GENETIC ENCODING OF CHEMICAL POST-TRANSLATIONAL MODIFICATION FOR PHAGE-DISPLAYED LIBRARIES

20170355982 · 2017-12-14

Assignee

Inventors

Cpc classification

International classification

Abstract

The present application provides a method of synthesizing a genetically-encoded chemical modification of a peptide library. A vector in a substrate, such as a phage, is modified to include a peptide linker and a modification to form a genetic “barcode”. The barcode is screened against potential targets which may be used in drug discovery.

Claims

1. A method of synthesizing a genetically-encoded chemical modification of a peptide library comprising: inserting, into multiple independent vectors in a substrate, a first set of gene sequences encoding one or more substantially similar peptide linkers; inserting, into each vector, a second set of gene sequences encoding a variable set of peptides; expressing and amplifying the first and second sets of gene sequences such that a translation product comprising the substantially similar linkers and variable peptides is synthesized; modifying the set of variable peptides by a modification; combining the set of modified variable peptides to produce a library in which the modification is encoded genetically.

2. The method of claim 1, wherein the first set of gene sequences encodes peptide sequences comprising chemically-similar or identical amino acids but are encoded by different nucleotide codons.

3. The method of claim 1 or 2, wherein the second set of gene sequences comprises a random genetic library that encodes a random peptide library of different chemical compositions.

4. The method of claim 1 or 2, wherein the second set of gene sequences comprises a focused genetic library that encodes a focused sub-set of peptide sequences of different chemical compositions, such as those generated by random mutagenesis.

5. The method of any one of claims 1 to 4, wherein the modification is a chemical modification of the set of peptides.

6. The method of claim 4, wherein the encoded chemical modification is an introduction of a different small molecule in any location of the displayed peptide using a site-specific chemical conjugation technique.

7. The method of claim 3, wherein the second set of gene sequences encodes a chemical structure of a molecule.

8. The method of claim 6, wherein the small molecule is a carbohydrate, biotin, sulphonamide, and other small molecules that have known biological activity.

9. The method of claim 6 wherein the chemical modification is formation of oxime at the N-terminal serine, alkylation of cysteine, or any suitable method to modify a peptide or protein in a specific location.

10. The method of any one of claims 1-5, wherein the encoded chemical modifications are chemical reactions that insert one or more linkers, one or more cross-linkers or one or more chemical staples to convert a peptide into a macrocycle with one of more bridges.

11. The method of claim 10, wherein the second set of gene sequence encodes a chemical structure of the linker, cross linker or chemical staple.

12. The method of any one of claims 6-12, wherein small molecules used for chemical modification or cross-linkers encoded by silent barcoding are diastereomers or enantiomers.

13. The method of claim any one of claims 1 to 4, wherein the modification is an enzymatic modification of the set of peptides.

14. The method of any one of claims 1 to 13, wherein the substrate is a phage, mRNA, ribosome, bacteria, yeast or any other suitable genetic display technology.

15. A method of selecting a genetically-encoded chemical modification of a peptide library comprising: inserting, into multiple independent vectors in a substrate, a first set of gene sequences encoding one or more substantially similar peptide linkers; inserting, into each vector, a second set of gene sequences encoding a variable set of peptides; separately expressing the first and second gene sequences on the substrate such that one or more peptide libraries are synthesized; modifying each of the one or more peptide libraries separately, pooling the modified peptide libraries together to produce a library in which chemical modification is encoded genetically; and screening the chemically-modified peptide library to select a peptide with a desired chemical modification.

16. A method of identifying a drug target comprising: preparing a genetically-encoded chemically modified peptide library according to the method of any one of claims 1 to 14; and screening said library with a molecule to identify chemically modified peptides by sequencing of the sequence encoding the peptide linker and the sequence encoding the variable peptide.

17. A method of synthesizing a genetically-encoded chemical modification of a peptide library comprising: inserting, into multiple independent vectors in a substrate, a redundant set of gene sequences encoding a peptide linker, such that gene sequences produce identical or closely related peptide sequences (“linkers”) upon translation; inserting, into each vector, a second set of gene sequences encoding a genetically diverse insert, such that a diverse set of peptides (“library”), is expressed upon translation; expressing and amplifying the first and second gene sequences such that a translation product comprises non-variable linker and variable peptide library is synthesized; and modifying each peptide library by a distinct modification and combining multiple modified libraries to produce a library in which chemical modification is encoded genetically.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0032] FIG. 1 provides a scheme for encoding which is specific to phage-displayed libraries of polypeptides. Analogous encoding by an adjacent random and silent barcode can be performed in any known-in-the art platform used for encoding and screening of polypeptide libraries.

[0033] FIG. 2 illustrates specific examples of silent barcodes. Sequences for barcodes are selected such that one barcode cannot be converted to another barcode by a single substitution of one nucleotide, thus reducing the likelihood of introducing errors. In other words, barcode sequences typically do not reside within hamming distance (Hd)=1 from each other. Ideally, sequences that are Hd=2-3 from each other are selected.

[0034] FIG. 3 illustrates modifications and selection against a matched target. Barcoded libraries are selected against the expected target. The selection strength follows the affinity of the ligands that anchor the library to the target protein.

[0035] FIG. 4 illustrates the confirmation of the presence of chemical modifiers on phage displayed libraries.

[0036] FIG. 5 illustrates the analysis of the enrichments in the selected library by ratiometric analysis.

[0037] FIG. 6 illustrates sequence preferences observed within a selected library.

[0038] FIG. 7 shows volcano analysis of the copy number of peptides identified after panning and deep-sequencing of the mixed-modified libraries (MIX).

[0039] FIG. 8 shows exemplary ligands binding to the corresponding target. Peptide sulfonamide binds with 30 nM affinity.

