METHODS FOR MOBILISING POPULATIONS OF STEM CELLS

Abstract

The invention provides a method for mobilising haematopoietic stem and progenitor cells (HSPC) and/or mesenchymal stem cells (MSC) in a subject, the method comprising administering a selective beta-3 adrenergic receptor (AR) agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject.

Claims

1. A method for mobilising haematopoietic stem and progenitor cells (HSPC) and/or mesenchymal stem cells (MSC) in a subject, the method comprising administering a selective beta-3 adrenergic receptor (AR) agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject.

2. A method for mobilising HSPCs and/or MSCs in a subject, the method comprising administering an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject, wherein the subject is one who is administered a selective beta-3 AR agonist.

3. A method for mobilising HSPCs and/or MSCs in a subject, the method comprising administering a selective beta-3 AR agonist to the subject, wherein the subject is one who is administered an inhibitor of the CXCR4/CXCL12 chemokine axis.

4. A selective beta-3 AR agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis, for use in mobilising HSPCs and/or MSCs in a subject.

5. Use of a selective beta-3 AR agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis, in the manufacture of a medicament for mobilising HSPCs and/or MSCs in a subject.

6. A method for mobilising mesenchymal stem cells (MSC) in a subject, the method comprising administering a beta adrenergic receptor (AR) agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject.

7. A method for mobilising mesenchymal stem cells (MSC) in a subject, the method comprising administering a beta AR agonist to the subject, wherein the subject is one who is administered an inhibitor of the CXCR4/CXCL12 chemokine axis.

8. A method for mobilising mesenchymal stem cells (MSC) in a subject, the method comprising administering an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject, wherein the subject is one who is administered a beta AR agonist.

9. A method for mobilising haematopoietic stem and progenitor cells (HSPC) and/or mesenchymal stem cells (MSC) in a subject, the method comprising administering a beta adrenergic receptor (AR) agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject, wherein a beta AR agonist is administered before the inhibitor of the CXCR4/CXCL12 chemokine axis.

10. A method for priming HSPCs and/or MSCs in a subject for mobilisation, the method comprising administering a beta AR agonist to the subject, wherein when the method is for priming HSPCs the beta AR agonist is a selective beta-3 AR agonist.

11. A method or use according to any of the preceding claims, wherein the HSPCs and/or MSCs are mobilised from the bone marrow of the subject.

12. A method or use according to any of the preceding claims, wherein the beta AR agonist is administered chronically to the subject.

13. A method or use according to claim 12, wherein the beta AR agonist is administered at regular intervals over a period of at least one day.

14. A method or use according to any of the preceding claims, wherein the inhibitor of the CXCR4/CXCL12 chemokine axis is administered acutely to the subject.

15. A method or use according to any of the preceding claims, wherein the beta AR agonist is administered at regular intervals over a period of at least one day before the inhibitor of the CXCR4/CXCL12 chemokine axis is administered acutely to the subject, optionally wherein the beta AR agonist is a beta-3 AR agonist.

16. A method or use according to any of the preceding claims, wherein the method or use is for harvesting HSPCs and/or MSCs.

17. A method of obtaining a population of HSPCs and/or MSCs from a subject, the method comprising administering a beta adrenergic receptor (AR) agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject so as to mobilise the HSPCs and/or MSCs from the bone marrow to the peripheral blood of the subject, and harvesting the mobilised HSPCs and/or MSCs from the peripheral blood; wherein when the method is for obtaining a population of HSPCs, the beta AR agonist is a selective beta-3 AR agonist.

18. A method of obtaining a population of MSCs from a subject, the method comprising administering a beta adrenergic receptor (AR) agonist to the subject, and harvesting the MSCs from the bone marrow.

19. A method or use according to any of claims 16-18, wherein the harvested HSPCs and/or MSCs are cultivated in vitro.

20. A method or use according to claim 19, wherein the cultivated cells are administered back to the subject or to another subject.

21. A method or use according to any of claims 17-19, wherein the cultivated cells are genetically modified.

22. A method or use according to any of claims 16-21, wherein the harvested cells are stored in a cell bank.

23. A method or use according to any of claims 19-21, wherein the cultivated cells are targeted to damaged tissue in the recipient subject, optionally wherein the damaged tissue is damaged by any one or more of ischaemia, stroke, myocardial infarction, radiotherapy, chemotherapy, auto-immune disease or physical injury.

24. A method for repairing damaged blood vessels, for tissue regeneration, for treating myocardial infarction, stroke, heart disease, peripheral ischaemia, for treating diabetes, autoimmune disease (eg liver cirrhosis, rheumatoid arthritis, sclerederma, graft versus host disease, rejection of organ allografts), systemic lupus erythematosus, multiple sclerosis, cystic fibrosis or other respiratory disease, for immunosuppression, for treating physical injuries (eg sports injuries) or for the healing of chronic wounds, the method comprising the step of administering a population of HSPCs and/or MSCs that has been mobilised and harvested from a subject according to the method of any of claims 17-19, and optionally administering a further therapeutic agent, to a subject.

25. A population of HSPCs and/or MSCs that has been mobilised and harvested from a subject according to the method of any of claims 17-19, and optionally a further therapeutic agent, for use in repairing damaged blood vessels, tissue regeneration, treating myocardial infarction, treating stroke, treating heart disease, treating peripheral ischaemia, treating diabetes, treating autoimmune disease (eg liver cirrhosis, rheumatoid arthritis, sclerederma, graft versus host disease, rejection of organ allografts), treating systemic lupus erythematosus, treating multiple sclerosis, treating cystic fibrosis or other respiratory disease, treating immunosuppression, treating physical injuries (eg sports injuries) or in the healing of chronic wounds; optionally wherein the beta AR agonist is a selective beta AR agonist.

26. Use of a population of HSPCs and/or MSCs that has been mobilised and harvested from a subject according to the method of any of claims 17-19, and optionally a further therapeutic agent, in the manufacture of a medicament for repairing damaged blood vessels, tissue regeneration, treating myocardial infarction, treating stroke, treating heart disease, treating peripheral ischaemia, treating diabetes, treating autoimmune disease (eg liver cirrhosis, rheumatoid arthritis, sclerederma, graft versus host disease, rejection of organ allografts), treating systemic lupus erythematosus, treating multiple sclerosis, treating cystic fibrosis or other respiratory disease, treating immunosuppression, treating physical injuries (eg sports injuries) or for the healing of chronic wounds.

27. A beta AR agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis, and optionally a further therapeutic agent, for use in repairing damaged blood vessels, tissue regeneration, treating myocardial infarction, treating stroke, treating heart disease, treating peripheral ischaemia, treating diabetes, treating autoimmune disease (eg liver cirrhosis, rheumatoid arthritis, sclerederma, graft versus host disease, rejection of organ allografts), treating systemic lupus erythematosus, treating multiple sclerosis, treating cystic fibrosis or other respiratory disease, treating immunosuppression, treating physical injuries (eg sports injuries) or for the healing of chronic wounds, optionally wherein the beta AR agonist is a selective beta-3 AR agonist.

28. Use of a beta AR agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis, and optionally a further therapeutic agent, in the manufacture of a medicament for repairing damaged blood vessels, tissue regeneration, treating myocardial infarction, treating stroke, treating heart disease, treating peripheral ischaemia, treating diabetes, treating autoimmune disease (eg liver cirrhosis, rheumatoid arthritis, sclerederma, graft versus host disease, rejection of organ allografts), treating systemic lupus erythematosus, treating multiple sclerosis, treating cystic fibrosis or other respiratory disease, treating immunosuppression, treating physical injuries (eg sports injuries) or for the healing of chronic wounds, optionally wherein the beta AR agonist is a selective beta-3 AR agonist.

29. A method for repairing damaged blood vessels, for tissue regeneration, for treating myocardial infarction, stroke, heart disease, peripheral ischaemia, for treating diabetes, autoimmune disease (eg liver cirrhosis, rheumatoid arthritis, sclerederma, graft versus host disease, rejection of organ allografts), systemic lupus erythematosus, multiple sclerosis, cystic fibrosis or other respiratory disease, for immunosuppression, for treating physical injuries (eg sports injuries) or for the healing of chronic wounds, the method comprising the step of administering a beta AR agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis, and optionally a further therapeutic agent, to a subject, optionally wherein the beta AR agonist is a selective beta-3 AR agonist.

30. A use according to claim 27 or 28, or a method according to claim 29, wherein administration of the beta AR agonist and an inhibitor of the CXCR4/CXCL12 chemokine axis mobilises HSPCs and/or MSCs in the subject.

31. A population of HSPCs and/or MSCs isolated from a subject, wherein the subject has been administered a beta AR agonist and optionally an inhibitor of the CXCR4/CXCL12 chemokine axis, optionally wherein the beta AR agonist is a selective beta-3 AR agonist.

32. A kit of parts comprising (i) a selective beta-3 AR agonist and (ii) an inhibitor of the CXCR4/CXCL12 chemokine axis.

33. A method for stimulating proliferation of MSCs, the method comprising contacting the MSCs with a beta AR agonist.

34. A method according to claim 33, wherein the beta AR agonist is a selective beta-3 AR agonist.

35. A method according to claim 34 or 35, wherein the method is performed in vivo or in vitro.

36. A method according to claim 35, wherein the method is performed in vitro and the cells are cultivated in vitro.

37. A method according to any of claims 1-3, 6-24, 29-30, and 33-36, a use according to any of claims 4, 5, 11-16, 19-23, and 25-28 and 30, a population of HSPCs and/or MSCs according to claim 31, and a kit of parts according to claim 32, wherein the beta AR agonist is a selective beta-3 AR agonist such as any of BRL37344; Mirabegron; CL316243; L-742,791; L-796,568; LY-368,842; Mirabegron (YM-178); Ro40-2148; Solabegron (GW-427,353); Betanis (Astellas); Betmiga (Astellas); Myrbetriq (Astellas); TT-138 (Mitsubishi Tanabe Pharma); GS-332 (Mitsubishi Tanabe Pharma); MN-246 (Mitsubishi Tanabe Pharma); FMP-1970302 (Molecular Design); and 4SC (4sc discovery).

