct bond, —Y.sub.3—S(═O)—Y.sub.4—; —Y.sub.3—S(═O).sub.2—Y.sub.4—, —Y.sub.3—C(═O)—Y.sub.4—, —Y.sub.3—C(═S)—Y.sub.4, —Y.sub.3—O—Y.sub.4, —Y.sub.3—S—Y.sub.4—, —Y.sub.3—O—C(═O)—Y.sub.4— or —Y.sub.3—C(═O)—O—Y.sub.4—; Y.sub.3 or Y.sub.4 each independently are a direct bond, C.sub.1-6 alkanediyl, C.sub.2-6 alkenediyl or C.sub.2-6alkynediyl; n is 1 or 2; m is 1 or 2; p is 1 or 2; r is 1 to 5; s is 1 to 3; aryl is phenyl or phenyl substituted with one, two, three, four or five substituents each independently selected from halo, C.sub.1-6alkyl, C.sub.3-7 cycloalkyl, C.sub.1-6alkyloxy, cyano, nitro, polyhaloC.sub.1-6alkyl and polyhaloC.sub.1-6alkyloxy; provided that —X—R.sup.2 and/or R.sup.3 is other than hydrogen; and provided that —Z—R.sup.4 is other than
##STR00022##
wherein R.sup.x is hydrogen, aryl, C.sub.1-6alkylcarbonyl, C.sub.1-6alkyl, C.sub.1-6alkyloxycarbonyl, C.sub.1-6alkyl substituted with C.sub.1-6alkyloxycarbonyl; R.sup.y is halo, C.sub.1-6alkyl, cyano, aminocarbonyl, nitro, trihalomethyl, trihalomethyloxy or C.sub.1-6 alkyl substituted with cyano or aminocarbonyl; R.sup.z is hydroxyl, halo, C.sub.1-6 alkyl, C.sub.1-6 alkyloxy, cyano, aminocarbonyl, nitro, amino, trihalomethyl, trihalomethyloxy or C.sub.1-6 alkyl substituted with cyano or aminocarbonyl; and n′ is 0, 1, 2 or 3; and provided that —Z—R.sup.4 is other than C.sub.1-6 alkyl substituted with indolyl which may be substituted with one, two, three, four or five substituents each independently selected from halo, hydroxyl, C.sub.1-6 alkyl, C.sub.1-6 alkyloxy, cyano, aminocarbonyl, C.sub.1-6alkyloxycarbonyl, formyl, nitro, amino, trihalomethyl, trihalomethyloxy and C.sub.1-6 alkylcarbonyl (see U.S. patent application U.S. Ser. No. 10/493,452, filed Apr. 23, 2004, published as US 2005/0004125 on Jan. 6, 2005, and issued on Apr. 7, 2009 as U.S. Pat. No. 7,514,445).
[0166] In certain embodiments, the GSK3 inhibitors are compounds of the following formula:
##STR00023##
and salts thereof, wherein: each X is independently O or NOR.sup.A; R.sup.A is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or an oxygen protecting group; R.sup.1 is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted heteroalkyl, optionally substituted heteroalkenyl, optionally substituted heteroalkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen protecting group; and R.sup.2 is hydrogen, halogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted heteroalkyl, optionally substituted heteroalkenyl, optionally substituted heteroalkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl.
[0167] In certain embodiments, at least one X is O. In certain embodiments, at least one X is NOH. In certain embodiments, both X are O. In certain embodiments, at least one X is NOR.sup.A, wherein R.sup.A is a oxygen protecting group. In certain embodiments, at least one R.sup.1 is hydrogen. In certain embodiments, both R.sup.1 are hydrogen. In certain embodiments, at least one R.sup.2 is hydrogen. In certain embodiments, at least one R.sup.2 is halogen. In certain embodiments, at least one R.sup.2 is bromide. In certain embodiments, all R.sup.2 are hydrogen. In certain embodiments, at least one R.sup.2 is unsubstituted alkyl. In certain embodiments, at least one R.sup.2 is substituted alkyl.
[0168] In certain embodiments, the GSK3 inhibitor is KIN 001-043:
##STR00024##
In certain embodiments, the GSK3 inhibitor is indirubin-monoxime:
##STR00025##
In certain embodiments, the GSK3 inhibitor is indirubin:
##STR00026##
[0169] In certain embodiments, the GSK3 inhibitors are selected from a group consisting of KIN 001-043, AR-A014418, TWS-119, Indirubin-monoxime, indirubin, beryllium, copper, lithium, mercury, tungsten, 6-BIO, dibromocantharelline, hymenialdisine, CT98014, CT98023, CT99021, SB-216763, SB-415286, AZD-1080, alsterpaullone, cazpaullone, kenpaullone, manzamine A, palinurine, tricantine, TDZD-8, NP00111, NP031115, tideglusib, HMK-32, and L803-mts.
[0170] In certain embodiments, the MET inhibitors are compounds of the following formula:
##STR00027##
and salts thereof, wherein: Ar.sup.1 is optionally substituted aryl or optionally substituted heteroaryl; Ar.sup.2 is optionally substituted aryl or optionally substituted heteroaryl; each R.sup.1 is independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted heteroalkyl, optionally substituted heteroalkenyl, optionally substituted heteroalkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and each R.sup.2 is independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted heteroalkyl, optionally substituted heteroalkenyl, optionally substituted heteroalkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen protecting group; or two R.sup.1 are taken together to form an optionally substituted carbocyclyl or optionally substituted heterocyclyl; or R.sup.1 and R.sup.2 are taken together to form an optionally substituted carbocyclyl or optionally substituted heterocyclyl.
[0171] In certain embodiments, Ar.sup.1 is unsubstituted phenyl. In certain embodiments, Ar.sup.1 is substituted phenyl. In certain embodiments, Ar.sup.2 is unsubstituted phenyl. In certain embodiments, Ar.sup.2 is substituted phenyl. In certain embodiments, at least one R.sup.1 is optionally substituted alkyl. In certain embodiments, both R.sup.1 are independently optionally substituted alkyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted heterocyclyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted carbocyclyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted cyclopropyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted cyclobutyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted cyclopentyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted cyclohexyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted cycloheptyl. In certain embodiments, two R.sup.1 are taken together to form a optionally substituted cyclooctyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted carbocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted heterocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted heterocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted 4-membered heterocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted 5-membered heterocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted 6-membered heterocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted 7-membered heterocyclyl. In certain embodiments, R.sup.1 and R.sup.2 are taken together to form an optionally substituted, unsaturated 6-membered heterocyclyl.
[0172] In certain embodiments, the MET inhibitor is BMS 777607:
##STR00028##
In certain embodiments, the MET inhibitor is Foretinib:
##STR00029##
In certain embodiments, the MET inhibitor is XL-184:
##STR00030##
[0173] In certain embodiments the MET inhibitors are selected from the group consisting of AMG-208, AMG-337, AMG-458, PHA-665752, SU11274, NPS-1034, SGX-523, BMS-777607, tepotinib, BMS-794833, NVP-BVU972, MK-2461, MGCD-265, golvatinib, JNJ-38877605, BMS-754807, PF-04217903, savolitinib, crizotinib, tivantinib, cabozantinib, foretinib, capmatinib (INC280), tepotinib, BMS-794833, BMS-817378, DCC-2618, merestinib (LY2801653), Altiratinib), BMS-794833, c-Met inhibitor 1, Ningetinib, MK-2461, NPS-1034, and SCR-1481B1.
[0174] In certain embodiments, the kinase inhibitors are compounds of the following formula:
##STR00031##
and salts thereof, wherein each Ar.sup.1 is independently optionally substituted aryl or optionally substituted heteroaryl.
[0175] In certain embodiments, at least one Ar.sup.1 is unsubstituted aryl. In certain embodiments, at least one Ar.sup.1 is substituted aryl. In certain embodiments, both Ar.sup.1 are unsubstituted aryl. In certain embodiments, both Ar.sup.1 are substituted aryl. In certain embodiments, at least one Ar.sup.1 is unsubstituted heteroaryl. In certain embodiments, at least one Ar.sup.1 is substituted heteroaryl. In certain embodiments, both Ar.sup.1 are unsubstituted heteroaryl. In certain embodiments, both Ar.sup.1 are substituted heteroaryl. In certain embodiments, the unsubstituted or substituted heteroaryl is selected from: pyrrolyl, furanyl, thiophenyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, tetrazinyl, azepinyl, oxepinyl, thiepinyl, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, quinazolinyl, phenanthridinyl, dibenzofuranyl, carbazolyl, acridinyl, phenothiazinyl, phenoxazinyl and phenazinyl. In certain embodiments, at least one Ar.sup.1 is substituted indolyl. In certain embodiments, both Ar.sup.1 are substituted indolyl.
[0176] In certain embodiments, the kinase inhibitor is Ro 31-8220:
##STR00032##
[0177] In certain embodiments, cell culture media are used to culture and maintain cells. In some embodiments, the cell culture medium is chemically defined medium. In some embodiments, cell culture medium is serum-free medium, e.g., mTeSR1™ medium (StemCell Technologies, Vancouver, BC). In some embodiments, the culture medium comprises one or more supplements, such as, but not limited to N2 and B27. In some embodiments, the cell culture medium comprises a serum replacement composition. In some embodiments, the cell culture medium comprises knock-out serum replacement medium. In some embodiments, the cell culture medium does not comprise a serum replacement composition.
[0178] In some embodiments, the cell culture medium comprises a basal medium to which one or more supplements are added, such as: N2 supplement, B27 supplement, glutamax, pyruvate, penicillin-streptomycin, and/or BSA (e.g., from Sigma). In certain embodiments the basal medium is DMEM/F12, Neurobasal medium, or a mixture thereof.
[0179] In some aspects, the present disclosure provides pharmaceutical compositions comprising a compound, or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient for use in treating and/or preventing a neurological disease, psychiatric disorder, or central nervous system injury characterized by deficient expression or function of KCC2. In certain embodiments, the pharmaceutical composition described herein comprises a compound, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. In certain embodiments, the compound is selected from a group consisting of kinase inhibitors, Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, gamma-aminobutyric acid (GABA) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and salts thereof. In certain embodiments, the compound is selected from a group consisting of (E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), 2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime), resveratrol, piperine, and salts thereof. In certain embodiments, the compound is selected from the group consisting of, MET proto-oncogene, receptor tyrosine kinase (MET) inhibitors. In certain embodiments the compound is selected from the group of compounds listed in Table 2 and salts thereof. In certain embodiments the compound is selected from the group of compounds listed in Table 3 and salts thereof. In some aspects, the present disclosure provides pharmaceutical compositions comprising a compound, or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient for use in treating and/or preventing ASD, RTT, epilepsy, schizophrenia, mental retardation, stroke, Fragile-X syndrome, traumatic brain injury, and spinal cord injury. In certain embodiments, the pharmaceutical composition described herein comprises a compound, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. In certain embodiments, the compound is selected from a group consisting of kinase inhibitors, Feline McDonough sarcoma-like tyrosine kinase 3 (FLT3) inhibitors, glycogen synthase kinase 3 (GSK3) inhibitors, gamma-aminobutyric acid (GABA) inhibitors, GABA reuptake inhibitors, monoamine oxidase inhibitors (MAOI), norepinephrine reuptake inhibitor (NRI), dopamine antagonist, Sirtuin 1 (SIRT1) activators, transient receptor potential cation channel subfamily V member 1 (TRPV1) activators, monoamine transporter activators, tropomyosin receptor kinase B (TrkB) agonists, ampakines, and salts thereof. In certain embodiments, the compound is selected from a group consisting of (E)-(4-(2-(1H-indazol-3-yl)vinyl)phenyl)(piperazin-1-yl)methanone (KW-2449), 2Z,3E)-6′-bromo-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (KIN 001-043), N-(2-diethylaminoethyl)-5-[(Z)-(5-fluoro-2-oxo-1H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (Sunitinib), 1-(2-(5-(2-(3-methyloxetan-3-yl)ethyl)-1H-benzo[d]imidazol-1-yl)quinolin-8-yl)piperidin-4-amine (Crenolanib), N′-[4-[(6,7-dimethoxy-4-quinolinyl)oxy]phenyl]-N-(4-fluorophenyl)-1,1-cyclopropanedicarboxamide (XL-184), 3-((6-(3-aminophenyl)-7H-pyrrolo[2,3-d]pyrimidin-4-yl)methyl)phenol (TWS-119), (2Z,3E)-3-(hydroxyimino)-[2,3′-biindolinylidene]-2′-one (Indirubin-monoxime), resveratrol, piperine, and salts thereof. In certain embodiments, the compound is selected from the group consisting of, MET proto-oncogene, receptor tyrosine kinase (MET) inhibitors. In certain embodiments the compound is selected from the group of compounds listed in Table 2 and salts thereof. In certain embodiments the compound is selected from the group of compounds listed in Table 3 and salts thereof.