[0040] FIG. 9 provides additional raw ITC data of sulfonamide-peptide (SA-XXXX) binding to carbonic anhydrase.

[0041] FIG. 10 shows analytical data for sulfonamide-modified peptides.

[0042] FIG. 11 shows a selection assay of phage libraries with various genetically encoded monosaccharides.

[0043] FIG. 12 shows activity of hits identified from genetically-encoded libraries of glycopeptides against Galactose-3.

[0044] FIG. 13 shows raw data from experiments that measures the ability of glycopeptides to inhibit interaction of galectin-3 with lactose

[0045] FIG. 14 shows analytical data for carbohydrate-modified peptides.

DETAILED DESCRIPTION

[0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0047] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.

[0048] The term “comprising” as used herein will be understood to mean that the list following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) and/or ingredient(s) as appropriate.

[0049] The present application provides a method for genetically encoding chemical modifications of a phage-displayed peptide library. In one embodiment, this can be achieved by assigning the identity of modifications in translationally “silent barcodes”. For example, there are 4 codons that encode Gly and 3.sup.4=81 different ways to encode a Gly-Gly-Gly (GGG) linker, which connects random peptide library to the pill protein of the phage. Thus, it is possible to construct 216 libraries identical on the chemical (translational) level and. distinguishable on genetic level, modify these libraries separately and pool them to create a cPTM-library in which every cPTM can be traced genetically.

[0050] Silent barcodes can be introduced at any location within the phage, including translationally active and silent regions, auxiliary proteins not used in phage assembly or sequences excised from phage proteins (e.g. leader). However, in certain embodiments, it is typical to position silent barcodes within close proximity to the variable region to allow for simultaneous characterization of these two regions by DNA sequencing.

[0051] For example, phage displaying the peptide sequence Ser-X-X-X-X-Gly-Gly-Gly were produced, where X is any amino acid and both Ser and Gly-Gly-Gly serve as the hidden barcode (HB) moiety. As shown in FIG. 2, specific examples of silent barcodes introduced in the regions adjacent to random tetra-amino acid library are provided. N is any nucleotide, K is G or T; NNK is a common combination of nucleotides uses to encode a random amino acid.

[0052] An unmodified library, and libraries carrying three different modifications, were combined to create libraries that contain four distinct N-terminal moieties (serine, biotin, sulfonamide and mannose). Panning and deep sequencing against four targets—streptavidin, carbonic anhydrase, ConA or BSA—was performed to illustrate that selection of modified peptides can be readily characterized by sequencing (see FIGS. 3 and 4).

[0053] Panning of libraries with multiplexed silent barcodes is limited to a single round of panning; however, analysis by deep-sequencing makes it possible to identify productive ligands even from a single round of panning. It is known in the art that the efficiency of one round of panning with deep sequencing can be matched to the efficiency of a multi-round screen with canonical Sanger sequencing.

[0054] Materials and Reagents

[0055] Chemical reagents and solvents were purchased from Sigma-Aldrich or Fisher Scientific unless noted otherwise. Synthesis of Mannose-hydroxylamine with 2-carbon linker has been described previously (Ng, et al.). Reagents for peptide synthesis were purchased from ChemPep; model peptides were synthesized using standard Fmoc solid phase synthesis as described below. Reactions were monitored by TLC which was carried out on silica gel 60 F254 (Merck) plates and visualized by UV-light (λ=254 nm) and/or by spraying potassium permanganate, anisaldehyde followed by heating. Flash column chromatography was performed using silica gel 60 (40-63 μm) using ISCO Teledyne Combiflash Rf instrument. The subsequent evaporation of solvents in vacuo was performed using IKA RV10 rotary evaporator. Proton (1H NMR) and carbon (13C NMR) nuclear magnetic resonance spectra were recorded on an Agilent/Varian VNMRS two channel 500 MHz or Agilent/Varian Inova two-channel 400 MHz spectrometer. The chemical shifts are given in part per million (ppm) on the delta scale. The solvent peak was used as reference values. For 1H NMR: CDCl3=7.24 ppm and for 13C NMR: CDCl3=77.16 ppm. The following abbreviations have been used: s, singlet; d, doublet; t, triplet; q, quadruplet, quin—quintet; m, multiplet; b, broad; d, doublet of doublets; ddd, doublet of doublet of doublets; td, triplet of doublets. Bovine carbonic anhydrase (BCA), biotin and lysozyme were obtained from Sigma-Aldrich Canada (Oakville, ON). The plasmid for natural core streptavidin, S4 (containing residues 13-139 of wildtype streptavidin, MW 13 271 Da) was a gift from Prof. P. Stayton (University of Washington) and expression of this protein is detailed below.

[0056] Synthetic procedures

##STR00001##

4-[[1,3-bis(oxidanylidene)isoindol-2-yl]oxymethyl]benzenesulfonamide (3′)

[0057] 4-sulfonamido-benzylbromide (Guillon et al., 2011) (460 mg, 1.84 mmol) and N-hydroxyphthalimide (360 mg, 1.2 eq) were dissolved in DMF (4 mL). K.sub.2CO3 (276 mg, 2 mmol) was added and the mixture was stirred at 80° C. for 30 min then diluted with ethyl acetate, acidified with HCl, washed with water, concentrated to give copious precipitate (520 mg, 85%). .sup.1H NMR (498 MHz, methanol-d4) δ ppm 7.92 (d, 2H, J 8.1 Hz, arom.), 7.82 (s, 4H, arom.); 7.71 (d, 2H, arom.), 4.82 (s, 2H, CH2). .sup.13C NMR (126 MHz, methanol-d4) δ ppm 164.87, 145.69, 139.89, 135.90, 131.16, 130.22, 127.32,124.39, 79.72. ESI-MS calculated for C.sub.15H13N2O5S (M+H).sup.+: 333.0540, found: 333.0549.

