Nucleic acid molecules capable of modulating target gene expression and uses thereof
20230193262 · 2023-06-22
Inventors
- Yoosik KIM (Daejeon, KR)
- Hyun Gyu PARK (Daejeon, KR)
- HANSOL KIM (Daejeon, KR)
- ryeongeun CHO (Daejeon, KR)
- JIN A LIM (Daejeon, KR)
- DOYEONG KU (Daejeon, KR)
Cpc classification
A61K45/06
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K31/7068
HUMAN NECESSITIES
C12N2310/3231
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
A61K31/7068
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/713
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
Abstract
This application pertains to a hairpin nucleic acid molecule capable of modulating expression of a target gene and a use thereof. A nucleic acid molecule according to an embodiment can modulate expression of a target gene in a specific manner for cells in which a miRNA hybridizable therewith is present, finding advantageous applications in compositions for regulating expression of a target gene or pharmaceutical compositions for treating diseases.
Claims
1. A nucleic acid molecule comprising: an X region capable of binding to a miRNA; and a Y region capable of binding to an mRNA of a target gene.
2. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule is represented by following General Formula 1 or 2:
5′-the X region-the Y region-3′ (General Formula 1)
5′-the Y region-the X region-3′ (General Formula 2).
3. The nucleic acid molecule of claim 1, wherein the X region comprises a nucleic acid sequence 40% or more complementary to the nucleic acid sequence of the mi RNA.
4. The nucleic acid molecule of claim 1, wherein the Y region comprises a nucleic acid sequence 80% or more complementary to the mRNA of the target gene.
5. The nucleic acid molecule of claim 1, wherein nucleotide residues of positions 10 and 11 from the 3′ end of the X region is not complementary to the miRNA.
6. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises the X region in the range of one to four.
7. The nucleic acid molecule of claim 6, wherein the different X regions are capable of binding to the same or different miRNAs.
8. The nucleic acid molecule of claim 1, wherein the X region consists of 10 to 22 nt nucleotides.
9. The nucleic acid molecule of claim 1, wherein the Y region consists of 15 to 20 nt nucleotides.
10. The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises at least one modified nucleotide or a backbone modification, wherein the modified nucleotide is a nucleotide residue modified with at least one selected from the group consisting of 2′-O-methyl, 2′-methoxyethoxy, 2′-fluoro, 2′-allyl, 2′-O-[2-(methylamino)-2-oxoethyl], 4′-thio, 4′-CH.sub.2—O-2′-bridge, 4′-(CH.sub.2).sub.2—O-2′-bridge, 2′-LNA, 2′-amino, and 2′-O—(N-methylcarbamate), and and the backbone modification is at least one selected from the group consisting of phosphonate, phosphorothioate, and phosphotriester.
11. The nucleic acid molecule of claim 1, wherein the miRNA is coupled with an RISC (RNA-induced silencing complex).
12. The nucleic acid molecule of claim 1, wherein the miRNA is present in diseased cells, and absent or hypoexpressed in normal cells.
13. The nucleic acid molecule of claim 1, wherein the miRNA is at least one selected from the group consisting of miR-141, miR-21, miR-200c, miR-222, let-7f, miR-155, miR-24, miR-29a, miR-27a, miR-200a, miR-200b, miR-429, miR-205, miR-30a, miR-34, miR-203, miR-10b, miR-31, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-22, miR-29b, miR-125b, miR-126, miR-146a, miR-193a, miR-196b, miR-223, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, miR-24, miR-9, miR-27, miR-103, and miR-107.
14. The nucleic acid molecule of claim 1, wherein the target gene is at least one selected from the group consisting of an anti-apoptotic gene, an oncogene, a protooncogene, and an epithelial-mesenchymal transition (EMT) promoting gene.
15. The nucleic acid molecule of claim 1, wherein the target gene is at least one selected from the group consisting of Mcl-1, Bcl-2, Bcl-xL, Snail1, Twist1, SLUG, Zeb1, TCF4, TCF3, FLT3, STATS, c-Sis, EGFR, Ras, CYCD, Her2, Myc, Raf, VIM, CDH2, FN1, ACTA2, COL1A1, and SNAI2.
16. A method for repressing expression of a target gene, comprising a step of administering the nucleic acid molecule of claim 1, in an effective amount to a subject.
17. A method for prevention or treatment of a cancer, comprising a step of administering the nucleic acid molecule of claim 1, in a pharmaceutically effective amount to a subject.
18. The method of claim 17, wherein the method induces apoptosis of cancer cells or inhibits metastasis of cancer cells.
19. The method of claim 17, wherein the cancer is at least one solid cancer selected from the group consisting of liver cancer, lung cancer, pancreatic cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, endometrial cancer, cervical cancer, gallbladder cancer, gastric cancer, biliary tract cancer, colorectal cancer, head and neck cancer, thyroid cancer, brain tumor, malignant melanoma, prostate cancer, testicular cancer, and tongue cancer, or at least one blood cancer selected from the group consisting of leukemias such as chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), non-Hodgkin lymphomas (NHL), acute myeloid leukemia (AML), and lymphomas.
20. The method of claim 17, wherein the method further comprises a step of administering an anticancer agent selected from the group consisting of cytarabine, azacitidine, decitabine, paclitaxel, Adriamycin, and tamoxifen.
21. The method of claim 17, wherein the cancer is breast cancer, and the nucleic acid molecule is capable of binding to at least one miRNA selected from the group consisting of miR-222, miR-141, miR-21, miR-200c, miR-222, let-7f, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, and miR-24.
22. The method of claim 21, wherein the nucleic acid molecule is capable of binding to at least one target gene selected from the group consisting of mcl-1, bcl-xL, and bcl-2.
23. The method of claim 17, wherein the cancer is acute myeloid leukemia (AML), and the nucleic acid molecule is capable of binding to at least one miRNA selected from the group consisting of miR-155, miR-21, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-10b, miR-22, miR-29b, miR-125b, miR-126, miR-146a, miR-193a, miR-196b, and miR-223.
24. The method of claim 23, wherein the nucleic acid molecule is capable of binding to at least one target gene selected from the group consisting of mcl-1, bcl-xL, and bcl-2.
25. The method of claim 17, wherein the cancer is uterine cervical cancer, and the nucleic acid molecule is capable of binding to at least one miRNA selected from the group consisting of miR-141 and miR-200c.
26. The method of claim 25, wherein the nucleic acid molecule is capable of binding to at least one target gene selected from the group consisting of mcl-1, bcl-xL, and bcl-2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
DETAILED DESCRIPTION OF THE INVENTION
[0062] Provided herein is a nucleic acid molecule that is capable of binding to both a miRNA and a target gene, thereby suggesting that the expression of the target gene can be modulated specifically in cells, tissues, and/or organs where the miRNA capable of binding to the nucleic acid molecule is present (and/or overexpressed).
[0063] The technique provided herein pertains to a nucleic acid molecule capable of modulating the expression of a target gene, and a use thereof and, more particularly, can modulating the expression of a target gene in a manner specific for the site where a miRNA is expressed (cells, tissues, and/or organs), wherein the target gene is not complementary to the nucleic acid sequence of the miRNA at all.
[0064] As used herein the term “nucleic acid” or “polynucleotide” refers to a polymer composed of deoxyribonucleotides, ribonucleotides, or modified nucleotides in a single- or double-stranded form and is intended to encompass nucleic acids bearing nucleotide analogs or modified backbone residues or linkages known in the art. For example, the term ‘nucleic acid” or “polynucleotide” includes single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
[0065] The term “miRNA” (microRNA), as used herein, refers to a small RNA that functions to mediate RNA interference (RNAi), and/or RNA silencing.
[0066] Herein, the term “nucleotide” is used as is recognized in the art. A nucleotide generally comprises a base, a sugar, and a phosphate moiety. The base may be a natural base (standard) or a modified base as is well known in the art. Such bases are generally located at the 1’ position of a nucleotide sugar moiety. Additionally, the nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety.
[0067] By “hybridizable” or “complementary” or “substantially complementary” as used herein, it is meant that a nucleic acid (e.g. RNA, DNA) comprises a sequence of nucleotides that enables it to non-covalently bind, i.e. form Watson-Crick base pairs and/or G/U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and/or in vivo conditions of temperature and solution ionic strength. Standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C) [DNA, RNA]. In addition, for hybridization between two RNA molecules (e.g., dsRNA), guanine (G) base pairs with uracil (U). For example, G/U base-pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anti-codon base-pairing with codons in mRNA. As used herein, the term “hybridization” refers to formation of a double-stranded nucleic acid between complementary single-stranded nucleic acids.
[0068] Hybridization can occur when the complementarity between two nucleic acid strands is perfect (perfect match) or even when some mismatched residues exist. The complementarity level for hybridization may vary depending on hybridization conditions, particularly annealing temperature.
[0069] As used herein, the term “homology” describes a degree of consensus between nucleotide sequences or amino acid sequences given and can be expressed in percentage (%). For example, a homology can be determined using a readily available computer program in which sequence information, e.g., parameters, such as scores, identity, similarity, etc., are directly aligned between two polynucleotide molecules or two polypeptide molecules. The computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), etc.
[0070] An aspect provides a nucleic acid molecule capable of binding to both a miRNA and an mRNA of a target gene, the nucleic acid molecule comprising:
[0071] an X region capable of binding to the miRNA; and
[0072] a Y region capable of binding to the mRNA of the target gene.
[0073] As used herein, the term “target gene” is a gene of which expression is inhibited at an mRNA level and/or a protein level by the nucleic acid molecule according to an embodiment of the present disclosure. The target gene may be an endogenous gene or a transgene introduced into a cell by an expression vector. For example, the target gene may be a gene which causes a disease.
[0074] In an embodiment, the nucleic acid molecule may be represented by the following General Formula 1 or 2:
5′-X region-Y region-3′ (General Formula 1)
5′-Y region-X region-3′ (General Formula 2).
[0075] The nucleic acid molecule may include an X region capable of binding to (hybridizing with) a miRNA. In an embodiment, the X region may include a nucleic acid sequence 35% or more, 36% or more, 37% or more, 38% or more, 39% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, 99.8% or more, 99.9% or more, or 100% complementary to the entire or partial nucleic acid sequence of a miRNA of interest and as such, can bind to (hybridize) with the miRNA.
[0076] In an embodiment, the nucleic acid molecule may comprise the X region in the range of 1 to 10, 2 to 10, 3 to 10, 1 to 8, 2 to 8, 3 to 8, 1 to 6, 2 to 6, 3 to 6, 1 to 5, 2 to 5, 3 to 5, 1 to 4, 2 to 4, or 3 to 4.
[0077] In an embodiment, the X region may include X.sub.1, X.sub.2, . . . , and X.sub.n. In this regard, the nucleic acid molecule can be represented by the following General Formula 3 or 4:
5′-X.sub.1-X.sub.2- . . . -X.sub.n-Y region-3′ (General Formula 3)
5′-Y region-X.sub.1-X.sub.2- . . . -X.sub.n-3′ (General Formula 4)
[0078] wherein X.sub.1, X.sub.2, . . . , and X.sub.n are each capable of binding to one miRNA, and n is a natural integer selected from, for example, 1 to 10 (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).
[0079] In an embodiment, when the nucleic acid molecule includes a plurality of X regions, the X regions may bind to the same or different miRNAs and may be composed of the same or different nucleic acid sequences.
[0080] In an embodiment, the X region may consist of a number of nucleotides the same as or smaller than that of the miRNA to which the nucleic acid molecule can bind. By way of example, the X region may be 15 to 30 nt, 15 to 28 nt, 15 to 27 nt, 15 to 26 nt, 15 to 25 nt, 16 to 30 nt, 16 to 28 nt, 16 to 27 nt, 16 to 26 nt, 16 to 25 nt, 17 to 30 nt, 17 to 28 nt, 17 to 27 nt, 17 to 26 nt, 17 to 25 nt, 18 to 30 nt, 18 to 28 nt, 18 to 27 nt, 18 to 26 nt, 18 to 25 nt, 19 to 30 nt, 19 to 28 nt, 19 to 27 nt, 19 to 26 nt, 19 to 25 nt, 20 to 30 nt, 20 to 28 nt, 20 to 27 nt, 20 to 26 nt, or 20 to 25 nt long.
[0081] In an embodiment, nucleotide residues of positions 10 and 11 from the 3′ end (or 5′ end) of the X region may be not complementary to the corresponding miRNA.
[0082] The nucleic acid molecule may include a Y region capable of binding to (hybridizing with) an mRNA of a target gene. In an embodiment, the Y region may include a nucleic acid sequence 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, 99.8% or more, 99.9% or more, or 100% complementary to the entire or a partial nucleic acid sequence of mRNA of a target gene of interest so that it can bind to (hybridize with) the mRNA of the target gene.
[0083] In an embodiment, the Y region may include a nucleic acid sequence capable of binding to (hybridizing with) a partial nucleic acid of a target gene, for example, include a nucleic acid sequence complementary to a partial sequence of a 3′-untranslated region (UTR) and/or a 5′-untranslated region of a target gene. In an embodiment, for the selection of a target region, a list of siRNA candidates for the target gene are acquired using on-line siRNA design tools (e.g., GenScript, Eurofins Genomics, siRNA Wizard, Block-iT RNAi Designer, etc.) and RNA-binding protein recognition regions and proximal regions (e.g., within about 20 nucleotides) obtained from such tools by ENCODE eCLIP data analysis can be used.