38. A method according to any of claims 6-24, 29-30, and 33-36, a use according to any of claims 4, 5, 11-16, 19-23, 25-28 and 30, a population of HSPCs and/or MSCs according to claim 31, and a kit of parts according to claim 32, wherein the beta AR agonist is a general beta AR agonist such as any of isoproterenol, epinephrine and norepinephrine.

39. A method according to any of claims 1-3, 6-24, 29-30, and 33-38, a use according to any of claims 4, 5, 11-16, 19-23, 25-28, 30, 37 and 38, a population of HSPCs and/or MSCs according to any of claims 31, 37 and 38, and a kit of parts according to any of claims 32, 37 and 38, wherein the inhibitor of the CXCR4/CXCL12 chemokine axis is a an agent that reduces the synthesis or function of CXCL12.

40. A method according to any of claims 1-3, 6-24, 29-30, and 33-38, a use according to any of claims 4, 5, 11-16, 19-23, 25-28, 30, and 37-39, a population of HSPCs and/or MSCs according to any of claims 31, and 37-39, and a kit of parts according to any of claims 32 and 37-39, wherein the inhibitor of the CXCR4/CXCL12 chemokine axis is a an antagonist of CXCR4.

41. A method, use, population, kit of parts or composition according to claim 40, wherein the antagonist of CXCR4 is AMD3100 or KRH3955.

42. A method or use for mobilising HSPCs and/or MSCs, according to any of claims 1-29 and 33-40 wherein the method or use further comprises administering a COX inhibitor (eg Naproxen, Aspirin) and/or a Free Fatty Acid Hydrolyse (FFAH) inhibitor (eg URB597) to the subject.

43. A method of identifying an inhibitor of the CXCR4/CXCL12 chemokine axis in a subject, wherein the method comprises the steps of: (i) administering a beta AR agonist to the subject; (ii) administering a test agent to the subject; and (iii) assessing the amount of HSPCs and/or MSCs in a sample from the subject.

44. A method of identifying an agonist of the beta AR receptor in a subject, wherein the method comprises the steps of: (i) administering a test agent to the subject (ii) administering an inhibitor of the CXCR4/CXCL12 chemokine axis to the subject; and (iii) assessing the amount of HSPCs and/or MSCs in a sample from the subject.

Description

[0099] The invention will now be described in more detail by reference to the following Figures and Examples.

[0100] FIG. 1. βAR Activation Primes Progenitor Cells for Mobilization

[0101] (A) Experimental design for 2 hours (2 h) of pretreatment (PT). Mice were pretreated with isoproterenol (ISO) or vehicle (VEH) followed 1 hour later by the administration of AMD3100 or VEH. (B) Experimental design for 4 days (4 d) of PT. Mice were pretreated once daily for 4 days with ISO or VEH. 1 hour after the last injection, mice were administered AMD3100 or VEH. In both treatment regimens, 1 hour after AMD3100 or VEH injection blood was collected for analysis of circulating (C) CFU-HPCs and (D) CFU-Fs. CFU-HPCs and CFU-Fs are shown as colonies per ml of blood. n=8 mice per group. Data represented as mean±SEM. ***p<0.001 (one-way ANOVA).

[0102] FIG. 2. β3AR Activation Primes Progenitor Cells for Mobilization

[0103] Mice were pretreated (PT) with isoproterenol (ISO), clenbuterol (β2), BRL 37344 (β3) or vehicle (VEH) once daily for 4 days. 1 hour after the last injection, mice were administered AMD3100 or VEH and 1 hour later blood was collected for analysis of circulating (A) CFU-HPCs, (B) CFU-Fs and (C) total white blood cells (WBCs). CFU-HPCs and CFU-Fs are shown as colonies per ml of blood. n=4-12 mice per group. Data represented as mean±SEM. ***p<0.001 (one-way ANOVA). See also FIG. 8.

[0104] FIG. 3. Characterization of Mobilized CFU-Fs

[0105] Mice were pretreated with BRL 37344 (β3) once daily for 4 days. 1 hour after the last injection, mice were administered AMD3100 and 1 hour later blood was collected for analysis of circulating CFU-Fs. (A) Panel shows light microscopy of a representative CFU-F. (B) Histograms of surface marker expression on culture-expanded CFU-F cells as determined by flow cytometry. Shaded histograms represent marker expression and open dashed-line histograms represent fluorescence minus one (FMO) controls. (C) Panel shows representative trilineage differentiation staining of FACS sorted CD45.sup.− culture-expanded CFU-Fs into osteocytes (Alizarin Red S), adipocytes (Oil Red) and chondrocytes (Alcian Bleu). (D) Histological analysis (H/E staining) showing In vivo bone formation (black arrows) of transplanted CD45− population with hydroxyapatite/tricalcium phosphate implants in mice.

[0106] FIG. 4. Inhibition of Lipolysis Abrogates the Mobilization of Progenitor Cells in Response to β3-AR Activation

[0107] Mice were pretreated (PT) with BRL 37344 (β3) or vehicle (VEH) in the presence or absence of orlistat (ORL) (FIG. 1B) once daily for 4 days. 1 hour after the last injection, mice were administered AMD3100 or VEH and 1 hour later blood was collected for analysis of circulating (A) free fatty acids (FFAs) (B) CFU-HPCs and (C) CFU-Fs. FFAs are shown as μM and CFU-HPCs and CFU-Fs are shown as colonies per ml of blood. n=4-12 mice per group. Data represented as mean±SEM. *p<0.05, **p<0.01, ***p<0.001 (one-way ANOVA). See also FIG. 9.

[0108] FIG. 5. β3-AR agonists Stimulate Generation of Lipid Mediators in the Bone Marrow that Prime Progenitor cells via Cannabinoid Receptors

[0109] Mice were pretreated (PT) with BRL 37344 (β3) or vehicle (VEH) in the presence or absence of AM251, AM630 CB1 and CB2 antagonists (ANT) respectively or URB597 a FAAH inhibitor as indicated once daily for 4 days. 1 hour after the last injection, mice were administered AMD3100 or VEH and 1 hour later blood was collected for analysis of circulating (A) CFU-HPCs and (B) CFU-Fs. CFU-HPCs and CFU-Fs are shown as colonies per ml of blood. n=8-20 mice per group. In the next experiments, mice were pretreated with URB597 in the presence or absence of BRL 37344 once daily for 4 days. 2 hours after the last injection, bone marrow was collected for (C) lipid mediator quantification by UPLC/ESI-MS/MSC. Representative graphs shown (n=18-21 with bone marrow of 3 mice pooled together). (D) Real-time qRT-PCR of relative mRNA expression of ADRB2, ADRB3, CNR1 and CNR2 in bone marrow HSPCs, neutrophils (PMN), monocytes (Mono), macrophages (Mφ), MSPCs and subcutaneous adipose tissue (AD). Data are shown relative to the lowermost expressing sample for each gene. ND=Not detectable. (E-F) Mice were pretreated with URB 597, BRL 37344 or VEH once daily for 4 days as indicated. 1 hour after the last injection, mice underwent perfusion of the right hind limb. The hind limb was infused with AMD3100 or VEH for 10 minutes and further perfused for 50 minutes while collecting the perfusate for analysis of (E) CFU-HPCs and (F) CFU-Fs. CFU-HPCs and CFU-Fs are shown per ml perfusate (n=4-6). Data represented as mean±SEM. (A,B) *p<0.05, **p<0.01, ***p<0.001 (one-way ANOVA). (C,E,F)***p<0.001 (unpaired student t-test). See also FIG. 10.

[0110] FIG. 6. Cannabinoid Receptor Signalling is Required but not Sufficient for Priming Progenitor Cells for MobilizationExperimental design (A). Mice were pretreated (PT) with URB597, ACEA (CB1), GP1a (CB2), BRL 37344 (β3) or vehicle (VEH) once daily on 3 consecutive days (3 d). On the fourth day, mice were either treated with BRL 37344 (β3) or VEH. 1 hour after last injection, mice were administered AMD3100 or VEH, and 60 minutes later blood was collected via cardiac puncture for enumeration of circulating CFU-HPCs (A) and CFU-Fs (B). CFU-HPCs and CFU-Fs are shown per ml of blood (n=6-10 mice per group). Data represented as mean±SEM. *p<0.05, **p<0.01, ***p<0.001 (one-way ANOVA).

[0111] FIG. 7. β3-AR Activation and Cannabinoid Signalling Induces an Increase in Bone Marrow-derived CFU-Fs in vitro and in vivo.

[0112] (A) Mice were pretreated with BRL 37344 (β3), G-CSF or vehicle (VEH) once daily on 4 consecutive days. 2 hours after the final BRL 37344 injection or 24 hours after the final G-CSF injection, bone marrow was collected for quantification of CXCL12 levels (n=16 and n=6-8, respectively). (B) Bone marrow cells were collected from naïve mice and were treated in vitro with clenbuterol (β2), BRL 37344 (β3) or vehicle (VEH). CFU-Fs per 10.sup.6 cells are shown (n=6 mice per group). (C) Mice were pre-treated with AM 251, AM 630, BRL 37344 (β3) or vehicle (VEH) once daily on 4 consecutive days. 2 hours after the last injection, bone marrow cells were collected for enumeration of CFU-Fs. CFU-Fs per 10.sup.6 cells are shown (n=6-8 mice per group). (D) CB.sub.1 receptor antagonist AM 251 (CB1.sub.l, CB.sub.2 receptor antagonist AM 630 (CB2.sub.l, BRL 37344 (β3) or vehicle. Data represented as mean±SEM. (A) **p<0.01 (unpaired student t-test) and (B-D) *p<0.05, **p<0.01, ***p<0.001 (one-way ANOVA).