[0180] In certain embodiments, the compound described herein is provided in an amount in the pharmaceutical composition effective to treat and/or prevent ASD, RTT, epilepsy, schizophrenia, mental retardation, stroke, Fragile-X syndrome, traumatic brain injury, and spinal cord injury. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount. In certain embodiments, the effective amount is an amount effective for treating a neurological disease in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for preventing a neurological disease in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for treating a psychiatric disorder in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for preventing a psychiatric disorder in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for reducing the risk of developing a disease (e.g., neurological disease or psychiatric disorder) in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for treating a central nervous system injury in a subject in need thereof. In certain embodiments, the effective amount is an amount effective for enhancing the gene expression of KCC2 in a subject or cell.
[0181] In certain embodiments, the subject is an animal. The animal may be of either sex and may be at any stage of development. In certain embodiments, the subject described herein is a human. In certain embodiments, the subject is a non-human animal. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human mammal. In certain embodiments, the subject is a domesticated animal, such as a dog, cat, cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a companion animal, such as a dog or cat. In certain embodiments, the subject is a livestock animal, such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a zoo animal. In some embodiments, the subject is a research animal, such as a rodent (e.g., mouse, rat), dog, pig, or non-human primate. In certain embodiments, the animal is a genetically engineered animal. In certain embodiments, the animal is a transgenic animal (e.g., transgenic mice and transgenic pigs).
[0182] Pharmaceutical compositions described herein can be prepared by any method known in the art of pharmacology. In general, such preparatory methods include bringing the compound described herein into association with a carrier or excipient, and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping, and/or packaging the product into a desired single- or multi-dose unit.
[0183] Pharmaceutical compositions can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. A “unit dose” is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage, such as one-half or one-third of such a dosage.
[0184] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition described herein will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. The composition may comprise between 0.1% and 100% (w/w) active ingredient.
[0185] Pharmaceutically acceptable excipients used in the manufacture of provided pharmaceutical compositions include inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweetening, flavoring, and perfuming agents may also be present in the composition.
[0186] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with ordinary experimentation.
[0187] The compounds and compositions provided herein can be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol. Specifically contemplated routes are oral administration, intravenous administration (e.g., systemic intravenous injection), regional administration via blood and/or lymph supply, and/or direct administration to an affected site. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and/or the condition of the subject (e.g., whether the subject is able to tolerate oral administration). In certain embodiments, the compound or pharmaceutical composition described herein is suitable for topical administration to the eye of a subject.
[0188] The exact amount of a compound required to achieve an effective amount will vary from subject to subject, depending, for example, on species, age, and general condition of a subject, severity of the side effects or disorder, identity of the particular compound, mode of administration, and the like. An effective amount may be included in a single dose (e.g., single oral dose) or multiple doses (e.g., multiple oral doses). In certain embodiments, when multiple doses are administered to a subject or applied to a tissue or cell, any two doses of the multiple doses include different or substantially the same amounts of a compound described herein. In certain embodiments, when multiple doses are administered to a subject or applied to a tissue or cell, the frequency of administering the multiple doses to the subject or applying the multiple doses to the tissue or cell is three doses a day, two doses a day, one dose a day, one dose every other day, one dose every third day, one dose every week, one dose every two weeks, one dose every three weeks, or one dose every four weeks. In certain embodiments, the frequency of administering the multiple doses to the subject or applying the multiple doses to the tissue or cell is one dose per day. In certain embodiments, the frequency of administering the multiple doses to the subject or applying the multiple doses to the tissue or cell is two doses per day. In certain embodiments, the frequency of administering the multiple doses to the subject or applying the multiple doses to the tissue or cell is three doses per day. In certain embodiments, when multiple doses are administered to a subject or applied to a tissue or cell, the duration between the first dose and last dose of the multiple doses is one day, two days, four days, one week, two weeks, three weeks, one month, two months, three months, four months, six months, nine months, one year, two years, three years, four years, five years, seven years, ten years, fifteen years, twenty years, or the lifetime of the subject, tissue, or cell. In certain embodiments, the duration between the first dose and last dose of the multiple doses is three months, six months, or one year. In certain embodiments, the duration between the first dose and last dose of the multiple doses is the lifetime of the subject, tissue, or cell. In certain embodiments, a dose (e.g., a single dose, or any dose of multiple doses) described herein includes independently between 0.1 μg and 1 μg, between 0.001 mg and 0.01 mg, between 0.01 mg and 0.1 mg, between 0.1 mg and 1 mg, between 1 mg and 3 mg, between 3 mg and 10 mg, between 10 mg and 30 mg, between 30 mg and 100 mg, between 100 mg and 300 mg, between 300 mg and 1,000 mg, or between 1 g and 10 g, inclusive, of a compound described herein. In certain embodiments, a dose described herein includes independently between 1 mg and 3 mg, inclusive, of a compound described herein. In certain embodiments, a dose described herein includes independently between 3 mg and 10 mg, inclusive, of a compound described herein. In certain embodiments, a dose described herein includes independently between 10 mg and 30 mg, inclusive, of a compound described herein. In certain embodiments, a dose described herein includes independently between 30 mg and 100 mg, inclusive, of a compound described herein.
[0189] Dose ranges as described herein provide guidance for the administration of provided pharmaceutical compositions to an adult. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.
[0190] A compound or composition, as described herein, can be administered in combination with one or more additional pharmaceutical agents (e.g., therapeutically and/or prophylactically active agents). The compounds or compositions can be administered in combination with additional pharmaceutical agents that improve their activity (e.g., activity (e.g., potency and/or efficacy) in treating a disease in a subject in need thereof, in preventing a disease in a subject in need thereof, in reducing the risk to develop a disease in a subject in need thereof, and/or in inhibiting the activity of a protein kinase in a subject or cell), improve bioavailability, improve safety, reduce drug resistance, reduce and/or modify metabolism, inhibit excretion, and/or modify distribution in a subject or cell. It will also be appreciated that the therapy employed may achieve a desired effect for the same disorder, and/or it may achieve different effects. In certain embodiments, a pharmaceutical composition described herein including a compound described herein and an additional pharmaceutical agent shows a synergistic effect that is absent in a pharmaceutical composition including one of the compound and the additional pharmaceutical agent, but not both.
[0191] The compound or composition can be administered concurrently with, prior to, or subsequent to one or more additional pharmaceutical agents, which may be useful as, e.g., combination therapies. Pharmaceutical agents include therapeutically active agents. Pharmaceutical agents also include prophylactically active agents. Pharmaceutical agents include small organic molecules such as drug compounds (e.g., compounds approved for human or veterinary use by the U.S. Food and Drug Administration as provided in the Code of Federal Regulations (CFR)), peptides, proteins, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides or proteins, small molecules linked to proteins, glycoproteins, steroids, nucleic acids, DNAs, RNAs, nucleotides, nucleosides, oligonucleotides, antisense oligonucleotides, lipids, hormones, vitamins, and cells. In certain embodiments, the additional pharmaceutical agent is a pharmaceutical agent useful for treating and/or preventing a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injury. Each additional pharmaceutical agent may be administered at a dose and/or on a time schedule determined for that pharmaceutical agent. The additional pharmaceutical agents may also be administered together with each other and/or with the compound or composition described herein in a single dose or administered separately in different doses. The particular combination to employ in a regimen will take into account compatibility of the compound described herein with the additional pharmaceutical agent(s) and/or the desired therapeutic and/or prophylactic effect to be achieved. In general, it is expected that the additional pharmaceutical agent(s) in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.
[0192] Also encompassed by the disclosure are kits (e.g., pharmaceutical packs). The kits provided may comprise a pharmaceutical composition or compound described herein and a container (e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container). In some embodiments, provided kits may optionally further include a second container comprising a pharmaceutical excipient for dilution or suspension of a pharmaceutical composition or compound described herein. In some embodiments, the pharmaceutical composition or compound described herein provided in the first container and the second container are combined to form one unit dosage form.
[0193] Thus, in one aspect, provided are kits including a first container comprising a compound or pharmaceutical composition described herein. In certain embodiments, the kits are useful for treating a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injury in a subject in need thereof. In certain embodiments, the kits are useful for preventing a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injuryin a subject in need thereof. In certain embodiments, the kits are useful for reducing the risk of developing a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injuryin a subject in need thereof. In certain embodiments, the kits are useful for enhancing the gene expression of KCC2 in a subject or cell.
[0194] In certain embodiments, a kit described herein further includes instructions for using the kit. A kit described herein may also include information as required by a regulatory agency such as the U.S. Food and Drug Administration (FDA). In certain embodiments, the information included in the kits is prescribing information. In certain embodiments, the kits and instructions provide for treating a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injury in a subject in need thereof. In certain embodiments, the kits and instructions provide for preventing a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injury in a subject in need thereof. In certain embodiments, the kits and instructions provide for reducing the risk of developing a disease (e.g., neurological disease or psychiatric disorder) or central nervous system injury a subject in need thereof. In certain embodiments, the kits and instructions provide for enhancing the gene expression of KCC2 in a subject or cell. A kit described herein may include one or more additional pharmaceutical agents described herein as a separate composition.
[0195] The collection of novel and specific KCC2 enhancing chemical compounds identified from the screening method will provide the basis of novel therapies that stimulate KCC2 expression to treat ASD, RTT, neurological diseases, psychiatric disorders, and central nervous system injuries. The screening for increased KCC2 expression in neurons may provide a readout for improved neuronal function through pathways affected by hit compounds. Moreover, increased KCC2 expression itself may have direct therapeutic benefits to ASD, RTT, neurological diseases, psychiatric disorders, and central nervous system injuries. In some aspects, a method of treating a subject comprises diagnosing a subject as having or being at risk of developing a neurologic, psychiatric, or central nervous system disorder and administering a KCC2 expression enhancing compound to the subject.
EXAMPLES
[0196] In order that the invention described herein may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the methods, compositions, and systems provided herein and are not to be construed in any way as limiting their scope.
Example 1. Identification of KCC2 Expression Enhancing Compounds
Results
[0197] The development of a compound screening platform with RTT KCC2-2A-luciferase reporter neurons to identify KCC2 expression enhancing compounds are outlined in
[0198] The RTT KCC2-2A-luciferase reporter neurons were treated with the test compounds from the LINCS kinase inhibitor library and IRSF SMART compound library and incubated before being lysed. The cell lysate was divided into two parts to measure luciferase signal (KCC2 translation) and Cell-Titer Glow (CTG, amount of ATP). The luciferase signal was normalized to CTG for each well, and the Luc/CTG ratio was normalized to the in-plate DMSO negative control to calculate fold change ratio.
[0199] The list of hit compounds identified from the compound screening with RTT KCC2 reporter neurons are given in Table 1.