[0084] In an embodiment, the sequence of the Y region may be as long as or shorter than that of the mRNA to which the nucleic acid molecular can bind, for example, may be 10 to 30 nt, 10 to 28 nt, 10 to 25 nt, 10 to 24 nt, 10 to 23 nt, 10 to 22 nt, 10 to 21 nt, 10 to 20 nt, 10 to 18 nt, 10 to 16 nt, 10 to 15 nt, 10 to 14 nt, 11 to 30 nt, 11 to 28 nt, 11 to 25 nt, 11 to 24 nt, 11 to 23 nt, 11 to 22 nt, 11 to 21 nt, 11 to 20 nt, 11 to 18 nt, 11 to 16 nt, 11 to 15 nt, 11 to 14 nt, 12 to 30 nt, 12 to 28 nt, 12 to 25 nt, 12 to 24 nt, 12 to 23 nt, 12 to 22 nt, 12 to 21 nt, 12 to 20 nt, 12 to 18 nt, 12 to 16 nt, 12 to 15 nt, 12 to 14 nt, 13 to 30 nt, 13 to 28 nt, 13 to 25 nt, 13 to 24 nt, 13 to 23 nt, 13 to 22 nt, 13 to 21 nt, 13 to 20 nt, 13 to 18 nt, 13 to 16 nt, 13 to 15 nt, 13 to 14 nt, 14 to 30 nt, 14 to 28 nt, 14 to 25 nt, 14 to 24 nt, 14 to 23 nt, 14 to 22 nt, 14 to 21 nt, 14 to 20 nt, 14 to 18 nt, 14 to 16 nt, or 14 to 15 nt long.
[0085] In an embodiment, the nucleic acid molecule bears at least one modified nucleotide or includes a backbone modification. The modified nucleotide may be a nucleotide residue modified with at least one selected from the group consisting of 2′-O-methyl, 2′-methoxyethoxy, 2′-fluoro, 2′-allyl, 2′-O-[2-(methylamino)-2-oxoethyl], 4′-thio, 4′-CH.sub.2—O-2′-bridge, 4′-(CH.sub.2).sub.2—O-2′-bridge, 2′-LNA, 2′-amino, and 2′-O—(N-methylcarbamate). The backbone modification may be made by at least one selected from the group consisting of phosphonate, phosphorothioate, and phosphotriester.
[0086] The nucleic acid molecule according to an embodiment can bind to a miRNA wherein the miRNA may be a posttranslational regulatory, non-coding RNA that functions in post-transcriptional regulation by binding to a 3′UTR (untranslated region) of a target RNA (a target of miRNA) to promote mRNA degradation or to induce translational repression.
[0087] In an embodiment, the term “miRNA” refers to a mature miRNA, functioning as a guide RNA, which is formed by cleaving a precursor having a hairpin structure, called pre-miRNA (precursor microRNA), with the RNase III dicer.
[0088] In an embodiment, a miRNA may be coupled with an RISC (RNA-induced silencing complex) (or loaded into an RISC) to form a ribonucleotide complex. The nucleic acid molecule according to an embodiment may bind to both a miRNA and an mRNA of a target gene and the miRNA may be coupled with an RISC which may, in turn, induce degradation (cleavage) and/or translational repression of the mRNA bound to the nucleic acid molecule.
[0089] In an embodiment, the miRNA may be present or overexpressed in diseased cells (tissues or organs) and may be absent or hypoexpressed in normal cells (tissues, or organs). The disease may be cancer and the diseased cells may be cancer cells.
[0090] The phrase “miRNA is present in diseased cells and is absent or hypoexpressed in normal cells” means that the miRNA is present or high in expression level (overexpressed) in diseased cells (abnormal cells) compared to normal cells and is absent or low in expression level in normal cells compared to diseased cells. Binding to a miRNA present or overexpressed in diseased cells, the nucleic acid molecule according to an embodiment can regulate (e.g., decrease) the expression of a target gene in a diseased cell-specific manner without any influence on the expression of the target gene in normal cells. As used herein, the term “normal cells” (tissue, or organs) refer to wild-type cells (tissues, or organs) and/or cells (tissues, or organs) isolated from a subject without the disease of interest.
[0091] The nucleic acid molecule according to the present disclosure may regulate expression of a target gene in a specific manner for cells (tissues, or organs) where a miRNA is present or overexpressed, for example, the nucleic acid molecule which bind to (i) a miRNA present in diseased cells and absent in normal cells and/or (ii) a miRNA higher in expression level in diseased cells than normal cells can regulate expression of a target gene in a diseased cell (tissue, or organ)-specific manner, and may have no influence on expression of the target gene in normal cells.
[0092] In an amount, the miRNA may be present or overexpressed cells (tissues, or organs), for example, may be at least one selected from the group consisting of miR-141, miR-21, miR-200c, miR-222, let-7f, miR-155, miR-24, miR-29a, miR-27 (e.g., miR-27a), miR-200a, miR-200b, miR-429, miR-205, miR-30a, miR-34, miR-203, miR-10b, miR-31, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-22, miR-29b, miR-125b, miR-126, miR-146a, miR-193a, miR-196b, miR-223, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, miR-24, miR-9, miR-103, and miR-107.
[0093] The nucleic acid molecule according to an embodiment may regulate expression of a target gene. For example, the target gene may be at least one selected from the group consisting of an anti-apoptotic gene (pro-apoptotic gene), an oncogene, a protooncogene, and an epithelial-mesenchymal transition (EMT) promoting gene. The anti-apoptotic gene may be Mcl-1, Bcl-2, and/or Bcl-xL, the oncogene may be Raf, EGFR, c-Sis, and/or Ras, and the protooncogene may be Ras, CYCD, Her2, and/or Myc. The angiogenic gene may be Twist1, Snail1, SLUG, Zeb1, TCF4, and/or TCF3. In an embodiment, the target gene may be at least one selected from the group; consisting of mcl-1, bcl-xL, bcl-2, Snail1, Twist1, SLUG, Zeb1, TCF4, TCF3, FLT3, STATS, c-Sis, EGFR, Ras, CYCD, Her2, Myc, Raf, VIM, CDT-12, FN1, ACTA2, COL1A1, and SNAI2.
[0094] Another aspect provides a composition for modulating expression of a target gene. The composition for modulating expression of a target gene contains the nucleic acid molecule according to an embodiment, and as such, can modulate expression of the target gene in a specific manner for cells, tissues, or organs where a specific miRNA exists.
[0095] In an embodiment, the composition for modulating expression of a target gene may downregulate mRNA and/or protein expression of the target gene.
[0096] The composition for regulating expression of a target gene may further contain a vehicle in addition to the nucleic acid molecule. The vehicle may be at least one selected from the group consisting of a lipid molecule, a liposome, a micelle, and a cationic lipid.
[0097] In one embodiment, the nucleic acid molecule may be delivered by direct application or in the form of a complex with a cationic lipid or the form of a package within a liposome. For example, the nucleic acid molecule can be administered to cells and/or a subject by a variety of methods known to those of skill in the art, including encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres, biodegradable nanocapsules, and bioadhesive microspheres.
[0098] As used herein, the term “liposome” refers to a vesicle composed of amphipathic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the nucleic acid molecule. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the nucleic acid molecule, although in some examples, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the nucleic acid molecule are delivered into the cell where the nucleic acid molecule can specifically bind to a target RNA and can mediate RNAi. In some embodiments, the liposomes are also specifically targeted to direct the nucleic acid molecule to particular cell types.
[0099] “Micelles” are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.
[0100] Another aspect provides a pharmaceutical composition containing the nucleic acid molecule for prevention or treatment of cancer.
[0101] In an embodiment, the pharmaceutical composition may induce apoptosis of cancer cells or inhibit metastasis of cancer cells.
[0102] In an embodiment, the cancer may be:
[0103] at least one solid cancer selected from the group consisting of liver cancer, lung cancer (e.g., non-small cell lung cancer), pancreatic cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, endometrial cancer, cervical cancer, gallbladder cancer, gastric cancer, biliary tract cancer, colorectal cancer, head and neck cancer, thyroid cancer, brain tumor, malignant melanoma, prostate cancer, testicular cancer, and tongue cancer, or
[0104] at least one blood cancer selected from the group consisting of lymphomas and leukemias such as chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), non-Hodgkin lymphomas (NHL), and acute myeloid leukemia (AML).
[0105] The pharmaceutical composition may be administered as an independent drug or may be co-administered with other drugs. In the case of co-treatment, they may be administered simultaneously or sequentially.
[0106] In an embodiment, the pharmaceutical composition may further contain an anticancer agent in addition to the nucleic acid molecule. The additionally contained anticancer agent may be an agent that is not designed to reduce the expression of the miRNA hybridizable with the nucleic acid molecule. For example, the pharmaceutical composition may further contain at least one anticancer agent selected from the group consisting of cytarabine, azacitidine, decitabine, paclitaxel, Adriamycin, and tamoxifen.
[0107] For practical application, the pharmaceutical composition may be formulated into oral dosage forms such as pulvis, granules, capsules, tablets, aqueous suspensions, and the like, agents for external use, suppositories, and sterile injections. An pharmaceutical composition according to an embodiment may include a pharmaceutically effective carrier. For oral administration, the pharmaceutically effective carrier may include a binder, a lubricant, a disintegrator, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a coloring agent, and a perfume. For injectable formulation, the pharmaceutically effective carrier may include a buffering agent, a preserving agent, an analgesic, a solubilizer, an isotonic agent, and a stabilizer. For formulations of topical administration, the pharmaceutically effective carrier may include a base, an excipient, a lubricant, and a preservative. The pharmaceutical composition of the present disclosure may be formulated in various forms by adding the pharmaceutically effective carriers. For example, for oral administration, the pharmaceutical composition may be formulated into tablets, troches, capsules, elixirs, suspensions, syrups or wafers. For injectable preparations, the pharmaceutical composition may be prepared into a single-dose ampule or multidose container. The pharmaceutical composition may be formulated into single-dose ampule or multidose container. The pharmaceutical composition may be also formulated into solutions, suspensions, tablets, pills, capsules, and sustained release preparations.
[0108] Examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oils or the like. In addition, the formulation may further include fillers, anti-coagulating agents, lubricants, humectants, perfumes, antiseptics or the like.
[0109] As used herein, the terms “pharmaceutically effective” means neither significantly stimulating an organism nor inhibiting the biological activity and characteristics of an active material administered. According to an embodiment, the pharmaceutical composition including a pharmaceutically effective carrier may be prepared into a formulation selected from the group consisting of a tablet, a pill, pulvis, granules, a capsule, a suspension, a liquid solution for internal use, an emulsion, a syrup, a sterile aqueous solution, a non-aqueous solution, a suspension, an emulsion, a lyophilizate, and a suppository.
[0110] The pharmaceutical composition may be in various formulations for oral or parenteral administration. The pharmaceutical composition may be formulated with a typically used diluent or excipient such as a filler, a thickener, a binder, a humectant, a disintegrant, a surfactant, etc.
[0111] Solid formulation agents for oral administration include tablets, pills, powders, granules, and capsules, and such solid dosage forms are formulated by mixing at least one active ingredient with one or more excipients, such as starch, calcium carbonate, sucrose, lactose, and gelatin. Also, lubricants such as magnesium stearate and talc can be used other than simple excipients. Liquid formulation agents for oral administration may be exemplified by suspensions, solutions for internal use, emulsions, and syrups, and may include various such as humectants, sweeteners, fragrances, and preservatives, in addition to simple diluents such as water and liquid paraffin.
[0112] Formulation agents for parenteral administration may be illustrated as sterile aqueous solutions, nonaqueous solvents, suspensions, emulsions, lyophilizates, and suppositories. Nonaqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable esters such as ethyl oleate. As a base of suppositories, witepsol, macrogol, Tween 61, cacao butter, laurin butter, or glycerogelatin may be used.
[0113] In an embodiment, the pharmaceutical composition may be administered to a subject via various routes. As used herein, the term “administration” means providing a given substance to a subject (patient) by any suitable method. The pharmaceutical composition may be administered orally or parenterally through any general route as long as it can reach the target tissue. All modes of administration may be contemplated. For example, oral administration or parenteral administration, such as intravenous, intramuscular, subcutaneous, intraperitoneal, intralesional, and topical administration, may be employed. In addition, the composition according to an embodiment may also be administered using any device capable of delivering the active ingredient to target cells.
[0114] The pharmaceutical composition according to the present disclosure may be administered through various routes, including, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardial, transdermal, subcutaneous, intraperitoneal, intranasal, gastrointestinal, local, sublingual, and rectal routes. As used herein, the term “partenteral” is intended to encompass subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present disclosure may also be administered in the form of suppositories for rectal administration.
[0115] The dose of the pharmaceutical composition of the present disclosure may vary depending on various factors, including the activity of a particular compound used, the patient's age, weight, general health, sex, diet, administration time, administration mode, excretion rate, drug combination and the severity of a particular disease to be prevented or treated. The dose of the pharmaceutical composition and/or the effective amount of the active ingredient (i.e., nucleic acid molecule) of the pharmaceutical composition may be suitably selected by a person skilled in the art and may vary depending on the patient's condition, weight, the severity of the disease, the type of drug, administration mode and period. The pharmaceutical composition may be administered at a dose of 0.0001 to 50 mg/kg or 0.001 to 50 mg/kg per day. The pharmaceutical composition may be administered once or several times (e.g., twice to four times, or three times) per day.