4-(aminooxymethyl)benzenesulfonamide (3)

[0058] To a suspension of precursor 3′ (200 mg, 0.6 mmol) in hot MeOH (2 mL) hydrazine hydrate was added (0.1 mL) (Kitov et al.). After 30 min the mixture was concentrated and purified using silica gel chromatography (DCM-5% MeOH) to give the title product (105 mg, 61%). .sup.1H NMR (498 MHz, methanol-d4) δ ppm (d, 2H, J 8.1. Hz, arom.); 7.51 (d, 2H, arom.), 4.73 (s, 2H, CH2). .sup.13C NMR (126 MHz, methanol-d4) δ ppm 144.32, 143.76, 129.37, 127.24, 77.75. ESI-MS calculated for C7H9N2O3S (M−H).sup.−: 201.0339, found: 201.0339.

[0059] Synthesis of Peptides on Solid Support

[0060] Rink Amide AM resin (200 mg, 0.91 mmol/g, 0.18 nimbi) was weighed into a Poly-Prep® chromatography column. The column was set up on a vacuum manifold. The manifold was equipped with a three-way stopcock that allows draining of the solvent by vacuum filtration and agitation of the resin by nitrogen bubbling (Kim et al., 2011). CH2Cl2 (3 mL) was added to the dried resin for swelling. After 15 min, the solvent was drained by vacuum aspiration. The resin was washed with. DMF (3 mL) and the protective Fmoc group was cleaved with 20% (v/v) piperidine in DMF (3 mL) for 1 min. The treatment was repeated for 10 min using fresh 20% (v/v) piperidine in DMF (3 mL). The resin was washed with DMF (4-3 mL). Fmoc-protected amino acid (0.73 mmol, 4 eq.) in DMF (1 mL) and HBTU (276 mg, 0.73 mmol, 4 eq.) in DMF (1 mL) was added to the resin followed by N,N-diisopropylaminoethylamine (DIPEA, 0.25 mL, 1.46 mmol, 8 eq.). After 30 min of agitation with nitrogen, the reagents were removed by vacuum aspiration and the resin was washed with DMF (4-3 mL). The Fmoc-deprotection, amide coupling, and washing steps were repeated consecutively as described above to elongate the peptide sequence. After final Fmoc deprotection, the resin was washed with DMF (5-3 mL), followed by CH.sub.2Cl.sub.2 (5-3 mL). The resin was left on the manifold for 10 min to dry under the vacuum. A cleavage cocktail containing TEA/H2O/phenol/triisopropylsilane [3 mL, 85/5/5/5 (v/v/w/v)] was added to the resin. The column was left on a rocker for 2 h to cleave the peptide then the solution was collected and the resin was rinsed with TEA (1 mL). The combined cleavage mixture was added dropwise to ice cold diethyl ether (20 mL) in a 50 mL centrifuge tube. The mixture was incubated on ice for 30 min then centrifuged for 5 min at 3000 rpm. Supernatant was decanted and the precipitates were resuspended in cold diethyl ether (10 mL). The centrifugation and washing steps were repeated 2 times. The precipitates were air-dried and then left under vacuum overnight. Typical yield: 50-150 mg.

[0061] Crude peptide (40 mg) was dissolved in DMF (0.25 mL) and 0.1% aqueous TEA (0.25 mL). The solution was injected into a semi-preparative C18-HPLC system. A gradient of solvent A (MQ deionized water, 0.1% (v/v) TEA) and solvent B (MeCN, 0.1% (v/v) TFA) was run at a flow rate of 12 mL/min as shown below.

TABLE-US-00001 Time (min) Eluent B (%) 0 2 2 2 26 35 27 100 29 100 30 2

[0062] The fractions containing target peptides were identified using mass spectrometry either by MALDITOF of ESI LCMS. MeCN was removed by evaporation under reduced pressure. The aqueous solution was lyophilized to yield the peptide as white powder (20-32 mg). All peptides were used for synthesis of peptide conjugates and characterization was performed after the synthesis of the conjugate.

[0063] Synthesis of Sulfonamide Peptides

##STR00002##

[0064] Synthesis was adapted from Ng et al (2012), with minor modifications. In one example of the procedure using H2N-SWYKL-CONH2 peptide: the peptide (6.9 mg, 10 μmol, 1 eq.) was dissolved in DMF (0.25 mL) followed by the addition of 200 mM MOPS (0.25 mL, pH 7.0). The solution was added to a 1.5-mL microcentrifuge tube containing aqueous solution of sodium periodate (60 μL, 42.6 mg/mL, 12 μmol, 1.2 eq.). The reaction mixture was incubated for 10 min at RT. To quench the oxidation, solid glutathione was added (GSH, 37 mg, 120 μmol, 12 eq.) and mixed instantly to prevent buildup of free iodine (brown color appears momentarily upon GSH addition). After incubation for 10 min at RT, 4-(aminooxymethyl)benzenesulfonamide (3) (2.6 mg, 20 μmol, 2 eq.) dissolved in DMF (60 μL) was added to the reaction mixture followed by 200 mM anilinium acetate (0.25 mL, pH 4.7). The oxime ligation was carried out for 30 min at RT. The reaction mixture was injected into a semipreparative C18-HPLC system. HPLC purification was carried out as described above for crude peptide to yield the product as a white fluffy powder (40-70% isolated yield) after lyophilization. The purity of the product was determined with an analytical C18-HPLC system (flow rate: 1 mL/min) using a gradient of solvent A (MQ water, 0.1% (v/v) TFA) and solvent B (MeCN, 0.1% (v/v) TFA) as shown below.