[0113] FIG. 8. P3AR Activation Regulates the Mobilization of Progenitor cells; dose-response and cel kinetics

[0114] Mice were pretreated once daily for 4 days with BRL 37344 (β3) (0-10 mg/ml as indicated) or vehicle (VEH). One hour after the last injection, mice were administered AMD3100 or VEH and one hour later blood was collected for analysis of circulating (A) CFU-HPCs and (B) CFU-Fs. Mice were pretreated either one hour (2 h) or once daily for 4 days (4 d) with BRL 37344 (β3) or vehicle (VEH). One hour after the last injection, mice were administered AMD3100 or VEH and one hour later blood was collected for analysis of circulating (C) CFU-HPCs and (D) CFU-Fs. (A-D) CFU-HPCs and CFU-Fs are shown as colonies per ml blood. (A-B) n=3-8 mice per group. (C-D) n=12 mice per group. Data are means±SEM. *p<0.05, **p<0.01, ***p<0.001 (one-way ANOVA). See also FIG. 2.

[0115] FIG. 9. Inhibition of Cyclooxygenase (COX) Enzyme Enhances Mobilization of Progenitor cells by β3AR Activation

[0116] Mice were pretreated with Naproxen (NAP), BRL 37344 (β3) or vehicle (VEH) once daily for 4 days. One hour after the last injection, mice were administered AMD3100 or VEH and one hour later blood was collected for analysis of circulating (A) CFU-HPCs and (B) CFU-Fs. CFU-HPCs and CFU-Fs are shown as colonies per ml blood. n=4-8 mice per group. Data are means±SEM. ***p<0.001 (one-way ANOVA). See also FIG. 4.

[0117] FIG. 10. G-CSF-induced Mobilization of Haematopoietic progenitor cells is Independent of Cannabinoid Receptor Signalling

[0118] Mice were pretreated with G-CSF or vehicle in the presence or absence of (A) AM251 or (B) AM630 once daily on 4 consecutive days. Twenty-four hours after last injection, blood was collected for analysis of circulating CFU-HPCs. CFU-HPCs are shown as colonies per ml blood. n=4-8 mice per group. Data are means±SEM. ***p<0.001 (one-way ANOVA).

[0119] FIG. 11. β.sub.3-adrenoceptor activation induces upregulation of lipid mediators. (A) Mice were pretreated with FAAH inhibitor URB 597 (URB; 0.5 mg/kg) or vehicle PBS v/v 2.5% EthOH prior treatment with BRL 37344 (β.sub.3; 10 mg/kg i.p.) or dH.sub.2O once daily on 4 consecutive days. Two hours after last injection, blood was collected via cardiac puncture and the levels of lipid mediators in blood plasma were quantified by mass spectrometry. (n=18-21; plasma of three mice pooled together). Data are displayed as mean±SEM. *p<0.05, ***p<0.001 (one-way ANOVA). See also FIG. 5.

[0120] FIG. 12. Illustration summarising the ability of beta-3 agonists to stimulate generation of lipid mediators locally in the bone marrow, that regulate stem cell mobilisation.

[0121] FIG. 13. Amino acid sequence of human beta-3 AR (SEQ ID No: 1).

[0122] FIG. 14. Amino acid sequence of human CXCL12 (SEQ ID No: 2).

[0123] FIG. 15. Amino acid sequence of human CXCR4 (SEQ ID No: 3).

[0124] FIG. 16. G-CSF pretreatment impairs β3-AR agon′/AMD3100 mobilisation of MSCPs.

[0125] Experimental design (A). BALB/c mice were pretreated with G-CSF (100 μg/kg i.p.) or vehicle (PBS) once daily for 4 consecutive days. One day post first G-CSF injection, mice were pretreated with β.sub.3-AR agonist (10 mg/kg i.p.) or vehicle (dH.sub.2O) once daily on 4 consecutive days. One hour after last injection, mice were administered AMD3100 (5 mg/kg i.p.) or vehicle (PBS), and an hour later blood was collected via cardiac puncture for enumeration of circulating TNCs (B), HSPCs (C) and MSPCs (D). TNCs, CFU-HPCs and CFU-Fs per ml blood (n=4-9). Data of two independent experiments (N=2), displayed as meant SEM. *p<0.05, **p<0.01 (one-way ANOVA; Bonferroni's Multiple Comparison Test).

[0126] FIG. 17. Mice were treated with clodronate on day 0 and CD115+, F4/80+ macrophages were quantified in the bone marrow by flow cytometry on day 1 and 5. (A) representative flow cytometry plots. (B) absolute numbers of macrophages.

[0127] FIG. 18. Mice were treated with a single injection of clodronate (CL) or vehicle control (−) on day 0. Mice were subsequently treated with β3 Adrenergic agonist (β3) or vehicle control (−) daily on days 1-4. On day 4 some mice received a single subcutaneous injection of AMD3100 as indicated. Mice were killed 1 hour after administration of AMD3100 or vehicle control. Circulating numbers of HPCs (A) and CFU-Fs (B) were determined using specific colony forming assays.

EXAMPLE 1

Beta 3 AR Aqonists Stimulate Localised Production of Endocannabinoids by Bone Marrow Adipocytes and Prime Haematopoietic and Mesenchymal Stem Cells for Mobilization

[0128] Summary

[0129] Treatment of mice with beta 3 adrenergic agonists over 4 days was shown to prime both haematopoietic and mesenchymal stem cells for mobilization in response to a CXCR4 antagonist. Investigation of the underlying mechanism revealed that the effect was due to the localised production lipid mediators within the bone marrow. Thus mass spectrometry revealed significantly elevated levels of AG, DHEA and PEA following in vivo administration of the b3 agonist and inhibition of the enzymes that stimulated the production (Lipase) or degradation (FAAH) of these mediators inversely affected the priming response. Further the priming effect of the beta 3 adrenergic agonists was inhibited in part, by CBI and CB2 receptor antagonists. The function of bone marrow adipocytes has hitherto been an enigma and these results suggest that they may provide a local source of lipid mediators that regulate stem cell activity in the bone marrow.

[0130] Introduction

[0131] The function of adipocytes in the bone marrow is an enigma and commonly these cells are considered merely as space fillers, their numbers increasing when the bone marrow is destroyed by irradiation or when haematopoiesis declines with age. Based on the results presented herein we propose a new paradigm whereby activation of beta 3 adrenoreceptors on bone marrow adipocytes promotes lipolysis and the localised production of lipid mediators (ethanolamides/endocannabinoids) that act locally to prime both HSPCs and MSCs for mobilization into the blood. This suggests a new function for bone marrow adipocytes as a source of short acting lipid mediators that exert their effects locally in the bone marrow environment to regulate stem cell activity.

[0132] Results

[0133] Activation of β3ARs Primes HSPCs and MSPCs for Mobilization by a CXCR4 Antagonist

[0134] We sought to investigate whether β adrenergic receptor agonists could stimulate the mobilization of MSCs into the blood. We examined both acute (2 h) and 4 day treatments, and included combined treatment regimens in our analyses (FIGS. 1A and 1B). Consistent with our previous work while treatment with the CXCR4 antagonist, AMD3100, stimulated mobilization of HSPCs into the blood, no colony forming units-fibroblasts (CFU-Fs; a measure of MSCs) were detectable. Acute treatment (2 h) of mice with the general β adrenoreceptor agonist, isoproterenol, alone or in combination with acute administration of the CXCR4 antagonist did not enhance the mobilization of HSPCs above AMD3100 alone and did not result in detectable numbers of CFU-Fs in the blood (FIGS. 1C and 1D). A 4 day pre-treatment with the isoproterenol alone did not change circulating numbers of HSPCs or CFU-Fs. However, when AMD3100 was administered to mice pre-treated for 4 days with isoproterenol, HSPC numbers were significantly elevated over treatment with the CXCR4 antagonist alone (FIG. 1C) and, uniquely, CFU-Fs were mobilized (FIG. 1D). Thus treatment with a general beta adrenergic agonist over 4 days appears to prime both HSPCs and MSCs for mobilization by the CXCR4 antagonist.

[0135] Activation of β3ARs is Important to Prime Stem Cells for Mobilization

[0136] To de-lineate the specific beta adrenoreceptor subtype involved in this mobilization response, we performed the same experiments, including the beta 2 and beta 3-specific adrenergic agonists Clenbuterol and BRL37344, respectively. While the beta 2 adrenoreceptor-specific agonist did not stimulate HSPC or MSC mobilization, when administered alone or in combination with the CXCR4 antagonist, the b3 adrenoreceptor specific agonist significantly boosted circulating numbers of HSPCs and CFU-Fs as compared to that observed with isoproterenol and AMD3100 in combination (FIGS. 2A and 2B). These data suggest that activation of beta 3 adrenoreceptors primes stem cells for mobilization by the CXCR4 antagonist. In contrast, mobilization of total white blood cells that is significantly increased with the CXCR4 antagonist alone was not further elevated by the adrenergic agonists (FIG. 2C).

[0137] Further experiments showed a dose response relationship for mobilization of HSPCs and CFU-Fs in response to the CXCR4 antagonist when mice were pre-treated with 0-30 mg/ml BRL37344 (FIG. 8A) and confirmed that the effect of the beta 3 agonist, like the general agonist, required the pre-treatment of mice over 4 days to see this effect (FIG. 9B). Similarly to the experiments using the general βAR agonist, the effect of the β3AR-specific agonist was only observed after the mice were pretreated for 4 days (FIG. 9C and FIG. 9D).