TABLE-US-00001 TABLE 1 List of hit compounds identified from compound screening with RTT KCC2 reporter neurons. Compound Name Cellular Effect KW-2449 FLT3 inhibitor KIN 001-043 GSK3 inhibitor AR-A014418 GSK3 inhibitor Nipecotic acid GABA reuptake inhibitor Methysticin Neuroprotective, MAOI, NRI Trifluoperazine dihydrochloride Dopamine Antagonist Resveratrol SIRT1 activator Piperine TRPV1 activator Luteolin, Flacitran Monoamine transporter activator 7,8-Dihydroxyflavone TrkB agonist CX-614 , BDP37 Ampakine, Antidepressant
The measure of KCC2 levels in cultured female ESC-derived human RTT neurons after Western blot analysis are shown in
[0200] In addition, CRISPR/Cas9 genome editing technology was utilized to insert a 2A-luciferase reporter gene directly before the stop codon of the endogenous KCC2 locus in human ES cells, thus creating wild type (WT) cells isogenic to the MECP2-null RTT human KCC2 reporter neurons. KCC2 expression reporter human neurons were differentiated from the gene-targeted ES cells and utilized as the substrate for unbiased compound screening (
[0201] Gene-targeted KCC2 reporter cells were used in a HTS pipeline to screen for small molecule compounds that enhance KCC2 gene expression (
TABLE-US-00002 TABLE 2 List of hit compounds identified from compound screening with wild type KCC2 reporter neurons (and certain analogs). B Major Name IUPAC Name Score Class targets 7,8-Dihydroxy- 7,8 -Dihydroxyflavone 4.01 TrkB TrkB flavone agonist 8-methoxy- 8-(Methoxymethyl)-1-methyl-3-(2- 4.8 Phosphodie PDE1 methyl-IBMX methylpropyl)-7H-purine-2,6-dione sterase inhibitor BIO 2H-Indol-2-one, 6-bromo-3-[(3E)-1,3- 3.42 GSK-3α/β GSK3 dihydro-3-(hydroxyimino)-2H-indol- inhibitor 2-ylidene]-1,3-dihydro-, (3Z)- Dovitinib 1-amino-5-fluoro-3-(6-(4- 4.44 RTK FLT3/c- methylpiperazin-1-yl)-1H- inhibitor Kit, benzo[d]imidazol-2-yl)quinolin- FGFR1/3, 2(1H)-one VEGFR1, VEGFR4 Foretinib N1’-[3-fluoro-4-[[6-methoxy-7-(3- 4.05 Kinase c-Met, morpholinopropoxy)-4- inhibitor VEGFR2;F quinolyl]oxy]phenyl]-N1-(4- FLT3 is fluorophenyl)cyclopropane-1,1- also a dicarboxamide target Indirubin (3Z)-3-(3-Oxo-1,3-dihydro-2H-indol- 3.73 N.A. PLK1, 2-ylidene)-1,3-dihydro-2H-indol-2- PIN1, one CDC25B KW-2449 (E)-(4-(2-(lH-indazol-3- 5.45 Multi- FLT3, yl)vinyl)phenyl)(piperazin-1- target ABL, yl)methanone inhibitor ABL- T315I, Aurora kinase Methysticin (2R)-2-[(E)-2-(1,3-Benzodioxol-5- 7.17 MAOI, CYP1A1 yl)ethenyl]-4-methoxy-2,3- NRI dihydropyran-6-one Paliperidone 9-Hydroxyrisperidone 11.03 D2 and Dopamine 5HT2A receptor, receptor 5-HT2A, antagonist a 1/2 adrenergic receptors, H1 histamin- ergic Paxilline (2R,4bS,6aS,12bS,12cR,14aS)- 4.1 Potassium Potassium 5,6,6a,7,12,12b,12c,13,14, channel channels 14a-Decahydro-4b-hydroxy-2-(1- blocker hydroxy-1-methylethyl)- 12b,12c- dimethyl-2H- pyrano[2″,3″:5',6']benz[1',2':6,7] indeno[1,2-b]indol-3(4bH)-one Resveratrol 3,5,4'-trihydroxy-trans-stilbene 12.65 MAOI, Sirtuin1, Anti- PGC-1α oxidant Safinamide (2S)-2-14-103- 4.82 MAOI MAO, fluorophenyl)methoxy]phenyl] Sigma methylamino]propanamide receptor SB-415286 3-[(3-Chloro-4-hydroxyphenyl)- 5.58 GSK-3 GSK-3 amino]-4-(2-nitrophenyl)-1H-pyrrol- inhibitor 2,5-dione SU-4312 3-(4-Dimethyl 3.55 Kinase FLT1, aminobenzylidenyl)-2-indolinone, 3- inhibitor VEGF, [[(4-Dimethyl- PDGF, amino)phenyl] methylene] -1,3- neuronal dihydro-2H-indol-2-one NOS Crenolanib l-(2-{5-[(3-Methyloxetan-3- N/A Kinase FLT3, yl)methoxy]-1H-benzimidazol-1- inhibitor PDGFRα/β yl}quinolin-8-yl)piperidin-4-amine Sunitinib N-[2-(Diethylamino)ethyl]-5-[(Z)-(5- N/A RTK PDGFRs, fluor-1,2-dihydro-2-oxo-3H-indol-3- inhibitor VEGFRs, yliden)-methyl]-2,4-dimethyl-1H- c-KIT pyrrol-3-carboxamid XL184 N-(4-((6,7-Dimethoxyquinolin-4- N/A Kinase c-Met, (Cabozantinib) yl)oxy)phenyl)-N'-(4- inhibitor VEGFR2, fluorophenyl)cyclopropane-1,1- AXL, RET dicarboxamide TWS-119 3-[6-(3-Amino-phenyl)-7H- N/A GSK3 GSK3P pyrrolo[2,3,-d]pyrimidin-4-yloxy]- inhibitor phenol Indirubin- 3-[1,3-dihydro-3-(hydroxyimino)-2H- N/A GSK3 GSK3, monoxiome indol-2-ylidene]-1,3-dihydro-2H- inhibitor CDK1/5 indol-2-one Note: The compounds with the description ‘N/A’ in the B-score field are analog compounds of primary hit compounds identified from screening.
[0202] To validate the KEECs, human neurons derived from WT ES cells (WIBR1 male ES cell line) were treated with KEECs, and conducted Western blot experiments were conducted to measure changes in KCC2 expression. Treatment of cultured WT human neurons with KW-2449, a potent inhibitor of fms-like tyrosine kinase-3 (FLT3) (41), induced a significant increase in KCC2 expression in a dose-dependent manner (
Example 2: KEECs Increase KCC2 mRNA and Protein Expression in Organotypic Brain Slices and Induce Hyperpolarizing Shift in EGABA in Immature Neurons
[0203] The organotypic mouse brain slice preserves the cellular architecture and cell-cell contact environment of the brain and, accordingly, is considered a suitable model system to investigate drug-induced changes in brain-specific gene expression (43). Organotypic brain slices were treated with identified KEECs and analyzed KCC2 protein level by Western blot analysis (
[0204] Brain slices were also treated with the FLT3 inhibitors Crenolanib and XL-184. Both compounds significantly increased the KCC2 protein level as compared to culture medium-only control slices (
[0205] Since treatment with KEECs induces a notable increase in the ratio of KCC2/NKCC1 levels in organotypic brain slices, we investigated whether treatment with KEECs would result in a hyperpolarizing shift in the GABA reversal potential (E.sub.GABA), an indicator of the efficacy of GABAergic inhibition in neurons (45). Previous work reports that mouse neurons cultured for 6-7 days in vitro (DIV6-7) have not undergone the GABA functional switch; thus, E.sub.GABA remains at the depolarized level of about −50 mV (46). E.sub.GABA from DIV6-7 immature mouse neurons treated with KEECs or controls were recorded. The results show that treatment with KEECs KW-2449, XL-184, TWS-119, or BIO, but not the DMSO vehicle nor the inactive compound MeBIO, induce a significant hyperpolarizing shift in the E.sub.GABA in the immature mouse neurons to levels of about −70 mV (
Example 3: Further Screens Identify Additional KEECs
[0206] Additional screens for reporter activation in the MECP2-null RTT human KCC2 reporter neurons (isogenic to the WT reporter cells used above) were performed with the LINCS and SMART libraries as well as the ICCB known bioactive library and identified hits as compounds with B score>3. Most KEECs that enhanced KCC2 expression in WT neurons, including KW-2449, BIO, Resveratrol, also induced a significant increase of KCC2 reporter activity in RTT neurons, as described in Example 1 (
TABLE-US-00003 TABLE 3 List of hit compounds identified from expanded compound screening with RTT KCC2 reporter neurons (and certain analogs) Class/ B Cellular Major Name IUPAC Name Score Effect targets (R)-Baclofen Benzenepropanoic acid 6.65 GAB A.sub.B GAB A.sub.B agonist receptor 7,8- 7,8-Dihydroxyflavone 4.01 TrkB agonist TrkB Dihydroxy- flavone 8- 8-(Methoxymethyl)-1-methyl-3- 4.8 Phospho- PDE1 methoxymethyl- (2-methylpropyl)-7H-purine-2,6- diesterase IBMX dione inhibitor AR-AO14418 N-(4-Methoxybenzyl)-N'-(5- 8.69 GSK3 GSK3 nitro-1,3-thiazol-2-yl)urea inhibitor Ataluren 3-[5-(2-Fluorophenyl)-1,2,4- 7.43 nonsense- CTFR oxadiazol-3-yl]benzoic acid suppressing mutation agent causal for CF BIO (2’Z,3’E)-6-Bromoindirubin-3'- 3.42 GSK-3α/β GSK3α/β oxime inhibitor BMS 777607 N-(4-(2-amino-3-chloropyridin-4- 11.97 Met-related e-Met, yloxy)-3-fluorophenyl)-4-ethoxy- protein kinase Axl, Ron, 1-(4-fluorophenyl)-2-oxo-1,2- inhibitor Tyro3 dihydropyridine-3-carboxamide XL-184 N-(4-(6,7-dimethoxyquinolin-4- 3.25 Kinase FLT3, MET, (Cabozantinib) yloxy)phenyl)-N-(4-fluorophenyl) inhibitor VEGFR, cyclopropane-1,1-dicarboxamide RET, GAS6 receptor (AXL), KIT Daidzein 7-hydroxy-3-(4-hydroxyphenyl)- 4.64 Antioxidant GPER 4H-chromen-4-one Dovitinib 1-amino-5-fluoro-3-(6-(4- 4.44 Multi-target FLT3/c-Kit, methylpiperazin-1-yl)-1H- RTK inhibitor FGFR1/3, benzo[d]imidazol-2-yl)quinolin- VEGFR1-4 2(1H)-one Foretinib N1’-[3-fluoro-4-[[6-methoxy-7- 4.05 Kinase c-Met, (3-morpholinopropoxy)-4- inhibitor VEGFR-2; quinolyl]oxy]phenyl]-N1-(4- FLT3 is also fluorophenyl)cyclopropane-1,1- a target dicarboxamide Genistein 4',5,7-Trihydroxyisoflavone 5.11 Nrf2 + PPAR ERβ, GPER, activator, PPARs, EGFR tyrosine inhibitor kinases, topo- isomerase, AAADs Indirubin (3Z)-3-(3-Oxo-1,3-dihydro-2H- 3.73 Kinase GSK3 indol-2-ylidene)-1,3-dihydro-2H- inhibitor PLK1, indol-2-one PIN1, CDC25B Kaempferol 3,5,7-Trihydroxy-2-(4- 3.92 SIRTI Sirtuin1, hydroxyphenyl)-4H-chromen-4- activator, MAO, one Anti- PGC-1α, depressant ERRα/β KW-2449 (E)-(4-(2-(lH-indazol-3- 5.45 Kinase FLT3, ABL, yl) vinyl)phenyl)(piperazin-1- inhibitor ABL-T315I, yl)methanone Aurora kinase Luteolin 2-(3,4-Dihydroxyphenyl)-5,7- 11.34 Mono NFκB dihydroxy-4-chromenone amine transporter activator Methysticin (2R)-2-[(E)-2-(1,3-Benzodioxol- 7.17 Neuro- CYP1A1 5-yl)ethenyl]-4-methoxy-2,3- protective, dihydropyran-6-one MAOI, NRI OSI-930 3-[(4- quinolinylmethyl)amino]- 5.55 Kinase Kit, KDR, N-[4- (trifluoromethoxy)phenyl] inhibitor CSF-1R, Flt- -2-thiophenecarboxamide 1, c-Raf Lek. PDGFRα/β, Flt-3, Abl Paxilline (2R,4bS,6aS,12bS,12cR,14aS)-4b- 4.1 Potassium Potassium hydroxy-2-(1-hydroxy-1- channel channels methylethyl)-12b,12c-dimethyl-5, blocker 6,6a,7,12,12b,12c,13,14,14a- decahydro-2H-chromeno[5',6': 6,7]indeno[1,2-b]indol-3(4bH)- one Pepstatin Isovalery-Val-Val-Sta-Ala-Sta 8.64 Aspartyl Acidic [Sta = statine = (3S,4S)-4-amino-3- peptidases proteases hydroxy-6-methylheptanoic acid] e.g. pepsin, renin, cathepsin D, bovine chymosin, protease B Piperine (2E,4E)-5-(Benzo[d][1,3]dioxol- 4.69 TRPV1 TRPV1, 5-yl)-1-(piperidin-1-yl)penta-2,4- activator, TRPA1, dien-1-one tyrosine P-Gylco- protein protein, kinases CYP450, inhibitor CYP3A4 Quercetin- 2-(3,4-dihydroxyphenyl)-3,5,7- 7.76 Polar auxin ER a/b, 2H.sub.2O trihydroxy-4H-chromen-4-one transport inhib GPER, itor, phospho- PI3-kinase, di-esterase mitochondria inhibitor 1 ATPase Resveratrol 3,5,4′- 12.65 MAOI, Anti- Sirtuin1, trihydroxy- oxidant PGC-1α trans- stilbene Ro 31-8220 2-{1-[3-(Amidinothio)propyl]- 10.11 Kinase GRK-5, 1H-indol-3-yl}-3-(1-methylindol- inhibitor PKC, 3-yl)maleimide methanesulfonate MAPKAP salt kinase Safinamide (2S)-2-[[4-[(3- 4.82 MAO MAO, fluorophenyl)methoxy]phenyl] inhibitor σ receptor methylamino] propanamide SB-415286 3-[(3-Chloro-4-hydroxyphenyl)- 5.58 GSK-3 GSK-3 amino]-4-(2-nitrophenyl)-1H- inhibitor pyrrol-2,5-dione Splitomycin 1,2-Dihydro-3H-naphtho[2,1- 9.79 N.A Sir2p, b]pyran-3-one HDAC, SIRT1 TWS119 3-[6-(3-Amino-phenyl)-7H- 3.64 GSK-3β GSK-3β pyrrolo[2,3,-d]pyrimidin-4- inhibitor yloxy]-phenol Valinomycin Cyclo- 4.49 Cyclo-dodeca- Biological, (L-Val-D-HyIva-D-Val-L-Lac-)3 depsipeptide artificial lipid [Hylva = a-Hydroxy ionophore 1 membranes isovaleric acid, antibiotic lac = Lactic acid] Valnoctamide 2-ethyl-3-methyl-pentanamide 14.99 Anti- GABA trans- convulsan, amination indirect GABA agonist Crenolanib 1-(2-{5-[(3-Methyloxetan-3- N/A Kinase FLT3, yl)methoxy ]-1H-benzimidazol-1- inhibitor PDGFRα/β yl}quinolin-8-yl)piperidin-4- amine Sunitinib N-[2-(Diethylamino)ethyl]-5- N/A RTK inhibitor PDGFRs, [(Z)-(5-fluor-1,2-dihydro-2-oxo- VEGFRs, c- 3H-indol-3-yliden)-methyl]-2,4- KIT; FLT3 is dimethyl-1H-pyrrol-3-carboxamid also a target XL-184 N-(4-((6,7-Dimethoxyquinolin-4- N/A Kinase c-Met, (Cabozantinib) yl)oxy)phenyl)-N'-(4- inhibitor VEGFR2, fluorophenyl)cyclopropane-1,1- AXL, RET dicarboxamide TWS-119 3-[6-(3-Amino-phenyl)-7H- N/A GSK3 GSK3P pyrrolo[2,3,-d]pyrimidin-4- inhibitor yloxy]-phenol Indirubin 3-[1,3-dihydro-3-(hydroxyimino)- N/A GSK3 GSK3, monoxiome 2H-indol-2-ylidene]-1,3-dihydro- inhibitor CDK1/5 2H-indol-2-one FLT inhibitor-1 2-(3,4-dimethoxybenzamido)-5,6- N/A FLT3 FLT3 (Calbiochem dihydro-4H- inhibitor 343020) cyclopenta[b]thiophene-3- carboxamide Note: The compounds with the description ‘N/A’ in the B-score field are analog compounds of primary hit compounds identified from screening.