[0116] Another aspect provides a method for repressing expression of a target gene, the method including a step of administering the nucleic acid molecule, and/or the composition for regulating expression of the gene in an effective amount to a subject. The method for repressing expression of a target gene may further include a step of identifying whether the subject is in need of repressing expression of the gene, prior to the administering step.
[0117] In an embodiment, the method for repressing expression of a target gene may be to repress expression of a target gene in a target cell in vitro. The target cell may be a cell in which a miRNA hybridizable with the nucleic acid molecule exists or is overexpressed.
[0118] Another aspect provides a method for prevention or treatment of a cancer or a proliferative disease, the method including a step of administering the nucleic acid molecule, the composition for regulating expression of a target gene, and/or the pharmaceutical composition in a pharmaceutically effective amount to a subject. The prophylactic or therapeutic method may include identify whether the subject (individual) is in need of preventing or treating a cancer or a proliferative disease, prior to the administering step.
[0119] In the method for regulating expression of a gene or the method for prevention or treatment of a cancer or a proliferative disease, the method, route, and dose of the nucleic acid and/or the composition for repressing expression of a target gene are as defined above.
[0120] As used herein, the term “pharmaceutically effective amount” or “effective amount” refers to a content or dose of an active ingredient (nucleic acid molecule according to an embodiment) capable of showing desirable pharmacological effects (e.g., effects of inhibiting expression of a target gene or preventing and/or treating cancer or a proliferative disease) and it may be determined in a variety of ways, depending on factors such as formulation methods, administration modes, patient's age, body weight, sex, pathologic conditions, and diets, administration time, administration route, excretion speed, and reaction sensitivity.
[0121] The term “subject”, “individual”, or “patient”, as used herein, means an organism to which an nucleic acid molecule according to an embodiment can be administered. The subject may include mammals (e.g., primates such as humans, monkeys, or mammals exclusive of humans), donors or recipients of explanted cells, and cells or tissues isolated from the mammals, or a culture thereof.
[0122] In an embodiment, when the cancer to be prevented and/or treated by the pharmaceutical composition is breast cancer, the nucleic acid molecule contained in the pharmaceutical composition may bind to at least one miRNA selected from the group consisting of miR-222, miR-141, miR-21, miR-200c, miR-222, let-7f, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, and miR-24 and to at least one target gene selected from the group consisting of mcl-1, bcl-xL, and bcl-2.
[0123] In an embodiment, when the cancer to be prevented and/or treated by the pharmaceutical composition is acute myeloid leukemia (AML), the nucleic acid molecule contained in the pharmaceutical composition may bind to at least one miRNA selected from the group consisting of miR-155, miR-21, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-10b, miR-22, miR-29b, miR-125b, miR-126, miR-146a, miR-193a, miR-196b, and miR-223 and to at least one target gene consisting of mcl-1, bcl-xL, and bcl-2.
[0124] In an embodiment, when the cancer to be prevented and/or treated by the pharmaceutical composition is uterine cervical cancer, the nucleic acid molecule contained in the pharmaceutical composition may bind to at least one miRNA selected from the group consisting of miR-141 and miR-200c and to at least one target gene selected from the group consisting of mcl-1, bcl-xL, and bcl-2.
[0125] Being capable of regulating expression of a target gene in a specific manner for cells where a miRNA hybridizable with the nucleic acid molecule according to an embodiment, the nucleic acid molecule can find advantageous applications for use in a composition for modulating expression of a target gene or a pharmaceutical composition for treatment of a disease.
DETAILED DESCRIPTION
[0126] A better understanding of the present disclosure may be obtained in light of following examples which are set forth to illustrate, but are not to be construed to limit, the present disclosure.
Reference Example 1. Construction of miRNA Trigger
[0127] Polynucleotides (hereinafter referred to as “miRNA triggers”) that each include a portion capable of binding to a miRNA and a portion capable of binding to an mRNA were requested for synthesis in Bioneer and purified through HPLC before use in experiments. Intracellular stability was achieved by introducing a chemical modification such as LNA (locked nucleic acid), PS (phosphorothioate), or 2′-O-Me (2′-O-Methyl) into the polynucleotides upon construction thereof.
Reference Example 1-1. Construction of miRNA Trigger in Linear Structure
[0128] The miRNA triggers constructed in this Example have the following structure:
[5′-portion capable of binding to miRNA (1) (mi(1)*)-portion capable of binding to miRNA (2) (mi(2)*)-portion capable of binding to mRNA of target gene (T*)-3′].
[0129] The portions capable of binding to miRNAs were as long as the miRNAs to be hybridized therewith and ranged in length from 20 to 25 nt depending on types of miRNAs. The portions capable of binding to miRNAs were each designed to mismatch with the miRNA at the 10.sup.th to 11.sup.th nucleotide residues from the 3′ end thereof and to include a sequence perfectly complementary to the miRNA, except for the mismatched residues.
[0130] The portion capable of binding to an mRNA of a target gene (hereinafter referred to as “target mRNA) was designed to be 14 to 20 nt in length and include a sequence complementary to that of the target mRNA.
[0131] The miRNA trigger constructed in this Example included two portions capable of two respective miRNAs and their sequences might be identical to or different from each other.
[0132] The miRNA trigger constructed in the Example was named “linear miRNA trigger” or “linear probe” (LP) to discriminate from the miRNA trigger constructed in the Example 1-2, below. Specific names of individual linear miRNA triggers were made in the pattern of [name of hybridizable target gene_name of hybridizable miRNA(2)_name of hybridizable miRNA(1)].
Reference Example 1-2. Construction of miRNA Trigger in Hairpin Structure
[0133] The miRNA triggers constructed in this Example have the following structure:
[5′-portion capable of binding to mRNA of target gene (T*)-portion capable of binding to miRNA (mi*)-portion capable of binding to T* (T)-3′].
[0134] Since the miRNA trigger constructed in this Example included sequences complementarily hybridizable with each other (T and T* in the structure), the flank portions (T and T*) of the mi* portion are hybridized with each other so that the miRNA trigger may have the form of a hairpin miRNA trigger in a stem-loop structure. The stem structure in the hairpin miRNA trigger results from the hybridized structure between T and T* portions while the loop structure is accounted for by the mi* portion. The miRNA trigger having such a hairpin structure was named “hairpin miRNA trigger” or “hairpin probe” (HP). Specific names of individual hairpin miRNA triggers were made in the pattern of [HP_name of hybridizable target gene_name of hybridizable miRNA].
[0135] The portion capable of binding to a miRNA (mi*), (that is, the portion corresponding to the loop of the hairpin) was as long as the miRNA to be hybridized therewith and ranged in length from 20 to 25 nt depending on types of the miRNA. When the portion binding complementarily to a miRNA was designed to mismatch with the miRNA at the 10.sup.th to 11.sup.th nucleotide residues (M2) from the 3′ end thereof and to include a sequence perfectly complementary to the miRNA, except for the mismatched residues, specific names of individual hairpin miRNA triggers were made in the pattern of [HP_name of hybridizable target gene_M2_name of hybridizable miRNA]. When the portion capable of binding to a miRNA was designed to have no mismatches with the miRNA, the HP was named in the pattern of [HP_name of hybridizable target gene_name of hybridizable miRNA]. The portion capable of binding to an mRNA of a target gene (hereinafter referred to “target mRNA), that is, the stem of the hairpin, was designed to range in length from 12 to 22 nt and include a sequence complementary to that of the target mRNA.
Reference Example 2. Design of miRNA Trigger and Assay for Performance Thereof
[0136] In order to examine whether intended hybridization was made among a miRNA trigger (M2 S12 miR141: 5′-CAAGAGGATTATCCATCTTTACCTCACAGTGTTAATAATCCTCTTG-3′; SEQ ID NO: 18), a miRNA (miR-141: 5′-UAACACUGUCUGGUAAAGAUGG-3′; SEQ ID NO: 17), and an mRNA (Mcl-1 mRNA 5′-GCAAGUGGCAAGAGGAUUAU-3′; SEQ ID NO: 131), a thermodynamic analysis was conducted using NUPACK (California Institute of Technology, http://www.nupack.org/). This analysis was carried out 37° C. in an aqueous solution containing 100 nM constituents (miRNA trigger, miRNA, mRNA) and 1.0 M Na.sup.+ ions. Using Oligo Analyzer version 3.1 of the IDT (Integrated DNA Technologies) website (http://www.idtdna.com), the melting point (Tm) was analyzed. The reaction products were separated at a constant voltage of 120 V for 180 minutes in a 20% polyacrylamide gel in 1×TBE buffer (Tris base 89 mM, boric acid 89 mM, EDTA 20 mM). After staining with GelRed, a gel image was obtained using Gel Doc EZ Imager (Bio-rad, Hercules, USA).
Reference Example 3. Assay for Resistance to Biological Degradation
[0137] A human serum was purchased from Sigma-Aldrich. A Bela cell lysate was prepared using RIPA buffer (NaCl 150 mM, EDTA 5 mM, Tris 50 mM, NP-40 1.0%, sodium deoxycholate 0.5%, SDS 0.1%). Oligonucleotides were mixed with the human serum, the cell lysate, or distilled water and incubated at 37° C. for 24 hours. Final concentrations of the human serum and the cell lysate were 80% and 5 mg/mL, respectively. Thereafter, the mixture was loaded to a centrifugal filter (MWCO=30 kDa, Millipore) and centrifuged at 14,000 g fir 30 minutes. Finally, a filtrate containing an oligonucleotide (˜15 kDa) was obtained. Separation was made for 120 minutes under a constant voltage of 120 V in a 15% polyacrylamide gel in 1×TBE buffer. After staining with EtBr, a gel image was obtained using Gel Doc EZ Imager (Bio-rad, Hercules, USA).
Reference Example 4. Cell Culture and Establishment of Stable Cell Line
[0138] A total of 11 cancer cell lines (HeLa, HeLa-141, HeLa-200c, MCF-7, MDA-MB-231, MDA-MB-453, HL-60, MV4-11, NB-4, and MOLM-14) were cultured according to the recommended conditions required therefor, respectively. The cell lines were purchased from the American Type Culture Collection (ATCC; Manassas, Va., US). Genomic Hela-141 and Hela-200c cells were genetically modified by adenoviral genetic recombination. The transformed Hela cell lines were provided from the laboratory of Professor V. Narry Kim, Seoul National University. The tetracycline-off system was used to establish Hela-141 and Hela-200c that overexpressed miR-141 and miR-200c, respectively, compared to their parent cell line. Each cell line was maintained at 37° C. in a 5% CO.sub.2 atmosphere and passaged every 3-4 days upon confluency. In all experiments, the cells were incubated and stabilized at least 18 hours before experimentation. All the cells used in this study were maintained in DMEM (Dulbecco's Modified Eagle Media) or RPMI-1640 supplemented with 10% fetal bovine serum (FBS).
Reference Example 5. Transfection of miRNA Trigger
[0139] Transfection into adherent cells (HeLa, HeLa-141, HeLa-200c, MCF-7, MDA-MB-231, and MDA-MB-453) was performed using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's instruction. For transfection into suspended cells (HL-60, MV4-11, NB-4, and MOLM-14), the Neon transfection system (Thermo Fisher Scientific) was used according to the manufacturer's instruction.
Reference Example 6. Assay for mRNA Trigger in AML Patient Sample
[0140] Peripheral blood samples were taken from seven AML patients. All patient information and samples were delivered from the Seoul National University Hospital (SNUH) in compliance with the Institutional Review Board (IRB) requirements for use of research samples. The cells were thawed and incubated at a density of 1×10.sup.6 cells/ml or greater in DMEM (Dulbecco's Modified Eagle Media) supplemented with 10% fetal bovine serum (FBS), sodium pyruvate, and L-glutamine (GIBCO; Grand Island, N.Y., US).
Reference Example 7. Western Blot
[0141] miRNA triggers were transfected into cells in the same manner as in Reference Example 4. After 72 hours, the cells were collected using a cell scraper and lysed with a RIPA buffer (NaCl 150 mM, EDTA 5 mM, Tris 50 mM, NP-40 1.0%, sodium deoxycholate 0.5%, SDS 0.1%). The cell lysate was sonicated 15 times, each for 20 sec, with a halt for 30 sec every sonication. Following centrifugation at 5,000 g for 5 min, the supernatant was taken and used to extract proteins therefrom. A total of 30-40 μg of protein sample was separated in 10-15% SDS-PAGE gel and transferred onto a PVDF membrane through a semi-dry blotting system. The membrane was blocked for 1 hour in 5% skimmed milk and incubated for 2 hours with a 1,000-fold dilution of a primary antibody in, 1% skimmed milk. As the primary antibody, PKR ((#12297S, Cell Signaling Technology, MA, US), Mcl-1 (#5453S, Cell Signaling Technology, MA, US), Bcl-2 (#4223S, Cell Signaling Technology, MA, US), Bcl-xl (#2764S, Cell Signaling Technology, MA, US), or B-tublin (#2148 Cell Signaling Technology, MA, US) was used. The membrane incubated with the primary antibody was washed three times with 1×PBST buffer (NaCl 137 mM, KCl 2.7 mM, Na.sub.2HPO.sub.4 10 mM, KH.sub.2PO.sub.4 1.8 mM, Tween 20 0.1%) for 10 min each wash before incubation with a 1,000-fold dilution of a secondary antibody in 1% skimmed milk for 1 hour. The secondary antibody for western blotting was Goat Anti-Rabbit IgG (H+L)-HRP Conjugate (#1706515, Bio-Rad) or Goat Anti-Mouse IgG (H+L)-HRP Conjugate (#1706516, Bio-Rad). The membrane incubated with the secondary antibody was washed three times with 1×PBST for 10 min each wash, and then reacted with Clarity Western ECL Substrate (#1705061, Bio-Rad), after which images were obtained and analyzed using ChemiDoc (Bio-rad, Hercules, USA).