TABLE-US-00002 Time (min) Eluent B (%) 0 2 2 2 16 40 17 100 19 100 20 2

[0065] The product SA-WYKL was further characterized with LCMS and FIRMS (ESI). Analytical data for all sulfonamide conjugates can be found below.

[0066] Construction of Silent Barcode Phage Display Libraries.

[0067] This protocol is modified from Ng et al. The anti-sense strand of the DNA oligonucleotide libraries were purchased from Integrated DNA Technologies with the following sequences (3′.fwdarw.5′):

TABLE-US-00003 3′-GGGCCCATGGAAAGATAAGAGTGAGAAGA(NNM).sub.4 CCACCTCCAAGCCGGCCCGCG-5′ 3′-GGGCCCATGGAAAGATAAGAGTGAGAAGA(NNM).sub.4 CCTCCACCTAGCCGGCCCGCG-5′ 3′-GGGCCCATGGAAAGATAAGAGTGAGAAGA(NNM).sub.4 CCGCCACCGAGCCGGCCCGCG-5′ 3′-GGGCCCATGGAAAGATAAGAGTGAGATCA(NNM).sub.4 CCTCCTCCTAGCCGGCCCGCG-5′

[0068] 200 pmol of each library was annealed with 3 molar equivalents of a short primer with the sequence 5′-CATGCCCGGGTACCTTTCTATTCTC-3′ and extended by 15U Klenow fragment (#EP0051, Thermo Scientific) in 1× of the provided reaction buffer and 50 μM dNTPs. The double-stranded library was purified by standard ethanol precipitation and resuspended in DNase-free water or TE buffer. The libraries were treated with KpnI and EagI FastDigest restriction enzymes (#FD0524 and #FD0334, Thermo Scientific) according to manufacturer recommendations and purified by 2% EGel ® SizeSelect™ gel (Life Technologies). M13KE bacteriophage double-stranded DNA (dsDNA) was isolated from a single phage clone originating from the Ph.D.-12 phage display library (New England BioLabs) using the GeneJET Plasmid Miniprep Kit (Life Technologies) and similarly treated with KpnI and EagI FastDigest restriction enzymes, according to manufacturer instructions. The resulting DNA was purified by 0.7% agarose gel purification followed by gel extraction by GeneJET Gel Extraction Kit (Thermo Fisher Scientific, Waltham, Mass., USA). A 1:30 molar ratio of cut M13KE vector and library duplex was ligated by 400 U of T4 DNA ligase (New England BioLabs) at 16° C. overnight. Ligated DNA was purified by ethanol precipitation and re-suspended in DNase-free H2O and transformed using the Gene Pulser Xcell™ Electroporation System, 2 mm CienePulser/MicroPulser Electroporation Cuvettes (all from BioRad) with the settings 2500 V/400 Ohm/46 μF and commercially available F(+) TG1 electrocompetent cells and recovery media (Lucigen, Middleton, Wis., USA). Transformed cells were allowed to recover in the provided recovery media for 15 min at 37° C., 225 amplification for 4.5 hours. Phage were collected by PEG/NaCl precipitation from supernatant of culture, titered, and stored in MOPS buffer, pH 7.4.

[0069] Chemical Modification of the Phage Libraries.

[0070] The following protocol was modified from Ng et al (2015, 2012). A ˜10.sup.11 PFU/mL solution of phage library was oxidized with 0.06 niM sodium periodate (e.g. 1 μL of 6 mM sodium periodate into 99 μL of phage in PBS) for 5 min at RT in the dark and quenched with 0.5 mM glutathione (e.g. 1 μL of 50 mM glutathione) for 10 min at RT. To monitor the oxidation, a small portion of the oxidized library was treated with aminooxy-biotin and captured by biotin-capture assay as previously described (Ng et al., 2012). Typically, 60% of the fractions of phage library were successfully oxidized. Oxidized phage library was then modified with an equivalent volume of hydroxylamine conjugate (4-(aminooxymethyl)benzenesulfonamide, 2-(aminooxy)ethyl α-D-mannopyranoside, or aminooxybiotin, 2 mM solution in 200 mM anilinium acetate buffer, pH 4.7). The reaction mixtures were incubated for 1 h at RT, followed by dialysis against MOPS buffer to remove excess reagents (4° C., 1 mM, pH 7.3, three buffer changes over 18 h, 10K MW cut-off). To quantify the reaction efficiency, a small portion of the library was treated with aminooxy-biotin following oxime ligation and captured by biotin-capture assay as previously described (Ng et al., 2012). Typically, 55% of the fractions of phage library were successfully modified with the reagents.

[0071] Panning of Modified of Mixed-Modified Phage Libraries

[0072] The panning protocol was adapted from Ng et al with minor modifications.

[0073] Preparation of targets: Designated wells of a flat bottom 96-well Costar plate were coated with 100 μL of 10 μg/mL. streptavidin, concanavalin A, bovine carbonic anhydrase II or BSA in MOPS buffer (20 mM, pH 7.4). Each target was coated in triplicate wells. The plate was sealed and incubated overnight at 4° C. The plate was then blocked for 1 h with a blocking solution (2% w/v BSA, 20 mM MOPS, pH 7.4) and washed using a 405™ Touch Microplate Washer (BioTek) as follows: 300 μL of wash buffer (0.1% w/v Tween-20, 20 mM MOPS, pH 7.4) followed by a 5 s shake and 30 s soak, repeated for a total of 10 cycles.

