PASTA SOURDOUGH CULTURES AND METHODS OF MAKING SAME

Abstract

The present disclosure relates to the preparation and maintenance of sourdough cultures that can be used to prepare pasta. The disclosure describes the identification of specific fermentation conditions that reliably maintain lactate-utilizing lactobacilli as dominant members of the microbiota by traditional methods. A crucial difference between known processes and the inventive process is that the conditions of the inventive fermentation process naturally select for several species of microorganisms, including Levilactobacillus koreensis and Levilactobacillus parabrevis. Specifically, the cold fermentation favors growth of these organisms and thereby produces more acetic acid than lactic acid in the sourdough.

Claims

1. A composition for producing a sourdough, the composition comprising one or more lactobacilli, that catalyze lactate to propanediol and acetate conversion, the lactobacilli selected from the Levilactobacillus species.

2. The composition of claim 1, wherein the one or more lactobacilli comprises Levilactobacillus parabrevis.

3. The composition of claim 1, wherein the one or more lactobacilli comprises Levilactobacillus koreensis.

4. The composition of claim 1, wherein the one or more lactobacilli comprise Levilactobacillus parabrevis and Levilactobacillus koreensis.

5. The composition of claim 1, further comprising one or more microorganisms selected from the group comprising: Furfurilactobacillus, Lentilactobacillus and Secundilactobacillus.

6. A method of producing sourdough by fermentation of lactobacilli, that catalyze lactate to propanediol and acetate conversion, the lactobacilli selected from the Levilactobacillus species.

7. The method of claim 6, wherein the one or more lactobacilli comprises Levilactobacillus parabrevis.

8. The method of claim 6, wherein the one or more lactobacilli comprises Levilactobacillus koreensis.

9. The method of claim 6, wherein the one or more lactobacilli comprise Levilactobacillus parabrevis and Levilactobacillus koreensis.

10. The method of claim 6, wherein the fermentation includes backslopping at 6-9 day intervals.

11. The method of claim 10, wherein the backslopping is conducted at a ratio of water to flour of between 1.25:1 and 1.50:1.

12. The method of claim 11, wherein the fermentation is conducted at a pH of below 4.2 for 7-12 days at 5.0° C., with 50% backslopping.

13. The method of claim 11, wherein the fermentation is conducted at a pH of below 4.2 for 6-10 days at 7.5° C., with 50% backslopping.

14. The method of claim 11, wherein the fermentation is conducted at a pH of below 4.2 for 9-15 days at 3.3° C., with 50% backslopping.

15. The method of claim 11, wherein the fermentation is conducted at a pH of below 4.2 for 9-15 days at 5.0° C., with 80-90% backslopping.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0028] To easily identify the discussion of any particular element or act, the most significant digit or digits in a reference number refer to the figure number in which that element is first introduced.

[0029] FIG. 1 illustrates shows different colony morphologies that were picked and streaked until uniform morphologies were achieved.

[0030] FIG. 2 illustrates a typical 50% takeaway and replenishing backslopping technique.

[0031] FIG. 3 illustrates a ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough.

[0032] FIG. 4 illustrates an alternative ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough.

[0033] FIG. 5 illustrates another ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough.

[0034] FIG. 6 illustrates yet another ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough.

[0035] FIG. 7 illustrates the approximate proportions of microorganisms present in the sourdough pasta and the commercially available non-sourdough pasta.

[0036] FIG. 8A to FIG. 8E illustrate microbial composition of an embodiment of the sourdough at the genus level.

[0037] FIG. 9A to FIG. 9H illustrate the effect of acute intake of conventional and sourdough pasta on, (FIG. 9A) blood glucose, (FIG. 9B) insulin, (FIG. 9C) C-peptide, (FIG. 9D) Glucagon, (FIG. 9E) PYY, (FIG. 9F) GLP-1, (FIG. 9F) GIP and (FIG. 9H) paracetamol.

[0038] FIG. 10A and FIG. 10B illustrate the effect of chronic intake of conventional and fermented sourdough pasta on (FIG. 10A) blood glucose, (FIG. 10B) fecal SCFA concentration. All data are presented as mean±SEM (n=16). *Indicates statistical significance in total SCFA concentration (p<0.05) compared to baseline values.

[0039] FIG. 11A to FIG. 11F illustrate the impact of chronic consumption of conventional vs. sourdough pasta on bacterial and fungal diversity of overweight participants after consumption of conventional and sourdough pasta for 5 days. (FIG. 11A) Bacterial and (FIG. 11B) fungal abundance; (FIG. 11C) bacterial and (FIG. 11D) fungal beta diversity; (FIG. 11E) bacterial and (FIG. 11F) fungal alpha diversity assessed using Shannon Index.

[0040] FIG. 12 illustrates the pathway for anaerobic degradation of lactic acid.

DETAILED DESCRIPTION

[0041] Devices and methods for carrying out the invention are presented in terms of embodiments depicted within the FIGs. However, the invention is not limited to the described embodiments, and a person skilled in the art will appreciate that many other embodiments of the invention are possible without deviating from the basic concept of the invention, and that any such work around will also fall under scope of this invention. It is envisioned that other styles and configurations of the present invention can be easily incorporated into the teachings of the present invention, and the configurations shall be shown and described for purposes of clarity and disclosure and not by way of limitation of scope.

[0042] The features of the invention which are believed to be novel are particularly pointed out in the specification. The present invention now will be described more fully hereinafter with reference to the accompanying drawings, which are intended to be read in conjunction with both this summary, the detailed description and any preferred and/or particular embodiments specifically discussed or otherwise disclosed. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided by way of illustration only and so that this disclosure will be thorough, complete and will fully convey the full scope of the invention to those skilled in the art.

EXAMPLE 1

[0043] FIG. 1 shows different colony morphologies, 102, that were picked and streaked until uniform morphologies were achieved.

[0044] FIG. 2 demonstrates the essence of the maintenance of lactate to acetate+propanediol converting lactobacilli is (i) the high inoculum used for the mother (50% previous sourdough+fresh flour); this keeps the pH low all the time and (ii) the long-term incubation at 4° C. Several publications refer to 4° C. as a preservation step that interrupts all microbial activity. Consequently, the presence of lactate to acetate+propanediol converting Levilactobacillus is virtually unprecedented. The selection of these organisms as stable components of the sourdough is preferably achieved by a multistage fermentation process at temperatures ranging from 4° C. to 35° C. with backslopping of 5-50% of inoculum. One of the stages is preferably conducted at a temperature below ambient for more than 3 days; other stages are preferably conducted at 20—more than 30° C.

EXAMPLE 2

[0045] This example outlines methods for the preparation of the sourdough culture and fermented sourdough composition that can subsequently be used in the preparation of pasta.

[0046] FIGS. 3-7 show examples of ‘Cool/Cold Methods’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough.

[0047] The first ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough is illustrated in FIG. 3. This method demonstrates having 7-day intervals with 50% backslopping at 5° C. It is intended that the 7-day backslopping intervals are a minimum, but can be extended to 12 days. The ratio of water to flour is between 1.25:1 and 1.50:1. The pH range is maintained below 4.2.

[0048] The second ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough is illustrated in FIG. 4. This method demonstrates having 6-day intervals with 50% backslopping at 7.5° C. It is intended that the 6-day backslopping intervals are a minimum, but can be extended to 10 days. The ratio of water to flour is between 1.25:1 and 1.50:1. The pH range is maintained below 4.2.

