Cystic fibrosis gene mutations

09840740 · 2017-12-12

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided.

Claims

1. A method of detecting a mutant cystic fibrosis transmembrane (CFTR) nucleic acid in an individual, comprising: (a) contacting a biological sample comprising a CFTR nucleic acid from an individual with a detectably labeled nucleic acid probe that specifically hybridizes to a mutant CFTR nucleic acid comprising the mutation but not to a wildtype CFTR nucleic acid; and the probe comprises the substitution mutation; and (b) detecting the CFTR substitution mutation in the individual when a hybrid is formed between the detectably labeled nucleic acid probe and the mutant CFTR nucleic acid, wherein the mutation is c.3017C>A.

2. The method of claim 1, further comprising nucleic acid amplification.

3. The method of claim 2, wherein the nucleic acid amplification is allele specific amplification.

4. The method of claim 2, wherein the portion of the CFTR nucleic acid sequence that contains the mutation is amplified.

5. The method of claim 1, wherein the biological sample comprises CFTR genomic DNA.

6. The method of claim 1, wherein the biological sample comprises CFTR mRNA.

7. The method of claim 6, further comprising reverse transcription of CFTR mRNA to cDNA.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 is a table showing various CFTR mutations and characterizing information.

DETAILED DESCRIPTION OF THE INVENTION

(2) CF mutations and PCR primer pairs for amplifying segments of the CFTR gene containing the mutation are shown in Table 1.

(3) TABLE-US-00001 TABLE 1 CF mutations and associated amplification primers CF Mutation Nucleotide Change Forward and CF (HGVS Nucleotide (HGVS Reverse PCR Mutation Nomenclature)* Change Nomenclature)* Primers S158T p.Ser158Thr 605G −> C c.473G > C q4e1F and q4e1R V358I p.Val358Ile 1204G −> A c.1072G > A q7e3F and q7e4R 119del6 p.Trp356_Ala366del 1198-1202del c.1066_1071del q7e3F and (deletes q7e4R TGGGCT and results in W356 and A357) G451V p.Gly451Val 1484G −> T c.1352G > T q9e9F and q9e11R K481E p.Lys481Glu 1573A −> G c.1441A > G s10e3F and s10e2R C491S p.Cys491Ser 1604G −> C c.1472G > C s10e3F and s10e2R K503N + p.Lys503fs 1641-1642AG −> T c.1509_1510delinsT s10e3F and frameshift (deletes 1641A s10e2R and 1642G and replaces with T) 2949del5 p.Thr940fs 2949-2953del c.2817_2821del q15e3F and (deletes TACTC) q15e4R H949L p.His949Leu 2978A −> T c.2846A > T q15e3F and q15e4R T1036N p.Thr1036Asn 3239C −> A c.3107C > A q17ae1F and q17ae1R F1099L p.Phe1099Leu 3429C −> A c.3297C > A q17be1F and q17be1R *Nomenclature is based on Human Genome Variation Society guidelines as adopted by Cystic Fibrosis Centre at the Hospital for Sick Children in Toronto, Canada and US Cystic Fibrosis Foundation, Bethesda, MD, USA in April 2010

(4) Further information relating to the CF mutations and the CFTR gene are found in FIG. 1. The primers for amplifying segments of the CFTR gene may hybridize to coding or non-coding CFTR sequences under stringent conditions. Preferred primers are those that flank mutant CF sequences. Primers for CF mutations in Table 1 are shown in Table 2.

(5) TABLE-US-00002 TABLE 2 Amplification primer sequences for CF mutations Forward and Reverse CF Mutation PCR Primers S158T q4e1F: (SEQ ID NO: 33) TGTAAAACGACGGCCAGTaaagtc ttgtgttgaaattctcagg q4e1R: (SEQ ID NO: 34) CAGGAAACAGCTATGACCCAGCTC ACTACCTAATTTATGACAT V358I q7e3F: (SEQ ID NO: 35) 119del6 TGTAAAACGACGGCCAGTcttcca ttccaagatccc q7e4R: (SEQ ID NO: 36) CAGGAAACAGCTATGACCGCAAAG TTCATTAGAACTGATC G451V g9e9F: (SEQ ID NO: 37) TGTAAAACGACGGCCAGTtggatc atgggccatgtgc and g9e11R: (SEQ ID NO: 38) CAGGAAACAGCTATGACCAAAGAG ACATGGACACCAAATTAAG K481E s10e3F: (SEQ ID NO: 39) C491S TGTAAAACGACGGCCAGTagcaga K503N + gtacctgaaacagga frameshift s10e2R: (SEQ ID NO: 40) CAGGAAACAGCTATGACCCATTCA CAGTAGCTTACCCA 2949del5 q15e3F: (SEQ ID NO: 41) H949L TGTAAAACGACGGCCAGTggttaa cggtgcatgctcttc q15e4R: (SEQ ID NO: 42) CAGGAAACAGCTATGACCGGCCCT ATTGATGGTGGATC T1036N q17ae1F: (SEQ ID NO: 43) TGTAAAACGACGGCCAGacacttt gtccacatgc q17ae1R: (SEQ ID NO: 44) CAGGAAACAGCTATGACCAGATGA GTATCGCACATTC F1099L q17be1F: (SEQ ID NO: 45) TGTAAAACGACGGCCAGTatctat tcaaagaatggcac q17be1R: (SEQ ID NO: 46) CAGGAAACACTCTATGACCGATAA CCTATAGAATGCAGC

(6) By “mutations of the CFTR gene” or “mutant CF sequence” is meant one or more CFTR nucleic acid sequences that are associated or correlated with cystic fibrosis. Additional CF mutations are disclosed in Table 3-17 may be correlated with a carrier state, or with a person afflicted with CF. Thus, the nucleic acid may be tested for CF mutations described in any of Tables 1-17. The nucleic acid sequences containing CF mutations are preferably DNA sequences, and are preferably genomic DNA sequences; however, RNA sequences such as mRNA or hnRNA may also contain nucleic acid mutant sequences that are associated with cystic fibrosis.

(7) By “carrier state” is meant a person who contains one CFTR allele that is a mutant CF nucleic acid sequence, but a second allele that is not a mutant CF nucleic acid sequence. CF is an “autosomal recessive” disease, meaning that a mutation produces little or no phenotypic effect when present in a heterozygous condition with a non-disease related allele, but produces a “disease state” when a person is homozygous, i.e., both CFTR alleles are mutant CF nucleic acid sequences.

(8) By “primer” is meant a sequence of nucleic acid, preferably DNA, that hybridizes to a substantially complementary target sequence and is recognized by DNA polymerase to begin DNA replication.

(9) By “substantially complementary” is meant that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences comprise a contiguous sequence of bases that do not hybridize to a target sequence, positioned 3′ or 5′ to a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target sequence.

(10) By “flanking” is meant that a primer hybridizes to a target nucleic acid adjoining a region of interest sought to be amplified on the target. The skilled artisan will understand that preferred primers are pairs of primers that hybridize 3′ from a region of interest, one on each strand of a target double stranded DNA molecule, such that nucleotides may be add to the 3′ end of the primer by a suitable DNA polymerase. Primers that flank mutant CF sequences do not actually anneal to the mutant sequence but rather anneal to sequence that adjoins the mutant sequence.

(11) By “isolated” a nucleic acid (e.g., an RNA, DNA or a mixed polymer) is one which is substantially separated from other cellular components which naturally accompany such nucleic acid. The term embraces a nucleic acid sequence which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates, oligonucleotides, and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.

(12) By “substantially pure” a nucleic acid, represents more than 50% of the nucleic acid in a sample. The nucleic acid sample may exist in solution or as a dry preparation.

(13) By “complement” is meant the complementary sequence to a nucleic acid according to standard Watson/Crick pairing rules. For example, a sequence (SEQ ID NO: 1) 5′-GCGGTCCCAAAAG-3′ has the complement (SEQ ID NO: 2) 5′-CTTTTGGGACCGC-3′. A complement sequence can also be a sequence of RNA complementary to the DNA sequence or its complement sequence, and can also be a cDNA.