[0074] Preparation of libraries. The libraries were chemically modified the day before panning using the protocol described above. The following libraries were used in the model panning assay: B1 (DMannose), B2 (Unmodified), B3 (Biotin), and B4 (Sulfonamide). Libraries were combined in a 1:1:1:1 ratio at approximately 1×10.sup.11 PFU/mL of each library. In a control panning experiment, B1, B2, B3 and B4 library were used individually,

[0075] Panning steps The mixed modified library (MIX) or individual libraries (B1-B4) were diluted to approximately 10.sup.9 PFU/mL in binding buffer (2% w/v BSA, 0.2% w/v Tween-20, 20 mM MOPS, pH 7.4) and distributed at 100 μL per well, at ˜1×10.sup.8 PFU/well concentration. After incubation for 1 h at RT, the plate was washed again using the same washing protocol. Bound phage was detached from the plates by elution buffer (0.2 M glycine-HCl, pH 2.2, 0.1% w/v BSA) for 9 minutes; the eluted solution was neutralized with M Tris-HCl, pH 9.1, The eluted phage solution was quantified by plaque forming assay. Titer of panning with individually-modified libraries were used to validate the presence of specific modifiers on these libraries (see FIG. 4).

[0076] Preparation for deep-sequencing (for MIX library only). The eluted phage was amplified for 4.5 h in 3 of LB supplemented with a 1:100 dilution of log phase E. coli K12 ER2738 (New England BioLabs). Single-stranded DNA (ssDNA) was isolated from the amplified phage using the QIAprep Spin M13 Kit (QIAGEN) and converted it to Illumina-compatible short dsDNA by PCR. Briefly, ˜150 ng phage ssDNA was combined with ix PCR buffer (New England BioLabs), 1 mM dNTPs, 0.5 μM each primer, and 0.5 μL Phusion High Fidelity DNA polymerase (New England BioLabs) in a total volume of 50 μL. Forward (F) and reverse (R) primer sequences, 5′.fwdarw.3′:

TABLE-US-00004 F: 5′- CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGC TCTTCCGATCTXXXXCCTTTCTATTCTCACTCT-3′ R: 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT TCCGATCTXXXXACAGTTTCGGCCGA-3′

[0077] The XXXX in the primer sequence denotes four-nucleotide-long barcodes used to trace multiple samples in one Illumina sequencing experiment. The temperature cycling protocol was as follows: 95° C. for 30 s, followed by 25 cycles of 95° C. for 10 s, 60.5° C. for 15 s and 72° C. for 30 s, and then a final extension at 72° C. for 5 min before holding at 4° C. The resulting dsDNA with Illumina compatible adapters was sequenced using the Illumina HiSeq platform (The Donnelly Sequencing Centre at The Donnelley Centre for Cellular and Biomolecular Research, University of Toronto) and analyzed as described in the subsequent section (Analysis of the Deep-sequencing Data).

[0078] Analysis of the Deep-Sequencing Data.

[0079] Analysis was adapted from Ng et al (2015) and Matochko et al., (2014) with minor modifications. Raw FASTQ data were processed using MatLab scripts described previously (Matochko et al.) with minor modifications to extract the copy numbers and enrichment ratios for significantly enriched sequences.

[0080] The following example illustrates calculation of the ratios for specific DNA sequences in The copy number of each read was offset by 1, to avoid division by zero, and then normalized by a total number of sequences in each column. The offset and normalized reads were averaged. R was calculated as the ratio of two averaged, normalized reads (eq. 1.1 and 1.2). Equation 1.3 describes specific example of calculation of one ratio for sequence SA-WYKL (SA is sulphonamide encoded by silent barcode). Note that all total number of sequences are in thousands of reads (i.e., 486 corresponds to 486,000 reads).

[00001] R 12 = Σ .Math. ( r i < MIX : BCA > + 1 ) T i < MIX : BCA > Σ .Math. ( r i < MIX : ConA > + 1 ) T i < MIX : ConA > ; R 13 = Σ .Math. ( r i < MIX : BCA > + 1 ) T i < MIX : BCA > Σ .Math. ( r i < MIX : Strep > + 1 ) T i < MIX : Strep > ; .Math. .Math. R 14 = Σ .Math. ( r i < MIX : BCA > + 1 ) T i < MIX : BCA > Σ .Math. ( r i < MIX : BSA > + 1 ) T i < MIX : BSA > ; R 15 = Σ .Math. ( r i < MIX : BCA > + 1 ) T i < MIX : BCA > Σ .Math. ( r i < MIX : amp > + 1 ) T i < MIX : amp > ( 1.1 ) R 0 = R 12 2 + R 13 2 + R 14 2 + R 15 2 ( 1.2 ) R 12 = Σ .Math. ( r i < MIX : BCA > + 1 ) T i < MIX : BCA > Σ .Math. ( r i < MIX : ConA > + 1 ) T i < MIX : ConA > = 661 + 1 486 + 940 + 1 515 + 255 + 1 568 0 + 1 459 + 0 + 1 491 + 0 + 1 528 = 596 ( 1.3 )

[0081] The present examples described herein focus on peptide libraries displayed on phage; however, other genetically-encoded libraries of peptides displayed on RNA, DNA, bacteria, yeast and other display systems known in the art may be used analogously.

EXAMPLE 1

A Specific Implementation of Peptide Libraries with Silent Barcodes

[0082] The M13KE vector, which is used in popular commercially-available Ph.D.-7 or Ph.D.-12 libraries, was used as the foundation for the present design. However, other phage/phagemid vectors and other display platforms may be used.

[0083] Production of libraries with silent barcodes required no modifications to phage-library cloning: restriction enzyme cloning to introduce different variants of SXXXXGGG linker was (see FIG. 1 for specific DNA sequences). Since production steps are identical, multiplex production and creating 5-10 libraries at once can be achieved.

[0084] FIG. 2 shows specific examples of silent barcodes introduced in the regions adjacent to random tetra-amino acid library. Nis any nucleotide, K is G or T; NNK is a common combination of nucleotides uses to encode a random amino acid.