Reference Example 8. Quantitative Real-Time Polymerase Chain Reaction
[0142] In the same manner as in Reference Example 4, miRNA triggers were transfected into cells. After 48 hours, total RNA was extracted using TRIzol (Thermo Fisher Scientific) according to the manufacturer's instruction. The purified RNA was treated with DNase I and then reverse transcribed in the presence of RevertAid reverse transcriptase (Thermo Fisher Scientific), with random hexamers (Thermo Fisher Scientific) serving as primers. For use in amplification of target genes, primers for target genes were added, together with the cDNA, to the SYBR Green PCR master mix (Thermo Fisher Scientific). RT-qPCR was conducted on a StepOnePlus real-time PCR system. Cq values obtained from this analysis was quantitatively analyzed based on the 2.sup.−ΔΔC(t) method. The primer sequences used in this experiment are listed in Table 1, below.
TABLE-US-00001 TABLE 1 Target SEQ name Primer name Sequence (5′.fwdarw.3′) ID NO GAPDH GAPDH-Forward CTC CTC CAC CTT TGA CGC 1 TG GAPDH-Reverse TCC TCT TGT GCT CTT GCT 2 GG PKR PKR-Forward GAG GGG AAT GAT GTG ATT 3 GG PKR-Reverse CTG GGC TGT CAC TTC TAG 4 CC Mcl-1 Mcl-1-Forward CTC TCA TTT CTT TTG GTG 5 CCT Mcl-1-Reverse ATT CCT GAT GCC ACC TTC 6 TA Bcl-xL Bcl-xL-Forward TCC CCA TGG CAG CAG TAA 7 AG Bcl-xL-Reverse TCC ACA AAA GTA TCC TGT 8 TCA AAG C Bcl-2 Bcl-2-Forward GAG AGT GCT GAA GAT TGA T 9 Bcl-2-Reverse ATC AAT CTT CAG CAC TCT C 10
Reference Example 9. Assay for Cytotoxicity and Cell Viability (CCK-8 Assay)
[0143] The miRNA triggers were assayed for cytotoxicity and apoptosis induction, using the CCK-8 (Cell Counting Kit-8) (Dojindo, Kumamoto, Japan) according to the manufacturer's instruction. Cells were incubated in 96-well plates (5×10.sup.3 cells/well) at 37° C. for 24 hours under a 5% CO.sub.2 atmosphere, followed by transfection. Three days after transfection, the medium was removed. A 10-fold dilution of CCK-8 solution in DMEM was added to the cells which were then incubated at 37° C. for 2 hours. After incubation, absorbance was read at 450 nm on Tecan Infinite M200 pro microplate reader (Mnnedorf, Switzerland).
Example 1. Structural Optimization of miRNA Trigger
Example 1-1. Binding of Hairpin miRNA Trigger to mRNA According to Loop Length
[0144] In this Example, an examination was made of stem lengths which allow for an optimal hairpin structure in which the hairpin miRNA triggers can bind to miRNAs to open their hairpin structures and thus can bind to target mRNAs.
[0145] Hairpin miRNA triggers (HPs) were prepared to have stems having various lengths (12 to 22 nt) as stated Reference Example 1-2 above. The hairpin miRNA triggers used in this Example were designed to bind to miR-141 and target random sequences. Their specific sequences are listed in Table 2, below. HPs and miRNAs used in this Example were not chemically modified.
TABLE-US-00002 TABLE 2 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO 12 nt stem HP TGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGG 11 ACGATGCA 14 nt stem HP GTTGCATCGTCCATCCATCTTTACCAGACAGTGTTAAT 12 GGACGATGCAAC 16 nt stem HP TGGTTGCATCGTCCATCCATCTTTACCAGACAGTGTTA 13 ATGGACGATGCAACCA 18 nt stem HP CATGGTTGCATCGTCCATCCATCTTTACCAGACAGTGT 14 TAATGGACGATGCAACCATG 20 nt stem HP ACCATGGTTGCATCGTCCATCCATCTTTACCAGACAGT 15 GTTAATGGACGATGCAACCATGGT 22 nt stem HP TGACCATGGTTGCATCGTCCATCCATCTTTACCAGACA 16 GTGTTAATGGACGATGCAACCATGGTCA miR-141 UAACACUGUCUGGUAAAGAUGG 17
[0146] Each hairpin miRNA trigger includes mutually complementary sequences which are hybridized with each other, forming a stem-loop structure, with a miRNA-binding sequence located at the loop moiety. Thus, examination was made to show whether when a miRNA was added, the miRNA trigger could open its hairpin structure as it bound to the miRNA.
[0147] In a buffer (1×PBS, 137 mM NaCl, 10 mM PO.sub.4, 2.7 mM KCl, 5 mM MgCl.sub.2; pH 7.4) for low cytotoxicity and stable hairpin structure formation, the hairpin miRNA trigger and a miRNA capable of hybridizing therewith were each added at a concentration of 100 nM and incubated at 37° C. for 1 hour. The reaction mixture was loaded into pockets in a PAGE (Polyacrylamide gel electrophoresis) gel and run. The result is shown in
[0148] As can be seen in
Example 1-2. Binding of Hairpin miRNA Trigger to mRNA and Target mRNA
[0149] It was primarily verified through the NUPACK program in the same manner as in Reference Example 2 whether the hairpin miRNA triggers bind to miRNAs and target mRNAs to form the ternary structures of miRNA-miRNA trigger-mRNA, and the simulation results are depicted in
TABLE-US-00003 TABLE 3 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: HP (HP-Mcl1-141) CAAGAGGATTATCCATCTTTACCTCACAGTGTTAATAA SEQ ID NO: TCCTCTTG 18 miRNA (miR-141) UAACACUGUCUGGUAAAGAUGG SEQ ID NO: 17 mRNA (Mcl1) GCAAGUGGCAAGAGGAUUA SEQ ID NO: 19
[0150] To a buffer (1×PBS+137 mM NaCl, 10 mM PO.sub.4, 2.7 mM KCl, 5 mM MgCl.sub.2; pH 7.4) containing the hairpin miRNA trigger (HP) verified through computer modeling, a miRNA and/or a target mRNA were each added at a concentration of 100 nM, followed by incubation at 37° C. for 1 hour. Each sample was loaded to a PAGE gel and electrophoresed. The results are shown in
[0151] As can be seen in
Example 1-3. Hairpin mRNA Trigger Capable of Binding to Various miRNAs
[0152] A hairpin miRNA trigger designed to bind to a miRNA-200 family (miR-200a, miR-200b, and miR-200c), or miR-21 and target Mcl-1 mRNA was prepared. To a buffer containing the hairpin miRNA trigger (HP), miRNA and/or target mRNA was added, followed by incubation at 37° C. for 1 hour. Each sample was loaded to a PAGE gel and electrophoresed. The results are given in
TABLE-US-00004 TABLE 4 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: HP_Mcl1_M2_S12_miR-21 CAAGAGGATTATTCAACATCAGATTGATAAGCT SEQ ID NO: ATAATCCTCTTG 20 HP_Mcl1_M2_S12_miR- CAAGAGGATTATACATCGTTACCGTACAGTGTT SEQ ID NO: 200a AATAATCCTCTTG 21 HP_Mcl1_M2_S12_miR- CAAGAGGATTATTCATCATTACCGAGCAGTATT SEQ ID NO: 200b AATAATCCTCTTG 22 HP_Mcl1_M2_S12_miR- CAAGAGGATTATTCCATCATTACCTTGCAGTAT SEQ ID NO: 200c TAATAATCCTCTTG 23 miR-21 UAGCUUAUCAGACUGAUGUUGA SEQ ID NO: 24 miR-200a UAACACUGUCUGGUAACGAUGU SEQ ID NO: 25 miR-200b UAAUACUGCCUGGUAAUGAUGA SEQ ID NO: 26 miR-200c UAAUACUGCCGGGUAAUGAUGGA SEQ ID NO: 27 Mcl-1 mRNA ACCCUAGCAACCUAGCCAGAAAAGCAAGUGGCA SEQ ID NO: AGAGGAUUAUGGCUAACAAGAAUAAAU 28
[0153] As shown in
Example 1-4. Stability of Trigger by Chemical Modification
[0154] In order to apply the miRNA trigger to in vitro and in vivo experiments, stability in biological samples was needed for the miRNA trigger. In this regard, HPs were prepared in the same similar manner as that of Reference Example 1, with the exception that a chemical modification, such as LNA (locked nucleic acid), PS (phosphorothioate), or 2′-O-Me (2′-O-Methyl), was introduced into nucleotides of the miRNA trigger. Sequences of HPs used in this Example and types and positions of chemical modifications in the sequences are summarized in Table 5, below.
TABLE-US-00005 TABLE 5 Chemical modi- Oligo name Sequence (5′.fwdarw.3′) afiction SEQ ID NO: DNA HP TATTTCTCATTCCCCCATCTTTACCAGACAGTGTTA — SEQ ID NO: GGGAATGAGAAATA 29 LNA HP [LNA T][LNA A][LNA T][LNA T] LNA SEQ ID NO: TCTCATTCCCCCATCTTTACCAGACAGTGTTAGG 30 GAATGAGA[LNA A][LNA A][LNA T][LNA A] PS4 HP T*A*T*T*TCTCATTCCCCCATCTTTACCAGACAGT PS SEQ ID NO: GTTAGGGAATGAGA*A*A*T*A 31 PS8 HP T*A*T*T*T*C*T*C*ATTCCCCCATCTTTACCAGA PS SEQ ID NO: CAGTGTTAGGGAAT*G*A*G*A*A*A*T*A 32 FPS HP T*A*T*T*T*C*T*C*A*T*T*C*C*C*C*C*A*T* PS SEQ ID NO: C*T*T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A* 33 G*G*G*A*A*T*G*A*G*A*A*A*T*A 2′-O-Me HP mUmAmUmUmUmCmUmCmAmUmUmCmCmCmCmCmAmU 2′-O-Me SEQ ID NO: mCmUmUmUmAmCmCmAmGmAmCmAmGmUmGmUmUmA 34 mGmGmGmAmAmUmGmAmGmAmAmAmUmA
[0155] The chemical modification-introduced hairpin miRNA triggers (LNA HP, PS4HP, PS8 HP, FPS HP, and 2′-O-Me HP) or the control hairpin miRNA trigger (DNA HP), which was not chemically modified, was added to cell lysates or human sera, and analyzed for resistance to biological resistance in the same manner as in Reference Example 3. The results are given in
[0156] As shown in
[0157] In addition, FPS HP and 2′-OMe HP, which were the most resistant to degradation in biological samples, were analyzed for cytotoxicity. In this regard, the HP in which the entire nucleotides of miRNA trigger (LP) were modified with PS (expressed as PS in Table 6 and
TABLE-US-00006 TABLE 6 Chemical modi- Oligo name Sequence (5′.fwdarw.3′) fication SEQ ID NO: siRNA UCGAAGUACUCAGCGUAAGU — SEQ ID NO: 35 DNA TCGAAGTACTCAGCGTAAGTTCGAAGTACTC — SEQ ID NO: AGCGTAAGTTCGAAGTACTCAGCGTAAGT 36 PS T*C*G*A*A*G*T*A*C*T*C*A*G*C*G*T *: phospho- SEQ ID NO: *A*A*G*T*T*C*G*A*A*G*T*A*C*T*C* rothioate 37 A*G*C*G*T*A*A*G*T*T*C*G*A*A*G*T linkage *A*C*T*C*A*G*C*G*T*A*A*G*T (PS) 2′-O-Me mUmCmGmAmAmGmUmAmCmUmCmAmGmCmGm m: 2′-O- SEQ ID NO: UmAmAmGmUmUmCmGmAmAmGmUmAmCmUmC Methyl (2′- 38 mAmGmCmGmUmAmAmGmUmUmCmGmAmAmGm O-Me) UmAmCmUmCmAmGmCmGmUmAmAmGmU
[0158] As shown in
Example 2. Structure for Enhancing Efficiency of miRNA Trigger
[0159] miRNA triggers which could each bind to a plurality of miRNAs were prepared and examined for repressive effect on expression of the target genes.
[0160] A miRNA trigger was designed to have a 2-seed hairpin structure in which the loop could hybridize with two miRNAs simultaneously (2-seed hairpin probe; hereinafter referred to as “2SD HP”). The structure of 2SD HP is as follows:
[5′-portion capable of binding to mRNA of target gene (T*)-portion capable of binding to miRNA(1) (mi(1)*)-spacer(TT)-portion capable of binding to miRNA(2) (mi(2)*)-portion capable of binding to T* (T)-3′].