[0207] Almost all of the compounds identified in the screens described in Example 1 were also identified as hits in these screens. A number of additional compounds were also identified. As described in Example 1, a significant enhancement of KCC2 expression was detected in human RTT neurons treated with FLT3 kinase inhibitors, including KW-2449 (
Example 4: Further Analysis of KEECs
[0208] To further corroborate the finding that inhibition of the FLT3 or GSK3β pathways lead to increase in KCC2 expression, we have carried out experiments that utilize small interfering RNA (siRNA) to directly silence the expression of target genes were carried out. Transfection of siRNA against the mouse Flt3 or Gskβ gene into immature mouse neurons significantly increase the KCC2 gene expression (
[0209] Two hit compounds Resveratrol and Piperine act on different pathways than the kinase inhibitors, activating the Sirtuin 1 (SIRT1) (49) and the transient receptor potential cation channel subfamily V member 1 (TRPV1) (50) signaling pathways, respectively. A study using a glioblastoma cell line has shown that treatments with Resveratrol activate the SIRT1 pathway, which reduces expression of the neuronal gene repressor NRSF/REST (49), an inhibitor of KCC2 expression (51). When Resveratrol was applied to cultured neurons in the presence of a high concentration of SIRT1 pathway blocker EX-527, the expression of neither KCC2 nor REST was changed as compared to the DMSO control (
Example 5: Rescue of the Morphological and Functional Deficits in RTT Neurons by KEECs
[0210] Previous work demonstrated that a reduction in the expression of KCC2 expression in the RTT neurons leads to a depolarizing shift in E.sub.GABA, which indicates an impairment in GABAergic inhibition (7, 52). Moreover, a reduction in the number or the strength of excitatory glutamatergic synapses in RTT neurons has been observed in postmortem RTT patient brain samples (30), mouse models of RTT (53), and human stem cell-derived RTT neurons (54). Electrophysiology recording was utilized to assess whether KEECs could rescue the deficits in E.sub.GABA and excitatory synaptic transmission of RTT neurons. Results from gramicidin perforated patch recording experiments indicated that the cultured human RTT neurons treated with DMSO has E.sub.GABA values of about −50 mV, which represents a significant depolarizing shift compared to the average value of −70 mV in WT neurons (
Example 6: KEECs Ameliorate Behavioral Deficits in a Mecp2 Mutant Mouse Model of RTT
[0211] We assessed the in vivo efficacy of KEECs by treating RTT disease-related symptoms such as breathing pauses and reduced locomotion (58) in a Mecp2 mutant mouse model of RTT. The results shown in
Discussion
[0212] As described herein, CRISPR/Cas9 gene editing technology was utilized to develop a compound-screening platform that provides a robust and convenient readout of the transcriptional and translational level of KCC2 from its endogenous locus in human neurons. Unbiased chemical screening approaches led to the identification of a group of small molecule KCC2 expression enhancer compounds (KEEC) that significantly increased the KCC2 reporter signal. The ability for KEECs to increase KCC2 expression levels was validated by mRNA and protein quantification performed both in cultured human neurons and organotypic mouse brain slices. Previous data showed that neurons in the RTT brain exhibit reduced KCC2 expression, which led to a depolarizing shift in GABA reversal potential, and impaired excitatory synapse development (7, 54). We demonstrate here that treatment with KEECs significantly increased KCC2 expression, and rescued the deficits in GABA functional switch and excitatory synapse development in RTT neurons to levels equivalent to their isogenic WT control in a KCC2-dependent manner. We also show that KEECs treatment rescues the immaturity in morphological development in RTT neurons. Without wishing to be bound by any theory, this is likely a secondary effect of the enhanced neuronal functional maturation levels. We further show that injection of KW-2449 or Piperine into Mecp2 mutant animal model of RTT ameliorated apnea and lethargy, two disease-related phenotypes of Mecp2 mutant animals associated with impairments in KCC2 expression and GABAergic inhibition (62, 63). The KEECs identified herein suggest a novel strategy for brain disease therapy aimed at restoring the impaired E/I balance in the neural circuitry through enhancement of KCC2 expression. Our target gene-specific reporter approach that robustly detects the transcriptional and translational levels of a therapeutic target gene, KCC2, in neurons allowed us to assess the effects of KEECs on relevant neuronal phenotypes. In cultured RTT neurons, treatment with KEECs KW-2449 and BIO restored the impaired KCC2 expression and rescued deficits in both GABAergic and glutamatergic neurotransmissions. Previous data suggested that disrupted Cl.sup.− homeostasis in the brainstem causes abnormalities in breathing pattern (62) consistent with breathing abnormalities seen in animals carrying a conditional Mecp2 deletion in GABAergic neurons (65). The reduction in locomotion activity observed in the Mecp2 mutant animals has also been attributed to abnormalities in the GABAergic system (63). Therefore, without wishing to be bound by any theory, treatment with the KEECs KW-2449 or Piperine may ameliorate disease phenotypes in Mecp2 mutant animal model of RTT through restoration of the impairments in KCC2 expression and GABAergic inhibition.
[0213] KEECs described herein may, among other things, help to elucidate the molecular mechanisms that regulate KCC2 expression in neurons. A previous study conducted with a glioma cell line showed that KEEC Resveratrol activates the SIRT1 pathway and reduces the level of NRSF/REST (66), a transcription factor that suppresses KCC2 expression (51). Our results demonstrate that Resveratrol increases KCC2 expression by a similar mechanism, which could contribute to the therapeutic benefit of Resveratrol on a number of brain disease conditions (67, 68).
[0214] We also identified a group of GSK3β pathway inhibitors as KEECs. Overactivation of the GSK3β pathway has been reported in a number of brain diseases (69). Thus, our results suggest that GSK3β pathway inhibitors could exert beneficial effects on brain function through stimulating KCC2 expression. Another major KEEC target pathway, the FLT3 kinase signaling, has been investigated as a cancer therapy target (70, 71). Although FLT3 is expressed in the brain (72), drugs that target FLT3 pathway have not been extensively studied as potential treatments for brain diseases. Our results provide what we believe is the first evidence that FLT3 signaling in the brain is critical for the regulation of key neuronal genes such as KCC2.
[0215] As described herein, we investigated the efficacy of KEECs to rescue a number of well-documented cellular and behavior phenotypes of RTT, including impaired GABA functional switch, reductions in excitatory synapse number and strength, immature neuronal morphology (53, 54), as well as an increase in breathing pauses and a decrease in locomotion (83). Impairment in KCC2 expression has been linked to many brain diseases (2, 84) including epilepsy (85-87), schizophrenia (4, 5, 88), brain and spinal cord injury (6, 89), stroke and ammonia toxicity conditions (90-92), as well as the impairments in learning and memory observed in the senile brain (25). Thus, a phenotypically diverse array of brain diseases may benefit from enhancing expression of KCC2 can be of benefit in a phenotypically diverse array of brain diseases.
Materials and Methods
Generation of KCC2-2A-Luciferase Reporter Cell Lines
[0216] Male WT ES colonies #22 (from the WIBR1 hESC line (Lengner, C. J. et al., Cell, 2010, 141, 872-83) and its isogenic RTT ES colony #493 (created by knocking out one exon of MeCP2, resulting in absence of MeCP2 protein) were used for gene targeting. One confluent 6-well plate of ES cells were dissociated with 0.05% trypsin (Gibco, Catalog number: 25300054) for 5 minutes. Cells were rigorously triturated in PBS to achieve single-cell suspension, and filtered through a 40 μm cell strainer to get rid of undissociated ES cell chunks and MEF aggregates. The cells were then spun down, resuspended with 500 μl ice-cold PBS, and mixed with 30 μg DNA constructs (10 μg guide RNA construct, 20 μl targeting template). The sgRNA sequence for CRISPR/Cas9-mediated targeting of the KCC2 locus is: ACCATCTACTCCTGAGAACC. The link between the exon 26 of KCC2 gene and firefly luciferase reporter is a V5-HA-P2A sequence: GGCAAACCGATTCCGAATCCGCTGCTGGGCCTGGATTCCACCTACCCATACGATG TTCCAGATTACGCTgccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggcca (SEQ ID NO: 1, wherein the P2A sequence is shown in lower case. The cell-DNA mix was transferred to an electroporation cuvette (Bio-Rad, Catalog number: 165-2088). A Bio-Rad Gene Pulser Xcell electroporator was used to deliver electroporate DNA constructs into ES cells. The cells were immediately collected (into medium containing ROCK inhibitor) and seeded onto one plate of MEF cells.
[0217] Two days after the electroporation, the cells were dissociated with trypsin and sorted based on the GFP fluorescence (from the PX330 guide RNA backbone). Typically from 3,000 to 10,000 cells were collected from the FACS sorting. The GFP+ single ES cells were seeded into 6-well MEF wells at a density of <5,000 cells per well (typically about 1,000 cells/well). After 10-14 days, individual ES cell colonies emerged. Individual colonies were picked into 12-well plates. Gene-targeted ES colonies were genotyped with PCR, followed by Southern blot analysis to confirm luciferase insertion into the correct genetic locus. Two homozygously targeted colonies (#13, #31) were generated from WT #22 ESC, and one homozygously targeted colony (#35) was generated from RTT #493 ESC.
Culture of Human Embryonic Stem Cell, Neuroprogenitor, and Neurons Embryonic Stem (ES) Cell Culture
[0218] Human female WT ES cells #396 were derived in the Whitehead Institute (WIBR3) and isogenic MeCP2 mutant ES cell lines #913 were generated through TALEN genome-editing (93). Only one of the MeCP2 copy was targeted by TALEN, therefore the mutant clone is heterozygous for MeCP2 mutation. Since the WIBR3 ES cells maintain a stable XaXi state (one active and one inactive X chromosome) in culture, the targeted MeCP2 allele is on the active chromosome while the wild-type allele is on the inactive chromosome, resulting in complete loss of MeCP2 in mutant ES cells and differentiated cells.