[0049] The third ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough is illustrated in FIG. 5. This method demonstrates having 9-day intervals with 50% backslopping at 3.3° C. It is intended that the 9-day backslopping intervals are a minimum, but can be extended to 15 days. The ratio of water to flour is between 1.25:1 and 1.50:1. The pH range is maintained below 4.2.

[0050] The fourth ‘Cool/Cold Method’ of developing and maintaining a natural stable heterofermentative Lactic Acid Bacteria based sourdough is illustrated in FIG. 6. This method demonstrates having 9-day intervals with 80-90% backslopping at 5° C. It is intended that the 9-day backslopping intervals are a minimum, but can be extended to 15 days. The ratio of water to flour is between 1.25:1 and 1.50:1. The pH range is maintained below 4.2.

EXAMPLE 3

[0051] This example identifies the composition of microorganisms present in the sourdough used in an embodiment of the cultures used in this unique pasta making process.

[0052] Materials and Methods:

[0053] Four sourdough samples were used for culturing and isolation:

[0054] a. Sourdough after first stage (fermentation);

[0055] b. Sourdough after second stage (ambient);

[0056] c. Pasta after mixing, and Pasta after mixing and 24 h of storage at ambient temperature;

[0057] d. Pasta after drying.

[0058] Samples were obtained and analyzed. In addition. frozen pasta samples (after mixing but before drying) were analyzed after 4-5 days of storage at ambient temperature.

TABLE-US-00001 TABLE 1A Conditions used for bacterial isolation Media Supplementation Temperature Condition modified MRS malt extract ambient, 30° C. aerobic, anaerobic (mMRS) mMRS malt extract, ambient, 30° C. aerobic, anaerobic antibiotics mMRS Vitamins ambient, 30° C. aerobic, anaerobic mMRS vitamins, ambient, 30° C. aerobic, anaerobic antibiotics M17 Glucose ambient, 30° C. aerobic, anaerobic M17 glucose, ambient, 30° C. aerobic, anaerobic antibiotics

[0059] Generally, modified MRS with addition of malt extract or vitamins is sufficient for cultivation of all lactic acid bacteria in sourdoughs; however, to accommodate the presence of unusual bacteria after fermentation at 4° C., a more extensive set of cultivation media and cultivation conditions was used. The addition of antibiotics was used to selectively identify yeasts.

[0060] Mannitol salt agar was used for specific detection of staphylococci in pasta that was frozen after mixing and extrusion, and stored at ambient temperature.

[0061] Isolate identification was carried out by first conducting random amplified polymorphic DNA (RAPD) analysis to eliminate clonal isolates followed by 16S sequencing to identify isolates at the species level. Details of culture isolation from food samples are attached in the SOP.

[0062] In addition, the ninhydrin method was used to determine the enzymatic activity in the sourdough noodles upon storage at ambient temperatures. Ninhydrin is a chemical which reacts with amines and amino acids in solution producing a colorimetric difference. Extraction of samples was carried out using 100 mM sodium buffer for 1 h at 5° C. The supernatant was combined with the ninhydrin reagent and heated for 16 min followed by measurement at 570 nm.

[0063] HPLC analysis of sourdough pasta samples were carried out to determine presence of organic acids during different processing steps. Samples were prepared at a 1:1 ratio with perchloric acid, left overnight at 4° C., centrifuged and filtered before loading onto the Aminex HPX-87H organic acid column for analysis.

[0064] Results:

[0065] The sourdough has a stable core microbiota consisting of Levilactobacillus koreensis, Lv. parabrevis, Pediococcus parvulus, and P. pentoceaus. The two predominant species Lv. koreensis and P. parvulus were present at approximately 10.sup.7 CFU/g to 10.sup.8 CFU/g in the samples before extrusion. Other bacteria were observed in individual samples or in individual batches, e.g. Fl. sanfranciscensis and Lactococcus lactis.

[0066] Details are shown in Table 1B for the 3 different batched of sourdough pasta.

TABLE-US-00002 TABLE 1B Bacterial counts and isolates found in different sourdough pasta samples. Table 1B - Batch 1 Batch #1 Sourdough 6 d Sourdough Pasta after Pasta after fermentation ambient mixing drying pH 3.61 3.53 — — Total cell 4-6 × 10.sup.8 4-9 × 10.sup.8 3-9 × 10.sup.4 10.sup.2-10.sup.3 count (CFU/g) Isolates Lactobacillus Lactobacillus Lactobacillus Lactobacillus found koreensis* koreensis* koreensis* koreensis* (*predomi- Lactobacillus Lactobacillus Lactobacillus Lactobacillus nant 10.sup.7- parabrevis parabrevis parabrevis parabrevis 10.sup.8; Pediococcus Pediococcus Pediococcus Pediococcus yeasts ≤ 10.sup.5) parvulus* parvulus* parvulus* parvulus* # present Pediococcus Pediococcus Pediococcus Pediococcus only in low pentosaceus pentosaceus pentosaceus pentosaceus cell count Pichia Pichia Kazachstania Lactobacillus (<1% of membranefaciens membranefaciens barnetti sanfranciscensis total) Kazachstania Kazachstania Lactobacillus Staphylococcus barnetti barnetti sanfranciscensis warneri Lactobacillus Lactobacillus sanfranciscensis sanfranciscensis Lactococcus lactis Table 1B - Batch 2 Batch #2 Sourdough 6 d Sourdough Pasta after Pasta after Pasta after fermentation ambient mixing mixing 24 h drying 3.57 3.61 — — — 1-4 × 10.sup.9 10.sup.7-10.sup.9 6 × 10.sup.4-8 × 10.sup.3 1-6 × 10.sup.4 0-1000 Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus koreensis* koreensis* koreensis* koreensis* koreensis* Lactobacillus Lactobacillus Lactobacillus Lactobacillus Lactobacillus parabrevis parabrevis parabrevis parabrevis parabrevis Pediococcus Pediococcus Pediococcus Pediococcus Pediococcus parvulus* parvulus* parvulus parvulus parvulus* Pediococcus Pediococcus Pediococcus Pediococcus Pediococcus pentosaceus pentosaceus pentosaceus pentosaceus pentosaceus Pichia Pichia Kazachstania Kazachstania Enterococcus membranifaciens membranifaciens barnetti barnetti lactis Torulaspora Acetobacter Enterococcus Staphylococcus delbrucckii cerevisiae lactis warneri Enterococcus Carnobacterium Erwinia ssp lactis maltaromaticum Table 1B - Batch 3 Batch #3 Sourdough 6 d Sourdough fermentation ambient 3.62 3.7 9 × 10.sup.8-2 × 10.sup.9 1-4 × 10.sup.9 Lactobacillus Lactobacillus koreensis* koreensis* Lactobacillus Lactobacillus parabrevis parabrevis Pediococcus Pediococcus parvulus* parvulus* Pediococcus Pediococcus pentosaceus pentosaceus Pichia Pichia membranifaciens membranifaciens Kazachstania Kazachstania barnetti barnetti Saccharomyces cerevisiae Naumovozyma castellii Note: Lactobacillus koreensis and Lactobacillus parabrevis are now assigned to the new genus Levilactobacillus. Lactobacillus sanfranciscensis is assigned to the new genus Fructilactobacillus. indicates data missing or illegible when filed

[0067] These organisms represent species that are present in low abundance and were detected only at cultivation conditions that do not support growth of dominant organisms (Enterococcus lactis, Lactococcus lactis, Carnobacterium maltaromaticum, Acetobacter cerevisiae). Fl. sanfranciscensis was detected on one batch but not in others. Fl. sanfranciscensis is detected only if it account for 1% or more of total bacterial cell counts; results thus indicate that Fl. sanfranciscensis is present in low cell counts and occasionally reaches higher cell counts.