[0085] The efficiency of modification by each cPTM was determined as previously described (Ng et al., 2012). As each modification uses the same bond-forming process, the efficiency of modifications was similar.

[0086] The preparation of single-stranded phage DNA for Illumina sequencing required no modification, because COG and S regions of the library reside in close proximity to each other and can be sequenced as described previously (Matochko et al., 2012)

EXAMPLE 2

Validation of the Barcode System with a Model Selection Assay Using Well-Defined Ligand-Target Pairs

[0087] This example describes the modification of four barcoded phage libraries produced in Example 1 by three ligands that recognize three specific proteins. Ligand 1 is biotin that recognizes streptavidin (target 1). Ligand 2 is sulfonamide that recognizes carbonic anhydrase. Ligand 3 is mannose that recognizes concanavaline A (target 3). Modification 4 is the absence of any modification (i.e. non-modified peptide libraries). Target 4 (BSA-coated well) was introduced, such that it is not specifically recognized by any modifications.

[0088] A mixed library containing modifications 1, 2, 3, and 4 against targets 1, 2,3, and 4 was panned. FIG. 3 illustrates a model selection assay of phage libraries with genetically encoded chemical modifications. In FIG. 3a, library phage were conjugated to compounds (FIG. 3b) through NaIO.sub.4 oxidation of N-terminal serine and a short quenching step with GSH, followed by oxime ligation of the compound. FIG. 3c-f show exemplary chemical modifications: HB1-Mannose (FIG. 3c), HB2-no modification (FIG. 3d), HB3-biotin (FIG. 3e), and HB4-streptavidin (FIG. 3f). FIG. 3g illustrates a mixed library containing equal ratios of each modified library incubated with immobilized streptavidin, carbonic anhydrase, ConA or an uncoated well, followed by a rinsing step and acid elution. Eluted phage were amplified and processed for single-stranded phage DNA isolation and sequencing by IIlumina. FIG. 3h uses stacked-bar representation to show the relative abundance of the barcodes in phage libraries. Prior to selection, the library contained ˜25:25:25:25 ratio of four barcodes. After selection on streptavidin, the ratio is ˜1:97:1:1, with barcode #2 dominating the population while selection on carbonic anhydrase yields ratio 97:1:1:1 with barcode #1 dominating the population. Barcodes #1 and #2 encode populations with biotin and sulfonamide respectively. Selection on unrelated target that should not be recognized by any modification, such as selection against blank, BSA-coated plate, does not yield enrichment of any barcode or this enrichment is not reproducible from experiment to experiment. Finally, the barcoded phage library is stable and its composition is not changed when the library is allowed to amplify without any selection.

[0089] FIG. 4 illustrates the confirmation of the presence of chemical modifiers: Biotin, Sulfonamide, D-Mannose, and unmodified on phage displayed libraries by measuring the input and output titers in panning of these phage libraries on the following four targets—streptavidin, bovine carbonic anhydrase II, concanavalin A, or BSA (“blank”)—coated on 96-well plates. Biotin and sulphonamide modified libraries enrich significantly in the wells coated by the cognate targets (streptavidin and carbonic anhydrase). Enrichment of mannose-modified libraries on ConA was modest, similarly to what was observed previously (Ng, S., 2015).

[0090] FIG. 3h illustrates that deep sequencing of the selected libraries 1, 2, 3, and 4 confirmed significant abundance of phage with “matched” modification. For example, when panning on carbonic anhydrase, 95% of the selected phage library members carried a silent barcode that indicated presence of sulfonamide.

[0091] FIG. 5 provides (A) a plot of ratio vs. p-value (“volcano plot”) in a selection of barcoded libraries against BCA and streptavidin; ligands with R>3 and p<0.05 were enriched in panning on BCA; those with R<0.3 and p<0.05 were enriched in panning on streptavidin. Equations below show calculation of ratios R from normalized fractions of each sequence. Two enriched sets have different chemical modifications—sulfonamide (SA) for BCA and. biotin (Bio) for streptavidin—and different sequence motifs. FIG. 5 provides copy numbers and ratios for selected sequences. (B) Sequences significantly enriched in panning on BCA but not in four control panning experiments on ConA, BSA, streptavidin or during amplification without selection (all in triplicates). The heat map describes copy numbers determined by deep sequencing.

[0092] FIG. 5 demonstrates that panning of the library with multiple modifications enriched not only specific modifiers but also specific peptide sequences. Using previously published enrichment analysis (Ng, et al., 2015) SA-modified peptides were identified as sequences that were significantly enriched (p<0.05) in panning on BCA when compared to panning on an unrelated target (BSA, Streptavidin or ConA, FIG. 3A). As an additional control, we screened for and discarded fast-growing “parasite sequences” (Matochko, et al., 2014) that emerged from amplified library phage without panning. For each test-control pair, the analysis can be illustrated as a volcano plot (FIG. 4 compares selection against BCA to selection against streptavidin; additional volcano plots are in FIG. 6).

[0093] FIG. 6 illustrates specific DNA sequences, peptides and sequence motifs identified in panning of the same mixed-modification library (from FIG. 3 or FIG. 5) on carbonic anhydrase (A) and strepatvatidine (B). Numbers represent normalized copy numbers of sequence in each panning experiment. “Blank” refers to well-coated with no target. “Naïve” refers to the library before selection and “Amplified” refers to the library amplified without any selection. “Ratio” represents a ratio of average copy number values.