(14) By “coding sequence” is meant a sequence of a nucleic acid or its complement, or a part thereof, that can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a fragment thereof. Coding sequences include exons in a genomic DNA or immature primary RNA transcripts, which are joined together by the cell's biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

(15) By “non-coding sequence” is meant a sequence of a nucleic acid or its complement, or a part thereof, that is not transcribed into amino acid in vivo, or where tRNA does not interact to place or attempt to place an amino acid. Non-coding sequences include both intron sequences in genomic DNA or immature primary RNA transcripts, and gene-associated sequences such as promoters, enhancers, silencers, etc.

(16) Nucleic acid suspected of containing mutant CF sequences are amplified using one or more primers that flank the mutations under conditions such that the primers will amplify CFTR fragments containing the mutations, if present. The oligonucleotide sequences in Table 2 are useful for amplifying segments of the CFTR gene which contain the mutations in Table 1. Nucleic acid from an individual also could be tested for CFTR mutations other than those in Table 1. Such mutations include, for example, any of those listed in Tables 4-18. Primers for these latter CFTR mutations include.

(17) The method of identifying the presence or absence of mutant CF sequence by amplification can be used to determine whether a subject has a genotype containing one or more nucleotide sequences correlated with cystic fibrosis. The presence of a wildtype or mutant sequence at each predetermined location can be ascertained by the invention methods.

(18) By “amplification” is meant one or more methods known in the art for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear. A target nucleic acid may be either DNA or RNA. The sequences amplified in this manner form an “amplicon.” While the exemplary methods described hereinafter relate to amplification using the polymerase chain reaction (“PCR”), numerous other methods are known in the art for amplification of nucleic acids (e.g., isothermal methods, rolling circle methods, etc.). The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods.

(19) The nucleic acid suspected of containing mutant CF sequence may be obtained from a biological sample. By “biological sample” is meant a sample obtained from a biological source. A biological sample can, by way of non-limiting example, consist of or comprise blood, sera, urine, feces, epidermal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample and/or chorionic villi. Convenient biological samples may be obtained by, for example, scraping cells from the surface of the buccal cavity. The term biological sample includes samples which have been processed to release or otherwise make available a nucleic acid for detection as described herein. For example, a biological sample may include a cDNA that has been obtained by reverse transcription of RNA from cells in a biological sample.

(20) By “subject” is meant a human or any other animal which contains as CFTR gene that can be amplified using the primers and methods described herein. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. A human includes pre and post natal forms. Particularly preferred subjects are humans being tested for the existence of a CF carrier state or disease state.

(21) By “identifying” with respect to an amplified sample is meant that the presence or absence of a particular nucleic acid amplification product is detected. Numerous methods for detecting the results of a nucleic acid amplification method are known to those of skill in the art.

(22) The present invention provides specific primers that aid in the detection of mutant CF genotype. Such primers enable the amplification of segments of the CFTR gene that are known to contain mutant CF sequence from a nucleic acid containing biological sample. By amplifying specific regions of the CFTR gene, the invention primers facilitate the identification of wildtype or mutant CF sequence at a particular location of the CFTR gene. Primers for amplifying various regions of the CFTR gene include the following: SEQ ID NO: 3, 5′-GCGGTCCCAAAAGGGTCAGTTGTAGGAAGTCACCAAAG-3′ (g4e1F), and SEQ ID NO: 4, 5′-GCGGTCCCAAAAGGGTCAGTCGATACAGAATATATGTGCC-3′ (g4e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 5, 5′-GCGGTCCCAAAAGGGTCAGTGAATCATTCAGTGGGTATAAGCAG-3′ (g19i2F), and SEQ ID NO: 6, 5′-GCGGTCCCAAAAGGGTCAGTCTTCAATGCACCTCCTCCC-3′ (q19i3R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 7, 5′-GCGGTCCCAAAAGGGTCAGTAGATACTTCAATAGCTCAGCC-3′ (g7e1F), and SEQ ID NO: 8, 5′-GCGGTCCCAAAAGGGTCAGTGGTACATTACCTGTATTTTGTTT-3′ (g7e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 9, 5′-GCGGTCCCAAAAGGGTCAGTGTGAATCGATGTGGTGACCA-3′ (s12e1F), and SEQ ID NO: 10, 5′-GCGGTCCCAAAAGGGTCAGTCTGGTTTAGCATGAGGCGGT-3′ (s12e1R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 11, 5′-GCGGTCCCAAAAGGGTCAGTTTGGTTGTGCTGTGGCTCCT-3′ (g14be1F), and SEQ ID NO: 12, 5′-GCGGTCCCAAAAGGGTCAGTACAATACATACAAACATAGTGG-3′ (g14be2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 13, 5′-GCGGTCCCAAAAGGGTCAGTGAAAGTATTTATTTTTTCTGGAAC-3′ (q21e1F), and SEQ ID NO: 14 5′-GCGGTCCAAAAGGGTCAGTGTGTGTAGAATGATGTCAGCTAT-3′ (q21e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 15, 5′-GCGGTCCCAAAAGGGTCAGTCAGATTGAGCATACTAAAAGTG-3′ (g11e1F), and SEQ ID NO: 16, 5′-GCGGTCCCAAAAGGGTCAGTTACATGAATGACATTTACAGCA-3′ (g11e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 17, 5′-GCGGTCCCAAAAGGGTCAGTAAGAACTGGATCAGGGAAGA-3′ (g20e1F), and SEQ ID NO: 18, 5′-GCGGTCCCAAAAGGGTCAGTTCCTTTTGCTCACCTGTGGT-3′ (g20e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 19, 5′-GCGGTCCCAAAAGGGTCAGTGGTCCCACTTTTTATTCTTTTGC-3′ (q3e2F), and SEQ ID NO: 20 5′-GCGGTCCCAAAAGGGTCAGTTGGTTTCTTAGTGTTTGGAGTTG-3′ (q3e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 21, 5′-GCGGTCCCAAAAGGGTCAGTTGGATCATGGGCCATGTGC-3′ (g9e9F), and SEQ ID NO: 22, 5′-GCGGTCCCAAAAGGGTCAGTACTACCTTGCCTGCTCCAGTGG-3′ (g9e9R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 23, 5′-GCGGTCCCAAAAGGGTCAGTAGGTAGCAGCTATTTTTATGG-3′ (g13e2F), and SEQ ID NO: 24, 5′-GCGGTCCCAAAAGGGTCAGTTAAGGGAGTCTTTTGCACAA-3′ (g13e2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 25.

(23) 5′-GCGGTCCCAAAAGGGTCAGTGCAATTFTGGATGACCTTC-3′ (q16i1F), and SEQ ID NO: 26 GCGGTCCCAAAAGGGTCAGTTAGACAGGACTTCAACCCTC-3′ (q16i2R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 27, 5′-GCGGTCCCAAAAGGGTCAGTGGTGATTATGGGAGAACTGG-3′ (q10e10F), and SEQ ID NO: 28, 5′-GCGGTCCCAAAAGGGTCAGTATGCTTTGATGACGCTTC-3′ (q10e11R), are preferably used together as forward (F) and reverse (R) primers; SEQ ID NO: 29, 5′-GCGGTCCCAAAAGGGTCAGTTTCATTGAAAAGCCCGAC-3′ (q19e12F), and SEQ ID NO: 30, 5′-GCGGTCCCAAAAGGGTCAGTCACCTTCTGTGTATTTTGCTG-3′ (q19e13R) are preferably used together as forward (F) and reverse (R) primers; and SEQ ID NO: 31, 5′-GCGGTCCCAAAAGGGTCAGTAAGTATTGGACAACTTGTTAGTCTC-3′ (q5e12F), and SEQ ID NO: 32, 5′-GCGGTCCCAAAAGGGTCAGTCGCCTTTCCAGTTGTATAATTT-3′ (q5e13R), are preferably used together as forward (F) and reverse (R) primers. These pairs of primers, which may been used in multiplex amplifications, can amplify the regions of the CFTR gene shown in Table 3.