[0068] Yeast cell counts accounted for less than 0.01% of total microbial counts—this is substantially lower when compared to most other sourdoughs where typically 1-10% of microbial cells are yeasts. Pichia membranifaciens—a non-fermenting yeast which likely grows only at the surface—and Kazachstania barnetti were isolated in all batches of the pasta sourdough.

[0069] The presence of Lv. koreensis and P. parvulus as dominant members of sourdough microbiota and the low yeast cell counts may not be unprecedented but are highly unusual—the exceptional fermentation conditions apparently select for exceptional microorganisms. The high cell counts of Levilactobacillus species likely relates to their ability to convert lactate, which support metabolic activity and growth at cold and acidic conditions.

[0070] The exceptional presence of Lv. koreensis and Lv. parabrevis is also reflected by the exceptional profile of metabolites. In particular, the conversion of lactate to acetate and 1,2 propanediol is generally not observed in sourdoughs. Acetic acid is volatile and impacts product flavor more strongly than lactic acid. The levels in pasta dough after mixing—5 mmol/kg—may be sufficient to impact product flavor.

[0071] Lactate conversion to acetate and 1,2 propanediol has been used in experimental sourdoughs to achieve an extended mold free shelf life of bread but is not typically observed in traditional or industrial sourdoughs. One exception pertains to the use of a lactate converting strain of Lentilactobacillus buchneri which is used in an industrial application. Here, lactate conversion to acetate and 1,2 propanediol warrants a high metabolic activity of lactic acid bacteria even after extended refrigerated storage.

[0072] Extrusion of pasta (samples after pasta mixing) reduced cell counts from one billion cells/g to 10,000 viable cells/g. Major organisms that were identified in sourdough were also identified in pasta after mixing and drying. In addition, enterococci, staphylococci and Erwinia spp. were detected, which likely represent contaminants from the processing environment or the flour. Low levels of these organisms are not of concern for food safety.

[0073] Analysis of the pasta after drying and days or weeks of dry storage suggested that sourdough lactic acid bacteria die relatively rapidly after drying while plant-associated enterococci and Enterobacteriaceae persist in low cell counts.

[0074] Storage of frozen pasta for 4-5 days at ambient temperature resulted in re-growth of Pediococcus parvulus to high cell counts (108-109) but not of lactobacilli (see Table 1C).

TABLE-US-00003 TABLE 1C Table 1C - Bacterial counts and isolates found in extruded pasta noodle samples. Extruded pasta Extruded pasta after 4-5 days of storage at ambient temperature pH — Total cell count 8 × 10.sup.8-1 × 10 (CFU/g) Isolates found Peiococcus parvulus* ( predominant Pichia mebranifaciens 10.sup.7-10.sup.8; yeasts Kazachstania barnetti 10 ) On MSA: Staphylococcus agenteus/aureus (1 × 10.sup.5 CFU/g) S. warneri (3 × 10.sup.4 CFU/g) S. saprophyticus (10  CFU/g) S. succinus (10.sup.3 CFU/g) indicates data missing or illegible when filed

[0075] Apparently, the water content and water activity in the pasta dough after mixing, estimated at about 30% and 0.9, respectively, was too low to support re-growth of lactobacilli. Staphylococcus strains were also present on the noodle, but at counts of approximately 104-105 CFU/g.

[0076] One of the Staphylococcus strains was similar to Staphylococcus aureus—although we did not confirm the species identification by re-sequencing, and although the cell counts are close but not quite at a level where toxin production by S. aureus presents a safety hazard, this indicates that the post-extrusion fermentation of pasta dough should be controlled to prevent growth of enterotoxin producing staphylococci.

[0077] Proteolytic activity during ambient storage of pasta after mixing and freezing was assessed with the ninhydrin assay. The content of primary amines increased more than twofold during storage of pasta (after mixing) for 4-5 days, indicating continued activity of cereal proteases. The content of primary amines in pasta after drying was also higher when compared to the sample analyzed after mixing and before drying, however, because these two samples were obtained from different batches, it cannot be concluded with certainty that this represents proteolytic activity during drying of pasta (Table 1D).

TABLE-US-00004 TABLE 1D Table 1D - Ninhydrin assay of frozen pasta noodles and dried pasta samples. Ninhydrin Assay Frozen pasta after  76.86 ± 14.65 mmol/kg arrival Frozen pasta after 4-5 d  218.06 ± 5.32 mmol/kg ambient temperature Pasta after drying (from 110.16 ± 13.32 mmol/kg batch #3)

SUMMARY

[0078] Samples of sourdoughs were obtained at three time points and were shown to contain a core microbiota consisting of Pediococcus parvulus, Levilactobacillus koreensis, Pediococcus pentosaceus and Levilactobacillus parabrevis. Yeasts accounted for 0.01% or less of total microbial counts. This composition of sourdough microbiota is exceptional when compared to other sourdoughs—a description of more than 500 sourdoughs is available in the literature—and likely reflects the exceptional fermentation conditions.

[0079] Pasta mixing and extrusion reduces bacterial cell counts to less than 10,000 and re-growth of pediococci takes more than 24 h. The substantial inactivation of bacterial cells likely represent local temperature inhomogeneities in the extruder—the temperature inactivation of pediococci requires local temperatures of more than 60° C. Bacterial metabolism thus does not occur during drying but flour enzymes may remain active.

[0080] Pediococci but not lactobacilli re-grow if pasta dough is stored at ambient temperature after mixing and before drying. Such incubation may require measures to control growth of molds and staphylococci.

TABLE-US-00005 TABLE 1E Table 1E - Concentration of organic acids and alcohols in sourdoughs, pasta dough, and pasta samples. 1,2- Lactate Acetate propanediol Ethanol (mmol/kg) (mmol/kg) (mAU*min) (mmol/kg) Batch 1- SD 99.6 ± 2.6 125.5 ± 6.7 41.92 80.4 ± 1.8 after 6 d fermentation Batch 2- SD 84.6 ± 5.3 110.7 ± 6.0 12.45 77.2 ± 7.3 after 6 d fermentation Batch 3- SD 78.1 ± 8.9  87.7 ± 0.4 — 87.4 ± 0.5 after 6 d fermentation Batch 2- SD 30.6 ± 5.3  31.3 ± 5.1 4.96 85.6 ± 17  after ambient temperature Batch 3- SD 55.3 ± 11    39 ± 7.9 2.85 110.3 ± 11.2 after ambient temperature Batch 2-  5.7 ± 0.11  4.6 ± 0.1 1.53  0.13 ± 0.01 pasta after mixing indicates data missing or illegible when filed

[0081] The lactate concentrations in sourdough samples shown in Table 1E match those typically found in sourdoughs, however, the concentrations of acetic acid were 5-10 times higher than usually found in sourdough, and acetate concentrations exceeded lactate concentrations after 6 d of fermentation at 4° C. This exceptional high concentration of acetate is attributed to conversion of lactate to acetate and 1,2 propanediol by Levilactobacillus parabrevis and/or Levilactobacillus koreensis.