[0161] Including sequences (T and T* in the structure) which can bind complementarily to each other as in HP, 2SD HP exists in the stem-loop structure as a hairpin miRNA trigger. The loop of 2SD HP included a portion capable of binding to miRNA(1) (mi(1)*) and a portion capable of binding to miRNA(2) (mi(2)*). mi(1)* and mi(2)* included in 2SD HP were each composed of a sequence complementarily hybridizable with a 10-nt-long sequence from the 5′ end of miRNA. 2SD HP included a spacer (TT) between mi(1)* and mi(2)*.
[0162] In brief, a hairpin miRNA trigger (HP) that could bind to miR-141 and target pkr (bind to pkr mRNA to regulate the expression of pkr) and 2SD HP that could target pkr and bind to two molecules of miR-141 per target were synthesized in Bioneer Inc.
[0163] The synthesized triggers were purified through HPLC before use. Sequences of HP and 2SD HP and types of chemical modification (*; phosphorothioate linkage) are given in Table 7, below.
TABLE-US-00007 TABLE 7 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: HP_PKR(3)_miR141 TAGCTGTACTTCAACCATCTTTACCAGACAGT SEQ ID NO: GTTATTGAAGTACAGCTA 39 2SD HP_PKR(3)_miR141 T*A*G*C*T*G*T*A*C*T*T*C*A*A*G*A* SEQ ID NO: C*A*G*T*G*T*T*A*T*T*G*A*C*A*G*T* 40 G*T*T*A*T*T*G*A*A*G*T*A*C*A*G*C* T*A
[0164] The synthesized HP and 2SD HP were transfected into miR-141-expressing Hela-141 cells which were then quantitatively measured for expression levels of the target pkr in the same manner as in Reference Example 8. The result is depicted in
[0165] From the result, it was confirmed that a portion capable of binding two miRNAs increases the repressive effect on the expression of a target gene, compared to a portion capable of binding one miRNA. This principle was introduced into linear miRNA triggers. That is, linear miRNA triggers were designed to each include two portions capable of binding to respective miRNAs, and used in subsequent experiments.
Example 3. A In Vitro Assay for Efficacy of miRNA Trigger
Example 3-1. Assay for Expression Regulation of Fluorescent Protein by miRNA Trigger
[0166] A GFP fluorescent protein-expressing plasmid (used in Chen L L, DeCerbo J N, Carmichael G G. 2008. Alu element-mediated gene silencing. EMBO J 27: 1694-1705) was transfected into Hela-141 cells to prepare GFP-expressing Hela-141 cells. As stated in Reference Example 1, a linear miRNA trigger (LP; GFP_141_141), which can target GFP mRNA (=complementarily bind to GFP mRNA to regulate the expression of GFP) and complementarily bind to miR-141, and siRNAs which target GFP and Luc (Luciferase), respectively, were synthesized in Bioneer Inc. Sequences of the LP and siRNAs and types and positions of chemical modifications in each sequence are listed in Table 8, below.
TABLE-US-00008 TABLE 8 modi- Oligo name Sequence (5′.fwdarw.3′) fication SEQ ID NO: GFP(1)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmC m; 2′-OMe SEQ ID NO: mAmGmUmGmUmUmAmCmCmAmUmCmUmUmU 41 mAmCmCmUmCmAmCmAmGmUmGmUmUmAmU mUmAmUmGmUmUmUmCmAmGmGmUmUmCmA mGmGmGmGmGmA GFP(2)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmC m; 2′-OMe SEQ ID NO: mAmGmUmGmUmUmAmCmCmAmUmCmUmUmU 42 mAmCmCmUmCmAmCmAmGmUmGmUmUmAmA mAmAmUmUmUmGmUmGmAmUmGmCmUmAmU mUmGmCmU siLuc UCGAAGUACUCAGCGUAAG None SEQ ID NO: 43 siGFP UUAUGUUUCAGGUUCAGGG None SEQ ID NO: 44
[0167] Above all, siLuc and siGFP were transfected into the GFP-expressing Hela-141 cells which were then measured for fluorescence intensity on an ELISA reader. A significantly reduced fluorescence intensity was detected from the siGFP-treated group, compared to the siLuc-treated group, confirming that the experimental condition of the Example worked normally. In addition, the linear miRNA trigger (GFP(1)_141_141) was transfected into the GFP-expressing Hela-141 cells which were then measured for fluorescence intensity. The result is depicted in
Example 3-2. Assay for Ability of Linear miRNA Trigger to Discriminate Cell Lines
[0168] A linear miRNA trigger (LP; PKR-141-141, PKR-200c-200c) that targets PKR and can bind to miR-141 or miR-200c was prepared in the same manner as in Reference Example 1, together with the controls including a linear miRNA trigger (LP; Luc-141-141, PKR-200c-200c) that targets Luc and can bind to miR-141 or miR-200c and a probe (Luc-Luc-Luc) that includes three portions capable of binding to Luc. Sequences of the prepared miRNA triggers and probe and positions and types of chemical modification (m; 2′-O-Me) are summarized in Table 9.
TABLE-US-00009 TABLE 9 Oligo name Sequence (5′-3′) SEQ ID NO: PKR(1)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmU SEQ ID NO: 45 mGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmA mCmAmGmUmGmUmUmAmUmAmUmGmUmGmAmGmGmC mAmGmAmGmAmAmCmGmA PKR(2)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmU SEQ ID NO: 46 mGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmA mCmAmGmUmGmUmUmAmUmAmUmUmUmCmUmCmAmU mUmCmCmCmUmUmCmCmU PKR(1)_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmG SEQ ID NO: 47 mUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmG mCmGmCmAmGmUmAmUmUmAmUmAmUmGmUmGmAmG mGmCmAmGmAmGmAmAmCmGmA PKR(2)_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmG SEQ ID NO: 48 mUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmG mCmGmCmAmGmUmAmUmUmAmUmAmUmUmUmCmUmC mAmUmUmCmCmCmUmUmCmCmU Luc_Luc_Luc mUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmA SEQ ID NO: 49 mGmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmA mAmGmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmU mAmAmG Luc_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmU SEQ ID NO: 50 mGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmA mCmAmGmUmGmUmUmAmUmCmGmAmAmGmUmAmCmU mCmAmGmCmGmUmAmAmG Luc_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmG SEQ ID NO: 51 mUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmG mCmGmCmAmGmUmAmUmUmAmUmCmGmAmAmGmUmA mCmUmCmAmGmCmGmUmAmAmG
[0169] Linear miRNA triggers (Table9, PKR(1)_141_141, PKR(1)_200c_200c and control) which had the same sequences as in the above linear miRNA triggers and additionally included PS (phosphorothioate) bonds between all nucleotides were prepared and transfected into Hela, Hela-141, Hela-200c, and MCF-7 cell lines. Expression levels of pkr mRNA was measured by real-time PCR and are depicted in
[0170] In addition, the linear miRNA triggers and probe (Table 9, PKR(1)_141_141, PKR(1)_200c_200c, and control) chemically modified with 2′-OMe were prepared and transfected into Hela, Hela-141, Hela-200c, and MCF-7 cell lines. Expression levels of pkr mRNA was measured by real-time PCR and are depicted in
[0171] As shown in
[0172] The transfection of the PS-modified miRNA trigger into cells was observed to induce cell death by about 7-% due to the cytotoxicity thereof irrespective of the sequences of the miRNA trigger, as shown in
Example 3-3. Assay for Ability of Hairpin miRNA Trigger to Discriminate Cell Lines
[0173] A hairpin miRNA trigger (HP_PKR(3)_141) that targets PKR and can bind to miR-141 was prepared in the same manner as in Reference Example 1-2. The sequence of the HP used in this Example and the position of chemical modification on the sequence are listed in Table 10. All the nucleotides of the sequence were chemically modified with 2′-OMe.
TABLE-US-00010 TABLE 10 Oligo name Sequence (5′-3′) SEQ ID NO: HP_PKR(3)_141 mUmUmGmAmAmGmUmAmCmAmGmCmUmAmCmCmAmUmC SEQ ID NO: mUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmA 52 mGmCmUmGmUmAmCmUmUmCmAmA
[0174] The hairpin miRNA triggers synthesized above were transfected into Hela, Hela-141, and MCF-7 cells, followed by performing real-time PCR to measure expression levels of pkr mRNA. The results are depicted in
[0175] Through this result, it is understood that the hairpin miRNA trigger can discriminates cell lines according to types of miRNAs expressed and can sufficiently regulate the expression of target genes at the levels of the miRNA expressed endogenously in cells themselves as well as the miRNA artificially expressed.
Example 4. Mechanism of Action of miRNA Trigger
Example 4-1. Assay for Regulation of Target Gene Expression According to miRNA
[0176] In this Example, examination was made to show whether the downregulation of mRNA expression of target genes by miRNA triggers was dependent on miRNA.
[0177] The hairpin miRNA trigger (HP_PKR(3)_141; Table 10) that can bind to miR-141 and target the pkr gene was prepared in a similar manner to those in Reference Example 1. miR-141, and miR-141*, which complementarily binds to miR-141 to inhibit the binding between the miRNA and the miRNA trigger in a competitive manner, were synthesized in Bioneer Inc. The sequence of the hairpin miRNA trigger (HP_PKR(3)_141) used in this Example is listed in Table 10 and the sequences of miR-141 and miR-141* are given in Table 11, below. Each of the sequences listed in Table 11 were not chemically modified.
TABLE-US-00011 TABLE 11 Oligo name Sequence (5′-3′) SEQ ID NO: miR-141 UAACACUGUCUGGUAAAGAUGG SEQ ID NO: 17 miR-141* CCAUCUUUACCAGACAGUGUUA SEQ ID NO: 53
[0178] (1) Hela-141 cells were transfected with (i) the hairpin miRNA trigger alone or (ii) the miRNA trigger and miR-141* in combination, and (2) Hela cells were transfected with (i) the miRNA trigger alone or (ii) the miRNA trigger and miR-141 hybridizable therewith in combination. In each case, pkr mRNA expression levels were measured and are depicted in
[0179] As shown in
[0180] In addition, as can be seen in
[0181] From the data, it was understood that the hairpin miRNA trigger acts as an expression inhibitor in the presence of miRNA.
Example 4-2. Assay for Binding of mRNA Trigger to Target Gene
[0182] In order to prove that the miRNA trigger actually binds to the mRNA of target gene, an RNA pulldown assay using streptavidin-coated magnetic beads was designed in this Example. A schematic diagram for the RNA pulldown assay is depicted in
[0183] A hairpin miRNA trigger (HP_PKR 141) that can bind to miR-141 and target the pkr gene and a control miRNA trigger (HP_luc-141) that can bind to miR-141 and target Luc were designed, and then labeled with biotin at the 3′ end of each trigger in Bioneer Inc. The biotin-labeled hairpin miRNA triggers were transfected into cells. After 48 hours, the cells were lysed in a lysis buffer (LB-A; 100 mM Tris-HCl, pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% Triton X-100, 5 mM DTT, 20 U/ml DNase I, 100 U/ml RNasin, complete EDTA-free protease-inhibitor cocktail). The cell lysate was sonicated for 20 sec three times using a sonicator, with a halt for 30 sec between the sonications. Then, the cell lysate was transferred into a 2-ml tube and centrifuged at 15,000 g for 10 min, 4° C. The supernatant thus formed was harvested, transferred to a new tube, and used for extracting RNA therefrom. Sequences of the trigger and control used in this Example are listed in Table 12, below, and every nucleotide in the miRNA trigger and control was bonded to adjacent nucleotide via a PS (phosphorothioate) linkage (expressed as * in Table 12, below).
TABLE-US-00012 TABLE 12 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: HP_PKR(2)_141 T*A*T*T*T*C*T*C*A*T*T*C*C*C*C*C*A*T*C*T SEQ ID NO: *T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*G*G*G* 54 A*A*T*G*A*G*A*A*A*T*A-Biotin HP_PKR(3)_141 T*A*G*C*T*G*T*A*C*T*T*C*A*A*C*C*A*T*C*T SEQ ID NO: *T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*T*T*G* 55 A*A*G*T*A*C*A*G*C*T*A-Biotin HP_Luc-141 T*C*G*A*A*G*T*A*C*T*C*A*G*C*C*C*A*T*C*T SEQ ID NO: *T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*G*C*T* 56 G*A*G*T*A*C*T*T*C*G*A-Biotin
[0184] Prior to the experiment, streptavidin-coated magnetic beads were washed three times with 750 μl of a B&W buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, pH 8.0) and then resuspended in 300 μl of a B&W buffer. Subsequently, the beads were incubated at room temperature for 1 hour in 1 μl of a B&W buffer containing 0.1 mg mL-1 Escherichia coli transfer RNA (tRNA). In order to binding the beads to the target RNA, 30 μl of the streptavidin-coated magnetic beads were incubated with the cell lysate at 25° C. for 3 hours while stirring at 950 rpm. The beads were washed three times at 55° C. with 750 μl of a B&W buffer to remove non-specifically bound RNAs. Thereafter, the beads were mixed at 950 rpm for 10 min with an elution buffer (10 mM Tris-HCl, pH 7.5) while being heated to 90° C. to rapidly separate the target RNA bound to the miRNA trigger complex. The isolated RNA was amplified by RT-PCR. PKR mRNA levels were measured and are depicted relative to those before the separation using magnetic beads in
[0185] As shown in
[0186] From the result, it is understood that the miRNA trigger can bind to the mRNA of the target gene only in the presence of the miRNA hybridizable with the miRNA trigger in the cells.