[0094] The sequence copy number (abundance) in the library is illustrated, as measured by Illumina sequencing, in 12 different phage populations. Three of them, described in the first three columns, originate from panning on sulfonamide (SA), three from panning on blank, BSA-coated well, three samples represent the naïve (unselected) library and the last three represent library that was amplified without any selection. Deep sequencing revealed peptide motifs in the variable peptide region, which suggested that there are peptide sequences that synergize with chemical modification to provide increased affinity towards the target. By comparing the abundances in CA-selected samples with abundances in other experiments, sequences were identified that are preferentially enriched in selection against CA. It was observed that selection on CA peptides modified peptides that carry GGAGGAGGA barcode, which indicates that all peptides were modified by sulfonamide (SA). Furthermore, it is observed that only specific peptides sequences modified with SA are reproducibly selected whereas the other peptides modified by SA are not. Specifically, W-rich peptide sequences are selected for SA-modified libraries panned on carbonic anhydrase. The nature of the peptide sequence changes when the barcode and the target changes. For example, H-P-rich motifs are more preferentially selected on biotin-modified peptides selected against streptavidin.

[0095] FIG. 7 shows a volcano analysis of the copy number of peptides identified after panning and deep-sequencing of the mixed-modified libraries (MIX) against Bovine Carbonic Anhydrase (BCA) and four additional controls. (A): MIX panned on BCA compared to MIX on ConA; (B): MIX panned on BCA compared to MIX on Streptavidin; (C): MIX panned on BCA compared to MIX on BSA; (D): MIX panned on BCA compared to MIX-library amplified without any panning. Normalized ratios (R) for each experiment were calculated as described above. P-values were calculated using normalized reads and one-tailed, unequal variance Student t-test. Blue lines define the thresholds used for selection: p<0.05 and R>3. All sequences that satisfy these criteria display sulfonamide barcodes.

[0096] FIG. 8 shows an example of binding of peptide-sulfonamide (left) and carboxy-sulfonamide (right) and to carbonic anhydrase. Binding constants are 1.6 uM and 30 nM respectively demonstrating 30-fold benefit for attaching the peptide moiety to sulfonamide.

[0097] Testing the peptide-sulfonamide by binding assays—isothermal titration calorimetry—validated that selected sequences indeed provide advantages over sulfomanide itself.

[0098] FIG. 9 provides additional replicates of raw ITC data of sulfonamide-peptide (SA-XXXX) binding to carbonic anhydrase. Raw data obtained for 30 injections of ligands (20-95 μM) into a solution of carbonic anhydrase (2.5-12 μM) at 4-min intervals and 30° C. is shown. The integrated curve showed experimental points in microcalories per second and the best fit (−) to the single binding site model. The assay confirms that peptides selected in the screen, such as SA-WIVP, have strong affinity as low as 5 nanomolar, which is significantly (30-fold) stronger than the affinity of the control peptide SA-GGGG (150 nanomolar).

[0099] FIG. 10 shows analytical data for sulfonamide-modified peptides. FIG. 10A is SA-WYKL; FIG. 10B is SA-WQQQ; FIG. 10C is SA-WIVP; FIG. 10D is SA-WNTK; FIG. 10E is SA-YQYS; FIG. 10F is SA-WTSG; FIG. 10G is SA-WTWL; FIG. 10H is SA-WTYW; FIG. 10I is SA-FVVR; FIG. 10J is SA-TRPA; FIG. 10K is SA-WPAR; FIG. 10L is SA-YQYR; FIG. 10M is SA-GGGG.

EXAMPLE 3

Validation of the Barcode System with a Selection Assay Using Structurally-Related Ligands (Monosaccharides that Differ by One Atom or One Chiral Center)

[0100] This example describes the modification of six barcoded phage libraries produced in Example 1 by six structurally related ligands: Glucose, galactose, rhamnose, xylose, mannose short-linker and mannose long-linker.

[0101] FIG. 11 shows a selection assay of phage libraries with six genetically encoded carbohydrates introduces by chemical conjugation. FIG. 11A illustrates library phage that were conjugated to compounds through NaIO4 oxidation of N-terminal serine and a short quenching step with GSH, followed by oxime ligation of the compound. Glucose (1), galactose (2), rhamnose (3), xylose (4), mannose short-linker (5) and mannose long-linker (6), derivatives used for modification of the libraries. The figure shows a model panning assay, a mixed library containing defined ratios of each modified library was incubated with immobilized galectin 3, followed by a washing step and acid elution. Eluted phage were amplified and processed for a second round of selection where all barcoded libraries were uniformly decorated with galactose derivative. Single-stranded phage DNA was isolated for Illumina sequencing at round 1 and round 2. FIG. 11B shows an analysis of sequencing data. Phage eluted from galectin3 coated wells showed a pronounced binding preference for the corresponding protein target. Relative ratios of eluted phage correspond to the relative binding affinity of the modification for the target protein.

[0102] Panning these libraries against human Galectin-3 protein (Gal3) using a selection and deep-sequencing procedure similar to the procedures described in Example 2 found combinations of monosaccharides and tetramer peptides that bind to Gal3 when modified with Galactose, Glucose, Xylose and Rhamnose. The identity of monosacharides was decoded using “silent barcode” technology.

[0103] Using an ELISA-like competition assay (FIGS. 12, 13), the binding activity of these glycopeptides to carbohydrate recognition domain (CRD) of the human Galectin-3 and their ability to compete with binding of Lactose-conjugated horseradish peroxidase (HRP), were validated (FIG. 12). As references, we used known Gal3 ligands, such as lactose, Methyl-β-D-galactopiranoside (MeGal) and tetrasaccharide Lacto-N-Tetraose (LNT).

[0104] In this screen, multiple combinations of Gal and tetrapeptides were found that may inhibit interaction of Gal3 and Lactose-HRP significantly stronger than MeGa (FIG. 11). The glycopeptide Gal-PAPT was the most potent hit. Its ability to inhibit HRP-Lac binding to immobilized Galectin-3 plates was 5 times better than LNT, 30 times better than the Lactose and >1500 times better than MeGal activity.