[0082] The concentration of organic acids in pasta dough after mixing matches the concentration that would be expected by dilution of the sourdough, confirming that lactic acid bacteria show very little metabolic activity after mixing of the pasta dough.

EXAMPLE 4

[0083] This example compares the composition of microorganisms present in the sourdough used in this unique pasta making process with the composition of microorganisms present in a commercially available non-sourdough pasta.

[0084] Materials and Methods:

[0085] Two different samples of pasta were used for culturing and isolation:

[0086] a. Catelli commercial pasta sample 202; and

[0087] b. sourdough pasta sample 204 from the unique pasta making process.

[0088] Samples were prepared by homogenizing 2.2 g of pasta in 5 ml distilled water.

[0089] The resulting homogenate was flash frozen at 80° C. to prevent bacterial growth.

[0090] Standard library primers were then used for MLSA typing of the selected genera.

[0091] Results

[0092] FIG. 7 illustrates the approximate proportions of microorganisms present in the sourdough pasta and the commercially available non-sourdough pasta.

[0093] Both pasta products contained bacterial 16S rRNA genes.

EXAMPLE 5

[0094] This example compares microorganisms (specifically 4 genera of the Lactobacillaceae) and lactaldehyde dehydrogenase in 11 commercial pastas with 3 samples of sourdough pasta and includes an analysis of dry wheat and dry rye samples.

[0095] Materials and Methods:

[0096] The taxonomic identification of bacterial isolates was based on the elimination of clonal isolates by random amplification of polymorphic DNA (RAPD) typing, followed by sequencing of 16S rRNA genes were conducted as outlined Appl. Environ. Microbiol. 2019, 85 (11), e03130-18.

[0097] 1. DNA was isolated from the pasta products.

[0098] 5.0 g of each of pasta product.

[0099] Use H.sub.2O to soft the pasta (total volume of pasta+H.sub.2O is 50 ml).

[0100] Homogenized by the stomacher for 5 min.

[0101] Centrifuge at 500 g for 15 min.

[0102] Transfer the supernatants into clean tubes and centrifuge at 5000 rpm for 15 min.

[0103] Harvest cell pellets.

[0104] Use the Blood & Tissue Kit to isolate DNA.

[0105] 2. Primer design for the amplification of genes targeting lactaldehyde dehydrogenase (LAD)

[0106] Using lactaldehyde dehydrogenase sequence (KRK67102.1) from Ln. buchneri to retrieve protein sequences from Lactobacillaceae in NCBI.

[0107] Selecting sequences from Secundilactobacillus (8 AA sequences), Levilactobacillus (6 AA sequences), Lentilactobacillus (7 AA sequences), Furfurilactobacillus (1 AA sequences), and Agrilactobacillus (1 AA sequences).

[0108] Importing all selected sequences into Geneious app and aligning them using MUSCLE.

[0109] Choosing two conserved amino acid sequences (SEQ ID No. 1: ADYFDYM; SEQ ID No. 2: WNFPFF).

TABLE-US-00006 SEQ ID No. 1: ADYFDYM served as the design of forward primer (nucleic acid sequence SEQ ID No. 3: 5′-GCNGAYTAYTTYGAYTAYATG-3′) SEQ ID No. 2: WNFPFF served as the design of reverse primer. (nucleic acid sequence SEQ ID No. 4: 5′-TGGAAYTTYCCNTTYTTY-3′; reverse complementary sequence SEQ ID No. 5: 5′-RAARAANGGRAARTTCCA-3′)

TABLE-US-00007 TABLE 2A Primers used in Example 5 Primer Targeted (forward, F; Amplicon Reference genes reverse, R) Sequence (5′-3′) lengt (bp) or source bacteria 24F AGAGTTTGATCCTGGCTCAG 1500 1492R GGCTACCTTGTTACGACTT Lab LAb, F AGCAGTAGGGAATCTTCCA  341 Lab, R CACCGCTACACATGGAG LAD LAD, F GCNGAYTAYTTYGAYTAYATG  147 This sandy LAD, R RAARAANGGRAARTTCCA SEQ ID Nos. 6 to 11: indicates data missing or illegible when filed

[0110] Real time quantitative PCR (qPCR) (SYBR Green dye).

[0111] Standard curve Three fragments were amplified using the genome of L. parabrevis as template with three primer pairs, respectively, and purified by PCR cleanup kit. A 10-dilution series of purified PCR products was used to create standard curve (plot Ct vs log copy number).

TABLE-US-00008 TABLE 2B Table 2B - Mixture preparation for qPCR (reaction volume: 25 μl) Volume (1x, μl) 2X SYBR Green master mix 12.5 Forward primer 2.5 Reverse primer 2.5 Template DNA 1 H.sub.2O 6.5

TABLE-US-00009 TABLE 2C Table 2C - PCR thermal-cycling conditions for quantifying bacteria with 16S rRNA primer Temperature (° C.) duration cycles AmpliTaq ® Fast DNA 95 5 min hold Polymerase, UP Activation denaturation 95 10 s 40 cycles annealing 55 30 s extension 72 60 s

TABLE-US-00010 TABLE 2D Table 2D - PCR thermal-cycling conditions for quantifying Lactobacillaceae with Lab primer Temperature (° C.) duration cycles AmpliTaq ® Fast DNA 95 5 min hold Polymerase, UP Activation denaturation 95 10 s 40 cycles Annealing/extension 60 30 s

TABLE-US-00011 TABLE 2E Table 2E - PCR thermal-cycling conditions for quantifying lactaldehyde dehydrogenase with LAD primer Temperature (° C.) duration cycles AmpliTaq ® Fast DNA 95 5 min hold Polymerase, UP Activation denaturation 95 10 s 40 cycles annealing 50 30 s extension 72 30 s

[0112] Results:

TABLE-US-00012 TABLE 2F Table 2F - The results of the above described analyses yielded the following results. copies/g pasta products total lactobacillaceae lactaldehyde sample name bacteria (4 families) dehydrogenase pasta Pasta 1 1788273.2 642667.5 16519.2 products Pasta 2 1046.0 120.8 719.5 Pasta 3 3756.7 222.0 317.0 Pasta 4 279.0 27.3 292.9 Pasta 5 6196.2 114.7 132.1 Pasta 6 348765.2 3859.5 446.1 Pasta 7 798.0 71.4 209.0 Pasta 8 1061.6 14.1 115.4 Pasta 9 875.7 25.2 144.8 Pasta 10 2156.7 76.0 857.4 Pasta 11 8353.9 696.2 431.9 samples Pasta 12 589945.2 361192.9 7484.6 in tubes Pasta 12 406498.0 202110.5 2113.0 Pasta 13 538899.1 314539.2 14520.5 Wheat (dry) 2597666.2 5288634.6 670760.2 Rye (dry) 3368521.8 141538.6 124353.3 Pasta 1—Kaslo sourdough Pasta Pasta 2—Catelli Healthy Harvest Pasta 3—Catelli Macaroni Pasta 4—Western Family Rotini Pasta 5—Gold d'Or Spaghetti Pasta 6—Lancia Spaghetti Pasta 7—Fiorfiore Rigatoni Pasta 8—Annie's Homegrown Shells Pasta 9—Kraft Dinner Macaroni Shells Pasta 10—Barilla Macaroni Pasta 11—Catelli Fusilli Kaslo Sourdough Pasta 1 Kaslo sourdough Pasta 2 Kaslo sourdough Pasta 3 Dried wheat sourdough for pasta making Dried rye sourdough for pasta making

[0113] Summary:

[0114] Quantitative PCR detects bacterial DNA. The results report “gene copies”, i.e. the number of DNA molecules with a specific sequence, which corresponds to the number of bacterial cells encoding for that gene. qPCR amplification of dissolved DNA is fairly accurate (not very precise), however, when isolating DNA from sourdough, the yield is not quantitative and how much DNA isolated depends on the organisms that are present in the dough.