[0138] CFU-Fs Mobilized into the Blood Exhibit Characteristics of MSPCs

[0139] Experiments were next performed to see whether the CFU-Fs mobilized into the blood following 4 day beta 3 pre-treatment and acute administration of the CXCR4 antagonist exhibited characteristics of MSCs. These blood-derived CFU-Fs were shown to be plastic-adherent cells that formed colonies when plated at low density (FIG. 3A). Following expansion in culture flow cytometry revealed that these cells expressed the classic markers of MSCs (CD29, CD90, CD73, CD105, Sca-1 and c-Kit) while being negative for CD45 (FIG. 3B). In vitro, these cells could be differentiated along osteogenic, chondrogenic and adipocyte lineages using standard protocols (FIG. 3C). Bone formation could be visualised in vivo (FIG. 3D). As such we consider that CFU-Fs measured in the blood represent MSPCs (Mesenchymal stem and progenitor cells).

[0140] Stem Cell Priming by β3AR Activation is Dependent on Lipolysis

[0141] Beta 3 adrenergic receptors are primarily expressed on adipocytes and are known to regulate lipolysis and thermogenesis. Thus in adipocytes, beta 3 adrenergic agonists stimulate lipase induced hydrolysis of triglycerides, leading to the generation of glycerol and free fatty acids (FFA) that are detectable in the plasma. Given that the bone marrow contains adipocytes we first sought to rule out the possibility that stem cell priming was associated with effects of beta 3 adrenergic agonists on lipolysis by pre-treating mice with Orlistat a general lipase inhibitor. Analysis of FFA levels in plasma showed an increase following treatment with the b3 adrenergic agonist over 4 days that was attenuated by pre-treatment of the mice with Orlistat (FIG. 4A). Moreover, HSPC and CFU-F mobilization induced by 4 day pre-treatment with the b3 adrenergic agonist was completely abrogated when mice were pre-treated with Orlistat (FIGS. 4B and 4C). These data suggested that stimulation of lipolysis mediated by Beta3 adrenergic agonist is necessary for stem cell priming.

[0142] Stem Cell Priming by β3AR Activation is Dependent on CB1 and CB2

[0143] Increased lipolysis may increase the availability of polyunsaturated fatty acid precursors, that are required to generate bioactive lipids (for example, eicosanoids and related oxylipins), as well as to increase the concentration of phospholipid-derived endocannabinoids and N-acyl ethanolamides (Ueda et al, 2013). We therefore sought to investigate whether these lipid signalling molecules were implicated in priming stem cells for mobilization. Use of a general COX inhibitor (Naproxen) ruled out a role for prostanoids in this process (FIG. 9). Indeed, inhibition of COX caused a significant increase in the mobilization of both HSPCs or CFU-Fs stimulated by b3 adrenergic agonist and CXCR4 antagonist in combination FIGS. 5A and 5B. In contrast, antagonists of either the cannabinoid receptor 1 (CB1-AM251) or cannabinoid receptor 2 (CB2-AM630) significantly suppressed Beta 3 adrenergic agonist mediated mobilization for both HSPCs and CFU-Fs in response to a CXCR4 antagonist, indicating a significant role for endocannabinoid signalling in this response (FIGS. 5A and 5B).

[0144] In general the effects of lipid mediators are limited both spatially and temporally by enzymes that efficiently degrade them. In the case of endocannabinoids fatty acid amide hydrolyse (FAAH) is key in their hydrolysis and inactivation (Hwang et al, 2010). We therefore examined whether inhibition of FAAH with a specific inhibitor (URB597) would affect stem cell mobilization in vivo. Our results show that mobilization of HSPCs and CFU-Fs by treatment with beta 3 agonist in combination with the CXCR4 antagonist was significantly enhanced when mice were pre-treated with URB597, consistent with a role of endocannabinoids in this response (FIGS. 5A and 5B).

[0145] β3AR-Specific Activation Stimulates Production of Endocannabinoids and N-acyl Ethanolamides in the Bone Marrow

[0146] Endocannabinoids are lipid mediators that are chemically unstable and rapidly degraded as such they are usually generated at their site of action. To examine whether endocannabinoids were generated locally in the bone marrow microenvironment, mass spectrometry was performed on mouse plasma and bone marrow samples following treatment with BRL37344 over 4 days. In these experiments, FAAH was inhibited in all mice to reduce the rapid hydrolysis of these lipid mediators. In mice in which only FAAH was inhibited, the endocannabinoids anandamide (AEA) and 2-arachidonoyl glycerol (2-AG), as well as several N-acyl ethanolamides (oleoyl ethanolamide, OEA, arachidonoyl ethanolamide AEA, palmitoyl ethanolamide PEA, Docosatetraenoyl ethanolamide, DHEA, linoleoyl ethanolamide LEA and stearoly ethanolamide STEA), could be detected in the bone marrow, with high basal levels of 2-AG, PEA and DHEA (FIG. 5C). Moreover, bone marrow levels of 2-AG, PEA and DHEA were significantly increased following β3AR-specific activation in combination with FAAH inhibition compared with that of mice in which only FAAH had been inhibited (FIG. 5C). To our knowledge this is the first demonstration that β3AR-specific agonists can stimulate the generation of endocannabinoids and their congeners locally in the bone marrow. Taken together, these results suggest that beta 3 agonists promote stem cell mobilization from the bone marrow due to the localized production of endocannabinoids/ethanolamides, some of which act via CB1 and CB2 receptors.

[0147] To give further insight into the cell types in the bone marrow that may be responding to the beta 3 adrenergic agonist or endocannabinoids, expression of beta 2, beta 3 adrenoreceptors and CB1 and CB2 receptors were examined by RT-PCR on purified populations of stem cells, leukocyte subsets and adipocytes (FIG. 5D). Consistent with previous reports (Bouaboula et al, 1993; Galiegue et al, 1995; Galve-Roperh et al, 2013; Li et al, 2010) we show expression of b2 adrenoreceptors on all of the cell types tested but selective expression of beta 3 adrenoreceptors on adipocytes. CBI receptors were expressed at high levels by adipocytes and low levels by both stem cell populations, while CB2 was expressed at high levels by all cell populations with the exception of MSCs.

[0148] HSPCs and MSPCs are Mobilized Directly from the Bone Marrow

[0149] To establish whether the observed changes in the number of progenitor cells circulating in the peripheral blood was due to increased egress directly out of the bone marrow, an in situ perfusion model of the murine hind limb was used. This model involves cannulation of the femoral artery and vein to allow the femur and tibia bone marrow to be perfused in (Pitchford et al, 2009; Pitchford et al, 2010) isolation. The CXCR4 antagonist is administered directly via infusion into the femoral artery over 10 mins, while cells that exit the bone marrow and enter the circulation are collected via cannulation of the femoral vein. This technique permits a more accurate quantification of mobilized bone marrow progenitors over a set time frame, as it prevents complications associated with mobilized cells trafficking into peripheral organs or homing back to the bone marrow. In mice pre-treated with vehicle and infused with the CXCR4 antagonist, HPCs but not MSCs were mobilized from the bone marrow (FIGS. 5E and 5F). Four day pretreatment with b3 adrenergic agonist in combination with the FAAH inhibitor significantly enhanced both HPC and MSC egress from the bone marrow in response to infusion of the CXCR4 antagonist (FIG. 5E). This result is consistent with the supposition that the bone marrow is the source of progenitors mobilized into the blood following this pharmacological treatment.

[0150] CB1 and CB2 are Required but Not Sufficient to Prime HSPCs and MSPCs for Mobilization

[0151] The actions of ethanolamides, in particular DHEA and PEA are not solely mediated via CB1 and CB2 receptors. To investigate whether stem cell priming for mobilization was mediated by these receptors we utilised ACEA and GP1a selective CB1 and CB2 agonists respectively Arachidonyl-2-chloroethylamide (ACEA) and CB2 (N-(Piperidin-1-yl)-1-(2,4-dichlorophenyl)-1,4-dihydro-6-methylindeno[1,2-c]pyrazole-3-carboxamide (GP1a). Initial experiments showed that a 4 day pre-treatment with ACAE and GP1a in combination was not sufficient to prime MSCs or HSPCs for mobilization even in the presence of the FAAH inhibitor to prevent hydrolysis of ACEA. As previously shown (FIGS. 1A and B), a 2-hour activation of β3AR, without additional activation of CB1 and CB2, did not increase the mobilization of HSPCs or MSPCs by CXCR4 antagonism (FIGS. 6B and C). However, when mice were pre-treated with ACAE and GP1a in combination for 3 days, stem cells were mobilized if the beta 3 adrenergic agonist was administered on the fourth day, prior to the CXCR4 antagonist (FIGS. 6A and 6B). A similar effect could be seen using a 3 day pre-treatment with either AHAE or GP1a alone, followed by administration of the beta 3 agonist and CXCR4 antagonist on day 4, but the level of mobilization was significantly less than that achieved using these agonists in combination. Taken together, FIG. 6 suggests that both CB1 and CB2 receptors are both required for optimal priming of stem cells. The requirement of beta 3 adrenergic agonist administration on day 4 after the 3 day pre-treatment with the CB1 and CB2 agonists suggests that final stage in stem cell priming requires lipid mediators that act on distinct receptors to CB1 and CB2 these lipid mediators are generated in response to treatment with the beta 3 adrenergic agonist on day 4. Overall, this data implies that the priming response is complex, involving multiple lipid mediators, receptors and mechanisms.

[0152] 4 days of β3AR-Specific Activation Does Not Change Bone Marrow CXCL12 Levels but Does Increase CFU-F Numbers

[0153] A reduction in the level of CXCL12 in the bone marrow is associated with HSPC mobilization in response to G-CSF treatment. It has been reported that β3AR is expressed on bone marrow stromal cells and that its activation reduces CXCL12 production by these cells in the short term (Katayama et al, 2006; Mendez-Ferrer et al, 2008; Mendez-Ferrer et al, 2010). We show here that, in contrast to treatment with G-CSF, 4 days of β3AR-specific agonist treatment had no effect on levels of CXCL12 in the bone marrow, which suggests that HSPC and MSPC mobilization in response to β3AR-specific activation and CXCR4 antagonism is not dependent on a reduction in bone marrow CXCL12 levels (FIG. 7A).