[0219] ES cells were maintained on mouse embryonic fibroblast (MEF) feeder cells in hES medium. Once ES cells reached approximately 70% confluence, enzymatic dissociation was performed using collagenase V (Invitrogen, 1 mg/1 ml) for 30 minutes and the cells were split 1:3 onto MEF cells for each passaging.
Neural Progenitor Cell (NPC) Generation
[0220] Human female ES cells (WIBR3) and human male ES cells (WIBR1) were derived in the Whitehead Institute (Lengner, C. J. et al., Cell, 2010). MeCP2 mutant ES cell lines (clone #913) were generated through TALEN genome-editing (93).
[0221] First, on the day before NPC derivation, a 6-well plate coated with growth factor-reduced Matrigel (BD Bioscience, 47743-720) and diluted 1:40 with DMEM. On day 1, the ES cell culture was washed with PBS, and the ES cell colonies were dissociated with 1 mg/ml collagenase V (Life Technologies) for 30 minutes. Next, the ES colonies were collected into a 15 ml Falcon tube. The ES colonies were separated using gravity-sediment method and washed twice with hES medium. Then the ES colonies were digested with 1 ml Accutase for 15 minutes in a 37° C. incubator. A P1000 pipet was used to rigorously triturate the digested ES colonies (approximately 20 times). The fully dissociated hES colonies were resuspended with 10 ml mTeSR medium. Then, the cell suspension was filtered through a 100 μm cell strainer to acquire single cell suspension. Next, the cells were counted with Countess automated cell counter (Invitrogen). Two million cells were seeded into one well in a six-well plate coated with Matrigel and Rock Inhibitor was added to the ES cell suspension to reduce cell death. On day 2, the culture medium was changed with mTeSR. This was performed on a daily basis after seeding. On day 3 and after, the cell density was monitored after plating. Once the cells were fully confluent, the mTeSR medium was changed gradually (¼ volume increment per day) into NPC medium with 2 μM Dorsormorphin (Stemgent, Cat #: 04-0024). Next, when NPC Rosettes were apparent (usually 4-7 days after switching to NPC medium), NPC cultures were passaged with Accutase and with the addition of rock inhibitor to reduce cell death. The cells were split 1:2 onto Matrigel-coated plates. Then, when the NPC cells were stably expanding, the Dorsomorphin was removed from the NPC medium. Next, 20 ng/ml of human recombinant FGF2 (Life Technologies, PHG0263) was added to promote NPC self-renewal and maintain multipotency. Two to three rounds of expansion/passaging yielded sufficient amount of cells for conducting experiments and establishing frozen stock. Once NP cells reached confluence, the number of cells seeded per well (6-well plate) was 10-15 million.
Neuronal Differentiation
[0222] On day 1, two confluent wells were dissociated from the 6-well plate that contained a total of approximately 20 million NPC cells with Accutase for 15 minutes at 37° C. The cells were spun down at 750 rpm for 5 minutes and resuspended with neuronal medium by gentle trituration. Next the cell suspension was filtered through a 100 μm mesh to get rid of clumps. The resulting single-cell suspension was cell-counted using a Countess apparatus (Invitrogen Countess Automated Cell Counter, Catalog no. C10227) and resuspended with Neuronal medium to reach a density of 1 million cells/ml. The number of neurons that can be obtained from a T75 flask is roughly 20 million. The dissociated NP cells were plated with 20 ml neuronal medium into a T75 flask coated with Matrigel. On day 2, the culture medium was completely changed with neuronal medium. On day 3 through day 30, the neuronal medium was changed fully on weekly basis (or when medium seemed acidified).
Screening Setup
[0223] #35 RTT KCC2 reporter ESC is generated by targeting the KCC2 locus of #493 RTT ESC generated by knocking out MECP2 gene in the WIBR1 ESC line (93) to insert a 2A-luciferase reporter. #35 ESC that has both KCC2 alleles targeted with luciferase reporter were differentiated into #35 NPC, then #35 RTT KCC2 reporter neurons. The cells were dissociated with Accutase and resuspended in 10 ml neuronal differentiation medium to count cells. The cells were then diluted to the final density of 200,000 to 500,000 cells/ml. Matrigel was added to the cell suspension at a dilution ratio of 1:300 to promote cell adhesion after plating. AraC was added to cell suspension at the concentration of 2 μM to inhibit cell division. The cells were plated into 96-well plates with an automated cell seeding machine using the following protocol: The neuron flask was washed with PBS. The neurons were digested off the plate with Accutase for 30 minutes at 37° C. Next, the dissociated cells were collected and spun down at 750 rpm for 5 minutes. The cell pellet was dissociated by gentle trituration with P1000 pipet and the cells were resuspended with 10 ml of neuronal medium. Then, the cells were filtered through a 40 μm cell strainer (Falcon) to get rid of clumps. The resulting single-cell suspension was counted using a Countess automated cell counter (Invitrogen Countess Automated Cell Counter, Catalog no. C10227). The neurons were resuspended with neuronal medium to 10× of the destination density (100,000 cells to 400,000 cells per ml). The cells were plated with a multichannel pipette, or proceeded to the machine-plating protocol described below:
[0224] For the machine-plating protocol, the plating machine (Multidrop 384, Labsystems) tubings were washed 2× with 70% EtOH. Then, the plating machine tubings were washed 2× with PBS. Next, the plating machine was used to dispense 100 μl cell solution/well to the destination areas in 96-well plates. A typical cell seeding area consisted of a total of 6 rows, 11 columns, which required a 6.6 ml cell suspension per plate.
[0225] The day after cell seeding, small molecule compounds from the IRSF (International Rett Syndrome Foundation) library were prepared at a concentration of 1 mM and dispensed into a blank V-bottomed test plates at 2 μl per well. Compound solvent DMSO was included in every plate as control. Using a liquid handling robot, about 80 μl of culture medium were discarded. Neuronal medium in the volume of 200 μl was added to the V-bottom test plate that contained 2 μl of 1 mM compounds, and mixed with compounds by pipetting up-and-down 3 times. The medium that contained the 10 μM compounds was then applied to the neuronal cell culture and incubated for 2 weeks before cell lysis and luciferase assay were performed.
[0226] A method to seed neurons in 100 μl medium on the first day was also tested successfully. On the second day, the compounds were dissolved at 5× concentration in neuronal culture medium, then 25 μl of compound-containing medium was added to the original medium to reach 1× compound concentration to treat cells.
[0227] For some screens, human WT (clone #13 or #31) or RTT (clone #35) KCC2 reporter neurons were differentiated in T75 flasks for 4 weeks from NPC with the method similar to previously described protocol (93). The cells were dissociated with Accutase, resuspended in 10 ml neuronal differentiation medium to count cells. the final cell seeding density was 20k-40k cells per well for 96-well plates, and ˜10k cells per well for 384-well plates. Matrigel was added to the cell suspension at a dilution ratio of 1:300 to promote cell adhesion after plating. AraC were added to the cell suspension at the concentration of 0.5 μM to inhibit astroglial cell division. The cells were dispensed into 96-well or 384-well plates (Corning) using a BioTek EL406 plate dispenser. One day after neuronal cell seeding, small molecule compounds from the IRSF library, ICCB known bioactive library (Enzo, Cat #BML-2840), or LINCS kinase inhibitor libraries were added to the cells at the final concentrations of 10 μM, 10 μM, and 0.5 μM, respectively, using a V&P pin transfer tool mounted on the MCA96 head of a Tecan Freedom Evo 150 liquid handling robot. The neurons were incubated with the compounds at 37° C./5% CO2 for a week before the luciferase assay.
Luciferase Assay
[0228] The cells used for luciferase assay were KCC2 reporter neurons differentiated for 4 weeks, and treated with drug in 96-well format for 2 weeks. Cell density was between 20k-40k cells per well.
[0229] On the day of the luciferase assay, the cells were washed with PBS for two times, and 100 μl of cell lysis buffer was applied to the washed cells. The cell plates were transferred to a rocker to shake for 10 minutes in order to fully lyse the cells. A liquid-handling robot was used to transfer 30 μl of lysate to a different blank white plate for Cell Titer Glo (CTG) reading. First, the cells were washed twice with PBS. Then, the cells were lysed for 10 minutes at room temperature with 100 ul 1× passive lysis buffer (Promega, E1941, 1:5 diluted with water). Then, 30 ul of lysate was transferred to a copy plate for CTG reading. Next, 20 ul of the luciferase assay buffer (Promega, E1501, diluted with provided buffer) was injected to the original plate which has 70 ul lysate, and the luciferase signal was read immediately on a Thermo Fischer Fluoroskan Ascent plate reader. Finally, 70 ul of diluted CTG buffer (Promega, G7572, 2:5 diluted with water) was added to a copy plate with 30 ul of lysate and incubated for 10 minutes before the CTG signal was read.
[0230] A Thermo-Fischer Ascent Luminoskan plate reader was used to read luciferase luminescence. An injection volume of 20 μl was chosen because dose-response experiment showed that 20 μl was already sufficient to elicit maximal response in a luciferase activity. For each well, 1 second after the luciferase reagent injection, the luminescence signals were integrated for 1 second. For the CTG reading, the CTG reaction agent was diluted with water 2:5, and a volume of 70 μl was injected to 30 μl of cell lysate. CTG assay plates were put on a rocker for 10 minutes and then read with the Luminoskan plate reader with the integration time of 100 ms. The luciferase signals were normalized to the CTG signal as control and the data was normalized to the in-plate DMSO control.
[0231] For some screens, on the day of the luciferase assay, the cells were washed with PBS three times using a BioTek EL406 plate washer. Cell lysis buffer (Promega, E1941, 1:5 diluted with water) was added at a volume of 100 μl per well for 96-well plates and 30 μl per well for 384-well plates, and incubated at room temperature for 10 minutes to lyse the cells. A fraction of the cell lysate (30 ul for 96-well, 5 ul for 384-well) was transferred to a new white, opaque plate and Cell Titer-Glo (CTG, Promega, G7572, diluted 2:5 in water) was added and incubated for 20 minutes at room temperature. CTG measures cellular ATP levels as a surrogate for cell viability. The reporter luciferase signal was assayed in the original source plate using Bright-Glo reagent per the manufacturer's protocol (Promega, E1501, 10 ul for 96-well plates, 3 ul for 384-well plates). Assay readouts were performed on a Tecan M1000 Infinite plate reader. For data analysis, the luciferase signal was normalized to the CTG signal to control for number of live cells per well. The Luc/CTG ratio data were then normalized to the in-plate DMSO control to calculate the signal induction fold change. Screening data were processed with CellHTS2 software package to calculate B-score (94)
Brain Slice Culture and Drug Treatment
[0232] Brain slice cultures were prepared from P1 neonatal mouse according to a protocol described by Antonio del Rio et al., Nature Protocols, 2010. Cerebrum slices (1 mm in thickness) were prepared from neonatal mouse brain, and were transferred to 6-well culture inserts with the pore size of 0.4 μm. The insert was placed in 6-well plates with 1 ml of culture medium. Three days after the initial culture, compounds and DMSO control were added to the medium. Alternately, in some experiments, brain slice cultures were prepared from P3 neonatal mouse according to a protocol described by Antonio del Rio et al., Nature Protocols, 2010. Cerebrum slices (1 mm in thickness) were prepared from neonatal mouse brain, and were transferred to 6-well culture inserts with the pore size of 0.4 μm. The insert was placed in 6-well plates with 1 ml of culture medium. The day after the initial culture, compounds and DMSO control were added to the medium. The medium with fresh compounds was used to replace old medium every other day. One week after drug treatment, the brain slices were harvested for Western blot or qRT-PCR analysis.
Western Blot
[0233] Protein samples were collected from cultured brain slices or cultured neurons in 12-well format with RIPA lysis buffer (in mM: 150 NaCl, 25 Tris-HCl, 1 EDTA, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, with protein kinase inhibitor and protease inhibitor, pH adjusted to 7.6). A sonication step was applied to homogenize tissue and extract protein, followed by a 10 minute centrifugation at 4° C. The protein samples were mixed with NuPAGE LDS sample buffer, heated at 95° C. for 10 minutes, and then separated on NuPAGE 4-12% Bis-Tris gel and transferred to PVDF membrane. The PVDF membrane was blocked for 30 minutes with 5% milk in TBS+0.1% Tween 20 (TBST), and incubated overnight at 4° C. with primary antibodies diluted in TBST-milk at the following concentrations: KCC2 (1:2000, Millipore), NKCC1 (1:1000, Iowa Hybridoma bank), α-Tubulin (1:4000, Abcam), GAPDH (1:3000, Abcam), Actin (1:2000, Sigma Aldrich #A2066). The membrane was rinsed with TBST three times to wash off excess antibodies, and then incubated in secondary HRP antibodies in TBST-milk at 1:5000 concentration.