[0115] The sourdoughs (wheat and rye) had ˜10.sup.5 to 10.sup.6 copies of any bacterial rRNA genes and an equivalent number of 16S rRNA genes of lactobacilli. The gene copy number of the lactaldehyde dehydrogenase gene, which is responsible for the enzyme that converts lactate to acetate and propanediol and unique to the sourdough pasta, ranged from 10-90% of numbers for lactobacilli. The numbers are a bit lower than expected—a microbial culture has 10exp9 bacterial cells so a 1000 fold higher count would have been the expectation but the yield of DNA from the sourdough can differ between strains.

[0116] From the pasta products, we detected a high (more than 10.sup.5) count of bacterial DNA in all Kaslo sourdough products and one other. High (more than 10.sup.5) counts of lactobacillus DNA was found only in the Kaslo products and the gene coding for lactaldehyde dehydrogenase was found only in the Kaslo products. The counts of DNA were lower in the pasta products than in the sourdoughs, which means that DNA is either partially destroyed during drying or is more difficult to isolate.

[0117] The data will serve as proof of concept that PCR can be used to detect microbial and enzyme levels in pasta and sourdough pasta and starter cultures.

EXAMPLE 6

[0118] This example demonstrates differences in glycemic content of sourdough and conventional non-fermented pasta.

[0119] Increasing consumer interest in fermented products has driven the emergence of a number of novel foods including shelf-stable sourdough pasta. This example comprehensively examined the impact of fermentation on the microbial composition of the culture, pasta, its subsequent effects on glycemic responses and gut microbiota in overweight men and women (>25 kg/m2) compared to a conventional, non-fermented pasta. Two, randomized crossover trials were performed. Study A examined acute feeding responses to each product wherein fasted participants completed a meal tolerance test comprised of 75 g of conventional or sourdough pasta to examine glycemic responses. Study B consisted of three standard oral glucose tolerance tests as well as fecal collection for sequencing at baseline and following each pasta intervention (150 g or 2 serving/d for 5 days) followed by a 2-week washout period.

[0120] Materials and Methods:

[0121] The study design was a randomized, double-blind, crossover trial. Participant inclusion criteria included >25 years of age and a body mass index (BMI) >25 kg/m2 at the time of the study. Researchers initially screened volunteers for overall health status and excluded those with a medical history of gluten allergy, dyslipidemia, gastrointestinal disease, diabetes, other chronic diseases, as well as those taking prescription medications, antibiotics (past 6 months) or natural health products (e.g., already consuming regular pre- or probiotics). Pregnant volunteers and smokers were also excluded from participating.

[0122] Following informed written consent from eligible volunteers, basic demographic information (e.g., age, sex), anthropometric measures (e.g., height, weight, calculated BMI, waist circumference, hip circumference), and health measures (e.g., resting blood pressure, resting heart rate) were collected. A full-body dual-energy x-ray absorptiometry (DEXA) scan was performed on each participant to analyze body composition.

[0123] The sourdough culture is maintained by back-slopping at Kaslo Sourdough (Kaslo, BC, Canada) for the purpose of making bread and pasta. To characterize the microbial composition of the sourdough culture, bacterial and fungal composition was assessed at two time points. The first (SD1) was the starter (mother) culture, while the second renewed (daughter) culture had added flour and water and was mixed before fermentation at ambient temperature for 14-18 h

[0124] Conventional and Sourdough Pasta Conventional (Catelli R Classic Rotini, Catelli Food Corporation. Winnipeg, MB, Canada) and sourdough pasta (Kaslo Sourdough Pasta Fermentata™ Classic Rotini, Kaslo BC, Canada) were tested in the present study. Both are shelf stable, dried pasta products that are widely available in Canada.

TABLE-US-00013 TABLE 4 Table 4 - The nutritional profile of Kaslo Sourdough Pasta and Catelli Classic Rotini Conventional Sourdough dried pasta dried pasta Grams (g) Calories Fat (g) 0. Cholesterol (mg) 0.0 0.0 Sodium (mg) 0.0 0.0 Carbohydrates (g) Fiber (g) .6 Sugars (g) .6 0.0 Protein (g) .7 Vitamin A (%) 0.0 0.0 Vitamin C (%) 0.0 0.0 Calcium (%) 0.0 Iron (%) 9.4 % represents percent daily value indicates data missing or illegible when filed

[0125] Pastas were compared on a per mass basis (grams) to simulate equivalent consumer consumption. Although not exact in terms of their composition, differences in overall macronutrient composition are minimal. For all studies, pasta was cooked al dente according to manufacturers' instructions. Visually, there was no overt difference between the two pasta products with both having the same color, texture and classic rotini shape.

[0126] Study A: Acute Pasta Consumption

[0127] This study investigated gastric emptying, blood glucose and gut peptide responses following pasta consumption. Eligible participants were asked to come into the laboratory to complete two meal tolerance tests. On the day of the appointment, participants arrived at the laboratory following an overnight fast (10-12 h), abstaining from alcohol, caffeine, strenuous physical activity, and analgesic medications for 24-48 h prior. Once screened, an indwelling catheter was placed in the antecubital vein by a trained nurse to facilitate repeated blood sampling. After baseline blood collection (t=0 min), participants consumed either 75 g dry weight of conventional or sourdough pasta in a randomized order along with 1 g of paracetamol to track gastric emptying. All pasta was served plain and consumed within 6 min. Additional blood samples were collected at 30, 45, 60, 75, 90, 105, 120, 150, and 180 min. A minimum 7-day washout period occurred before the entire procedure was replicated with the other treatment.

[0128] Study B: Chronic Pasta Consumption

[0129] This study investigated the impact of chronic pasta consumption over the course of 5 days. This protocol consisted of three standard oral glucose tolerance tests (OGTT) as well as fecal collection at baseline and following each pasta intervention. All participants provided a baseline fecal sample and completed an OGTT (75 g Trutol) following the pre-study procedures outlined in Study A. Blood samples were collected at baseline and at 15, 30, 60, 90, and 120 min. Following baseline sampling, subjects consumed 150 g dry weight/d of either sourdough or conventional pasta for five consecutive days followed by another OGTT (morning of Day 6) and provided an additional fecal sample. After a washout period of at least 2 weeks, but not more than 4 weeks, participants then switched to the other treatment and repeated the protocol.