[0154] CB2 agonists have previously been reported to increase MSPC proliferation in vitro but only in mixed cultures of bone marrow mononuclear cells (Scutt and Williamson, 2007). Consistent with this finding, we observed an increase in the number of CFU-Fs in bone marrow cultures following β3AR-specific but not β2AR-specific activation in vitro (FIG. 7B). Furthermore, β3AR-specific activation in vivo led to an increase in CFU-F numbers in the bone marrow. This was inhibited when mice were co-administered CB1 and CB2 antagonists (FIG. 7C). This data shows that β3AR-specific activation stimulates MSPCs in the bone marrow through generation of endocannabinoids.

[0155] Discussion

[0156] Taken together, our data suggest a novel function of BMAT as a localised source of lipid mediators that regulate stem cell activity. We have provided the first evidence that beta 3 agonists administered systematically drive the local generation of a unique profile of endocannabinoids/ethanolamides in the bone marrow that act to prime both HSPCs and MSCs for mobilization.

[0157] The physiological function of adipocytes in the bone marrow is still considered an enigma. BMATs are yellow as they contain an intermediate number of mitochondria as compared to high levels that are present in brown fat and low levels in white fat. In addition to their distinct phenotype they are unresponsive to high fat diets or anorexia, and there is no evidence to suggest that they play a role in the bodies general energy metabolism or thermogenesis. Indeed, BMAT is commonly considered a space filler in bone marrow expanding with age as haematopoiesis declines, or in response to irradiation-induced injury.

[0158] Beta 3 adrenoreceptors are expressed at high levels on adipocytes and beta 3 agonists are known to stimulate lipolysis in peripheral fat stores. BMAT similarly expresses b3 adrenoreceptors and contains high levels of triglycerides. In fact, infusion of the general β agonist, isoproterenol, directly into the vasculature of the canine femur was shown to lead to the release of FFAs into the femoral vein, suggesting that lipolysis could also be stimulated locally in the bone marrow (Tran et al, 1981). In our study, the fact that the lipase inhibitor, Orlistat, abrogated the ability of the b3 agonist to prime both HSPCs and MSCs for mobilization led us to investigate the potential role of lipid mediators in this response.

[0159] BMAT expresses all the biochemical machinery to synthesise and degrade ethanolamides, and it has previously been reported that extracts of bone marrow contain ethanolamides at similar levels to those reported in the brain, where they are known to exert physiological effects (Bab et al, 2011). Analysis of lipids extracted from the bone marrow of naïve mice revealed the presence of endocannabinoids and N-acyl ethanolamides, with high basal concentrations of AG, DHEA and PEA which were all significantly elevated following administration of a selective β3 agonist in vivo. In contrast, other N-acyl ethanolamides, including AEA were present at low levels in naïve mice and remained unchanged following administration of the b3 agonist. Therefore, we have provided the first direct evidence that systemic β3AR-specific activation drives the local generation of a unique profile of endocannabinoids and N-acyl ethanolamides in the bone marrow. This suggests that BMAT is important in generating bioactive lipid mediators.

[0160] Ethanolamides are not chemically stable entities and are rapidly degraded, as such they are thought to act locally close to their site of generation. FAAH is an enzyme expressed in BM and other tissues that degrades ethanolamides and thereby limits their action, both temporally and spatially. In this study, we observed enhanced stem cell mobilization in response to β3 agonist/CXCR4 antagonist treatment when FAAH was inhibited, consistent with the concept that degradation of lipid mediators limits their actions. We also observed an increase in β3-stimulated stem cell mobilization when cyclooxygenase was inhibited, consistent with previous reports showing that inhibition of COX is associated with an increased bioavailability of the substrate (arachadonic acid) for generation of ethanolamides.

[0161] Ethanolamides are known to act as full or partial agonists of the cannabinoid receptors 1 and 2 (Sugiura, 2009). In the periphery, CB1 receptors are primarily expressed on pre-synaptic sympathetic neurones and function to reduce noradrenaline release (Elefteriou, 2008; Elefteriou et al, 2014), while CB2 receptors are expressed on cells of the immune system and on osteoblasts (Bab et al, 2011). With respect to the bone marrow a number of studies have reported effects of CB1 and 2 agonists on bone density and stem cell activity, by a number of distinct mechanisms. Release of noradrenaline from sympathetic nerves activates beta 2 adrenoreceptors on osteoblasts, inhibiting their differentiation and reducing mineralisation, thereby leading to bone loss. CB1 agonists are physiological antagonists of this process as they act pre-synaptically to reduce noradrenaline release from sympathetic nerves thereby attenuating bone loss. CB2 agonists act directly to enhance bone density by stimulating osteoblast proliferation. Thus both CB1 and CB2 agonists increase bone density. In terms of stem cells, CB2 agonists have been shown to stimulate the proliferation of MSCs when they are initially cultured from the bone marrow, an effect that is lost in pure cultures of MSCs. We report here that β3 agonists stimulate an increase in CFU-Fs in the bone marrow, an effect that is abrogated by CB1 and 2 antagonists, suggesting that lipid mediators that act via cannabinoid receptors expand MSCs in the bone marrow. In contrast, while HSPCs are known to express CB1 and CB2 receptors we did not observe any changes in the number of HSPCs, suggesting that other mechanisms must regulate their mobilization via CB1/CB2. In this respect, it has been reported that 2AG stimulates the migration of HSPCs and thus could potentially stimulate their migration to the vascular niche for mobilization (Patinkin et al, 2008).

[0162] Not all the effects of ethanolamides are mediated via CB1/2 receptors. Specifically, DHEA, originally termed synaptamide, is an ethanolamide that stimulates synaptogenesis and synaptic connectivity in a CB.sup.1/2-independent manner, suggesting that its effects are mediated by other distinct receptors (Kim and Spector, 2013). Thus, given that we have observed a significant elevation of an array of ethanolamides in response to β3 administration, it is likely that a number of distinct receptors, cell types and potentially multiple mechanisms are operating to prime both MSCs and HSPCs for mobilisation following the administration of a β3 agonist. Indeed, the fact that we could not replicate the effect of B3 pre-treatment using a combination of CB1 and CB2 agonists, points to this conclusion.

[0163] It has previously been reported that the SNS plays a critical role in regulating HSPC mobilization in response to circadian oscillations with beta 2 adrenoreceptors regulating the clock genes while stimulation of beta 3 adrenoreceptors on osteoblasts was reported to reduce their production of CXCL12. In this context, the cells responding are those that are directly innervated by the SNS and changes in CXCL12 are occurring within a matter of hours to regulate HSPC mobilization over the course of a day. In the experiments presented here, stem cell mobilization was not seen when beta agonists were administered acutely to naïve mice, while the effects of longer term treatment with beta agonists has not previously been examined.

[0164] A number of clinical trials were set up to investigate whether mobilizing HSPCS with G-CSF can promote tissue repair in the context of both MI and stroke. To date only very modest positive effects have been reported. Use of β3 agonists in combination with a CXCR4 antagonist may be more effective given that this pharmacological strategy mobilizes both HSPCS and MSCs, but also unlike G-CSF it does not induce granulopoiesis and an increase in inflammatory cells.

[0165] Experimental Procedures

[0166] Animals

[0167] Female BALB/c mice weighing 22-25 g were purchased from Harlan Laboratories. All studies were carried out under the United Kingdom's Animals (Scientific Procedures) Act of 1986 and local ethical approval from Imperial College London.

[0168] Administration of Drugs

[0169] Mice were administered the β-adrenergic agonists isoproterenol (10 mg/kg i.p.), clenbuterol (5 mg/kg i.p.) and BRL 37344 (10 mg/kg i.p.), the cannabinoid receptor agonists ACEA (10 mg/kg i.p.) and GP1a (5 mg/kg i.p.), or vehicle either on 4 consecutive days or 2 hours prior to the cull. 1 hour after the last injection, mice were administered the CXCR4 antagonist AMD3100 (5 mg/kg i.p.) or vehicle. 1 hour later their blood was collected via cardiac puncture for enumeration of circulating CFU-HPCs and CFU-Fs. Mice were administered murine G-CSF (100 μg/kg i.p.) or vehicle on 4 consecutive days. On day 5, blood was collected via cardiac puncture for enumeration of circulating HSPCs.

[0170] The antagonists or inhibitors AM251 (5 mg/kg i.p.), AM630 (5 mg/kg), orlistat (50 mg/kg i.p.), URB 597 (0.5 mg/kg), naproxen (10 mg/kg oral gavage) or vehicle, were administered 60 minutes prior to the injection of the mobilizing treatment, BRL 37344, ACEA, GP1a or G-CSF.

[0171] In Situ Perfusion of Mouse Hind Limb

[0172] Mice were administered BRL 37344 (10 mg/kg i.p.) or vehicle on 4 consecutive days. 1 hour after the last injection, the mice were anaesthetized. The femoral vein and artery were exposed and cannulated in situ immediately after the hind limb was isolated by occlusion of the surrounding arteries as previously described (Pitchford et al, 2009; Pitchford et al, 2010). Perfusion buffer was infused via the arterial cannula and removed from the venous cannula using a Minipuls Peristaltic Pump (Anachem). The hind limb was initially infused with AMD3100 (0.1 mM) or vehicle for 10 minutes using an infusion/withdrawal pump (Harvard Instruments) and was further perfused for 50 minutes with perfusion buffer (Pitchford et al, 2010). The perfusate was collected over 60 minutes and then centrifuged and resuspended in DMEM (Gibco) +20% fetal bovine serum for enumeration of CFU-HPCs and CFU-Fs.

[0173] CFU-HPC Assay

[0174] Harvested peripheral blood or perfusate was red blood cell-lysed and 1×10.sup.5 cells were added to tissue culture-treated petri dishes containing 1 ml of Methocult™ (M3434; StemCell Technologies) to select for CFU-HPCs. Cultures were incubated at 37° C. and quantified on day 12. Similarly, 1×10.sup.6 bone marrow cells harvested by bone marrow flush of the hind limb femur were plated for CFU-HPCs.