Example 4-3. Functional Association of mRNA Trigger with Ago Protein
[0187] In this Example, an examination was made to show whether Ago (Argonaute), which is a protein mediating the miRNA function, is associated with the function of miRNA trigger. In this regard, siAGO, which can repress AGO expression, was transfected, together with the miRNA trigger, into cells to examine whether the siAGO inhibit the action of the miRNA trigger.
[0188] Hela-141 cells were transfected with the hairpin miRNA trigger (HP_PKR(3)_141), together with siAGO1, siAGO2 (siAGO2-1 to siAGO2-4 mixed at the same ratio (1:1:1:1)), or a combination thereof, and measured for mRNA levels of target pkr. The result is depicted in
TABLE-US-00013 TABLE 13 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: siLuc(MM) UCGAAGUACUCAGCGUAAG SEQ ID NO: 43 siAGO1 GGAGUUACUUUCAUAGCAU SEQ ID NO: 57 siAGO2-1 GCACGGAAGUCCAUCUGAA SEQ ID NO: 58 siAGO2-2 GCAGGACAAAGAUGUAUUA SEQ ID NO: 59 siAGO2-3 GGGUCUGUGGUGAUAAAUA SEQ ID NO: 60 siAGO2-4 GUAUGAGAACCCAAUGUCA SEQ ID NO: 61
[0189] As shown in
Example 5. Assay for Therapeutic Effect of miRNA Trigger on Cancer
Example 5-1. Selection of Target Gene for Apoptosis Induction
[0190] For use in inducing cancer cells to undergo apoptosis, Bcl-2 family genes (bcl-2, bcl-xL, mcl-1), which are anti-apoptotic genes, were selected as target genes of the miRNA triggers.
[0191] To investigate the influence of Bcl-2 family gene regulation on apoptosis, siRNAs capable of regulating expression of the Bcl-2 family genes (bcl-2, bcl-xL, mcl-1) were prepared. Sequences of the siRNAs are given in Table 14, below.
TABLE-US-00014 TABLE 14 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: siBcl-2 AUCAAUCUUCAGCACUCUC SEQ ID NO: 62 siBcl-xL UUGGUCCCUCAGUAUGGUC SEQ ID NO: 63 siMcl-1 AAAUUCGAUACUUCCUUCG SEQ ID NO: 64 siLuc UCGAAGUACUCAGCGUAAG SEQ ID NO: 43
[0192] An siRNA targeting bcl-2, bcl-xL, or mcl-1 was transfected into MCF-7 breast cancer cells and PANC-1 pancreatic cancer cells. By using qRT-PCR, establishment was made of a condition under which the expression of each target gene is decreased by 80% or more (transfection was performed at a concentration of 60 nM with the aid of Lipofectamine). As a negative control, a Luc (Luciferase)-targeting siRNA (siLuc) was used. Under the same condition of decreasing the expression of each target gene by 80% or more, the cells transfected with the siRNAs were measured for apoptosis, and the results are depicted in
[0193] As shown in
[0194] Additionally, repression of both bcl-xL and mcl-1 in PANC1 cells was observed to increase the expression of the apoptotic marker cleaved-PARP1, as assayed by western blotting, and the result is given in
Example 5-2. Apoptosis Induction by Linear miRNA Trigger
[0195] Based on the result of Example 5-1, linear miRNA triggers that could bind to the miR-200 family (miR-141, miR-200c) and target Mcl-1 gene (hereinafter Mcl-1-141-141, Mcl-1-200c-200c) were prepared in a similar manner to that of Reference Example 1-1 while linear miRNA triggers that could bind to the miR-200 family (miR-141, miR-200c) and target Luc (luciferase) gene (hereinafter Luc-Luc-Luc, Luc-141-141, Luc-200c-200c) were prepared as controls.
[0196] Sequences are listed in Table 15 for the linear miRNA triggers used, in Table 9 for the controls, and in Table 14 for siLuc and siMcl-1.
TABLE-US-00015 TABLE 15 Oligo SEQ ID name Sequence (5′.fwdarw.3′) NO: Mcl-1_ mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAm SEQ ID 141_141 GmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmC NO: 65 mUmCmAmCmAmGmUmGmUmUmAmCmCmGmAmAm CmUmAmCmGmUmAmGmC Mcl-1_ UmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmA SEQ ID 200c_ mGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAm NO: 66 200c CmCmGmCmGmCmAmGmUmAmUmUmAmCmCmGmA mAmCmUmAmCmGmUmAmGmCm
[0197] The linear miRNA triggers or siRNAs (siLuc and siMcl-1) prepared above were transfected into Hela, Hela-141, and Hela-200c cells which were then measured for cell viability. The results are depicted in
[0198] As shown in
Example 5-3. Assay for Repression of Linear mRNA Trigger Against Target Protein Expression
[0199] A linear miRNA trigger (Mcl-1-141-141; Table 15) that could bind to miR-141 and target mcl-1 was prepared while a linear miRNA trigger (Luc-141-141; Table 9) that could bind to miR-141 and target Luc (luciferase) was used as a control. The triggers were transfected at various concentrations (5 to 120 nM) into Hela-141 cells. Then, proteins were extracted from the Hela-141 cells and quantitatively analyzed for Mcl-1 protein level by western blotting. The results are depicted in
[0200] As shown in
Example 5-4. Apoptosis Induction by Hairpin miRNA Trigger
[0201] Hairpin miRNA triggers (Mcl-1(1)-141, Mcl-1(3)-141) which could bind to miR-141 and target mcl-1 were prepared and assayed for ability to induce apoptosis. Sequences of the hairpin miRNA triggers used in this Example are listed in Table 16, with every nucleotide modified with 2′-OMe while the sequence of the control siMcl-1 is given in Table 14.
TABLE-US-00016 TABLE 16 Oligo SEQ ID name Sequence (5′.fwdarw.3′) NO: HP_Mcl- mGmCmUmAmCmGmUmAmGmUmUmCmGmGmCmCmAm SEQ ID 1(1)_ UmCmUmUmUmAmCmCmAmGmAmCmAmGmUmGmUmU NO: 67 141 mAmCmCmGmAmAmCmUmAmCmGmUmAmGmC HP_Mcl- mCmGmAmAmGmGmAmAmGmUmAmUmCmGmCmCmAm SEQ ID 1(3)_ UmCmUmUmUmAmCmCmAmGmAmCmAmGmUmGmUmU NO: 68 141 mAmCmGmAmUmAmCmUmUmCmCmUmUmCmG
[0202] The hairpin miRNA triggers prepared above were transfected into Hela and Hela-141 cells which were then assayed for apoptosis. The results are given in
[0203] As can be seen in
Example 6. Assay for Possibility of In Vivo Delivery of miRNA Trigger
Example 6-1. Construction of Fluorephore-Labeled miRNA Trigger and Cell Transformation
[0204] A linear miRNA trigger (5′-Cy5.5-PKR-miR-155-miR-155-3′) which could bind to miR-155 and target PKR and was labeled with Cy5.5 fluorophore was prepared as in Reference Example 1. The sequence of the trigger is given in Table 17, below.
TABLE-US-00017 TABLE 17 Oligo SEQ ID name Sequence (5′-3′) NO: Cy5.5_ Cy5.5- 69 PKR- mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmA 155_155 mGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmA mGmGmUmUmCmAmGmGmGmGmGmAmUmAmUmG mUmGmAmGmGmCmAmGmAmGmAmAmCmGmA
[0205] With the aid of Lipofectamine, the linear miRNA trigger (5′-Cy5.5-miR-155-miR-155-PKR-3′) was transfected into the FLT3-ITD mutant AML cell lines MOLM-14 and MV4-11 and the solid cancer cell line Hela. Fluorescence was detected from all of NOML-14, MV4-11, and Hela cells transfected with the linear miRNA trigger as measured by IVIS 100 (PerkinElmer). Subsequent animal tests were performed with the trigger.
Example 6-2. In Vivo Delivery of miRNA Trigger
[0206] The linear miRNA trigger (5′-Cy5.5-PKRmiR-155-miR-155-PKR-3′) prepared in Example 6-1 was mixed in an amount of 200 μl with Invivofectamine (Thermo Fisher Scientific) to form a final concentration of 120 nM and administered into 8-week-old C57BL/6 (B6) mice by tail vein injection. As a negative control, PBS was injected at a dose of 200 μl into mice.
[0207] Days 1, 2, and 4 after miRNA trigger injection, in vivo imaging was performed using IVIS 100 (PerkinElmer). The results are depicted in
Example 6-3. Intracellular Delivery of miRNA Trigger Among Hematopoietic Origin Cells
[0208] Day 4 after miRNA trigger injection in Example 6-2, mice in the miRNA trigger-administered test group (N=4) and the PBS-administered control (N=4) were sacrificed and specimens (blood cells) were taken from peripheral blood vessels, the spleen, and the bone marrow (femur blood cells). Erythrocytes were removed using an RBC lysis buffer.
[0209] FACS (FSC-A/SSC-A) profiles of the cells are given in
[0210] The cells in peripheral blood sample were gated through three steps (step 1: debris removal, step 2: selection of single blood cell population, step 3: Cy5.5 detection) to select single blood cells of quality. Through FACS, blood cells retaining Cy5.5 were identified. The results are depicted in
[0211] Spleen-derived hematopoietic cells and bone marrow hematopoietic cells of mice were gated in the foregoing manner and Cy5.5 was detected. The results are depicted in
[0212] In addition, as shown in
[0213] From the data, it was understood that even at 4 days after intravenous injection into B6 mice, the miRNA trigger was detected in main organs and hematopoietic organs and intracellularly delivered into blood cells such as lymphocytes and monocytes.
[0214] As shown in
Example 7. Therapeutic Effect of miRNA Trigger on Blood Cancer
Example 7-1. Selection of AML-Specific miRNA
[0215] In this Example, the miRNA trigger technology was applied to the therapy of AML (acute myeloid leukemia). In this regard, various AML cell lines were established and selection was made of miRNAs that are expressed specifically in AML cells. FLT3-ITD mutation, which is observed in about 25% of AML patients, was selected as a target disease. MV4-11 and MOLM-14 cells, both having FLT3-ITD mutation, were acquired while NB-4 and HL60 cells, both exhibiting FLT3-WT, were used as controls. In order to examine whether the expression of miR-155 was increased in FLT3-ITD mutated AML cells, miR-155 levels were quantitated using qRT-PCR. The results are depicted in
Example 7-2. Preparation of miR-155-specific Trigger
[0216] The hairpin miRNA triggers HP_PKR(2)_155 (2′-O-Me-PKR(2)_PM_S14_155) and HP_PKR(3)_155 (2′-O-Me-PKR(3)_PM_S14_155) which could both bind to miR-155 and target the pkr gene were prepared in a similar manner as in Reference Example 1-2. Every nucleotide in the HPs used in this Example was chemically modified with 2′-OMe, and all of the nucleotides in the portions capable of binding to the miRNA were complementary to those in the miRNA sequence (perfect match; PM), with the stem being 14 nt long (S14). Sequences of the HP, miRNA, and mRNA are listed in Table 18, below.
TABLE-US-00018 TABLE 18 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: HP_PKR(2)_155 mUmAmUmUmUmCmUmCmAmUmUmCmCmCmAmAmCmCmC SEQ ID NO: mCmUmAmUmCmAmCmGmAmUmUmAmGmCmAmUmUmAmA 70 mGmGmGmAmAmUmGmAmGmAmAmAmUmA HP_PKR(3)_155 mUmAmGmCmUmGmUmAmCmUmUmCmAmAmAmAmCmCmC SEQ ID NO: mCmUmAmUmCmAmCmGmAmUmUmAmGmCmAmUmUmAmA 71 mUmUmGmAmAmGmUmAmCmAmGmCmUmA miR-155 UUAAUGCUAAUCGUGAUAGGGGUU SEQ ID NO: 72 PKR mRNA (2) CAAUAAUGGGAAGGAAGGGAAUGAGAAAUAUUAAAUUC SEQ ID NO: UG 73 PKR mRNA (3) GUAUUGAAAACAAUUGAAGUACAGCUAAAUGUAAUAAC SEQ ID NO: G 74
[0217] In a buffer (1×PBS, 137 mM NaCl, 10 mM PO4, 2.7 mM KCl, 5 mM MgCl.sub.2; pH 7.4), the hairpin miRNA triggers, miR-155 and/or the pkr mRNA were each added at a concentration of 100 nM and incubated at 37° C. for 1 hour. The mixtures were loaded to a PAGE gel and run to examine whether the hairpin miRNA triggers bind to the miRNA and the mRNA. The results are depicted in
Example 7-3. Selection of Gene Inducing AML Apoptosis
[0218] Selection was made of a target gene of the miRNA trigger to induce apoptosis in blood cancer cell lines. In this regard, the Bcl-2 family genes, which are anti-apoptotic genes, were knocked down by transfecting siRNAs (siMcl-1, siBcl-2, and siBcl-xL; Table 14) against the genes into HL-60 cells, followed by western blotting to measure protein levels of the apoptotic marker (cleaved PARP). The results are depicted in
[0219] As can be seen in
Example 7-4. Therapeutic Agent Usable in Combination with miRNA Trigger
[0220] In this Example, investigation was made of agents that can exhibit excellent therapeutic effects on AML when used in combination with a miRNA trigger capable of binding miR-155.