[0130] Blood Analyses

[0131] At each time point, approximately 5 mL of venous blood was collected. Samples were aliquoted into a 2 mL into a K2EDTA plasma vacutainer, 2 mL into a serum vacutainer, and 1 mL into an Eppendorf tube containing EDTA, diprotinin-A (0.034 g/L blood), sigma protease inhibitor (1 g/L blood), and Pefabloc R SC (1 g/L of blood) to preserve analytes. Tubes were centrifuged for 15 min at 4.C. Supernatant was removed from each sample and transferred into a new labeled Eppendorf tube for storage at −80° C. until analysis. Blood samples collected in Study A were assessed by a custom Human Metabolic Array [C-peptide, glucagon, gastric inhibitory peptide (GIP), glucagon-like peptide-1 (GLP-1 active), insulin and peptide YY (total)]. A glucose oxidase assay kit used plasma samples to measure plasma glucose concentrations at all time points. Serum paracetamol concentrations, determined using a paracetamol assay kit, were used to track gastric emptying. Several studies have demonstrated paracetamol concentrations to be a valid measure of gastric emptying.

[0132] Pasta Microbial Analyses

[0133] Under sterile conditions 2.2 g of cooked pasta was homogenized into 5 mL of purified, distilled laboratory grade water for analysis. For bacterial and fungal sequencing, DNA was then extracted as per the below described protocol. To assess total bacterial and fungi in the pastas, PCR was performed (Mol Autism. (2016) 7:37) using the following primers for bacterial 16S rRNA genes (Forward SEQ ID No. 12: TGAAGAATTGATGGAACTCG, Reverse SEQ ID No. 13: CATTGTGGTTCACCGTTC, Tm=63° C.) or the internal transcribed spacer region 1 (ITS1) of fungi (Forward SEQ ID No. 14: GAGGAAGTAAAAGTCGTAACAAGGTTTC, Reverse SEQ ID No. 15: GTATCGCATTTCGCTGCGTT, Tm=56° C.).

[0134] Standard curves were normalized to the copy number of 16SrRNA genes and ITS1 region using reference strain genome size and gene copy number values obtained from the following reference (http://cels.uri.edu/gsc/cndna.html) for both, bacteria and fungi groups. Data are expressed as gene copies/g pasta water slurry described above. It should be recognized that bacteria and fungi in each pasta are not viable, and that the above analysis was done to highlight differences between the two pastas resulting from the fermentation process. Sourdough samples SD1 and SD2 as well as conventional and sourdough pasta were additionally characterized by high throughput sequencing of 16S rRNA and ITS2 sequence tags as outlined below.

[0135] Fecal Microbial Analyses

[0136] Following collection, fecal samples were stored at −80° C. DNA was extracted by a PowerMag Soil DNA Isolation kit (MP Biomedical) as per protocol. 16S rRNA genes and ITS2 regions were targeted for bacterial and fungal sequencing, respectively. PCR amplification was done with dual-barcoded primers targeting the V4 region and sequenced with an IIlumina MiSeq using the 300-bp paired-end kit. Primers and PCR conditions used for 16S sequencing were followed as described (Appl Environ Microbiol. (2013) 79:5112-20); those used for ITS2 sequencing were identical to Gweon et al. (Methods Ecol Evol. (2015) 6:973-80). Sequences were denoised, taxonomically classified using Greengenes (v. 13_8) as the reference database, and clustered into 97%-similarity operational taxonomic units (OTUs) with the mothur (Appl Environ Microbiol. (2009) 75:7537-41). Paired end reads were merged and curated to reduce sequencing error. The processing pipeline for investigating fungal populations was identical to the one used for bacteria, except for the following differences: (1) paired-end reads were trimmed at the nonoverlapping ends, and (2) high quality reads were classified using UNITE (v. 7.1) as the reference database. The resulting dataset had 23008 OTUs (including those occurring once with a count of 1, or singletons). An average of 28163 quality-filtered reads were generated per sample. Sequencing quality for R1 and R2 was determined using FastQC 0.11.5. A consensus taxonomy for each OTU was obtained and the OTU abundances were then aggregated into genera with modifications, accounting for the current taxonomy of lactobacilli (Int J Syst Evol Microbiol. (2020) 70:2782-858). The datasets generated for this study can be found in NCBI BioProject, NCBI Accession No. PRJNA668386. Fecal Short Chain Fatty Acid Analyses For SCFA of fecal samples, methods followed those previously described (J Nutr Biochem. (2019) 64:228— 36). Briefly, 200 mg of sample was weighed and internal standard (2-ethylbutyric acid) was added. Samples were dissolved in 95% ethanol and homogenized for two cycles. The samples were stored overnight in −80° C. and SCFA were derivatized to its hydrazide forms for further analysis using High Performance Liquid Chromatography (HPLC) as described previously with some modifications (Ann Clin Biochem. (2010) 47:447-52). An aliquot of 20 μL of sample was injected into the HPLC. The analytes were separated with the use of a C18 column (150 mm×4.6 and 2.6 um pore size) at 40° C. temperature. A gradient method was applied by using acetonitrile and water as solvents at a flowrate of 0.8 mL/min. SCFA were detected at a wavelength of 230 nm and corresponding peaks were integrated using the OpenLab software from Agilent Technologies.

[0137] Statistical Analysis

[0138] Participant data are presented as mean±SD. All the other data are presented as mean ±SEM unless otherwise indicated. Normality of the data was assessed using the Shapiro-Wilk normality test. Differences between treatments were determined using two-way repeated measures ANOVA and Tukey's multiple comparison post-hoc test for repeated measures for timed data. Area under the curve (AUC) was calculated using the trapezoid method. Statistical analysis was performed using GraphPad Prism (v. 7.0; La Jolla, USA) and the mothur software package. Alpha diversity for bacterial and fungal reports was estimated with the Shannon index on raw OTU abundance tables after filtering out contaminants. The significance of diversity differences was tested with an ANOVA. To estimate beta diversity across samples, we excluded OTUs occurring with a count of less than three in at least 10% of the samples and then abundance-weighted sample pair-wise differences were computed using Bray-Curtis dissimilarity. Beta diversity was visualized using Principal Coordinates Analysis (PCoA) ordination. Variation in community structure was assessed with permutational multivariate analyses of variance (PERMANOVA) with treatment group as the main fixed factor and using 4,999 permutations for significance testing. All analyses were conducted in the R environment. Statistical significance was set at p<0.05.

[0139] Results

[0140] Culture-Independent Analyses of Sourdoughs Sourdough cultures are extremely complex, and vary in their composition. They can contain two to five of more than 100 different species of lactic acid bacteria and one to three of more than two dozen species of yeasts. For this reason, the microbial composition of the culture used in this study is reported. To determine the microbial composition of the sourdough culture, sequencing was performed.

[0141] FIG. 8A to FIG. 8E—Microbial composition of the sourdough. Results are reported at the genus level. The mother culture (SD1) was dominated by Pediococcus (15%) and Levilactobacillus (74%); most sequences matched most closely to Levilactobacillus parabrevis (FIG. 8A). In the second sourdough stage after 14-18 h of fermentation at ambient temperature (SD2), the abundance of Pediococcus remained unchanged, Levilactobacillus were reduced to 40% and sequences matching the genus Fructilactobacillus increased (41%). There was bacterial alpha diversity in SD1 and SD2 remained essentially unchanged (FIG. 8B). Fungal analysis showed the SD1 culture to be dominated by Naumovozyma genus with Naumovozyma castelli (anamorph: Saccharomyces castelii) accounting for 55% of abundance. Levels of the Naumovozyma genus were reduced in SD2 with growth of Kazachstania barneti (26.9%) and other unclassified fungi (53.7%) (FIG. 8C). Overall, fungal alpha diversity increased in SD2 (FIG. 8D).