[0175] CFU-F Assay

[0176] Harvested peripheral blood or perfusate was red blood cell-lysed and 1×10.sup.6 cells were added to tissue culture-treated 6-well plates containing 3 ml of Mesencult™ (05502; StemCell Technologies) to select for CFU-Fs. Similarly, 1×10.sup.6 bone marrow cells harvested by bone marrow flush of the hind limb femur were plated for CFU-Fs. Cultures were incubated at 37° C. and media was changed on day 7. Bone marrow-derived CFU-Fs were enumerated on day 13 and blood- and perfusate-derived CFU-Fs were enumerated on day 21. Blood derived-CFU-Fs were further expanded and assessed for mesenchymal lineage markers by flow cytometry and following CD45 depletion (flow cytometry sorting of CD45 negative for mesenchymal trilineage differentiation (Supplemental Experimental Procedures).

[0177] Flow Cytometry Analysis and Fluorescence-Activated Cell Sorting

[0178] Flow cytometry was used to determine the expression of MSC markers on blood CFU-Fs that had been expanded in culture for 6 weeks. Cells were stained with fluorochrome-conjugated monoclonal antibodies directed against CD45, CD29, CD73, CD90, CD105, Sca-1, and c-Kit, Cells were analysed using a Fortessa (Becton Dickson). Fluorescence-activated cell sorting was performed on blood CFU-Fs expanded in culture for 6 weeks before performing mesenchymal trilineage differentiation. Cells were stained with fluorochrome-conjugated monoclonal antibodies directed against CD45. Cells were sorted using a FACS Aria II (Becton Dickson).

[0179] CXCL12 Enzyme-Linked Immunosorbent Assay

[0180] CXCL12 content in blood plasma and bone marrow supernatant was quantified using CXCL12 capture (MAB350) and detection (BAF351) antibodies (RnD systems), and the assay was performed according to the manufacturers' instructions. Recombinant mouse CXCL12 (RnD systems) was used to generate a standard curve.

[0181] Free Fatty Acid Assay

[0182] Free fatty acid content in blood plasma was quantified using a serum/plasma fatty acid detection Kit (Zen Bio) and the assay was performed according to the manufacturers' instructions. Data are expressed as μM concentration of free fatty acids.

[0183] Real-Time Quantitative PCR

[0184] Total RNA was isolated from cells or tissue using QIAamp RNA Mini Kit according to the manufacturers' instructions (Qiagen). Subsequent cDNA was prepared for each sample using a High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems) according to the manufacturers' instructions. qRT-PCR reactions were performed with Power SYBR® Green PCR Master Mix (Applied Biosystems), user-designed primers (Primer-BLAST-assisted; Invitrogen) and run on ViiA™ 7 Real-Time PCR System (Invitrogen). Data are shown relative to the lowermost expressing sample for each gene. Gene expression was normalized to the internal standard gene ACTB. Primer information is presented in the Supplemental Experimental Procedures.

[0185] Mass Spectrum and Chromatographic Analysis of Endocannabinoids and Congeners

[0186] Plasma and bone marrow flush (pool of 3 mice, n=1) were processed in order for the extraction of endocannabinoids and congeners (Astarita and Piomelli, 2009; Kingsley and Marnett, 2009). Samples were analysed on an electrospray (ESI) tandem quadrupole Xevo TQ-S mass spectrometer (MS/MS; Waters) coupled to an Acquity Ultrahigh Pressure Chromatography (UPLC) system, and the concentration of analytes was calculated (TargetLynx). Further details concerning extraction and analysis can be found in the Supplemental Experimental Procedures.

[0187] Materials

[0188] The source, dose and vehicle for all drugs is shown in Table 1. Methocult and Mesencult proliferation kit (StemCell Technologies). Murine G-CSF (PeproTech). SDF-1α/CXCL12 ELISA (R&D Systems). Serum/Plasma Fatty Acid Detection Kit (ZenBio). Commercially available standards for A-EA, A-EA-d8, palmitoylethanolamine (P-EA), docosahexaenoyl (DH-EA), a-linleoyl ethanolamine (AL-EA), oleoyl ethanolamine (O-EA), stearoyl ethanolamine (ST-EA), linoleoyl ethanolamine (L-EA), 2-arachidonylglycerol (2-AG), 2-AG-d8 were purchased from Cayman Chemical Co (Ann Arbour, Mich., USA). Ultrapure water was tapped by a Purelab Flex system from Elga Process Water (Marlow, UK), Strata Si-1 (Silica) SPE tubes (Phenomenex, Macclesfield, UK). Chloroform and methanol (Chromosolv LC-MS grade—Sigma-Aldrich).

TABLE-US-00001 TABLE 1 In vivo reagents and solvents/vehicles Reagent Company Dose (in Vivo) Vehicle Isoproterenol Sigma Aldrich 10 mg/kg dH.sub.20 Clenbuterol Sigma Aldrich 5 mg/kg dH.sub.20 BRL 37344 Sigma Aldrich 10 mg/kg dH.sub.20 AMD3100 Sigma Aldrich 5 mg/kg PBS Orlistat Tocris Bioscience 50 mg/kg PBS v/v 12.5% EthOH AM251 Tocris Bioscience 5 mg/kg PBS v/v 6.25% EthOH & 5% Tween 80 AM630 Tocris Bioscience 5 mg/kg PBS v/v 6.25% DMF & 5% Tween 80 URB597 Sigma Aldrich 0.5 mg/kg PBS v/v 2.5% EthOH Naproxen Sigma Aldrich 10 mg/kg PBS v/v 2% DMSO, 5% Tween 80, 5% castor oil & w/v 1% GP1a Tocris Bioscience 5 mg/kg PBS v/v 2.8% EthOH & 5% Tween 80 ACEA Enzo Life 10 mg/kg PBS v/v 5% EthOH & Sciences 5% Tween 80 G-CSF PeproTech 100 μg/kg PBS

TABLE-US-00002 TABLE 2 For flow cytometry antibodies Antibody Clone Company TER119-FITC TER119 eBioscience CD29-PE eBioHMb1-1 eBioscience CD31-FITC 390 Biolegend CD45-FITC 30-F11 BD CD73-PE TY/11.8 Biolegend CD90.2-PE 30-H12 Biolegend CD105-PE M17/18 eBioscience Ly-6A-E/Sca1-PECy7 D7 BD CD117/C-kit-PE 2B8 eBioscience CD140α/PDGFRα-APC APA5 eBioscience CD140β/PDGFRβ-PE APB5 eBioscience

TABLE-US-00003 TABLE 3 Primers for qRT-PCR Gene Primer Sequence SEQ ID No ADRB2 F CTGGTTGGGCTACGTCAACT  4 R CTTCCTTGGGAGTCAACGCT  5 ADRB3 F GCAGGAGGAAGATGGAAACC  6 R CAGTTACTGGAGACACCCGC  7 CNR1 F CGTTGAGCCTGGCCTAATCA  8 R GAACCAACGGGGAGTTGTCT  9 CNR2 F TTCGCCCACGCTTAGTGATT 10 R AGCTGGTGCAGGAATTCACA 11 ACTB F CTGTCGAGTCGCGTCCACCC 12 R GCTTTGCACATGCCGGAGCC 13

[0189] Mesenchymal Trilineage Differentiation

[0190] Blood mobilized CFU-F colonies were first expanded for 6 weeks and flow cytometry active cell sorting was used to isolate CD45 negative population. These cells were then cultured for 3 weeks in adipogenic, osteogenic and chondrogenic differentiation media. Adipogenic medium contained 0.5 μM dexamethasone, 0.5 μM isobutyl-methylxanthine and 50 μM indomethacin. Osteogenic medium contained 1 nM dexamethasone, 20 μM β-glycerolphosphate and 50 mM ascorbic acid-2-phosphate. Serum-free chondrogenic medium contained 10 ng/mL TGF-61, 100nM dexamethasone, 50 μg/mL ascorbic acid-2-phosphate, 100 μg/mL sodium pyruvate, 40 μg/mL L-proline, 1× ITS+3 (Sigma-Aldrich) and 1.25 mg/mL BSA. Cells were then stained with Oil Red O, Alizarin Red S and Alcian Blue for adipocytes, osteoblasts and chondrocytes, respectively.

[0191] In Vitro Pretreatment of Bone Marrow CFU-Fs with β-Adrenoceptor Agonists

[0192] Cells were harvested by bone marrow flush of the hind limb femur, and 1×10.sup.6 cells were added to tissue culture treated 6-well plates containing 3 ml of Mesencult™ (05502; StemCell Technologies) to select for CFU-Fs, and incubated at 37° C. After fifteen minutes the plate was treated with a single dose of clenbuterol (10 μM), BRL 37344 (10 μM) or vehicle. Media exchange was performed on day 7 and CFU-Fs were enumerated on day 13.

[0193] Isolation and Culture of Cells Used for Gene Expression Studies

[0194] Bone marrow cells were isolated via bone marrow flush of femur, tibia and iliac crest. To isolate bone marrow neutrophils, cells were carefully layered over a previously prepared Percoll gradient (52%, 64%, 72% percoll fractions; Sigma-Aldrich) and centrifuged for 30 mins (1500 g). The enriched neutrophil layer was collected and washed twice with media.