(24) TABLE-US-00003 TABLE 3 CFTR Primer Pairs and Amplicon Characteristics Forward Primer Reverse Primer Exon/Intron Size g14be1F (SEQ ID NO. 11) g14be24 (SEQ ID NO. 12) 14b/i14b 149 q5e12F (SEQ ID NO. 31) q5e13R (SEQ ID NO. 32) 5/i5 165 g20e1F (SEQ ID NO. 17) g20e2R (SEQ ID NO. 18) 20 194 q16i1F (SEQ ID NO. 25) q16i2R (SEQ ID NO. 26) 16/i16 200 q10e10F (SEQ ID NO. 27) q10e11R (SEQ ID NO. 28) 10 204 q21e1F (SEQ ID NO. 13) q21e2R (SEQ ID NO. 14) 21 215 g11e1F (SEQ ID NO. 15) g11e2R (SEQ ID NO. 16) i10/11/i11 240 g7e1F (SEQ ID NO. 7) g7e2R (SEQ ID NO. 8)  7 259 g4e1F (SEQ ID NO. 3) g4e2R (SEQ ID NO. 4) 4/i4 306 q3e2F (SEQ ID NO. 19) q3e2R (SEQ ID NO. 20) 3/i3 308 q19e12F (SEQ ID NO. 29) q1913e2R (SEQ ID NO. 30) i18/19 310 q13e2F (SEQ ID NO. 23) g13e2R (SEQ ID NO. 24) 13 334 g9e9F (SEQ ID NO. 21) g9e9R (SEQ ID NO. 22) i8/9 351 g19i2F (SEQ ID NO. 5) g19i3R (SEQ ID NO. 6) i19 389 s12e1F (SEQ ID NO. 9) s12e1R (SEQ ID NO. 10) i11/12/i12 465

(25) The nucleic acid to be amplified may be from a biological sample such as an organism, cell culture, tissue sample, and the like. The biological sample can be from a subject which includes any eukaryotic organism or animal, preferably fungi, invertebrates, insects, arachnids, fish, amphibians, reptiles, birds, marsupials and mammals. A preferred subject is a human, which may be a patient presenting to a medical provider for diagnosis or treatment of a disease. The biological sample may be obtained from a stage of life such as a fetus, young adult, adult, and the like. Particularly preferred subjects are humans being tested for the existence of a CF carrier state or disease state.

(26) The sample to be analyzed may consist of or comprise blood, sera, urine, feces, epidermal sample, skin sample, cheek swab, sperm, amniotic fluid, cultured cells, bone marrow sample and for chorionic villi, and the like. A biological sample may be processed to release or otherwise make available a nucleic acid for detection as described herein. Such processing may include steps of nucleic acid manipulation, e.g., preparing a cDNA by reverse transcription of RNA from the biological sample. Thus, the nucleic acid to be amplified by the methods of the invention may be DNA or RNA.

(27) Nucleic acid may be amplified by one or more methods known in the art for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification may be exponential or linear. The sequences amplified in this manner form an “amplicon.” In a preferred embodiment, the amplification by the is by the polymerase chain reaction (“PCR”) (e.g., Mullis, K. et al., Cold Spring Harbor Symp. Quant. Biol. 51:263-273 (1986); Erlich H. et al., European Patent Appln. 50,424; European Patent Appln. 84,796, European Patent Application 258,017, European Patent Appln. 237,362; Mullis, K., European Patent Appln. 201,184; Mullis K. et al., U.S. Pat. No. 4,683,202; Erlich, H., U.S. Pat. No. 4,582,788; and Saiki, R. et al., U.S. Pat. No. 4,683,194). Other known nucleic acid amplification procedures that can be used include, for example, transcription-based amplification systems or isothermal amplification methods (Malek, L. T. et al., U.S. Pat. No. 5,130,238; Davey, C. et al., European Patent Application 329,822; Schuster et al., U.S. Pat. No. 5,169,766; Miller, H. I. et al., PCT appln. WO 89/06700; Kwoh, D. et al., Proc. Natl. Acad. Sci. (U.S.A.) 86:1173 (1989); Gingeras, T. R. et al., PCT Application WO 88/10315; Walker, G. T. et al., Proc. Natl. Acad. Sci. (U.S.A.) 89:392-396 (1992)). Amplification may be performed to with relatively similar levels of each primer of a primer pair to generate an double stranded amplicon. However, asymmetric PCR may be used to amplify predominantly or exclusively a single stranded product as is well known in the art (e.g., Poddar et al. Molec. And Cell. Probes 14:25-32 (2000)). This can be achieved for each pair of primers by reducing the concentration of one primer significantly relative to the other primer of the pair (e.g. 100 fold difference). Amplification by asymmetric PCR is generally linear. One of ordinary skill in the art would know that there are many other useful methods that can be employed to amplify nucleic acid with the invention primers (e.g., isothermal methods, rolling circle methods, etc.), and that such methods may be used either in place of, or together with, PCR methods. Persons of ordinary skill in the art also will readily acknowledge that enzymes and reagents necessary for amplifying nucleic acid sequences through the polymerase chain reaction, and techniques and procedures for performing PCR, are well known. The examples below illustrate a standard protocol for performing PCR and the amplification of nucleic acid sequences that correlate with or are indicative of cystic fibrosis.

(28) In another aspect, the present invention provides methods of detecting a cystic fibrosis genotype in a biological sample. The methods comprise amplifying nucleic acids in a biological sample of the subject and identifying the presence or absence of one or more mutant cystic fibrosis nucleic acid sequences in the amplified nucleic acid. Accordingly, the present invention provides a method of determining the presence or absence of one or more mutant cystic fibrosis nucleic acid sequences in a nucleic acid containing sample, comprising: contacting the sample with reagents suitable for nucleic acid amplification including one or more pairs of nucleic acid primers flanking one or more predetermined nucleic acid sequences that are correlated with cystic fibrosis, amplifying the predetermined nucleic acid sequence(s), if present, to provide an amplified sample; and identifying the presence or absence of mutant or wildtype sequences in the amplified sample.

(29) One may analyze the amplified product for the presence of absence of any of a number of mutant CF sequences that may be present in the sample nucleic acid. As already discussed, numerous mutations in the CFTR gene have been associated with CF carrier and disease states. For example, a three base pair deletion leading to the omission of a phenylalanine residue in the gene product has been determined to correspond to the mutations of the CF gene in approximately 70% of the patients affected by CF. The table below identifies preferred CF sequences and identifies which of the primer pairs of the invention may be used to amplify the sequence.