[0142] To further distinguish the two pasta products and highlight microbial changes taking place with fermentation, the microbial composition of each pasta was assessed. However, it must be realized that the microbes in each were no longer viable. Conventional pasta was dominated by Prevotella (15%) while sequences representing the genera Pediococcus (64%) and Levilactobacillus (28%) were the most prevalent species in the sourdough pasta. Together, these two genera accounted for 95% of the sequences from sourdough pasta. Relative to bacteria, both pasta products displayed minimal fungal diversity with most being unclassified. Analysis of total bacterial and fungal content in the samples showed the sourdough pasta to contain greater counts of bacteria and fungi compared to the conventional product (FIG. 8E).

TABLE-US-00014 TABLE 5 Table 5 - Participant Characteristics Study A Study B Total participants, n 16 16 Age (years) 38.6 ± 10.6 42 ± 10 Males/females 6/11 5/11 BMI, kg/m.sup.2 29.6 ± 1.0 28.46 ± 2.8 Waist circumference, cm .7 ± 3.1 93.71 ± 9.1 Hip circumference, cm 10 .9 ± 2.1 106.13 ± 7.2 Systolic BP, mmHg 124.5 ± 3.7 117.87 ± 14.9 Diastolic BP, mmHg 72.3 ± 1. 68. 7 ± 9.3 Resting HR, bpm 66.9 ± 2.2 63.93 ± 8.3 Total BMD, g/cm.sup.2 1.14 ± 0.0 1.16 ± 0.1 % Fat arm 34.5 ± 9.9 31.60 ± 10.8 % Fat trunk 32.4 ± 7.6 28.21 ± 8.4 % Fat leg 3 .0 ± 11.2 31.69 ± 9.9 Total % fat 32.1 ± 2.0 29.29 ± .2 Values represent as mean ± SD  BMD  bone mineral density  BMI  body mass index  BP  blood pressure  HR  heart rate indicates data missing or illegible when filed

[0143] Study A consisted of 18 participants while Study B consisted of 16 of the same participants. The age and cardiometabolic parameters (BMI, Waist/Hip circumference, resting blood pressure, heart rate) and DEXA scan results were also similar in both, Study A and Study B participants (p>0.05).

[0144] Study A—Acute Pasta Consumption

[0145] FIG. 9A to FIG. 9H illustrate the effect of acute intake of conventional and sourdough pasta on, (FIG. 9A) blood glucose, (FIG. 9B) insulin, (FIG. 9C) C-peptide, (FIG. 9D) Glucagon, (FIG. 9E) PYY, (FIG. 9F) GLP-1, (FIG. 9F) GIP and (FIG. 9H) paracetamol. All data are presented as mean±SEM (n=18). Abbreviations: GIP—gastric inhibitory polypeptide, GLP1—glucagon-like peptide, PYY—peptide YY. *Indicates statistical significance (p<0.05) compared to conventional pasta treatment at a corresponding time point.

[0146] To assess the impact of acute pasta consumption, each participant consumed 75 g of conventional or sourdough pasta, followed by assessment of their glycemic response. No differences in baseline glucose or insulin levels were present prior to meal tolerance tests between conventional or sourdough pasta administration (p>0.05). Following pasta administration, there were no significant differences in the overall responses (total AUC) of glucose (FIG. 9A, p>0.05) and insulin (FIG. 9B, p>0.05). However, insulin levels were greater with sourdough at 60 min post-consumption (p <0.05). No differences between conventional or sourdough pasta consumption for gut peptide responses including C-Peptide, glucagon, PYY, GIP or GLP-1 were found (FIGS. 9C-9G, p>0.05). The total serum paracetamol levels (AUC), a proxy measure of gastric emptying was elevated with sourdough consumption (FIG. 9H, p<0.05).

[0147] Study B—Chronic Pasta Consumption

[0148] FIG. 10A and FIG. 10B illustrate the effect of chronic intake of conventional and fermented sourdough pasta on (FIG. 10A) blood glucose, (FIG. 10B) fecal SCFA concentration. All data are presented as mean±SEM (n=16). *Indicates statistical significance in total SCFA concentration (p<0.05) compared to baseline values.

[0149] To assess the impact of chronic pasta consumption, subjects completed a baseline OGTT followed by 5 days of pasta consumption (150 g/day) in a cross-over design. Similar to previous study A, there was no difference in blood glucose levels prior to OGTT administration in any trial. Likewise, there were no differences in glucose or insulin excursion between baseline (no pasta), conventional and sourdough pasta (FIG. 10A, p>0.05). As the benefits of fermented foods may involve the gut microbiota, microbial metabolites including SCFA (acetate, propionate, butyrate) were analyzed in fecal samples. There was no difference in the concentration of individual fecal SCFA at baseline or with each pasta treatment (FIG. 10B, p>0.05). However, the concentration of total SCFA concentration decreased in the sourdough treatment compared to baseline values (p<0.05).

[0150] FIG. 11A to FIG. 11F illustrate the impact of chronic consumption of conventional vs. sourdough pasta on bacterial and fungal diversity of overweight participants after consumption of conventional and sourdough pasta for 5 days. (FIG. 11A) Bacterial and (FIG. 11B) fungal abundance; (FIG. 11C) bacterial and (FIG. 11D) fungal beta diversity; (FIG. 11E) bacterial and (FIG. 11F) fungal alpha diversity assessed using Shannon Index. *Indicates statistical significance (p<0.05) compared to baseline values.

[0151] To investigate the potential impact of pasta consumption on the gut microbiota, both 16S and ITS2 sequencing were performed. No treatment differences were observed for bacterial (FIG. 11A) and fungi (FIG. 11B) at the phyla, class, family or genus levels (p>0.05). We next assessed the alpha and beta-diversity as a reflection of how each pasta treatment changed microbial structure (FIGS. 11C to 11F). There were no changes found in alpha diversity (F=1.88, P=0.17) as assessed by the Shannon Index (FIG. 11C, p>0.05) of bacterial groups with treatment; however, there was a significant decrease in alpha diversity in fungi (F=5.37, P=0.008) with chronic consumption of sourdough (FIG. 11D, p<0.05). These differences in microbial structure are also reflected in the separation between groups when plotted as principal coordinates (FIGS. 11E and 11F).

SUMMARY

[0152] Sourdough fermentation has the potential to increase nutrient bioavailability, decrease the glycemic index and gluten content of foods along with improving product shelf life (20). In the present study, we examined the impact of fermentation on the microbial composition of pasta as well as the acute and chronic effects of consumption on glucose regulation and gut microbial composition in overweight and obese adults. Major findings indicate that acute or chronic consumption of sourdough pasta had no effect on glycemia and other gut hormones in participants compared to conventional, non-fermented pasta. Of interest, we found that the microbiome was adaptive following chronic pasta consumption with reductions in fecal SCFA and decreases in the alpha diversity of fungi following sourdough, but not conventional pasta.

[0153] It was found that glucose and insulin responses remain unaltered in overweight individuals after acute and chronic sourdough pasta consumption. We also found that there are no significant changes in gut microbial profile or their associated metabolites after 5 days of dietary intervention. Unexpectedly, consumption of the sourdough product reduced fecal fungal alpha diversity.