[0195] Neutrophils isolated had expected 85-90% purity. Bone marrow monocytes were isolated using the EasySep™ Mouse Monocyte Enrichment Kit (StemCell Technologies) according to the manufacturer's instructions. Bone marrow HSPCs were isolated using the EasySep™ Mouse Hematopoietic Progenitor Cell Enrichment Kit (StemCell Technologies) according to the manufacturer's instructions. Bone marrow MSPCs were isolated by plastic adherence followed by immunomagnetic cell isolation. Briefly, bone marrow cells were cultured on tissue culture treated plastic flasks in DMEM (Gibco) supplemented with 20% FBS (Gibco), 5 ng/ml basic Fibroblast Growth Factor (bFGF; Peprotech), 2 U/ml heparin (Sigma-Aldrich) and 1% penicillin/streptomycin (Sigma-Aldrich). Cultured MSCs were enriched at passage 1 using EasySep™ Mouse Mesenchymal Stem/Progenitor Cell Enrichment Kit (StemCell Technologies) according to the manufacturer's instructions. Bone marrow macrophages were isolated by culture on plastic petri dishes in RPMI w L-Glutamine (Gibco) supplemented with 10% FBS, 100 ng/ml human M-CSF (PeproTech), 50 μM β-mercaptoethanol (Sigma-Aldrich) and 1% penicillin/streptomycin (Sigma-Aldrich). Adipose tissue was isolated from mouse inguinal fat pads.

[0196] Extraction of Endocannabinoids and N-acyl Ethanolamides from Mouse Plasma and Bone Marrow Flush

[0197] Bone marrow flushed from the femurs of 3 mice were pooled (6 ml in total) per treatment to give an n=1 sample. This volume was required to achieve sufficient concentrations of endocannabinoids and N-acyl ethanolamides for detection by UPLC/ESI-MS/MS. Extraction of lipids was carried out by addition of chloroform:methanol (2:1, v/v) (Astarita and Piomelli, 2009; Kingsley and Mamett, 2009). Specifically, ice cold chloroform:methanol was added to each bone marrow supernatant (ml per pooled bone marrow sample), followed by the internal standards AEA-d8 (20 ng) and 2AG-d8 (40 ng). The resulting suspensions were kept on ice for 30 min with occasional vortexing and centrifuged at 5000 rpm for 8 min, to separate the organic and aqueous phases. The organic layer (bottom) from each sample was then removed into a clean vial. The supernatant was evaporated under a fine stream of nitrogen. Once dried the extract was reconstituted in 1 ml of chloroform and semi-purified by SPE (Guo et al, 2010). Briefly, the silica cartridge was equilibrated with 5×1 ml cholorform, the extract was applied, the cartridge was washed with 2×1 ml chloroform and the endocannabinoids eluted with 5×1 ml chloroform:methanol (2:1 v/v). The remaining residue, reconstituted in 100 μL ethanol was stored at −20° C., for no more than 1 week, awaiting UPLC/ESI-MS/MS analysis.

[0198] UPLC/ESI-MS/MS Analysis

[0199] All analysis was performed on an electrospray (ESI) tandem quadrupole Xevo TQ-S mass spectrometer (Waters) coupled to an Acquity Ultrahigh Pressure Chromatography (UPLC) system. The system was controlled by MassLynx v4.1 Software. TargetLynx was used to construct calibration lines and calculate the concentration of analytes of interest. Optimised ESI-MS/MS conditions were achieved through the use of Intellistart within MassLynx software. Individual standards (100 pg/μl) were introduced into the spectrometer by direct infusion via the Xevo TQ-S integrated syringe pump (flow rate 10 μl/min) combined with UPLC solvent flow (rate 0.2 mL/min). All analytes were monitored on the positive ionisation mode. Capillary voltage was set at 2000V, source temperature at 150° C., desolvation temperature at 400° C. and the cone voltage at 20 V.

[0200] Chromatographic analysis of the endocannabinoids and congeners was performed on an Acquity UPLC® BEH Phenyl C18 column (1.7 μm, 2.1×50 mm) maintained at 25° C. supported with Acquity UPLC® BEH Phenyl VanGuard pre-column (1.7 μm, 2.1×5 mm). Sample injections were performed with the Acquity sample manager (Waters); the sample chamber temperature was set at 8° C. The injection volume was 3 μL and the flow rate 0.6 ml/min. Analytes were separated using an acetonitrile-based gradient system comprising two solvents: solvent A: water/glacial acetic acid 99.5:0.5 (v/v); solvent B: acetonitrile/glacial acetic acid 99.5:0.5 (v/v). The following gradient was used: Initial conditions 22% solvent B increasing linearly to 28% solvent B at 3min; 3.0-3.1 increase of solvent B to 55% and remaining at 55% up to 10.9 min; 10.9-11.0 min increase of solvent B to 80% and remaining at 80% up to 12.5 min; 12.5-12.51 decrease of solvent B to 22%.

[0201] In Vivo Bone Formation

[0202] Culture expanded CFU-F colonies were FACS sorted for the CD45 negative population. These cells were then seeded on hydroxyapatite/tricalcium phosphate (HA/TCP) granules overnight at 37° C. They were then transplanted in mice for six weeks. The implants were removed, fixed, gently decalcified and finally paraffin embedded for histological analysis by H/E staining as is standard procedure in the art.

EXAMPLE 2

Bone Marrow Macrophages Required for Mobilisation of Mesenchymal Progenitor Cells in Response to β3AR Agonist in Combination with AMD3100

[0203] To further investigate the mechanisms regulating the mobilisation of Haematopietic progenitor cells (HPCs) and mesenchymal progenitor cells (MPCs) mice were pretreated with clodronate liposomes which were shown to significantly reduce numbers of macrophages in the bone marrow (FIG. 1). Mice that were treated with clodronate were subsequently treated with β3 adrenergic agonist over 4 days followed by the CXCR4 antagonist AMD3100 on day 4. The data indicate that depletion of macrophages with clodronate significantly enhanced the mobilisation of HPCs with AMD3100 alone and with the β3AR agonist in combination with AMD3100. From these data we propose that bone marrow macrophages negatively regulate the mobilisation of HPCs from the bone marrow. In contrast the mobilisation of MPCs (as measured by CFU-Fs) was completely abrogated when macrophages were depleted from the bone marrow. These data indicate that bone marrow macrophages are required for the mobilisation of mesenchymal progenitor cells in response to β3AR agonist in combination with AMD3100.

REFERENCES

[0204] Astarita, G., and Piomelli, D. (2009). Lipidomic analysis of endocannabinoid metabolism in biological samples. J. Chromatogr. B. Analyt Technol. Biomed. Life. Sci. 877, 2755-2767.

[0205] Bab, I., Smoum, R., Bradshaw, H., and Mechoulam, R. (2011). Skeletal lipidomics: regulation of bone metabolism by fatty acid amide family. Br. J. Pharmacol. 163, 1441-1446.

[0206] Bianco, P., Cao, X., Frenette, P. S., Mao, J. J., Robey, P. G., Simmons, P. J., and Wang, C. Y. (2013). The meaning, the sense and the significance: translating the science of mesenchymal stem cells into medicine. Nat. Med. 19, 35-42.

[0207] Bouaboula, M., Rinaldi, M., Carayon, P., Carillon, C., Delpech, B., Shire, D., Le Fur, G., and Casellas, P. (1993). Cannabinoid-receptor expression in human leukocytes. Eur. J. Biochem. 214, 173-180.

[0208] Broxmeyer, H. E., Orschell, C. M., Clapp, D. W., Hangoc, G., Cooper, S., Plett, P. A., Liles, W. C., Li, X., Graham-Evans, B., Campbell, T. B., et al. (2005). Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonist. J. Exp. Med. 201, 1307-1318.

[0209] Chow, A., Lucas, D., Hidalgo, A., Mendez-Ferrer, S., Hashimoto, D., Scheiermann, C., Battista, M., Leboeuf, M., Prophete, C., van Rooijen, N., et al. (2011). Bone marrow CD169+ macrophages promote the retention of hematopoietic stem and progenitor cells in the mesenchymal stem cell niche. J. Exp. Med. 208, 261-271.

[0210] Christopher, M. J., Rao, M., Liu, F., Woloszynek, J. R., and Link, D.C. (2011). Expression of the G-CSF receptor in monocytic cells is sufficient to mediate hematopoietic progenitor mobilization by G-CSF in mice. J. Exp. Med. 208, 251-260.

[0211] Costola-de-Souza, C., Ribeiro, A., Ferraz-de-Paula, V., Calefi, A. S., Aloia, T. P., Gimenes-Junior, J. A., de Almeida, V. I., Pinheiro, M. L., and Palermo-Neto, J. (2013). Monoacylglycerol lipase (MAGL) inhibition attenuates acute lung injury in mice. PLoS One 8, e77706.

[0212] Duerr, G. D., Heinemann, J. C., Suchan, G., Kolobara, E., Wenzel, D., Geisen, C., Matthey, M., Passe-Tietjen, K., Mahmud, W., Ghanem, A., et al. (2014). The endocannabinoid-CB2 receptor axis protects the ischemic heart at the early stage of cardiomyopathy. Basic Res. Cardiol. 109, 425-014-0425-x. Epub 2014 Jul. 1.

[0213] Elefteriou, F. (2008). Regulation of bone remodeling by the central and peripheral nervous system. Arch. Biochem. Biophys. 473, 231-236.

[0214] Elefteriou, F., Campbell, P., and Ma, Y. (2014). Control of bone remodeling by the peripheral sympathetic nervous system. Calcif. Tissue Int. 94, 140-151.

[0215] Fazeli, P. K., Horowitz, M. C., MacDougald, O. A., Scheller, E. L., Rodeheffer, M. S., Rosen, C. J., and Klibanski, A. (2013). Marrow fat and bone—new perspectives. J. Clin. Endocrinol. Metab. 98, 935-945.

[0216] Fricker, S. P. (2013). Physiology and pharmacology of plerixafor. Transfus. Med. Hemother 40, 237-245.

[0217] Galiegue, S., Mary, S., Marchand, J., Dussossoy, D., Carriere, D., Carayon, P., Bouaboula, M., Shire, D., Le Fur, G., and Casellas, P. (1995). Expression of central and peripheral cannabinoid receptors in human immune tissues and leukocyte subpopulations. Eur. J. Biochem. 232, 54-61.

[0218] Galve-Roperh, I., Chiurchiu, V., Diaz-Alonso, J., Bari, M., Guzman, M., and Maccarrone, M. (2013). Cannabinoid receptor signaling in progenitor/stem cell proliferation and differentiation. Prog. Lipid Res. 52, 633-650.