(30) TABLE-US-00004 TABLE 4 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 19 and 20. Name Nucleotide change Exon Consequence 297 − 3C −> T C to T at 297 − 3 intron 2 mRNA splicing defect E56K G to A at 298 3 Glu to Lys at 56 300delA Deletion of A at 3 Frameshift 300 W57R T to C at 301 3 Trp to Arg at 57 W57G T to G at 301 3 Trp to Gly at 57 W57X(TAG) G to A at 302 3 Trp to Stop at 57 W57X(TGA) G to A at 303 3 Trp to Stop at 57 D58N G to A at 304 3 Asp to Asn at 58 D58G A to G at 305 3 Asp to Gly at 58 306insA Insertion of A at 3 Frameshift 306 306delTAGA deletion of TAGA 3 Frameshift from 306 E60L G to A at 310 3 Glu to Leu at 60 E60X G to T at 310 3 Glu to Stop at 60 E60K G to A at 310 3 Glu to Lys at 60 N66S A to G at 328 3 Asn to Ser at 66 P67L C to T at 332 3 Pro to Leu at 67 K68E A to G at 334 3 Lys to Glu at 68 K68N A to T at 336 3 Lys to Asn at 68 A72T G to A at 346 3 Ala to Thr at 72 A72D C to A at 347 3 Ala to Asp at 72 347delC deletion of C at 3 Frameshift 347 R74W C to T at 352 3 Arg to Trp at 74 R74Q G to A at 353 3 Arg to Gln at 74 R75X C to T at 355 3 Arg to Stop at 75 R75L G to T at 356 3 Arg to Leu at 75 359insT Insertion of T 3 Frameshift after 359 360delT deletion of T at 3 Frameshift 360 W79R T to C at 367 3 Trp to Arg at 79 W79X G to A at 368 3 Trp to Stop at 79 G85E G to A at 386 3 Gly to Glu at 85 G85V G to T at 386 3 Gly to Val at 85 F87L T to C at 391 3 Phe to Leu at 87 394delTT deletion of TT 3 frameshift from 394 L88S T to C at 395 3 Leu to Ser at 88 L88X(T −> A) T to A at 395 3 Leu to Stop at 88 L88X(T −> G) T to G at 395 3 Leu to Stop at 88 Y89C A to G at 398 3 Tyr to Cys at 89 L90S T to C at 401 3 Leu to Ser at 90 G91R G to A at 403 3 Gly to Arg at 91 405 + 1G −> A G to A at 405 + 1 intron 3 mRNA splicing defect 405 + 3A −> C A to C at 405 + 3 intron 3 mRNA splicing defect 405 + 4A −> G A to G at 405 + 4 intron 3 mRNA splicing defect

(31) TABLE-US-00005 TABLE 5 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 3 and 4. Name Nucleotide change Exon Consequence A96E C to A at 419 4 Ala to Glu at 96 Q98X C to T at 424 4 Gln to Stop at 98 Q98P A to C at 425 4 Gln to Pro at 98 Q98R A to G at 425 4 Gln to Arg at 98 P99L C to T at 428 4 Pro to Leu at 99 L101X T to G at 434 4 Leu to Stop at 101 435insA Insertion of A 4 Frameshift after 435 G103X G to T at 439 4 Gly to Stop at 103 441delA deletion of A 4 Frameshift at 441 and T to A at 486 444delA deletion of A 4 Frameshift at 444 I105N T to A at 446 4 Ile to Asn at 105 451del8 deletion of 4 Frameshift GCTTCCTA from 451 S108F C to T at 455 4 Ser to Phe at 108 457TAT −> G TAT to G at 457 4 Frameshift Y109N T to A at 457 4 Tyr to Asn at 109 458delAT deletion of AT 4 Frameshift at 458 Y109C A to G at 458 4 Tyr to Cys at 109 460delG deletion of G 4 Frameshift at 460 D110Y G to T at 460 4 Asp to Tyr at 110 D110H G to C at 460 4 Asp to His at 110 D110E C to A at 462 4 Asp to Glu at 110 P111A C to G at 463 4 Pro to Ala at 111 P111L C to T at 464 4 Pro to Leu at 111 ΔE115 3 bp deletion of 4 deletion of Glu 475-477 at 115 E116Q G to C at 478 4 Glu to Gln at 116 E116K G to A at 478 4 Glu to Lys at 116 R117C C to T at 481 4 Arg to Cys at 117 R117P G to C at 482 4 Arg to Pro at 117 R117L G to T at 482 4 Arg to Leu at 117 R117H G to A at 482 4 Arg to His at 117 I119V A to G at 487 4 Iso to Val at 119 A120T G to A at 490 4 Ala to Thr at 120 Y122X T to A at 498 4 Tyr to Stop at 122 I125T T to C at 506 4 Ile to Thr at 125 G126D G to A at 509 4 Gly to Asp at 126 L127X T to G at 512 4 Leu to Stop at 127 525delT deletion of T 4 Frameshift at 525 541del4 deletion of 4 Frameshift CTCC from 541 541delC deletion of C 4 Frameshift at 541 L137R T to G at 542 4 Leu to Arg at 137 L137H T to A at 542 4 Leu to His at 137 L138ins insertion of CTA, 4 insertion of TAC or ACT at leucine at 138 nucleotide 544, 545 or 546 546insCTA Insertion of CTA 4 Frameshift at 546 547insTA insertion of TA 4 Frameshift after 547 H139L A to T at 548 4 His to Leu at 548 H139R A to G at 548 4 His to Arg at 139 P140S C to T at 550 4 Pro to Ser at 140 P140L C to T at 551 4 Pro to Leu at 140 552insA Insertion of A 4 Frameshift after 552 A141D C to A at 554 4 Ala to Asp at 141 556delA deletion of A 4 Frameshift at 556 557delT deletion of T 4 Frameshift at 557 565delC deletion of C 4 Frameshift at 565 H146R A to G at 569 4 His to Arg at 146 (CBAVD) 574delA deletion of A 4 Frameshift at 574 I148N T to A at 575 4 Ile to Asn at 148 I148T T to C at 575 4 Ile to Thr at 148 G149R G to A at 577 4 Gly to Arg at 149 Q151X C to T at 583 4 Gln to Stop at 151 M152V A to G at 586 4 Met to Val at 152 (mutation) M152R T to G at 587 4 Met to Arg at 152 591del18 deletion of 18 4 deletion of 6 amino bp from 591 acids from the CFTR protein A155P G to C at 595 4 Ala to Pro at 155 S158R A to C at 604 4 Ser to Arg at 158 605insT Insertion of T 4 Frameshift after 605 L159X T to A at 608 4 Leu to Stop at 159 Y161D T to G at 613 4 Tyr to Asp at 161 Y161N T to A at 613 4 Tyr to Asn at 161 Y161S A to C at 614 4 Tyr to Ser at 161 (together with 612T/A) K162E A to G at 616 4 Lys to Glu at 162 621G −> A G to A at 621 4 mRNA splicing defect 621 + 1G −> T G to T at 621 + 1 intron 4 mRNA splicing defect 621 + 2T −> C T to C at 621 + 2 intron 4 mRNA splicing defect 621 + 2T −> G T to G at 621 + 2 intron 4 mRNA splicing defect 621 + 3A −> G A to G at 621 + 3 intron 4 mRNA splicing defect

(32) TABLE-US-00006 TABLE 6 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 31 and 32. Name Nucleotide_change Exon Consequence 681delC deletion of C at 681 5 Frameshift N186K C to A at 690 5 Asn to Lys at 186 N187K C to A at 693 5 Asn to Lys at 187 ΔD192 deletion of TGA or 5 deletion of Asp GAT from 706 or 707 at 192 D192N G to A at 706 5 Asp to Asn at 192 D192G A to G at 707 5 Asp to Gly at 192 E193K G to A at 709 5 Glu to Lys at 193 E193X G to T at 709 5 Glu to Stop at 193 711 + 1G −> T G to T at 711 + 1 intron 5 mRNA splicing defect 711 + 3A −> G A to G at 711 + 3 intron 5 mRNA splicing defect 711 + 3A −> C A to C at 711 + 3 intron 5 mRNA splicing defect 711 + 3A −> T A to T at 711 + 3 intron 5 mRNA splicing defect 711 + 5G −> A G to A at 711 + 5 intron 5 mRNA splicing defect 711 + 34A −> G A to G at 711 + 34 intron 5 mRNA splicing defect