[0234] Chemiluminescence method (HRP substrate, Millipore) detected clear KCC2 protein monomer (˜120 kDa) and dimer (>200 kDa) bands. The PVDF membrane was then stripped using the Re-blot plus strong solution (Millipore), and re-immunoblotted for NKCC1 (˜150 kDa) to acquire KCC2/NKCC1 ratio. The area and intensity of protein signal was determined using ImageJ. The relative KCC2 and NKCC1 expression were calculated by normalizing protein signal to GAPDH or Tubulin loading control. Both monomeric and dimeric KCC2 bands were detected in P20 WT and gKO mouse brain, and were combined together while quantifying KCC2 expression. KCC2 expression during early development (P8) remained low and the KCC2 dimer band was faint. Hence, only the monomer band was quantified.
Quantitative RT-PCR Analysis
[0235] To prepare RNA samples from cultured organotypic brain slice, tissue samples were homogenized by passing through a 23 gauge needle for a number of times. Total RNA was extracted with Omega Total RNA kit and was reverse-transcribed into cDNA using the Invitrogen Superscript RT system and Oligo dT primer. SYBR green-based quantitative RT-PCR assay was performed to detect for the abundance of specific mRNA transcripts. The primer sequence for the detection of KCC2 expression in mouse brain samples are as follows: KCC2-Forward: CCGTGCCTGCAGAACATCTTTGGTGT (SEQ ID NO: 2); KCC2-Reverse: GCCACCAGCAGGCACAACACCATTGG (SEQ ID NO: 3). The primer sequence for detection of NKCC1 mRNA are as follows: NKCC1-Forward: GGCACCAAGGATGTGGTAGT (SEQ ID NO: 3); NKCC1-Reverse: TTGCAGTCTTGCCATCCTCT (SEQ ID NO: 4). The gene expression was calculated by normalizing the KCC2 data with the expression of housekeeping gene HDAC2 in every sample. HDAC2 expression was detected using the following primers: HDAC2-Forward: CTTTCCTGGAACAGGAGACTTGAGGG (SEQ ID NO: 5); HDAC2-Reverse: GGCTGGTACATCTCCATCACTTTTGAG (SEQ ID NO: 6). Relative gene expression levels were calculated by normalizing KCC2 or NKCC1 expression in drug-treated groups with that in DMSO controls with the housekeeping gene HDAC being used as internal control.
siRNA and Plasmid Transfection
[0236] Two different siRNA preparations were ordered per gene from Thermo Fischer with the following catalog numbers: mouse Flt3 (158581, 158583), mouse Gsk3β (185671, 185673), human FLT3 (s5290, s5291), human GSK3β (VHS40271, VHS40279). For the DIV2 mouse neuron or 1-month human RTT neurons cultured in 12-well plates, 20 nMol of siRNA were transfected per well with Lipofectamine RNAiMAX transfection reagent (13778030, Life Technologies). Six days later, protein samples were harvested from transfected cells.
[0237] RTT neurons that under KW-2449 or BIO treatment were co-transfected with GFP and a KCC2 shRNA construct (7) with a modified calcium-phosphate transfection method (96). GFP positive neurons that has the KCC2 level knocked down were recorded 6-8 days after transfection.
Neuronal Morphology Analysis
[0238] Cultured 2-month RTT neurons were treated with DMSO, KW-2449, BIO, or MeBIO for 1-2 weeks and subjected to PFA fixation and immunostaing with a MAP2 antibody (1:800, Encor). Fluorescent images of randomly-selected neurons were acquired on a Nikon Eclipse Ti epifluorescence microscope equipped with 20× lens. Nucleus size analysis of DAPI-stained neuronal nucleus were performed with ImageJ. Sholl analysis and measurements of the total neurite length and branch points were performed with the Simple Neurite Tracer plugin of the ImageJ software. Morphological analyses were carried out with about 60 randomly-selected neurons per treatment group. Image acquisition and analysis were carried out by different researchers, and automated analysis software pipeline were utilized to reduce human bias.
Electrophysiology
[0239] Functionally mature human neuron cultures were obtained by seeding female human WT or isogenic RTT NPCs on a layer of primary mouse astrocyte culture as previously described (57). In the cultured WT human neurons, KCC2 expression reaches mature level between 2-3 months (7). We therefore treated the WT or RTT human neurons 8-12 weeks in culture, with compounds for a duration of two weeks before conducting whole-cell patch-clamp recording. The extracellular bath solution, that perfused the recording chamber, consists of (in mM): 120 NaCl, 30 glucose, 25 HEPES, 5 KCl, 2 CaCl.sub.2), 1 MgCl.sub.2. The pH was adjusted to 7.3 with NaOH. The high-chloride internal pipette solution consists of (in mM): 147 KCl, 5 Na-phosphocreatine, 2 EGTA, 10 HEPES, 4 MgATP, and 0.5 Na.sub.2GTP; the pH 7.3 was adjusted with KOH. To record mini EPSC, the membrane potential was held at −70 mV, and 0.5 μM of TTX and 50 μM Picrotoxin were applied with bath solution to block action potential and GABAergic synaptic transmission.
[0240] In order to estimate GABA.sub.A receptor reversal potential, Gramicidin perforated patch recordings were performed as described previously (7). Briefly, Gramicidin (G5002, Sigma) was diluted with high-chloride internal pipette solution to a final concentration of 50 μg/ml to perforate the membrane in a cell-attached recording configuration. If the cell membrane is ruptured during the perforation process, high-chloride pipette solution will immediately replace the cytosol and the E.sub.GABA will depolarize to ˜+10 mV that is out of the physiological range. Membrane-ruptured neurons and the neurons that failed to perforate (access resistance >30 MΩ after 15 min of perforation) were excluded from the experiment.
[0241] To evoke GABA response, a pipette filled with 100 μM GABA solution was positioned 5-10 μm away from the neuronal cell body. Air pulses at the pressure of 10 p.s.i. and duration of 100 ms were generated with a Picrospritzer (Parker Instrumentation) to puff GABA solution onto neuronal cell body. Neuronal response to GABA puffs were recorded at different membrane holding potentials from −90 mV to +30 mV, and the E.sub.GABA values were calculated with linear regression. Electrophysiological signals were recorded with Multiclamp 700A patch-clamp amplifier and data were collected with Clamp 9 software (Molecular Devices, Palo Alto, Calif.), sampled at 10 kHz and filtered at 1 kHz. Off-line data analyses of mEPSC synaptic events were performed with MiniAnalysis software (Synaptosoft, Decator, Ga.). All experiments were performed at room temperature. A sample size of 5-8 neurons was used for E.sub.GABA measurements, while a sample size of 14-19 neurons was used for mEPSC measurements. All data were presented as mean±SEM. ANOVA test followed by the Bonferroni correction were used for statistical analysis. The Kolmogorov-Smirnov test was employed to compare the cumulative distribution between two datasets.
Animal Behavior Experiments
[0242] Male Mecp2 mutant mice (Mecp2′, e.g. the Bird model) between 4-12 weeks of age were used for the in vivo experiments. Subjects were divided into drug treated KO (Piperine/KW-2449), and vehicle treated KO (EtOH/DMSO) groups. Animals were randomly assigned to treatment arms with approximately equivalent numbers in each group.
[0243] KW-2449 stock solution was prepared at 10 mg/ml with DMSO, and Piperine stock solution at 30 mg/ml with EtOH. 20 μl of stock solution were diluted with 1 ml saline for injection. Daily drug treatments or sham injections were performed on both groups between P28 and P56, for at least two weeks, as Mecp2 mutant mice start to show symptoms around P28 and die around P60. Both following tests were performed on both groups of mice before the injections start, and repeated at the end of the injection period. The animals' performance was then compared before and after drug/vehicle injections.
[0244] A full body plethysmograph chamber (EMKA Inc, PA) was used to measure breathing patterns. The subject was first familiarized with the chamber for 20 minutes before the pre-injection test. For each test, the subject was left in the chamber for 20 minutes, afterwards its breath pattern was recorded for the next 20 minutes, and the estimated amplitude modulation index (eAMI) was calculated from the breath trace to label breath pauses automatically. Only breath pauses longer than 1 second were used to calculate the average breath pause per minute at the time points before and after drug treatment.
[0245] To measure the subjects' nighttime locomotion, a 1-D infrared light-beam frame (ActiMot, TSE-systems, MO) was used. Animals were single-housed in new cages with the same setup as their home cages. The infrared monitor was set up for each cage and the beam crossings was recorded between 17:00 and 9:00 the next morning, where the lights were turned off between 19:00 and 7:00. The average beam crossing frequency during the night (21:00-5:00) was used as the subject's activity score, and the average beam crossing frequency after lights on (7:00-9:00) was used as the subject's day time activity score. The time periods where the mouse is stationary for >5 minutes are discarded to reduce artifact caused by the mouse sleeping. As we look at both day-time and night-time locomotion, a bonferroni correction with repeated comparison number of 2 was applied. All behavioral analyses were performed by experimenters who were blind to the treatment condition.