[0154] Conclusion

[0155] Production of food and food ingredients via microbial fermentation is characterized by and intrinsic complexity. The raw material and the final product typically have a complex composition: fermented food is often the result of the metabolic activity of mixed microbial populations, resulting in the production of complex ensemble of primary and secondary metabolites that are responsible for the main and specific features of a certain food or beverage

[0156] It had previously been stated [in Microbial production of food ingredients, enzymes and nutraceuticals. Edited by Brian McNeil, David Archer, Ioannis Giavasis and Linda Harvey, Woodhead Publishing, 2013] that “Production of food and food ingredients via microbial fermentation is characterized by and intrinsic complexity. The raw material and the final product typically have a complex composition: fermented food is often the result of the metabolic activity of mixed microbial populations, resulting in the production of complex ensemble of primary and secondary metabolites that are responsible for the main and specific features of a certain food or beverage.”

[0157] The findings presented herein challenge the general assumption in the science of sourdough fermentation perceives that refrigerated cold temperature of 4° C. is only for preservation and that all microbial activity stops. This is disproven with this new ‘Cold back-slopping method’ for sourdough method. Over an extended period of time of ‘cold/cool back-slopping’ techniques using distinctive LAB species develop that have or do adapt themselves to the colder environment and start to thrive, and can be utilized for products made with natural sourdough ferment.

[0158] As Charles Ellery Avery First Manufacturer of Lactic Acid, in 1881 noted: ‘Avery's ideas about preparing pure cultures by selecting conditions favoring the growth of the desired culture while at the same time suppressing the growth of other microorganisms can be seen as an extension of Pasteur who already in his early investigations of lactic and alcohol fermentations had stressed the point that the conditions of the medium play a great part in the predominant development of any given ferment (Nicolle, 1961).’ Also, noteworthy is Avery's observation that the inoculation of each solution from the preceding one should be affected at the point of full height of fermentation, as evidenced by the evolution of the carbonic acid gas (i.e. backslopping) Avery, 1883. Page 91. (back-slopping).

[0159] Critical observations that enable embodiments of the invention include:

[0160] discovering that indeed certain LAB species are capable to adapting to cold environmental conditions;

[0161] using ‘back-slopping’ in combination with the logarithmic nature of the pH scale' thereby ensuring ‘natural pure culture’ propagation preserving LAB species;

[0162] discovering that these LAB are suitable for a multitude of wheat grain-based products like breads, sweet dough, pasta etc. Virtually any product made from gluten and none gluten combinations;

[0163] observing that these concentrated LAB produced achieve dominance over other microorganism naturally present in these grain-based products, depressing questionable or pathogenic microorganism naturally present in any cereal based agricultural product. Similarly observed in latest scientific research on the human digestive system, where beneficial LAB crowd out pathogenic microorganism in the human digestive tract. It seems that it becomes a question of momentum, concentration of LAB in order to establish dominance, may it be in products made or the human digestive system;

[0164] multitude of testimonials over 30 years verify that product made from these LAB, as with all-natural sourdough ferments, aid in digesting cereal-based crops, reduce allergic reaction and possible avoid gluten sensitivity, irritable bowel symptoms etc.; and

[0165] recognizing the 4.2ph threshold to advantage though targeted observation and utilizing bacteria growth momentum to ensure if above the time is kept to a minimum to reduce any pathogenic growth. Below pH 4.2 is the threshold where no pathogenic bacterial growth is observed in nature.

[0166] Lactobacilli that catalyze the lactate to propanediol and acetate conversion include Loigolactobacillus coryniformis, Furfurilactobacillus species, few of the Levilactobacillus species and several Lentilactobacillus species. Of these, Furfurilactobacillus and Levilactobacillus species are more or less common in sourdough but the lactate converting levilactobacilli species are not common in sourdough, the conversion has not been shown experimentally for furfurilactobacilli, and the conversion in sourdough has been shown only once in sourdough (Food Microbiol. (2010) 27:390-395) and the species used in that study to convert lactate to acetate and propanediol (Lentilactobacillus buchneri) was not a sourdough isolate, does not commonly occur in sourdough, and is not found in any embodiments of the instantly disclosed sourdough.

[0167] The conversion of lactic acid to propanediol and acetic acid has to date only been observed in Lentilactobacillus species, mainly Lentilactobacillus buchneri. See FIG. 12 for the proposed pathway for anaerobic degradation of lactic acid by L. buchneri into equimolar amounts of 1,2-propanediol and acetic acid and trace amounts of ethanol. It is known to be relevant in silage fermentations, and during spoilage of pickled cucumbers. The key gene coding for the conversion has been identified in a few other lactobacilli including few Levilactobacillus and Furfurilactobacillus species but confirmation that the pathway is functional is missing for Furfurilactobacillus.

[0168] The conversion has been observed in sourdoughs that are inoculated with Lentilactobacillus buchneri (Food Microbiol (2010) 27:390-395 and CA 2759532). The disclosures essentially relate to the use of Lentilactobacillus buchneri and lists a number of species but not Levilactobacillus parabrevis (which would then have been termed Lactobacillus) brevis and Levilactobacillus koreensis.

[0169] The presence of Levilactobacillus koreensis and Levilactobacillus parabrevis in the disclosed sourdough is not unprecedented but exceptional. Of the 1,364 sourdoughs for which literature data is available, less than 30 include one or the other (eLife (2021) 10:e61644 and Int J Food Microbiol 239:35-43). None of the two reports indicate the lactate to propanediol conversion.

[0170] The present disclosure confirms the novel identification of specific fermentation conditions that reliably maintain lactate-utilizing lactobacilli as dominant members of the microbiota by traditional methods (i.e. without inoculating controlled strains).

[0171] Also note that none of the cited prior art documents are connected specific fermentation conditions that catalyze lactate to acetate and propanediol in sourdough pasta making. In sourdough baking, most of the acetic acid in bread is formed in the bread dough, i.e. is less than 3 h and the slow lactate to acetate conversion by Lentilactobacillus or Levilactobacillus species has no role to play. In pasta making, dough mixing and extrusion kills most bacteria and acetic acid in the final product is produced in the (long and cold) sourdough fermentation.

[0172] Numerous cited documents refer to putting a sourdough in the fridge but the sourdoughs do not fermentation in the cold storage. This is not the case for embodiments of the present process. Part of the fermentation process occurs in cold storage. The presence of these unusual combination of Levilactobacillus koreensis and Levilactobacillus parabrevis almost certainly relates to the cool fermentation. These microorganisms are seen in high proportion after the cold fermentation step and in a much lower proportion of the fermentation after the second fermentation step which happens at anywhere between 20 and 30 degrees centigrade. The reason being that Levilactobacillus species to grow in the fridge but Lentilactobacillus species do not.

[0173] A crucial difference between known processes and the inventive process is that the conditions of the inventive fermentation process naturally select for several species of microorganisms, including Levilactobacillus koreensis and Levilactobacillus parabrevis. Specifically, the cold fermentation favors growth of these organisms and thereby produces more acetic acid than lactic acid in the sourdough.

[0174] The foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the invention and method of use to the precise forms disclosed. Many modifications and variations are possible in light of the above teaching. The embodiments described were chosen and described in order to best explain the principles of the invention and its practical application, and to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated. It is understood that various omissions or substitutions of equivalents are contemplated as circumstance may suggest or render expedient, but is intended to cover the application or implementation without departing from the spirit or scope of the claims of the present invention.