(33) TABLE-US-00007 TABLE 7 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 7 and 8. Name Nucleotide_change Exon Consequence ΔF311 deletion of 3 bp between 7 deletion of Phe310, 1059 and 1069 311 or 312 F311L C to G at 1065 7 Phe to Leu at 311 G314R G to C at 1072 7 Gly to Arg at 314 G314E G to A at 1073 7 Gly to Glu at 314 G314V G to T at 1073 7 Gly to Val at 324 F316L T to G at 1077 7 Phe to Leu at 316 1078delT deletion of T at 1078 7 Frameshift V317A T to C at 1082 7 Val to Ala at 317 L320V T to G at 1090 7 Leu to Val at 320 CAVD L320X T to A at 1091 7 Leu to Stop at 320 L320F A to T at 1092 7 Leu to Phe at 320 V322A T to C at 1097 7 Val to Ala at 322 1112delT deletion of T at 1112 7 Frameshift L327R T to G at 1112 7 Leu to Arg at 327 1119delA deletion of A at 1119 7 Frameshift G330X G to T at 1120 7 Gly to Stop at 330 R334W C to T at 1132 7 Arg to Trp at 334 R334Q G to A at 1133 7 Arg to Gln at 334 R334L G to T at 1133 7 Arg to Leu at 334 1138insG Insertion of G after 1138 7 Frameshift I336K T to A at 1139 7 Ile to Lys at 336 T338I C to T at 1145 7 Thr to Ile at 338 1150delA deletion of A at 1150 7 Frameshift 1154insTC insertion of TC after 7 Frameshift 1154 1161insG Insertion of G after 1161 7 Frameshift 1161delC deletion of C at 1161 7 Frameshift L346P T to C at 1169 7 Leu to Pro at 346 R347C C to T at 1171 7 Arg to Cys at 347 R347H G to A at 1172 7 Arg to His at 347 R347L G to T at 1172 7 Arg to Leu at 347 R347P G to C at 1172 7 Arg to Pro at 347 M348K T to A at 1175 7 Met to Lys at 348 A349V C to T at 1178 7 Ala to Val at 349 R352W C to T at 1186 7 Arg to Trp at 352 R352Q G to A at 1187 7 Arg to Gln at 352 Q353X C to T at 1189 7 Gln to Stp at 353 Q353H A to C at 1191 7 Gln to His at 353 1199delG deletion of G at 1199 7 Frameshift W356X G to A at 1200 7 Trp to Stop at 356 Q359K/T360K C to A at 1207 and C to 7 Glu to Lys at 359 A at 1211 and Thr to Lys at 360 Q359R A to G at 1208 7 Gln to Arg at 359 1213delT deletion of T at 1213 7 Frameshift W361R(T −> C) T to C at 1213 7 Trp to Arg at 361 W361R(T −> A) T to A at 1213 7 Trp to Arg at 361 1215delG deletion of G at 1215 7 Frameshift 1221delCT deletion of CT from 7 Frameshift 1221 S364P T to C at 1222 7 Ser to Pro at 364 L365P T to C at 1226 7 Leu to Pro at 365

(34) TABLE-US-00008 TABLE 8 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 21 and 22. Name Nucleotide_change Exon Consequence 1342 − TTT to G at intron 8 mRNA splicing 11TTT −> G 1342 − 11 defect 1342 − 2delAG deletion of AG intron 8 Frameshift from 1342 − 2 1342 − A to C at 1342 − 2 intron 8 mRNA splicing 2A −> C defect 1342 − G to C at 1342 − 1 intron 8 mRNA splicing 1G −> C defect E407V A to T at 1352 9 Glu to Val at 407 1366delG deletion of G 9 Frameshift at 1366 1367delC deletion of C 9 Frameshift at 1367 1367del5 deletion of 9 Frameshift CAAAA at 1367 Q414X C to T at 1372 9 Gln to Stop at 414 N418S A to G at 1385 9 Asn to Ser at 418 G424S G to A at 1402 9 Gly to Ser at 424 S434X C to G at 1433 9 Ser to Stop at 434 D443Y G to T at 1459 9 Asp to Tyr at 443 1460delAT deletion of AT 9 Frameshift from 1460 1461ins4 insertion of AGAT 9 Frameshift after 1461 I444S T to G at 1463 9 Ile to Ser at 444 1471delA deletion of A 9 Frameshift at 1471 Q452P A to C at 1487 9 Gln to Pro at 452 ΔL453 deletion of 3 9 deletion of Leu bp between at 452 or 454 1488 and 1494 A455E C to A at 1496 9 Ala to Glu at 455 V456F G to T at 1498 9 Val to Phe at 456

(35) TABLE-US-00009 TABLE 9 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 27 and 28. Name Nucleotide_change Exon Consequence G480C G to T at 1570 10 Gly to Cys at 480 G480D G to A at 1570 10 Gly to Asp at 480 G480S G to A at 1570 10 Gly to Ser at 480 1571delG deletion of G at 1571 10 Frameshift 1576insT Insertion of T at 1576 10 Frameshift H484Y C to T at 1582 10 His to Tyr at 484 (CBAVD) H484R A to G at 1583 10 His to Arg at 484 S485C A to T at 1585 10 Ser to Cys at 485 G486X G to T at 1588 10 Glu to Stop at 486 S489X C to A at 1598 10 Ser to Stop at 489 1601delTC deletion of TC from 10 Frameshift 1601 or CT from 1602 C491R T to C at 1603 10 Cys to Arg at 491 S492F C to T at 1607 10 Ser to Phe at 492 Q493X C to T at 1609 10 Gln to Stop at 493 1609delCA deletion of CA from 10 Frameshift 1609 Q493R A to G at 1610 10 Gln to Arg at 493 1612delTT deletion of TT from 10 Frameshift 1612 W496X G to A at 1619 10 Trp to Stop at 496 P499A C to G at 1627 10 Pro to Ala at 499 (CBAVD) T501A A to G at 1633 10 Thr to Ala at 501 I502T T to C at 1637 10 Ile to Thr at 502 I502N T to A at 1637 10 Ile to Asn at 502 E504X G to T at 1642 10 Glu to Stop at 504 E504Q G to C at 1642 10 Glu to Gln at 504 I506L A to C at 1648 10 Ile to Leu at 506 ΔI507 deletion of 3 bp between 10 deletion of Ile506 1648 and 1653 or Ile507 I506S T to G at 1649 10 Ile to Ser at 506 I506T T to C at 1649 10 Ile to Thr at 506 ΔF508 deletion of 3 bp between 10 deletion of Phe 1652 and 1655 at 508 F508S T to C at 1655 10 Phe to Ser at 508 D513G A to G at 1670 10 Asp to Gly at 513 (CBAVD) 1677delTA deletion of TA from 10 frameshift 1677 Y517C A to G at 1682 10 Tyr to Cys at 517

(36) TABLE-US-00010 TABLE 10 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 15 and 16. Name Nucleotide_change Exon Consequence 1716 − 1G −> A G to A at 1716 − 1 intron 10 mRNA splicing defect 1717 − 8G −> A G to A at 1717 − 8 intron 10 mRNA splicing defect 1717 − 3T −> G T to G at 1717 − 3 intron 10 mRNA splicing defect 1717 − 2A −> G A to G at 1717 − 2 intron 10 mRNA splicing defect 1717 − 1G −> A G to A at 1717 − 1 intron 10 mRNA splicing defect D529H G to C at 1717 11 Asp to His at 529 1717 − 9T −> A T to A at 1717 − 9 intron 10 mRNA splicing mutation A534E C to A at 1733 11 Ala to Glu at 534 1742delAC deletion of AC from 11 Frameshift 1742 I539T T to C at 1748 11 Ile to Thr at 539 1749insTA Insertion of TA at 1749 11 frameshift resulting in premature termination at 540 G542X G to T at 1756 11 Gly to Stop at 542 G544S G to A at 1762 11 Gly to Ser at 544 G544V G to T at 1763 11 Gly to Val at 544 (CBAVD) 1774delCT deletion of CT from 11 Frameshift 1774 S549R(A −> C) A to C at 1777 11 Ser to Arg at 549 S549I G to T at 1778 11 Ser to Ile at 549 S549N G to A at 1778 11 Ser to Asn at 549 S549R(T −> G) T to G at 1779 11 Ser to Arg at 549 G550X G to T at 1780 11 Gly to Stop at 550 G550R G to A at 1780 11 Gly to Arg at 550 1782delA deletion of A at 1782 11 Frameshift G551S G to A at 1783 11 Gly to Ser at 551 1784delG deletion of G at 1784 11 Frameshift G551D G to A at 1784 11 Gly to Asp at 551 Q552X C to T at 1786 11 Gln to Stop at 552 Q552K C to A at 1786 11 Gln to Lys 1787delA deletion of A at position 11 frameshift, stop codon at 558 1787 or 1788 R553G C to G at 1789 11 Arg to Gly at 553 R553X C to T at 1789 11 Arg to Stop at 553 R553Q G to A at 1790 11 Arg to Gln at 553 (associated with ΔF508); R555G A to G at 1795 11 Arg to Gly at 555 I556V A to G at 1798 11 Ile to Val at 556 (mutation) 1802delC deletion of C at 1802 11 Frameshift L558S T to C at 1805 11 Leu to Ser at 558 1806delA deletion of A at 1806 11 Frameshift A559T G to A at 1807 11 Ala to Thr at 559 A559E C to A at 1808 11 Ala to Glu at 559 R560T G to C at 1811 11 Arg to Thr at 560; mRNA splicing defect R560K G to A at 1811 11 Arg to Lys at 560 1811 + 1G −> C G to C at 1811 + 1 intron 11 mRNA splicing defect 1811 + 1.6 kbA −> G A to G at 1811 + 1.2 kb intron 11 creation of splice donor site 1811 + 18G −> A G to A at 1811 + 18 intron 11 mRNA splicing defect