[0105] FIG. 12 illustrates an evaluation of activity of hits identified from genetically-encoded libraries of glycopeptides against Galactose-3. The assay measures that inhibitory constant (denoted as Effective concentrations of half-maximal response or EC50) of compounds in the inhibition of the interaction between soluble HRP-Lactose and surface-immobilized Galectin-3. The Galactose modified glycopeptide Gal-PAPT had the strongest inhibition activity EC50: 0.014 mM, which is significantly lower than EC50 os any of the controls.The results revealed a combination glucose and tetramer peptide (Glu-SIYG) that binds to Gal3 and inhibits the binding of HRP-Lactose on Galectin 3 coated wells with 10 times higher potency than the control MeGal and it was similar to the affinity of Lactose (FIG. 12).

[0106] Surprisingly, it was found also that combinations of Xylose and Rhamnose with peptides can also bind specifically to Gal3 and compete with interaction of Gal3 with Lactose-HRP. Xylose-linked to the tetrapetide Xyl-ALRV compete with HRP-Lac with IC50 similar to MeGal. FIG. 13 shows representative raw data from the HRP-Lac competition experiments for peptides Gal-PAPT and Xyl-ALRV. The competitive activity is quantified as decrease in color development by HRP-lac conjugate bound to Galectin-3 coated at 10 μg/ml. concentration on polystyrene 96-well plates. Conjugate Rha-IVR was 400 times more potent inhibitor for Galectin-3 binding of HRP-Lac conjugate, than the control MeGal and 10 times better than Lactose control. This activity was in the same order of the LNT, which was reported that binds to Galectin-3 with a Kd of 97 nanomolars.

[0107] FIG. 14 shows chemical structures and characterization of glycan-peptide conjugates: FIG. 14A is Rha-IWVR, FIG. 14B is Xyl-ALRV, FIG. 14C is Glu-SIYG, FIG. 14D is Gal-PAPT.

REFERENCES

[0108] Chen, S.; Bertoldo, D.; Angelini, A.; Pojer, R; Heinis, C. Angewandte Chemie-International Edition 2014, 53, 1602.

[0109] Schlippe, Y. V. G.; Hartman, M. C. T.; Josephson, K.; Szostak, J. W. JACS 2012, 134, 10469.

[0110] Scott, J. K.; Smith, G. P. Science 1990, 249, 386.

[0111] Brenner, S.; Lerner, R. A. PNAS 1992, 89, 5381.

[0112] Santoso, B.; Lam, S.; Murray, B. W.; Chen, G. Bioorganic & Medicinal Chemistry Letters 2013, 23, 5680.

[0113] Kawakami, T.; Ishizawa, T.; Fujino, T.; Reid, P. C.; Suga, H.; Murakami, H. Acs Chemical Biology 2013, 8, 1205.

[0114] Josephson, K.; Hartman, M. C. T.; Szostak, J. W. JACS 2005, 127, 11727.

[0115] Jafari, M. R.; Deng, L.; Kitov, P. I.; Ng, S.; Matochko, W. L.; Tjhung, K. F.; Zeberoff, A.; Elias, A.; Klassen, J. S.; Derda, R. ACS Chem Biol 2014, 9, 443.

[0116] Heinis, C.; Rutherford, T.; Freund, S.; Winter, G. Nature Chemical Biology 2009, 5, 502.

[0117] Matochko, W. Chu, K.; Jin, B.; Lee, S. W.; Whitesides, G. M.; Derda, R. Methods 2012, 58, 47.

[0118] Ng, S.; Lin, E.; Kitov, P. I.; Tjhung, K. F.; Gerlits, O. O.; Deng, L.; Kasper, B.; Sood, A.; Paschal, B. M.; Zhang, P.; Ling, C. C.; Klassen, J. S.; Noren, C. J.; Mahal, L. K.; Woods, R. J.; Coates, L.; Derda, R. J. Am. Chem, Soc. 2015, 137, 5248-5251.

[0119] Guillon, R.; Pagniez, F.; Giraud, F.; Crépin, D.; Picot, C.; Le Borgne, M.; Morio, F.; Duflos, M. Logé, C.; Le Pape, P. Chem Med Chem 2011, 6, 816-825.

[0120] Kitov, P. I.; Vinals, D. F.; Ng, S.; Tjhung, K. F.; Derda, R. J. Am. Chem. Soc. 2014, 136, 8149-8152.

[0121] Kim, Y. W.; Grossmann, T. N.; Verdine, G. L. Nature protocols 2011, 6, 761-771.

[0122] Ng, S.; Jafari, M. R.; Matochko, W. L.; Derda, R. ACS Chem Biol 2012, 7, 1482-1487.

[0123] Matochko, W. L.; Cory Li, S.; Tang, S. K.; Derda, R. Nucleic Acids Res. 2014, 42, 1784-1798.

[0124] Wang, W.; Kitova, E. N.; Klassen, J. S. Anal. Chem. 2003, 75, 4945-4955.

[0125] Kitova, E. N.; El-Hawiet, A.; Schnier, P. D.; Klassen, J. S. J. Am. Soc. Mass. Spectrom. 2012, 23, 431-441.

[0126] El-Hawiet, A.; Kitova, E. N.; Klassen, J. S. Biochemistry 2012, 51, 4244-4253.

[0127] Sun, J.; Kitova, E. N.; Wang, W.; Klassen, J. S. Anal. Chem. 2006, 78, 3010-3018.

[0128] Chilkoti, A.; Tan, P. Stayton, P. S. Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 1754-1.758.

[0129] Green, N. M. Methods Enzymol. 1990, 184, 51-67.

[0130] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be incorporated by reference.

[0131] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and. scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.