[0221] The FLT3-ITD mutated AML cell line (NOLM-14) was treated with an IC.sub.50 dose of cytarabine, azacitidine, decitabine, venetoclax, or gilteritinib, which is used as standard therapeutic agents for AML, at 37° C. for 72 hours, followed by measuring expression levels of miR-155. The results are given in
[0222] From the result, it was understood that cytarabine, azacitidine, and decitabine did not deplete miR-155 and thus could be used as agents which could be used, in combination with a miRNA trigger capable of binding miR-155, to exhibit excellent AML treatment effects.
Example 7-5. Action of Linear miRNA Trigger in AML Cell Line
[0223] The linear miRNA trigger (PKR-155-155) that could bind to miR-155 and target pkr gene was prepared and then transfected into the FLT3-ITD mutated cell line MV4-11 and the FLT3-WT cell line HL60 as a control, followed by measuring expression levels of the target gene (pkr). The results are depicted in
TABLE-US-00019 TABLE 19 Oligo name Sequence (5′-3′) SEQ ID NO: PKR(1)-155-155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmG SEQ ID NO: mGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmG 75 mGmGmGmAmUmAmUmGmUmGmAmGmGmCmAmGmAmGmAmA mCmGmA PKR(2)-155-155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmG SEQ ID NO: mGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmG 76 mGmGmGmAmUmAmUmUmUmCmUmCmAmUmUmCmCmCmUmU mCmCmU luc_155-155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmG SEQ ID NO: mGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmG 77 mGmGmGmAmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmU mAmAmG
[0224] As shown in
Example 7-6. Assay for Efficacy of miRNA Trigger in AML Patient-Derived Primary Cells
[0225] Blood samples taken from the bone marrows of AML patients were quantitated for expression levels of various miRNAs and compared. Myeloblasts including monocytes, present in the buffy coat layers separated from 10 blood samples taken from 10 patients, were transferred to a culture system under the same condition as that for cell lines and cultured in a lab scale. Among them, 7 patent samples that had high cell activity (cells that did not die, but were growing) were selected for RNA extraction. Expression levels of miR-9, miR-10b, miR-17, miR-22, miR-125b, miR-126, and miR-155 were quantitated using stem-loop qRT-PCR, and the results are depicted in
TABLE-US-00020 TABLE 20 Target name Primer name Sequence (5′ .fwdarw. 3′) SEQ ID NO: U6 RT Primer CGCTTCACGAATTTGCGTGTCAT SEQ ID NO: 78 Forward Primer GCTTCGGCAGCACATATACTAAAAT SEQ ID NO: 79 Reverse Primer CGCTTCACGAATTTGCGTGTCAT SEQ ID NO: 80 miR-9 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 81 CTCATACAG Forward Primer GCGTCTTTGGTTATCTAGCTG SEQ ID NO: 82 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 83 miR-10b RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 84 CCACAAATT Forward Primer GCTACCCTGTAGAACCGAAT SEQ ID NO: 85 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 86 miR-17 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 87 CCTACCTGC Forward Primer GCCAAAGTGCTTACAGTGCA SEQ ID NO: 88 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 89 miR-22 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 90 CACAGTTCT Forward Primer GCAAGCTGCCAGTTGAAGAA SEQ ID NO: 91 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 92 miR-125b RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 93 CTCACAAGT Forward Primer GCGTCGTACCGTGAGTAATAA SEQ ID NO: 94 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 95 miR-126 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 96 CCGCATTAT Forward Primer GTCCCTGAGACCCTAACTT SEQ ID NO: 97 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 98 miR-155 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGA SEQ ID NO: AGACGGAAGAATGTGCGTCTCGCCTTCTTT 99 CAACCCCTA Forward Primer GCGGTTAATGCTAATCGTGATA SEQ ID NO: 100 Reverse Primer CGAGGAAGAAGACGGAAGAAT SEQ ID NO: 101
[0226] As shown in
[0227] To the 6528-sample taken from FLT3-WT patients and the 6562-sample taken from FLT3-ITD mutated patients were transfected the linear miRNA trigger (PKR-155-155; Table 18) which could bind to miR-155 and target pkr and the control linear miRNA triggers (Luc-155-155, Luc-luc-luc; Tables 9 and 18) which target Luc, followed by quantitation of pkr expression levels. The results are depicted in
[0228] As shown in
[0229] From the results, it was understood that when applied to FLT3-ITD-mutated AML patients, a miRNA trigger capable of binding to miR-155 can regulate the expression of the target gene in a specific manner for FLT3-ITD-mutated AML patients.
Example 7-7. Effect of miRNA Trigger Targeting Bcl-2
[0230] Five linear miRNA triggers which could each bind to miR-155 and target bcl-2 gene were prepared in the same manner as in Reference Example 1. The five linear miRNA triggers included respective portions capable of binding complementarily to bcl-2 gene, with a difference among the portions. Sequences are listed in Table 20 for the linear miRNA triggers, in Tables 18 and 19 for the controls Luc-Luc-Luc and luc-155-155, respectively, and in Table 13 for siRNAs. Every nucleotide of the triggers and the controls were chemically modified with 2′-OMe.
TABLE-US-00021 TABLE 21 Oligo SEQ ID name Sequence (5′-3′) NO: Bcl-2 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmG SEQ ID (1)_155_ mGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmG NO: 155 mUmUmCmAmGmGmGmGmGmAmUmUmGmCmCmUmG 102 mAmAmGmAmCmUmGmUmUmAmA Bcl-2 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmG SEQ ID (2)_155_ mGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmG NO: 155 mUmUmCmAmGmGmGmGmGmAmAmUmGmCmCmAmC 103 mAmGmAmGmUmUmAmUmUmCmC Bcl-2 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmG SEQ ID (3)_155_ mGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmG NO: 155 mUmUmCmAmGmGmGmGmGmAmAmUmAmCmAmCmU 104 mAmUmUmUmGmUmGmAmGmCmA
[0231] The five linear miRNA triggers and the positive siRNA (siBcl-2) capable of binding bcl-2 were transfected to the FLT3-mutated AML cell line MOLM-14 which was then measured for cell viability. The results are depicted in
[0232]
[0233] As shown in
[0234] In addition, the miRNA trigger-transfected cells were measured for protein expression levels of the target Bcl-2 and the apoptotic marker cleaved PARP through western blotting, and the results are given in
Example 7-8. Effect of miRNA Trigger Targeting Mcl-1
[0235] A linear miRNA trigger (Mcl-1_155_155 or Bcl-2_155_155) which could bind to miR-155 and target mcl-1 or bcl-2 gene was prepared and transfected into the FLT3 mutated AML cell line MV4-11 which was then measured for cell viability. The results are depicted in
TABLE-US-00022 TABLE 22 Oligo SEQ ID name Sequence (5′.fwdarw.3′) NO: Mc1-1_ mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGm SEQ ID 155_155 GmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmU NO: mUmCmAmGmGmGmGmGmAmCmCmGmAmAmCmUmAm 105 CmGmUmAmGmC
[0236] As shown in
Example 8. Assay for Therapeutic Effect of miRNA Trigger on Breast Cancer
Example 8-1. Effect of Linear miRNA Trigger Targeting Bcl-xL
[0237] Two linear miRNA triggers (Bcl-xL(1)-222-222 and Bcl-xL(2)-222-222) which could each bind to miR-222 and knock down bcl-xL gene were prepared in the same manner as in Reference Example 1. The two linear miRNA triggers included respective portions capable of complementarily binding to bcl-xL gene, but with a difference between the portions. Sequences are listed in Table 23 for the linear miRNA triggers prepared above and in Tables 23 and 9 for the controls Luc-Luc-Luc and luc-222-222, respectively. Every nucleotide of the triggers and the controls were chemically modified with 2′-OMe.
TABLE-US-00023 TABLE 23 Oligo name Sequence (5′.fwdarw.3′) SEQ ID NO: bcl-xL(1)_222_222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmG SEQ ID NO: mCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmU 106 mAmGmCmUmUmCmUmCmCmUmUmCmCmUmGmCmCmCmU mUmCmCmU bcl-xL(2)_222_222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmG SEQ ID NO: mCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmU 107 mAmGmCmUmUmAmCmCmUmGmCmCmAmGmCmCmUmCmC mUmU luc_222-222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmG SEQ ID NO: mCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmU 108 mAmGmCmUmUmCmGmAmAmGmUmAmCmUmCmAmGmCmG mUmAmAmG
[0238] The seven linear miRNA triggers prepared above and the positive control siRNA(siBcl-xL) capable of binding to bcL-xL were transfected into the breast cancer cell line MDA-MB-231 in which miR-222 is overexpressed. Cell viability was measured and is depicted in
[0239] As shown in
[0240] The cells transfected with the selected miRNA triggers were measured for protein expression levels of the target Bcl-xL and the apoptotic marker cleaved PARP through western blotting, and the results are depicted in
[0241] The selected linear miRNA triggers (bcl-xL(1)_22_2222 and bcl-xL(2)_222_222) were transfected into the breast cancer cell line MDA-MB-453 to which miR-222 is not endogenous. Cell viability, and the mRNA and protein expression levels of the target gene (bcl-xL) were measured and the results are depicted in
Example 8-2. Effect of Linear miRNA Trigger Targeting bcl-xL or mcl-1
[0242] Linear miRNA triggers that could bind to miR-222 and target bcl-xL and mcl-1, respectively, were prepared and transfected alone or in combination into the breast cancer cell line MDA-MB-231. Cell viability was measured and the measurements are depicted in
[0243] Every nucleotide of the triggers and the controls was chemically modified with 2′-OMe.
TABLE-US-00024 TABLE 24 Oligo SEQ ID name Sequence (5′.fwdarw.3′) NO: Mcl-1_ mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUm SEQ ID 222_222 AmGmCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmA NO: mUmGmUmAmGmCmUmCmCmGmAmAmCmUmAmCmGm 109 UmAmGmC
[0244] As shown in
Example 8-3. Effect of miRNA Trigger Capable of Binding to miR-141 or let7f
[0245] Linear miRNA triggers that could bind to miR-141 or let7f and target bcl-xL or mcl-1 were prepared and transfected alone or in combination into the breast cancer cell line MCF-7 which was then measured for cell viability. The measurements are given in
TABLE-US-00025 TABLE 25 SEQ ID Oligo name Sequence (5′.fwdarw.3′) NO: Luc_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUm SEQ ID GmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmC NO: 50 mAmGmUmGmUmUmAmUmCmGmAmAmGmUmAmCmUmCm AmGmCmGmUmAmAmG Mcl-1_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUm SEQ ID GmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmC NO: 110 mAmGmUmGmUmUmAmCmCmGmAmAmCmUmAmCmGmUm AmGmC Luc_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGm SEQ ID UmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmGmC NO: 51 mGmCmAmGmUmAmUmUmAmUmCmGmAmAmGmUmAmCm UmCmAmGmCmGmUmAmAmG Mcl-1_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGm SEQ ID UmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmGmC NO: 111 mGmCmAmGmUmAmUmUmAmCmCmGmAmAmCmUmAmCm GmUmAmGmC luc_let7f_let7f mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCm SEQ ID CmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmC NO: 112 mUmAmCmCmUmCmAUmCmGmAmAmGmUmAmCmUmCmA mGmCmGmUmAmAmG Mcl-1_let7f_let7f mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCm SEQ ID CmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmC NO: 113 mUmAmCmCmUmCmAmCmCmGmAmAmCmUmAmCmGmUm AmGmC bcl- mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCm SEQ ID xL(1)_let7f_let7f CmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmC NO: 114 mUmAmCmCmUmCmAmUmCmUmCmCmUmUmCmCmUmGm CmCmCmUmUmCmCmU bcl- mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCm SEQ ID xL(2)_let7f_let7f CmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmC NO: 115 mUmAmCmCmUmCmAmUmAmCmCmUmGmCmCmAmGmCm CmUmCmCmUmU Bcl-xL(1)-141-141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUm SEQ ID GmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmC NO: 116 mAmGmUmGmUmUmAmUmCmUmCmCmUmUmCmCmUmGm CmCmCmUmUmCmCmU Bcl-xL(2)-141-141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUm SEQ ID GmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmC NO: 117 mAmGmUmGmUmUmAmUmAmCmCmUmGmCmCmAmGmCm CmUmCmCmUmU
[0246] As shown in
Example 8-4. Effect of miRNA Trigger Targeting miR-222 or let7f
[0247] Linear miRNA triggers that could bind to miR-141 or let7f and target Bcl-xL or Mcl-1 were prepared and transfected alone or in combination into the breast cancer cell line MDA-MB-231 which was then measured for cell viability. The measurements are given in
[0248] As shown in
Example 9. Hairpin miRNA Trigger Capable of Binding to Two Types of miRNAs
[0249] Hairpin miRNA triggers designed to open their hairpin structures upon binding to two different miRNAs were prepared in a same manner as in Example 2. The hairpin miRNA triggers prepared in this Example have the following structure:
[5′-portion capable of binding to mRNA of target gene (T*)-portion capable of binding to miRNA(1) (mi(1)*)-spacer(TT)-portion capable of binding to miRNA(2) (mi(2)*)-portion capable of binding toT* (T)-3′].