(37) TABLE-US-00011 TABLE 11 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 9 and 10. Name Nucleotide change Exon Consequence 1812 − 1G −> A G to A at 1812 −1 intron 11 mRNA splicing defect R560S A to C at 1812 12 Arg to Ser at 560 1813insC Insertion of C after 1813 12 Frameshift (or 1814) A561E C to A at 1814 12 Ala to Glu at 561 V562I G to A at 1816 12 Val to Ile at 562 V562L G to C at 1816 12 Val to Leu at 562 Y563D T to G at 1819 12 Tyr to Asp at 563 Y563N T to A at 1819 12 Tyr to Asn at 563 Y563C A to G at 1821 12 Tyr to Cys at 563 1833delT deletion of T at 1833 12 Frameshift L568X T to A at 1835 12 Leu to Stop at 568 L568F G to T at 1836 12 Leu to Phe at 568 (CBAVD) Y569D T to G at 1837 12 Tyr to Asp at 569 Y569H T to C at 1837 12 Tyr to His at 569 Y569C A to G at 1838 12 Tyr to Cys at 569 V569X T to A at 1839 12 Tyr to Stop at 569 L571S T to C at 1844 12 Leu to Ser at 571 1845delAG/1846d deletion of AG at 1845 12 Frameshift elGA or GA at 1846 D572N G to A at 1846 12 Asp to Asn at 572 P574H C to A at 1853 12 Pro to His at 574 G576X G to T at 1858 12 Gly to Stop at 576 G576A G to C at 1859 12 Gly to Ala at 576 (CAVD) Y577F A to T at 1862 12 Tyr to Phe at 577 D579Y G to T at 1867 12 Asp to Tyr at 579 D579G A to G at 1868 12 Asp to Gly at 579 D579A A to C at 1868 12 Asp to Ala at 579 1870delG deletion of G at 1870 12 Frameshift 1874insT Insertion of T between 12 Frameshift 1871 and 1874 T582R C to G at 1877 12 Thr to Arg at 582 T582I C to T at 1877 12 Thr to Ile at 582 E585X G to T at 1885 12 Glu to Stop at 585 S589N G to A at 1898 12 Ser to Asn at 589 (mRNA splicing defect) S589I G to T at 1898 12 Ser to Ile at 589 (splicing) 1898 + 1G −> A G to A at 1898 + 1 intron 12 mRNA splicing defect 1898 + 1G −> C G to C at 1898 + 1 intron 12 mRNA splicing defect 1898 + 1G −> T G to T at 1898 + 1 intron 12 mRNA splicing defect 1898 + 3A −> G A to G at 1898 + 3 intron 12 mRNA splicing defect 1898 + 3A −> C A to C at 1898 + 3 intron 12 mRNA splicing defect 1898 + 5G −> A G to A at 1898 + 5 intron 12 mRNA splicing defect 1898 + 5G −> T G to T at 1898 + 5 intron 12 mRNA splicing defect 1898 + 73T −> G T to G at 1898 + 73 intron 12 mRNA splicing defect

(38) TABLE-US-00012 TABLE 12 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 23 and 24. Name Nucleotide_change Exon Consequence 1918delGC deletion of GC from 13 Frameshift 1918 1924del7 deletion of 7 bp 13 Frameshift (AAACTA) from 1924 R600G A to G at 1930 13 Arg to Gly at 600 I601F A to T at 1933 13 Ile to Phe at 601 V603F G to T at 1939 13 Val to Phe at 603 T604I C to T at 1943 13 Thr to Ile at 604 1949del84 deletion of 84 bp from 13 deletion of 28 a.a. 1949 (Met607 to Gln634) H609R A to G at 1958 13 His to Arg at 609 L610S T to C at 1961 13 Leu to Ser at 610 A613T G to A at 1969 13 Ala to Thr at 613 D614Y G to T at 1972 13 Asp to Tyr 614 D614G A to G at 1973 13 Asp to Gly at 614 I618T T to C at 1985 13 Ile to Thr at 618 L619S T to C at 1988 13 Leu to Ser at 619 H620P A to C at 1991 13 His to Pro at 620 H620Q T to G at 1992 13 His to Gln at 620 G622D G to A at 1997 13 Gly to Asp at 622 (oligospermia) G628R(G −> A) G to A at 2014 13 Gly to Arg at 628 G628R(G −> C) G to C at 2014 13 Gly to Arg at 628 L633P T to C at 2030 13 Leu to Pro at 633 Q634X T to A at 2032 13 Gln to Stop at 634 L636P T to C at 2039 13 Leu to Pro at 636 Q637X C to T at 2041 13 Gln to Stop at 637 2043delG deletion of G at 2043 13 Frameshift 2051delTT deletion of TT from 13 Frameshift 2051 2055del9 −> A deletion of 9 bp 13 Frameshift CTCAAAACT to A at 2055 D648V A to T at 2075 13 Asp to Val at 648 D651N G to A at 2083 13 Asp to Asn at 651 E656X T to G at 2098 13 Glu to Stop at 656 2108delA deletion of A at 2108 13 Frameshift 2109del9 −> A deletion of 9 bp from 13 Frameshift 2109 and insertion of A 2113delA deletion of A at 2113 13 Frameshift 2116delCTAA deletion of CTAA at 13 Frameshift 2116 2118del4 deletion of AACT from 13 Frameshift 2118 E664X G to T at 2122 13 Glu to Stop at 664 T665S A to T at 2125 13 Thr to Ser at 665 2141insA Insertion of A after 2141 13 Frameshift 2143delT deletion of T at 2143 13 Frameshift E672del deletion of 3 bp between 13 deletion of Glu 2145-2148 at 672 G673X G to T at 2149 13 Gly to Stop at 673 W679X G to A at 2168 13 Trp to stop at 679 2176insC Insertion of C after 2176 13 Frameshift K683R A to G at 2180 13 Lys to Arg at 683 2183AA −> G A to G at 2183 and 13 Frameshift deletion of A at 2184 2183delAA deletion of AA at 2183 13 Frameshift 2184delA deletion of A at 2184 13 frameshift 2184insG Inserion of G after 2184 13 Frameshift 2184insA Insertion of A after 2184 13 Frameshift 2185insC Insertion of C at 2185 13 Frameshift Q685X C to T at 2185 13 Gln to Stop at 685 E692X G to T at 2206 13 Glu to Stop at 692 F693L(CTT) T to C at 2209 13 Phe to Leu at 693 F693L(TTG) T to G at 2211 13 Phe to Leu at 693 2215insG Insertion of G at 2215 13 Frameshift K698R A to G 2225 13 Lys to Arg at 698 R709X C to T at 2257 13 Arg to Stop at 709 K710X A to T at 2260 13 Lys to Stop at 710 K716X AA to GT at 2277 and 13 Lys to Stop at 716 2278 L719X T to A at 2288 13 Leu to Stop at 719 Q720X C to T at 2290 13 Gln to stop codon at 720 E725K G to A at 2305 13 Glu to Lys at 725 2307insA Insertion of A after 2307 13 Frameshift E730X G to T at 2320 13 Glu to Stop at 730 L732X T to G at 2327 13 Leu to Stop at 732 2335delA deletion of A at 2335 13 Frameshift R735K G to A at 2336 13 Arg to Lys at 735 2347delG deletion of G at 2347 13 Frameshift 2372del8 deletion of 8 bp from 13 Frameshift 2372 P750L C to T at 2381 13 Pro to Leu at 750 V754M G to A at 2392 13 Val to Met at 754 T760M C to T at 2411 13 Thr to Met at 760 R764X C to T at 2422 13 Arg to Stop at 764 2423delG deletion of G at 2423 13 Frameshift R766M G to T at 2429 13 Arg to Met at 766 2456delAC deletion of AC at 2456 13 Frameshift S776X C to G at 2459 13 Ser to Stop at 776