REFERENCES
[0246] 1. M. R. Kelley, T. Z. Deeb, N. J. Brandon, J. Dunlop, P. A. Davies, S. J. Moss, Compromising KCC2 transporter activity enhances the development of continuous seizure activity. Neuropharmacology 108, 103-110 (2016). [0247] 2. K. T. Kahle, A. R. Khanna, J. Duan, K. J. Staley, E. Delpire, A. Poduri, The KCC2 Cotransporter and Human Epilepsy: Getting Excited About Inhibition. Neuroscientist 22, 555-562 (2016). [0248] 3. K. T. Kahle, N. D. Merner, P. Friedel, L. Silayeva, B. Liang, A. Khanna, Y. Shang, P. Lachance-Touchette, C. Bourassa, A. Levert, P. A. Dion, B. Walcott, D. Spiegelman, A. Dionne-Laporte, A. Hodgkinson, P. Awadalla, H. Nikbakht, J. Majewski, P. Cossette, T. Z. Deeb, S. J. Moss, I. Medina, G. A. Rouleau, Genetically encoded impairment of neuronal KCC2 cotransporter function in human idiopathic generalized epilepsy. EMBO Rep 15, 766-774 (2014). [0249] 4. T. M. Hyde, B. K. Lipska, T. Ali, S. V. Mathew, A. J. Law, O. E. Metitiri, R. E. Straub, T. Ye, C. Colantuoni, M. M. Herman, L. B. Bigelow, D. R. Weinberger, J. E. Kleinman, Expression of GABA signaling molecules KCC2, NKCC1, and GAD1 in cortical development and schizophrenia. J Neurosci 31, 11088-11095 (2011). [0250] 5. D. Arion, D. A. Lewis, Altered expression of regulators of the cortical chloride transporters NKCC1 and KCC2 in schizophrenia. Arch Gen Psychiatry 68, 21-31 (2011). [0251] 6. P. Boulenguez, S. Liabeuf, R. Bos, H. Bras, C. Jean-Xavier, C. Brocard, A. Stil, P. Darbon, D. Cattaert, E. Delpire, M. Marsala, L. Vinay, Down-regulation of the potassium-chloride cotransporter KCC2 contributes to spasticity after spinal cord injury. Nat Med 16, 302-307 (2010). [0252] 7. X. Tang, J. Kim, L. Zhou, E. Wengert, L. Zhang, Z. Wu, C. Carromeu, A. R. Muotri, M. C. Marchetto, F. H. Gage, G. Chen, KCC2 rescues functional deficits in human neurons derived from patients with Rett syndrome. Proc Natl Acad Sci USA 113, 751-756 (2016). [0253] 8. A. Banerjee, R. V. Rikhye, V. Breton-Provencher, X. Tang, C. Li, K. Li, C. A. Runyan, Z. Fu, R. Jaenisch, M. Sur, Jointly reduced inhibition and excitation underlies circuit-wide changes in cortical processing in Rett syndrome. Proceedings of the National Academy of Sciences 113, 7287 (2016). [0254] 9. D. G. Glaze, A. K. Percy, S. Skinner, K. J. Motil, J. L. Neul, J. O. Barrish, J. B. Lane, S. P. Geerts, F. Annese, J. Graham, L. McNair, H. S. Lee, Epilepsy and the natural history of Rett syndrome. Neurology 74, 909-912 (2010). [0255] 10. S. N. Pandis D, Seizures in Alzheimer disease: clinical and epidemiological data. Epilepsy Curr September; 12(5):184-7, (2012). [0256] 11. O. Yizhar, L. E. Fenno, M. Prigge, F. Schneider, T. J. Davidson, D. J. O'Shea, V. S. Sohal, I. Goshen, J. Finkelstein, J. T. Paz, K. Stehfest, R. Fudim, C. Ramakrishnan, J. R. Huguenard, P. Hegemann, K. Deisseroth, Neocortical excitation/inhibition balance in information processing and social dysfunction. Nature 477, 171-178 (2011). [0257] 12. O. Marin, Interneuron dysfunction in psychiatric disorders. Nat Rev Neurosci 13, 107-120 (2012). [0258] 13. C. E. Robertson, E. M. Ratai, N. Kanwisher, Reduced GABAergic Action in the Autistic Brain. Curr Biol 26, 80-85 (2016). [0259] 14. B. Zikopoulos, H. Barbas, Altered neural connectivity in excitatory and inhibitory cortical circuits in autism. Front Hum Neurosci 7, 609 (2013). [0260] 15. W. L. Henderson C, Kinoshita M N, Shumway M, Hammond R S, Postma F R, Brynczka C, Rush R, Thomas A, Paylor R, Warren S T, Vanderklish P W, Kind P C, Carpenter R L, Bear M F, Healy A M., Reversal of disease-related pathologies in the fragile X mouse model by selective activation of GABAB receptors with arbaclofen. Sci Transl Med. 2012 Sep. 19; 4(152), (2012). [0261] 16. A. A. Till S M, Jackson A D, Katsanevaki D, Barnes S A, Osterweil E K, Bear M F, Chattarji S, Wood E R, Wyllie D J, Kind P C., Conserved hippocampal cellular pathophysiology but distinct behavioural deficits in a new rat model of FXS. Hum Mol Genet. November 1; 24(21):5977-84, (2015). [0262] 17. Q. He, T. Nomura, J. Xu, A. Contractor, The developmental switch in GABA polarity is delayed in fragile X mice. European Journal of Neuroscience 34, 446-450 (2014). [0263] 18. V. S. Dani, Q. Chang, A. Maffei, G. G. Turrigiano, R. Jaenisch, S. B. Nelson, Reduced cortical activity due to a shift in the balance between excitation and inhibition in a mouse model of Rett syndrome. Proc Natl Acad Sci USA 102, 12560-12565 (2005). [0264] 19. Y. Ben-Ari, J. L. Gaiarsa, R. Tyzio, R. Khazipov, GABA: a pioneer transmitter that excites immature neurons and generates primitive oscillations. Physiol Rev 87, 1215-1284 (2007). [0265] 20. K. Kaila, T. J. Price, J. A. Payne, M. Puskarjov, J. Voipio, Cation-chloride cotransporters in neuronal development, plasticity and disease. Nat Rev Neurosci 15, 637-654 (2014). [0266] 21. H. Li, S. Khirug, C. Cai, A. Ludwig, P. Blaesse, J. Kolikova, R. Afzalov, S. K. Coleman, S. Lauri, M. S. Airaksinen, K. Keinanen, L. Khiroug, M. Saarma, K. Kaila, C. Rivera, KCC2 interacts with the dendritic cytoskeleton to promote spine development. Neuron 56, 1019-1033 (2007). [0267] 22. M. Puskarjov, P. Seja, S. E. Heron, T. C. Williams, F. Ahmad, X. Iona, K. L. Oliver, B. E. Grinton, L. Vutskits, I. E. Scheffer, S. Petrou, P. Blaesse, L. M. Dibbens, S. F. Berkovic, K. Kaila, A variant of KCC2 from patients with febrile seizures impairs neuronal Cl— extrusion and dendritic spine formation. EMBO Rep 15, 723-729 (2014). [0268] 23. G. Gauvain, I. Chamma, Q. Chevy, C. Cabezas, T. Irinopoulou, N. Bodrug, M. Carnaud, S. Levi, J. C. Poncer, The neuronal K—Cl cotransporter KCC2 influences postsynaptic AMPA receptor content and lateral diffusion in dendritic spines. Proc Natl Acad Sci USA 108, 15474-15479 (2011). [0269] 24. S. P. Janssen, M. Truin, M. Van Kleef, E. A. Joosten, Differential GABAergic disinhibition during the development of painful peripheral neuropathy. Neuroscience 184, 183-194 (2011). [0270] 25. I. Ferando, G. C. Faas, I. Mody, Diminished KCC2 confounds synapse specificity of LTP during senescence. Nat Neurosci 19, 1197-1200 (2016). [0271] 26. M. L. Horvath P M, MeCP2 as an Activator of Gene Expression. Trends Neurosci. February; 41(2):72-74, (2018). [0272] 27. M. Chahrour, S. Y. Jung, C. Shaw, X. Zhou, S. T. Wong, J. Qin, H. Y. Zoghbi, MeCP2, a key contributor to neurological disease, activates and represses transcription. Science 320, 1224-1229 (2008). [0273] 28. S. J. Williams J R, Kumari V G, Wilson M, Payne J A., The neuron-specific K—Cl cotransporter, KCC2. Antibody development and initial characterization of the protein. J Biol Chem April 30; 274(18): 12656-12664 (1999). [0274] 29. Delpire E, Lu J, England R, Dull C, T. T., Deafness and imbalance associated with inactivation of the secretory Na—K-2Cl co-transporter. Nat Genet., (1999). [0275] 30. C. A. Chapleau, G. D. Calfa, M. C. Lane, A. J. Albertson, J. L. Larimore, S. Kudo, D. L. Armstrong, A. K. Percy, L. Pozzo-Miller, Dendritic spine pathologies in hippocampal pyramidal neurons from Rett syndrome brain and after expression of Rett-associated MECP2 mutations. Neurobiol Dis 35, 219-233 (2009). [0276] 31. M. Phillips, L. Pozzo-Miller, Dendritic spine dysgenesis in autism related disorders. Neurosci Lett 601, 30-40 (2015). [0277] 32. P. Penzes, M. E. Cahill, K. A. Jones, J. E. VanLeeuwen, K. M. Woolfrey, Dendritic spine pathology in neuropsychiatric disorders. Nat Neurosci 14, 285-293 (2011). [0278] 33. E. Delpire, E. Days, L. M. Lewis, D. Mi, K. Kim, C. W. Lindsley, C. D. Weaver, Small-molecule screen identifies inhibitors of the neuronal K—Cl cotransporter KCC2. Proc Natl Acad Sci USA 106, 5383-5388 (2009). [0279] 34. D. Zhang, S. M. Gopalakrishnan, G. Freiberg, C. S. Surowy, A thallium transport FLIPR-based assay for the identification of KCC2-positive modulators. J Biomol Screen 15, 177-184 (2010). [0280] 35. E. Delpire, C. D. Weaver, Challenges of Finding Novel Drugs Targeting the K—Cl Cotransporter. ACS Chem Neurosci 7, 1624-1627 (2016). [0281] 36. I. Chamma, Q. Chevy, J. C. Poncer, S. Levi, Role of the neuronal K—Cl co-transporter KCC2 in inhibitory and excitatory neurotransmission. Front Cell Neurosci 6, 5 (2012). [0282] 37. V. S. Dani, S. B. Nelson, Intact long-term potentiation but reduced connectivity between neocortical layer 5 pyramidal neurons in a mouse model of Rett syndrome. J Neurosci 29, 11263-11270 (2009). [0283] 38. E. T. K. Lisa M. Monteggia, Rett Syndrome and the Impact of MeCP2 Associated Transcriptional Mechanisms on Neurotransmission. Biol Psychiatry. February 1; 65(3): 204-210., (2009). [0284] 39. E. D. Nelson, E. T. Kavalali, L. M. Monteggia, MeCP2-dependent transcriptional repression regulates excitatory neurotransmission. Curr Biol 16, 710-716 (2006). [0285] 40. W. C. Szymczak A L, Wang Y, Vignali K M, Dilioglou S, Vanin E F, Vignali D A., Correction of multi-gene deficiency in vivo using a single ‘self-cleaving’ 2A peptide-based retroviral vector. Nat Biotechnol. May; 22(5):589-94, (2004). [0286] 41. K. W. Pratz, J. Cortes, G. J. Roboz, N. Rao, O. Arowojolu, A. Stine, Y. Shiotsu, A. Shudo, S. Akinaga, D. Small, J. E. Karp, M. Levis, A pharmacodynamic study of the FLT3 inhibitor KW-2449 yields insight into the basis for clinical response. Blood 113, 3938-3946 (2009). [0287] 42. M. P. Polychronopoulos P, Skaltsounis A L, Myrianthopoulos V, Mikros E, Tarricone A, Musacchio A, Roe S M, Pearl L, Leost M, Greengard P, Meijer L., Structural basis for the synthesis of indirubins as potent and selective inhibitors of glycogen synthase kinase-3 and cyclin-dependent kinases. J Med Chem. February 12; 47(4):935-46., (2004). [0288] 43. P. J. Lein, C. D. Barnhart, I. N. Pessah, Acute hippocampal slice preparation and hippocampal slice cultures. Methods Mol Biol 758, 115-134 (2011). [0289] 44. J. Yamada, A. Okabe, H. Toyoda, W. Kilb, H. J. Luhmann, A. Fukuda, Cl— uptake promoting depolarizing GABA actions in immature rat neocortical neurones is mediated by NKCC1. J Physiol 557, 829-841 (2004). [0290] 45. A. Munoz, P. Mendez, J. DeFelipe, F. J. Alvarez-Leefmans, Cation-chloride cotransporters and GABA-ergic innervation in the human epileptic hippocampus. Epilepsia 48, 663-673 (2007). [0291] 46. T. P. Q. Chen G, van den Pol A N, Excitatory actions of GABA in developing rat hypothalamic neurones. The Journal of Physiology 10.1113/jphysiol.1996.sp021505, (1996). [0292] 47. N. M. F. R. G. GOGLIOTTI, B. J. STANSLEY, C. K. JONES, C. W. LINDSLEY, P. J. CONN, C. M., Total RNA-sequencing of Rett syndrome autopsy samples to facilitate preclinical target identification. Society for Neuroscience Annual Conference 2017 Session 450—Advances in Understanding Rett Syndrome Pathophysiology, (2017). [0293] 48. S. T. Duarte, J. Armstrong, A. Roche, C. Ortez, A. Perez, M. O'Callaghan Mdel, A. Pereira, F. Sanmarti, A. Ormazabal, R. Artuch, M. Pineda, A. Garcia-Cazorla, Abnormal expression of cerebrospinal fluid cation chloride cotransporters in patients with Rett syndrome. PLoS One 8, e68851 (2013). [0294] 49. N. Guida, G. Laudati, S. Anzilotti, A. Secondo, P. Montuori, G. Di Renzo, L. M. Canzoniero, L. Formisano, Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death. Toxicol Appl Pharmacol 288, 387-398 (2015). [0295] 50. I. Nagy, D. Friston, J. S. Valente, J. V. T. Perez, A. P. Andreou, Pharmacology of the Capsaicin Receptor, Transient Receptor Potential Vanilloid Type-1 Ion Channel. 