[0219] Godlewski, G., Offertaler, L., Wagner, J. A., and Kunos, G. (2009). Receptors for acylethanolamides-GPR55 and GPR119. Prostaglandins Other Lipid Mediat. 89, 105-111.

[0220] Guo, L., Amamath, V., and Davies, S. S. (2010). A liquid chromatography-tandem mass spectrometry method for measurement of N-modified phosphatidylethanolamines. Anal. Biochem. 405, 236-245.

[0221] Heidt, T., Sager, H. B., Courties, G., Dutta, P., Iwamoto, Y., Zaltsman, A., von Zur Muhlen, C., Bode, C., Fricchione, G. L., Denninger, J., et al. (2014). Chronic variable stress activates hematopoietic stem cells. Nat. Med. 20, 754-758.

[0222] Hong, H. S., Lee, J., Lee, E., Kwon, Y. S., Lee, E., Ahn, W., Jiang, M. H., Kim, J. C., and Son, Y. (2009). A new role of substance P as an injury-inducible messenger for mobilization of CD29(+) stromal-like cells. Nat. Med. 15, 425-435.

[0223] Hu, C., Yong, X., Li, C., Lu, M., Liu, D., Chen, L., Hu, J., Teng, M., Zhang, D., Fan, Y., and Liang, G. (2013). CXCL12/CXCR4 axis promotes mesenchymal stem cell mobilization to burn wounds and contributes to wound repair. J. Surg. Res. 183, 427-434.

[0224] Hwang, J., Adamson, C., Butler, D., Janero, D. R., Makriyannis, A., and Bahr, B. A. (2010). Enhancement of endocannabinoid signaling by fatty acid amide hydrolase inhibition: a neuroprotective therapeutic modality. Life Sci. 86, 615-623.

[0225] Iso, Y., Yamaya, S., Sato, T., Poole, C. N., Isoyama, K., Mimura, M., Koba, S., Kobayashi, Y., Takeyama, Y., Spees, J. L., and Suzuki, H. (2012). Distinct mobilization of circulating CD271+ mesenchymal progenitors from hematopoietic progenitors during aging and after myocardial infarction. Stem Cells Trans!. Med. 1, 462-468.

[0226] Katayama, Y., Battista, M., Kao, W. M., Hidalgo, A., Peired, A. J., Thomas, S. A., and Frenette, P. S. (2006). Signals from the sympathetic nervous system regulate hematopoietic stem cell egress from bone marrow. Cell 124, 407-421.

[0227] Kim, H. Y., and Spector, A. A. (2013). Synaptamide, endocannabinoid-like derivative of docosahexaenoic acid with cannabinoid-independent function. Prostaglandins Leukot. Essent. Fatty Acids 88, 121-125.

[0228] Kingsley, P. J., and Marnett, L. J. (2009). Analysis of endocannabinoids, their congeners and COX-2 metabolites. J. Chromatogr. B. Analyt Technol. Biomed. Life. Sci. 877, 2746-2754.

[0229] Lan, Y., Kodati, S., Lee, H. S., Omoto, M., Jin, Y., and Chauhan, S. K. (2012). Kinetics and function of mesenchymal stem cells in corneal injury. Invest. Ophthalmol. Vis. Sci. 53, 3638-3644.

[0230] Levesque, J. P., Hendy, J., Takamatsu, Y., Simmons, P. J., and Bendall, L. J. (2003). Disruption of the CXCR4/CXCL12 chemotactic interaction during hematopoietic stem cell mobilization induced by GCSF or cyclophosphamide. J. Clin. Invest. 111, 187-196.

[0231] Levesque, J. P., and Winkler, I. G. (2008). Mobilization of hematopoietic stem cells: state of the art. Curr. Opin. Organ. Transplant. 13, 53-58.

[0232] Li, H., Fong, C., Chen, Y., Cai, G., and Yang, M. (2010). Beta-adrenergic signals regulate adipogenesis of mouse mesenchymal stem cells via cAMP/PKA pathway. Mol. Cell. Endocrinol. 323, 201-207.

[0233] Liles, W. C., Rodger, E., Broxmeyer, H. E., Dehner, C., Badel, K., Calandra, G., Christensen, J., Wood, B., Price, T. H., and Dale, D. C. (2005). Augmented mobilization and collection of CD34+ hematopoietic cells from normal human volunteers stimulated with granulocyte?colony-stimulating factor by single-dose administration of AMD3100, a CXCR4 antagonist. Transfusion 45, 295-300.

[0234] Martin, C., Bridger, G. J., and Rankin, S. M. (2006). Structural analogues of AMD3100 mobilise haematopoietic progenitor cells from bone marrow in vivo according to their ability to inhibit CXCL12 binding to CXCR4 in vitro. Br. J. Haematol. 134, 326-329.

[0235] Mendelson, A., and Frenette, P. S. (2014). Hematopoietic stem cell niche maintenance during homeostasis and regeneration. Nat. Med. 20, 833-846.

[0236] Mendez-Ferrer, S., Battista, M., and Frenette, P. S. (2010). Cooperation of beta(2)- and beta(3)-adrenergic receptors in hematopoietic progenitor cell mobilization. Ann. N. Y. Acad. Sci. 1192, 139-144.

[0237] Mendez-Ferrer, S., Lucas, D., Battista, M., and Frenette, P. S. (2008). Haematopoietic stem cell release is regulated by circadian oscillations. Nature 452, 442-447.

[0238] Mendez-Ferrer, S., Michurina, T. V., Ferraro, F., Mazloom, A. R., Macarthur, B. D., Lira, S. A., Scadden, D. T., Ma'ayan, A., Enikolopov, G. N., and Frenette, P. S. (2010). Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature 466, 829-834.

[0239] Morrison, S. J., and Scadden, D. T. (2014). The bone marrow niche for haematopoietic stem cells. Nature 505, 327-334.

[0240] Patinkin, D., Milman, G., Breuer, A., Fride, E., and Mechoulam, R. (2008). Endocannabinoids as positive or negative factors in hematopoietic cell migration and differentiation. Eur. J. Pharmacol. 595, 1-6.

[0241] Petit, I., Szyper-Kravitz, M., Nagler, A., Lahav, M., Peled, A., Habler, L., Ponomaryov, T., Taichman, R. S., Arenzana-Seisdedos, F., Fujii, N., et al. (2002). G-CSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4. Nat. Immunol. 3, 687-694.

[0242] Pitchford, S. C., Furze, R. C., Jones, C. P., Wengner, A. M., and Rankin, S. M. (2009). Differential mobilization of subsets of progenitor cells from the bone marrow. Cell. Stem Cell. 4, 62-72.

[0243] Pitchford, S. C., Hahnel, M. J., Jones, C. P., and Rankin, S. M. (2010). Troubleshooting: Quantification of mobilization of progenitor cell subsets from bone marrow in vivo. J. Pharmacol. Toxicol. Methods 61, 113-121.

[0244] Riebe, C. J., and Wotjak, C. T. (2011). Endocannabinoids and stress. Stress 14, 384-397.

[0245] Rochefort, G. Y., Delorme, B., Lopez, A., Herault, O., Bonnet, P., Charbord, P., Eder, V., and Domenech, J. (2006). Multipotential mesenchymal stem cells are mobilized into peripheral blood by hypoxia. Stem Cells 24, 2202-2208.

[0246] Rosen, C. J., Ackert-Bicknell, C., Rodriguez, J. P., and Pino, A. M. (2009). Marrow fat and the bone microenvironment: developmental, functional, and pathological implications. Crit. Rev. Eukaryot. Gene Expr. 19, 109-124.

[0247] Scutt, A., and Williamson, E. M. (2007). Cannabinoids stimulate fibroblastic colony formation by bone marrow cells indirectly via CB2 receptors. Calcif. Tissue Int. 80, 50-59.

[0248] Sugiura, T. (2009). Physiological roles of 2-arachidonoylglycerol, an endogenous cannabinoid receptor ligand. Biofactors 35, 88-97.

[0249] Takahata, Y., Takarada, T., Iemata, M., Yamamoto, T., Nakamura, Y., Kodama, A., and Yoneda, Y. (2009). Functional expression of beta2 adrenergic receptors responsible for protection against oxidative stress through promotion of glutathione synthesis after Nrf2 upregulation in undifferentiated mesenchymal C3H10T1/2 stem cells. J. Cell. Physiol. 218, 268-275.

[0250] Tamai, K., Yamazaki, T., Chino, T., Ishii, M., Otsuru, S., Kikuchi, Y., Iinuma, S., Saga, K., Nimura, K., Shimbo, T., et al. (2011). PDGFRalpha-positive cells in bone marrow are mobilized by high mobility group box 1 (HMGB1) to regenerate injured epithelia. Proc. Natl. Acad. Sci. U.S.A. 108, 6609-6614.

[0251] Tran, M. A., Dang, T. L., and Berlan, M. (1981). Effects of catecholamines on free fatty acid release from bone marrow adipose tissue. J. Lipid Res. 22, 1271-1276.

[0252] Ueda, N., Tsuboi, K., and Uyama, T. (2013). Metabolism of endocannabinoids and related N-acylethanolamines: canonical and alternative pathways. FEBS J. 280, 1874-1894.

[0253] Vagima, Y., Lapid, K., Kollet, O., Goichberg, P., Alon, R., and Lapidot, T. (2011). Pathways implicated in stem cell migration: the SDF-1/CXCR4 axis. Methods Mol. Biol. 750, 277-289.

[0254] Wang, Y., Johnsen, H. E., Mortensen, S., Bindslev, L., Ripa, R. S., Haack-Sorensen, M., Jorgensen, E., Fang, W., and Kastrup, J. (2006). Changes in circulating mesenchymal stem cells, stem cell homing factor, and vascular growth factors in patients with acute ST elevation myocardial infarction treated with primary percutaneous coronary intervention. Heart 92, 768-774.