(39) TABLE-US-00013 TABLE 13 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 11 and 12. Name Nucleotide_change Exon Consequence T908N C to A at 2788 14b Thr to Asn at 908 2789 + 2insA insertion of A after intron 14b mRNA splicing 2789 + 2 defect (CAVD) 2789 + 3delG deletion of G at intron 14b mRNA splicing 2789 + 3 defect 2789 + 5G −> A G to A at 2789 + 5 intron 14b mRNA splicing defect

(40) TABLE-US-00014 TABLE 14 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 25 and 26. Name Nucleotide_change Exon Consequence 3100insA Insertion of A 16 Frameshift after 3100 I991V A to G at 3103 16 Ile to Val at 991 D993Y G to T at 3109 16 Asp to Tyr at 993 F994C T to G at 3113 16 Phe to Cys at 994 3120G −> A G to A at 3120 16 mRNA splicing defect 3120 + G to A at 3120 + 1 intron 16 mRNA splicing defect 1G −> A

(41) TABLE-US-00015 TABLE 15 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 29 and 30. Name Nucleotide_change Exon Consequence 3601 − 20T −> C T to C at 3601 − 20 intron 18 mRNA splicing mutant 3601 − 17T −> C T to C at 3601 − 17 intron 18 mRNA splicing defect 3601 − 2A −> G A to G at 3601 − 2 intron 18 mRNA splicing defect R1158X C to T at 3604 19 Arg to Stop at 1158 S1159P T to C at 3607 19 Ser to Pro at 115p S1159F C to T at 3608 19 Ser to Phe at 1159 R1162X C to T at 3616 19 Arg to Stop at 1162 3622insT Insertion of T 19 Frameshift after 3622 D1168G A to G at 3635 19 Asp to Gly at 1168 3659delC deletion of C 19 Frameshift at 3659 K1177X A to T at 3661 19 Lys to Stp at 3661 (premature termina- tion) K1177R A to G at 3662 19 Lys to Arg at 1177 3662delA deletion of A 19 Frameshift at 3662 3667del4 deletion of 4 19 Frameshift bp from 3667 3667ins4 insertion of TCAA 19 Frameshift after 3667 3670delA deletion of A 19 Frameshift at 3670 Y1182X C to G at 3678 19 Tyr to Stop at 1182 Q1186X C to T at 3688 19 Gln to Stop codon at 1186 3696G/A G to A at 3696 18 No change to Ser at 1188 V1190P T to A at 3701 19 Val to Pro at 1190 S1196T C or Q at 3719 19 Ser-Top at 1196 S1196X C to G at 3719 19 Ser to Stop at 1196 3724delG deletion of G 19 Frameshift at 3724 3732delA deletion of A 19 frameshift and Lys at 3732 and A to Glu at 1200 to G at 3730 3737delA deletion of A 19 Frameshift at 3737 W1204X G to A at 3743 19 Trp to Stop at 1204 S1206X C to G at 3749 19 Ser to Stop at 1206 3750delAG deletion of AG 19 Frameshift from 3750 3755delG deletion of G 19 Frameshift between 3751 and 3755 M1210I G to A at 3762 19 Met to Ile at 1210 V1212I G to A at 3766 19 Val to Ile at 1212

(42) TABLE-US-00016 TABLE 16 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 5 and 6. Name Nucleotide_change Exon Consequence 3849 + C to T in a 6.2 kb intron 19 creation of splice 10 kbC −> EcoRI fragment 10 kb acceptor site T from 19

(43) TABLE-US-00017 TABLE 17 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 17 and 18. Name Nucleotide_change Exon Consequence T1252P A to C at 3886 20 Thr to Pro at 1252 L1254X T to G at 3893 20 Leu to Stop at 1254 S1255P T to C at 3895 20 Ser to Pro at 1255 S1255L C to T at 3896 20 Ser to Leu at 1255 S1255X C to A at 3896 and A to 20 Ser to Stop at 1255 G at 3739 in exon 19 and Ile to Val at 1203 3898insC Insertion of C 20 Frameshift after 3898 F1257L T to G at 3903 20 Phe to Leu at 1257 3905insT Insertion of T 20 Frameshift after 3905 3906insG Insertion of G 20 Frameshift after 3906 ΔL1260 deletion of ACT from 20 deletion of Leu at either 3909 or 3912 1260 or 1261 3922del10 −> C deletion of 10 bp from 20 deletion of Glu1264 3922 and replacement to Glu1266 with 3921 I1269N T to A at 3938 20 Ile to Asn at 1269 D1270N G to A at 3940 20 Asp to Asn at 1270 3944delGT deletion of GT from 20 Frameshift 3944 W1274X G to A at 3954 20 Trp to Stop at 1274 Q1281X C to T at 3973 20 Gln to Stop at 1281 W1282R T to C at 3976 20 Trp to Arg at 1282 W1282G T to G at 3976 20 Trp to Gly at 1282 W1282X G to A at 3978 20 Trp to Stop at 1282 W1282C G to T at 3978 20 Trp to Cys at 1282 R1283M G to T at 3980 20 Arg to Met at 1283 R1283K G to A at 3980 20 Arg to Lys at 1283 F1286S T to C at 3989 20 Phe to Ser at 1286

(44) TABLE-US-00018 TABLE 18 CFTR mutations that may be detected in amplified product using as the primer pair SEQ ID NO: 13 and 14. Name Nucleotide_change Exon Consequence T1299I C to T at 4028 21 Thr to Ile at 1299 F1300L T to C at 4030 21 Phe to Leu at 1300 N1303H A to C at 4039 21 Asn to His at 1303 N1303I A to T at 4040 21 Asn to Ile at 1303 4040delA deletion of A at 4040 21 Frameshift N1303K C to G at 4041 21 Asn to Lys at 1303 D1305E T to A at 4047 21 Asp to Glu at 1305 4048insCC insertion of CC after 21 Frameshift 4048 Y1307X T to A at 4053 21 Tyr to Stop at 1307 E1308X G to T at 4054 21 Glu to Stop at 1308
CF mutations including those known under symbols: 2789+5G>A; 711+1G>T; W1282X; 3120+1G>A; d1507; dF508; (F508C, 1507V, I506V): N1303K; G542X, G551D, R553X, R560T, 1717-1G>A: R334W, R347P, 1078delT; R117H, I148T, 621+1G>T; G85E; R1162X, 3659delC; 2184delA; A455E, (5T, 7T, 9T); 3849+10kbC>T; and 1898+1G>A, are described in U.S. patent application Ser. No. 396,894, filed Apr. 22, 1989, U.S. patent application Ser. No. 399,945, filed Aug. 29, 1989, U.S. patent application Ser. No. 401,609 filed Aug. 31, 1989, and U.S. Pat. Nos. 6,001,588 and 5,981,178, which are hereby incorporated by reference in their entirety. Any and all of these mutations can be detected using nucleic acid amplified with the invention primers as described herein.