[0250] Hairpin miRNA triggers that could bind to both Let-7f and miR-222 and target mcl-1 were synthesized in Bioneer Inc., purified through HPLC, and stored until subsequent experiments. Every nucleotide was modified with 2′-O-methyl. Sequences of the miRNA triggers are listed in Table 26. In the table below, (10) means a hairpin in which only 10 mers from the 5′ of the miRNA binds to the loop and (full) means a hairpin in which the full sequence of the miRNA binds to the loop.
TABLE-US-00026 TABLE 26 SEQ ID Oligo name Sequence (5′.fwdarw.3′) NO: HP_Luc_7f + 222(10) mUmCmGmAmAmGmUmAmCmUmCmAmGmCmAmAmCmU SEQ ID mAmUmAmCmAmAmAmCmCmCmAmGmUmAmGmCmGmC NO: 118 mUmGmAmGmUmAmCmUmUmCmGmA HP_Mcl-1_7f + 222(full) mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmAmCmU SEQ ID mAmUmAmCmAmAmUmCmUmAmCmUmAmCmCmUmCmA NO: 119 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmA mGmCmUmGmCmUmAmCmGmUmAmGmUmUmCmGmG HP_Mcl-1_7f + 222(10) mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmAmCmU SEQ ID mAmUmAmCmAmAmAmCmCmCmAmGmUmAmGmCmGmC NO: 120 mUmAmCmGmUmAmGmUmUmCmGmG
[0251] It is expected that only when the two different types of miRNAs exist, the hairpin miRNA triggers prepared above can be opened to repress the expression of the target gene. A schematic diagram illustrating the mechanism in which a hairpin miRNA trigger capable of binding to two types of miRNAs regulates a target gene is depicted in
[0252] The hairpin miRNA triggers prepared above were transfected into MDA-MB-231 and MDA-MB-453 cells which were then measured for cell viability. The results are depicted in
Example 10. Apoptotic Effect of Hairpin miRNA Trigger on Breast Cancer
[0253] Hairpin miRNA triggers which could bind to miR-222 or let-7f and target mcl-1 or bcl-xL were prepared and transfected into the breast cancer cell line MDA-MB-231 which was then measured for cell viability. The results are depicted in
[0254] The hairpin miRNA triggers used in this Example are listed in Table 27, below. Every nucleotide of the triggers was modified with 2′-O-methyl. In Table 27, the numerals (−1, −4, or −6) used as suffixes in the miRNA trigger names refer to relative positions selected from various numbers of cases allowing the target site for each target gene to have a 14-nt long stem.
TABLE-US-00027 TABLE 27 SEQ ID Oligo name Sequence (5′.fwdarw.3′) NO: HP_luc_let7 mUmCmGmAmAmGmUmAmCmUmCmAmGmCmAmAmCmU SEQ ID mAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmA NO: 121 mGmCmUmGmAmGmUmAmCmUmUmCmGmA HP_luc_222 mUmCmGmAmAmGmUmAmCmUmCmAmGmCmAmCmCmC SEQ ID mAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmG NO: 122 mCmUmGmAmGmUmAmCmUmUmCmGmA HP_Mcl-1_let7 mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmAmCmU SEQ ID mAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmA NO: 123 mGmCmUmAmCmGmUmAmGmUmUmCmGmG HP_Mcl-1_222 mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmCmCmC SEQ ID mAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmG NO: 124 mCmUmAmCmGmUmAmGmUmUmCmGmG HP_bcl-xL(5)_222-1 mUmUmCmCmUmGmCmCmCmUmUmmCmCmUmAmCmCm SEQ ID CmAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUm NO: 125 AmGmGmAmAmGmGmGmCmAmGmGmAmA HP_bcl-xL(6)_222-4 mUmAmCmCmUmGmCmCmAmGmCmCmUmCmAmCmCmC SEQ ID mAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmG NO: 126 mAmGmGmCmUmGmGmCmAmGmGmUmA HP_bcl-xL(5)_222-6 mUmCmUmCmCmUmUmCmCmUmGmCmCmCmAmCmCmC SEQ ID mAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmG NO: 127 mGmGmCmAmGmGmAmAmGmGmAmGmA HP_bcl-xL(6)_let7-1 mCmUmGmCmCmAmGmCmCmUmCmCmUmUmAmAmCmU SEQ ID mAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmA NO: 128 mAmAmGmGmAmGmGmCmUmGmGmCmAmG HP_bcl-xL(6)_let7-4 mUmAmCmCmUmGmCmCmAmGmCmCmUmCmAmAmCmU SEQ ID mAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmA NO: 129 mGmAmGmGmCmUmGmGmCmAmGmGmUmA
[0255] As can be seen in
Example 11. Construction of Dumbbell-Shaped miRNA Trigger
[0256] In this Example, a miRNA trigger having increased binding affinity for mRNA of a target gene was constructed. In this regard, the mRNA-recognizing portion of the linear or hairpin miRNA trigger was lengthened from a 14-nt size to a 20-nt size to increase the repressive effect on the expression of the target gene. In order to increase binding affinity for a target gene while retaining the advantage of hairpin miRNA triggers that the expression of the target gene can be repressed only in the presence of a miRNA recognizable by the triggers, the portion capable of complementarily binding to the mRNA of the target gene was lengthened to an about 20-nt size to construct a dumbbell-shaped miRNA trigger (hereinafter referred to as “dumbbell miRNA trigger”). Sequences of dumbbell miRNA triggers are listed in Table 28, below.
TABLE-US-00028 TABLE 28 Oligo SEQ ID name Sequence (5′-3′) NO: DB_PKR_ CCCCCCGAATGAGAAATACCATCTTTACCAGACAGT SEQ ID S20_141 GTTATATTTCTCATTCCCTTCCTT(C12SPACER)A 130 AGGAAGGGGGGGG miRNA- UAACACUGUCUGGUAAAGAUGG SEQ ID 141 NO: 17 PKR CAAUAAUGGGAAGGAAGGGAAUGAGAAAUAUUAAAU SEQ ID mRNA UCUG NO: 73 (2)
[0257] To a buffer (1×PBS buffer, +5 mM MgCl2, 137 mM NaCl, 10 mM PO4, 2.7 mM KCl, 5 mM MgCl.sub.2; pH 7.4) containing 100 nM of the dumbbell miRNA trigger (DP) prepared above, 100 nM miRNA and/or 100 nM target mRNA was added, followed by incubation at 37° C. for 1 hour. Each sample was loaded to a PAGE gel and run. The results are depicted in
[0258] As shown in
Example 12. Maximization of Gene Regulation Efficiency Through Various Designs of miRNA Triggers
[0259] Comparison was made of the regulatory efficiency of various designs of miRNA triggers against the gene expression of BCL-xL in the breast cancer cell line MDA-MB-231. On the basis of the comparison, research has been directed toward optimal designs that allow for the highest gene regulation efficiency.
[0260] In the foregoing, it was confirmed that when the BCL-xL-222-222 miRNA trigger, which is designed to use miR-222, overexpressed specifically in MDA-MB-231, to suppress the expression of BCL-xL, was applied to cells, the MDA-MB-231 cell-specific BCL-xL mRNA expression level and protein expression level decreased. The downregulation of BCL-xL gene expression induced MDA-MB-231-specific apoptosis.
[0261] Various designs of miRNA triggers that can maximize gene regulation efficiency have been studied. Various sequences of miRNA triggers capable of regulating the BCL-xL gene were designed on the basis of miR-222, which is overexpressed specifically in MDA-MB-231, and compared for the efficiency of BCL-xL gene regulation in MDA-MB-231.
[0262] Since the previously prepared miRNA trigger sequence had the structure of 5′-target gene binding sequence-target gene binding sequence-miRNA binding sequence-3′, miRNA triggers were designed with various sequence lengths and sequences and compared for BCL-xL gene regulation efficiency in this example (see
[0263] After treatment with miRNA triggers, mRNA expression levels of the target gene BCL-xL were measured. In this manner, gene regulation efficiency was compared between the BCL-xL-222-222 miRNA trigger and the 222-222-BCL-xL miRNA trigger to determine the effect of the order of the sequences binding to miRNA and target gene in miRNA triggers on the gene regulation efficiency of the miRNA triggers.
[0264] The result is shown in
[0265] Next, gene regulation efficiency was compared between the BCL-xL-222-222 miRNA trigger and the BCL-xL-222 miRNA trigger, which includes one miRNA binding region. The effect of the number of miRNA binding sequences and the length of entire miRNA triggers on gene regulation efficiency was examined.
[0266] The results are depicted in
[0267] Finally, the miRNA trigger designed with the miRNA binding sequence composed only of the 8 nucleotide (nt)-long seed sequence essential for the function of the miRNA was examined for gene regulation efficiency. Comparison was made of gene regulation efficiency between the BCL-xL-222-222 miRNA trigger and the (SEED)BCL-xL-222-222 miRNA trigger that has a complementary sequence to the seed-sequence of miRNA.
[0268] The results are depicted in
Example 13. Increase in Apoptotic Efficiency by miRNA Trigger
[0269] Two different types of miRNAs were used to regulate the expression of two genes of the BCL-2 family in the breast cancer cell lines MDA-MB-231 and MDA-MB-453, thereby increasing apoptotic efficiency.
[0270] When administered to cells, the BCL-xL-222-222 miRNA trigger, designed to knock down BCL-xL by using miR-222, which is overexpressed specifically in MDA-MB-231, induced apoptosis in MDA-MB-231, but not in MDA-MB-453, which does not overexpress miR-222. In addition, the MCL-1-let7f-let7f miRNA trigger, designed to knock down MCL-1 by using miR-let7f, which is overexpressed in both MDA-MB-231 and MDA-MB-453, was administered to the cells. However, none of the two cell lines were induced to undergo apoptosis when MCL-1 alone was downregulated.
[0271] In contrast, when BCL-XL was regulated using siRNA together with the regulation of MCL-1, very high apoptotic efficiency was detected. This data led to the experiment for examining whether apoptotic efficiency is increased by using miR-222 and miR-let7f to simultaneously regulate the two genes of the BCL-2 family. When the BCL-xL-222-222 trigger and the MCL-1-let7f-let7f miRNA trigger were co-administered, MDA-MB-231 underwent apoptosis, but no apoptosis was detected in MDA-MB-453 that does not express miR-222.
[0272] On the basis of these results, apoptosis was examined when miR-222 and miR-let7f were used to simultaneously regulate the two different genes of the BCL-2 family (see
[0273] The MCL-1-222-222 miRNA trigger, which utilizes miR-222 to regulate MCL-1 gene, and the BCL-xL-let7f-let7f miRNA trigger, which utilizes miR-let7f to regulate BCL-xL gene, were administered to MDA-MB-231 and MDA-MB-453.
[0274] First, administration of the BCL-xL-let7f-let7f miRNA trigger, which utilizes miR-let7f to regulate BCL-xL gene, exhibited relatively low apoptotic efficiency in MDA-MB-231 as shown in
[0275] Furthermore, when the MCL-1-222-222 miRNA trigger, which utilizes miR-222 to regulate MCL-1 gene, was administered to MDA-MB-231, no apoptosis was observed, which was consistent with the previous study, as shown in
[0276] When the BCL-xL-let7f-let7f miRNA trigger, which utilizes miR-let7f to regulate BCL-xL gene, was administered to MDA-MB-453, no apoptosis was observed, which was consistent with the previous study, as shown in
[0277] Administration of the MCL-1-222-222 miRNA trigger, which utilizes miR-222 to regulate MCL-1 gene, did not induce apoptosis of MDA-MB-453 that does not overexpress miR-222, as shown in
[0278] Next, apoptosis was examined when the two types of miRNA triggers were co-administered to cells. The total concentration of the two triggers was 120 nM, which was the same as for individual miRNAs. The results are depicted in
Example 14. Influence of BCL-2 Family Gene Regulation on Apoptosis
[0279] The BCL-2 family of proteins controls cell death. Among others, BCL-2, BCL-xL, and MCL-1 are known to inhibit apoptosis. As described in the foregoing, regulation of two or more genes of the BCL-2 family brought about very strong apoptotic effects.
[0280] In the MCF-7 breast cancer cell line and the PANC-1 pancreatic cancer cell line, three genes of the BCL-2 family were regulated separately and together as follows.
[0281] First, MCF-7 was measured for cell viability after treatment with siMCL-1, siBCL-xL, and siBCL-2 (
[0282] Next, examination was made of the apoptosis when two or more genes were regulated together. MCF-7 was measured for cell viability after treatment with siMCL-1+siBCL-xL, siMCL-1+siBCL-2, siBCL-xL+siBCL-2, and siMCL-1+siBCL-xL+siBCL-2 (
[0283] Finally, experiments under all the conditions (individual and simultaneous regulation) were conducted simultaneously so as to compare effects thereof. In this regard, each siRNA was used at a concentration of 20 nM, with a total of 60 nM set forth for all the siRNAs used (
[0284] The same experiment as in the breast cancer cell line was conducted for the PANC-1 pancreatic cancer cell. Likewise, each siRNA was used at a concentration of 20 nM, with a total of 60 nM set forth for all the siRNAs used (
[0285] As shown in