39-76 (2014). [0296] 51. M. Yeo, K. Berglund, G. Augustine, W. Liedtke, Novel repression of Kcc2 transcription by REST-RE-1 controls developmental switch in neuronal chloride. J Neurosci 29, 14652-14662 (2009). [0297] 52. Banerjee A, Rikhye R V, B.-P. V, Tang X, Li C, Li K, Runyan C A, Fu Z, Jaenisch R, S. M, Jointly reduced inhibition and excitation underlies circuit-wide changes in cortical processing in Rett Syndrome. Proc Natl Acad Sci USA., (2016). [0298] 53. H. T. Chao, H. Y. Zoghbi, C. Rosenmund, MeCP2 controls excitatory synaptic strength by regulating glutamatergic synapse number. Neuron 56, 58-65 (2007). [0299] 54. M. C. Marchetto, C. Carromeu, A. Acab, D. Yu, G. W. Yeo, Y. Mu, G. Chen, F. H. Gage, A. R. Muotri, A model for neural development and treatment of Rett syndrome using human induced pluripotent stem cells. Cell 143, 527-539 (2010). [0300] 55. W. H. Li Y, Muffat J, Cheng A W, Orlando D A, Lovén J, Kwok S M, Feldman D A, Bateup H S, Gao Q, Hockemeyer D, Mitalipova M, Lewis C A, Vander Heiden M G, Sur M, Young R A, Jaenisch R., Global Transcriptional and Translational Repression in Human-Embryonic-Stem-Cell-Derived Rett Syndrome Neurons. Cell Stem Cell, 446-458 (2013). [0301] 56. M. V. Nguyen, F. Du, C. A. Felice, X. Shan, A. Nigam, G. Mandel, J. K. Robinson, N. Ballas, MeCP2 is critical for maintaining mature neuronal networks and global brain anatomy during late stages of postnatal brain development and in the mature adult brain. J Neurosci 32, 10021-10034 (2012). [0302] 57. X. Tang, L. Zhou, A. M. Wagner, M. C. Marchetto, A. R. Muotri, F. H. Gage, G. Chen, Astroglial cells regulate the developmental timeline of human neurons differentiated from induced pluripotent stem cells. Stem Cell Res 11, 743-757 (2013). [0303] 58. K. A. Julu P O, Apartopoulos F, Al-Rawas S, Engerström I W, Engerström L, Jamal G A, Hansen S., Characterisation of breathing and associated central autonomic dysfunction in the Rett disorder. Arch Dis Child. July; 85(1):29-37., (2001). [0304] 59. S. Li, C. Wang, M. Wang, W. Li, K. Matsumoto, Y. Tang, Antidepressant like effects of piperine in chronic mild stress treated mice and its possible mechanisms. Life Sci 80, 1373-1381 (2007). [0305] 60. B. Pragnya, J. S. Kameshwari, B. Veeresh, Ameliorating effect of piperine on behavioral abnormalities and oxidative markers in sodium valproate induced autism in BALB/C mice. Behav Brain Res 270, 86-94 (2014). [0306] 61. J. Castro, R. I. Garcia, S. Kwok, A. Banerjee, J. Petravicz, J. Woodson, N. Mellios, D. Tropea, M. Sur, Functional recovery with recombinant human IGF1 treatment in a mouse model of Rett Syndrome. Proc Natl Acad Sci USA 111, 9941-9946 (2014). [0307] 62. K. Ikeda, H. Onimaru, J. Yamada, K. Inoue, S. Ueno, T. Onaka, H. Toyoda, A. Arata, T. O. Ishikawa, M. M. Taketo, A. Fukuda, K. Kawakami, Malfunction of respiratory-related neuronal activity in Na+, K+-ATPase alpha2 subunit-deficient mice is attributable to abnormal Cl— homeostasis in brainstem neurons. J Neurosci 24, 10693-10701 (2004). [0308] 63. H. L. K Ure, W Wang, A Ito-Ishida, Z Wu, L He, Restoration of Mecp2 expression in GABAergic neurons is sufficient to rescue multiple disease features in a mouse model of Rett syndrome. eLife, (2016). [0309] 64. M. Gagnon, M. J. Bergeron, G. Lavertu, A. Castonguay, S. Tripathy, R. P. Bonin, J. Perez-Sanchez, D. Boudreau, B. Wang, L. Dumas, I. Valade, K. Bachand, M. Jacob-Wagner, C. Tardif, I. Kianicka, P. Isenring, G. Attardo, J. A. Coull, Y. De Koninck, Chloride extrusion enhancers as novel therapeutics for neurological diseases. Nat Med 19, 1524-1528 (2013). [0310] 65. H. T. Chao, H. Chen, R. C. Samaco, M. Xue, M. Chahrour, J. Yoo, J. L. Neul, S. Gong, H. C. Lu, N. Heintz, M. Ekker, J. L. Rubenstein, J. L. Noebels, C. Rosenmund, H. Y. Zoghbi, Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes. Nature 468, 263-269 (2010). [0311] 66. L. G. Guida N, Anzilotti S, Secondo A, Montuori P, Di Renzo G, Canzoniero L M, Formisano L., Resveratrol via sirtuin-1 downregulates RE1-silencing transcription factor (REST) expression preventing PCB-95-induced neuronal cell death. Toxicol Appl Pharmacol., (2015). [0312] 67. J. A. Baur, D. A. Sinclair, Therapeutic potential of resveratrol: the in vivo evidence. Nat Rev Drug Discov 5, 493-506 (2006). [0313] 68. J. Gambini, M. Ingles, G. Olaso, R. Lopez-Grueso, V. Bonet-Costa, L. Gimeno-Mallench, C. Mas-Bargues, K. M. Abdelaziz, M. C. Gomez-Cabrera, J. Vina, C. Borras, Properties of Resveratrol: In Vitro and In Vivo Studies about Metabolism, Bioavailability, and Biological Effects in Animal Models and Humans. Oxid Med Cell Longev 2015, 837042 (2015). [0314] 69. P. C. S. Frame, The renaissance of GSK3. Nature Reviews Molecular Cell Biology 2, 769-776 (October 2001)|(2001). [0315] 70. H. Konig, M. Levis, Targeting FLT3 to treat leukemia. Expert Opin Ther Targets 19, 37-54 (2015). [0316] 71. A. T. Fathi, Y. B. Chen, The role of FLT3 inhibitors in the treatment of FLT3-mutated acute myeloid leukemia. Eur J Haematol 98, 330-336 (2017). [0317] 72. C. Y. Brazel, M. H. Ducceschi, B. Pytowski, S. W. Levison, The FLT3 tyrosine kinase receptor inhibits neural stem/progenitor cell proliferation and collaborates with NGF to promote neuronal survival. Mol Cell Neurosci 18, 381-393 (2001). [0318] 73. Y. Ben-Ari, NKCC1 Chloride Importer Antagonists Attenuate Many Neurological and Psychiatric Disorders. Trends in Neurosciences 40, p 536-554 (2017). [0319] 74. R. Tyzio, R. Nardou, D. C. Ferrari, T. Tsintsadze, A. Shahrokhi, S. Eftekhari, I. Khalilov, V. Tsintsadze, C. Brouchoud, G. Chazal, E. Lemonnier, N. Lozovaya, N. Burnashev, Y. Ben-Ari, Oxytocin-mediated GABA inhibition during delivery attenuates autism pathogenesis in rodent offspring. Science 343, 675-679 (2014). [0320] 75. G. Deidda, M. Parrini, S. Naskar, I. F. Bozarth, A. Contestabile, L. Cancedda, Reversing excitatory GABAAR signaling restores synaptic plasticity and memory in a mouse model of Down syndrome. Nat Med 21, 318-326 (2015). [0321] 76. E. Lemonnier, C. Degrez, M. Phelep, R. Tyzio, F. Josse, M. Grandgeorge, N. Hadjikhani, Y. Ben-Ari, A randomised controlled trial of bumetanide in the treatment of autism in children. Transl Psychiatry 2, e202 (2012). [0322] 77. E. Lemonnier, G. Robin, C. Degrez, R. Tyzio, M. Grandgeorge, Y. Ben-Ari, Treating Fragile X syndrome with the diuretic bumetanide: a case report. Acta Paediatr 102, e288-290 (2013). [0323] 78. L. D. Hubner C A, Hermans-Borgmeyer I., Expression of the Na—K-2Cl-cotransporter NKCC1 during mouse development. Mech Dev. April; 102(1-2):267-9., (2001). [0324] 79. S. C. Gore M E, Porta C, Bracarda S, Bjarnason G A, Oudard S, Lee S H, Haanen J, Castellano D, Vrdoljak E, Schöffski P, Mainwaring P, Hawkins R E, Crinò L, Kim T M, Carteni G, Eberhardt W E, Zhang K, Fly K, Matczak E, Lechuga M J, Hariharan S, Bukowski R., Final results from the large sunitinib global expanded-access trial in metastatic renal cell carcinoma. Br J Cancer June 30; 113(1):12-9., (2015). [0325] 80. M. A. Eldar-Finkelman H, GSK-3 Inhibitors: Preclinical and Clinical Focus on CNS. Front Mol Neurosci. 2011 Oct. 31; 4:32., (2011). [0326] 81. H. M. Panahi Y, Khalili N, Naimi E, Majeed M, Sahebkar A, Antioxidant and anti-inflammatory effects of curcuminoid-piperine combination in subjects with metabolic syndrome: A randomized controlled trial and an updated meta-analysis. Clin Nutr. December; 34(6):1101-8., (2015). [0327] 82. T. R. Turner R S, Craft S, van Dyck C H, Mintzer J, Reynolds B A, Brewer J B, Rissman R A, Raman R, Aisen P S; Alzheimer's Disease Cooperative Study., A randomized, double-blind, placebo-controlled trial of resveratrol for Alzheimer disease. Neurology. October 20; 85(16):1383-91, (2015). [0328] 83. D. T. Lioy, S. K. Garg, C. E. Monaghan, J. Raber, K. D. Foust, B. K. Kaspar, P. G. Hirrlinger, F. Kirchhoff, J. M. Bissonnette, N. Ballas, G. Mandel, A role for glia in the progression of Rett's syndrome. Nature 475, 497-500 (2011). [0329] 84. E. Delpire, K. T. Kahle, The KCC3 cotransporter as a therapeutic target for peripheral neuropathy. Expert Opin Ther Targets 21, 113-116 (2017). [0330] 85. P. B. M Kobayashi, Reduced inhibition of dentate granule cells in a model of temporal lobe epilepsy. Journal of Neuroscience, (2003). [0331] 86. X. Jin, J. R. Huguenard, D. A. Prince, Impaired Cl— extrusion in layer V pyramidal neurons of chronically injured epileptogenic neocortex. J Neurophysiol 93, 2117-2126 (2005). [0332] 87. E. Palma, M. Amici, F. Sobrero, G. Spinelli, S. Di Angelantonio, D. Ragozzino, A. Mascia, C. Scoppetta, V. Esposito, R. Miledi, F. Eusebi, Anomalous levels of Cl— transporters in the hippocampal subiculum from temporal lobe epilepsy patients make GABA excitatory. Proc Natl Acad Sci USA 103, 8465-8468 (2006). [0333] 88. R. Tao, C. Li, E. N. Newburn, T. Ye, B. K. Lipska, M. M. Herman, D. R. Weinberger, J. E. Kleinman, T. M. Hyde, Transcript-specific associations of SLC12A5 (KCC2) in human prefrontal cortex with development, schizophrenia, and affective disorders. J Neurosci 32, 5216-5222 (2012). [0334] 89. E. P. S. David P. Bonislawski, Akiva S. Cohen, Brain injury impairs dentate gyrus inhibitory efficacy. Neurobiol Dis., (2006). [0335] 90. N. Jaenisch, O. W. Witte, C. Frahm, Downregulation of potassium chloride cotransporter KCC2 after transient focal cerebral ischemia. Stroke 41, e151-159 (2010). [0336] 91. M. A. Martin-Aragon Baudel, A. V. Poole, M. G. Darlison, Chloride co-transporters as possible therapeutic targets for stroke. J Neurochem 140, 195-209 (2017). [0337] 92. T. A. Rangroo Thrane V, Wang F, Cotrina M L, Smith N A, Chen M, Xu Q, Kang N, Fujita T, Nagelhus E A, Nedergaard M., Ammonia triggers neuronal disinhibition and seizures by impairing astrocyte potassium buffering. Nat Med. December; 19(12):1643-8, (2013). [0338] 93. Y. Li, H. Wang, J. Muffat, A. W. Cheng, D. A. Orlando, J. Loven, S. M. Kwok, D. A. Feldman, H. S. Bateup, Q. Gao, D. Hockemeyer, M. Mitalipova, C. A. Lewis, M. G. Vander Heiden, M. Sur, R. A. Young, R. Jaenisch, Global transcriptional and translational repression in human-embryonic-stem-cell-derived Rett syndrome neurons. Cell Stem Cell 13, 446-458 (2013). [0339] 94. G. M. Pelz O, Boutros M., web cellHTS2: a web-application for the analysis of high-throughput screening data. BMC Bioinformatics 2010 Apr. 12; 11:185., (2010). [0340] 95. J. A. del Rio, E. Soriano, Regenerating cortical connections in a dish: the entorhino-hippocampal organotypic slice co-culture as tool for pharmacological screening of molecules promoting axon regeneration. Nat Protoc 5, 217-226 (2010). [0341] 96. C. G. Jiang M, High Ca2+-phosphate transfection efficiency in low-density neuronal cultures. Nature Protocol 1(2): 695-700. (2006).
EQUIVALENTS AND SCOPE
[0342] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
[0343] Furthermore, the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements and/or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and/or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms “comprising” and “containing” are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub-range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0344] This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.
[0345] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.