(45) CF mutations in the amplified nucleic acid may be identified in any of a variety of ways well known to those of ordinary skill in the art. For example, if an amplification product is of a characteristic size, the product may be detected by examination of an electrophoretic gel for a band at a precise location. In another embodiment, probe molecules that hybridize to the mutant or wildtype CF sequences can be used for detecting such sequences in the amplified product by solution phase or, more preferably, solid phase hybridization. Solid phase hybridization can be achieved, for example, by attaching the CF probes to a microchip. Probes for detecting CF mutant sequences are well known in the art. See Wall et al. “A 31-mutation assay for cystic fibrosis testing in the clinical molecular diagnostics laboratory,” Human Mutation, 1995; 5(4):333-8, which specifies probes for CF mutations ΔF508 (exon 1), G542X (exon 11), G551D (exon 11), R117H (exon 4), W1282X (exon 20), N1303K (exon 21), 3905insT (exon 20), 3849+10Kb (intron 19), G85E (exon 3), R334W (exon 7), A455E (exon 9), 1898+1 (exon 12), 2184delA (exon 13), 711+1 (exon 5), 2789+5 (exon 14b), Y1092x exon 17b), ΔI507 (exon 10), S549R(T-G) (exon 11), 621+1 (exon 4), R1162X (exon 19), 1717-1 (exon 11), 3659delC (exon 19), R560T (exon 11), 3849+4(A-G) (exon 19), Y122X (exon 4), R553X (exon 11), R347P (exon 7), R347H (exon 7), Q493X (exon 10), V520F (exon 10), and S549N (exon 11).

(46) CF probes for detecting mutations as described herein may be attached to a solid phase in the form of an array as is well known in the art (see, U.S. Pat. Nos. 6,403,320 and 6,406,844). For example, the full complement of 24 probes for CF mutations with additional control probes (30 in total) can be conjugated to a silicon chip essentially as described by Jenison et al., Biosens Bioelectron. 16(9-12):757-63 (2001) (see also U.S. Pat. Nos. 6,355,429 and 5,955,377). Amplicons that hybridized to particular probes on the chip can be identified by transformation into molecular thin films. This can be achieved by contacting the chip with an anti-biotin antibody or streptavidin conjugated to an enzyme such as horseradish peroxidase. Following binding of the antibody (or streptavidin)-enzyme conjugate to the chip, and washing away excess unbound conjugate, a substrate can be added such as tetramethylbenzidine (TMB) {3,3′,5,5′Tetramethylbenzidine} to achieve localized deposition (at the site of bound antibody) of a chemical precipitate as a thin film on the surface of the chip. Other enzyme/substrate systems that can be used are well known in the art and include, for example, the enzyme alkaline phosphatase and 5-bromo-4-chloro-3-indolyl phosphate as the substrate. The presence of deposited substrate on the chip at the locations in the array where probes are attached can be read by an optical scanner. U.S. Pat. Nos. 6,355,429 and 5,955,377, which are hereby incorporated by reference in their entirety including all charts and drawings, describe preferred devices for performing the methods of the present invention and their preparation, and describes methods for using them.

(47) The binding of amplified nucleic acid to the probes on the solid phase following hybridization may be measured by methods well known in the art including, for example, optical detection methods described in U.S. Pat. No. 6,355,429. In preferred embodiments, an array platform (see, e.g., U.S. Pat. No. 6,288,220) can be used to perform the methods of the present invention, so that multiple mutant DNA sequences can be screened simultaneously. The array is preferably made of silicon, but can be other substances such as glass, metals, or other suitable material, to which one or more capture probes are attached. In preferred embodiments, at least one capture probe for each possible amplified product is attached to an array. Preferably an array contains 10, more preferably 20, even more preferably 30, and most preferably at least 60 different capture probes covalently attached to the array, each capture probe hybridizing to a different CF mutant sequence. Nucleic acid probes useful as positive and negative controls also may be included on the solid phase or used as controls for solution phase hybridization.

(48) Another approach, variously referred to as PCR amplification of specific allele (PASA) (Sarkar, et al., 1990 Anal. Biochem. 186:64-68), allele-specific amplification (ASA) (Okayama, et al., 1989 J. Lab. Clin. Med. 114:105-113), allele-specific PCR (ASPCR) (Wu, et al. 1989 Proc. Natl. Acad. Sci. USA. 86:2757-2760), and amplification-refractory mutation system (ARMS) (Newton. et al., 1989 Nucleic Acids Res. 17:2503-2516). The method is applicable for single base substitutions as well as micro deletions/insertions. In general, two complementary reactions are used. One contains a primer specific for the normal allele and the other reaction contains a primer for the mutant allele (both have a common 2nd primer). One PCR primer perfectly matches one allelic variant of the target, but is mismatched to the other. The mismatch is located at/near the 3′ end of the primer leading to preferential amplification of the perfectly matched allele. Genotyping is based on whether there is amplification in one or in both reactions. A band in the normal reaction only indicates a normal allele. A band in the mutant reaction only indicates a mutant allele. Bands in both reactions indicate a heterozygote. As used herein, this approach will be referred to as “allele specific amplification.”

(49) In yet another approach, restriction fragment length polymorphism (RFLP), which refers to the digestion pattern of various restriction enzymes applied to DNA. RFLP analysis can be applied to PCR amplified DNA to identify CF mutations as disclosed herein.

(50) In still another approach, wildtype or mutant CF sequence in amplified DNA may be detected by direct sequence analysis of the amplified products. A variety of methods can be used for direct sequence analysis as is well known in the art. See, e.g., The PCR Technique: DNA Sequencing (eds. James Ellingboe and Ulf Gyllensten) Biotechniques Press, 1992; see also “SCAIP” (single condition amplification/internal primer) sequencing, by Flanigan et al. Am J Hum Genet. 2003 April; 72(4):931-9. Epub 2003 Mar. 11. Direct sequencing of CF mutations is also described in Strom et al., 2003 Genetics in Medicine 5(1):9-14.

(51) In yet another approach for detecting wildtype or mutant CF sequences in amplified DNA is single nucleotide primer extension or “SNuPE.” SNuPE can be performed as described in U.S. Pat. No. 5,888,819 to Goelet et al., U.S. Pat. No. 5,846,710 to Bajaj, Piggee, C. et al. Journal of Chromatography A 781 (1997), p. 367-375 (“Capillary Electrophoresis for the Detection of Known Point Mutations by Single-Nucleotide Primer Extension and Laser-Induced Fluorescence Detection”); Hoogendoorn, B. et al., Human Genetics (1999) 104:89-93, (“Genotyping Single Nucleotide Polymorphism by Primer Extension and High Performance Liquid Chromatography”); and U.S. Pat. No. 5,885,775 to Haff et al. (analysis of single nucleotide polymorphism analysis by mass spectrometry). In SNuPE, one may use as primers such as those specified in Table 17.

(52) Another method for detecting CF mutations include the Luminex xMAP system which has been adapted for cystic fibrosis mutation detection by TM Bioscience and is sold commercially as a universal bead array (Tag-It™).

(53) Still another approach for detecting wildtype or mutant CF sequences in amplified DNA is oligonucleotide ligation assay or “OLA” or “OL”. The OLA uses two oligonucleotides which are designed to be capable of hybridizing to abutting sequences of a single strand of a target molecules. One of the oligonucleotides is biotinylated, and the other is detectably labeled. If the precise complementary sequence is found in a target molecule, the oligonucleotides will hybridize such that their termini abut, and create a ligation substrate that can be captured and detected. See e.g., Nickerson et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:8923-8927, Landegren, U. et al. (1988) Science 241:1077-1080 and U.S. Pat. No. 4,998,617.

(54) These above approaches for detecting wildtype or mutant CF sequence in the amplified nucleic acid is not meant to be limiting, and those of skill in the art will understand that numerous methods are known for determining the presence or absence of a particular nucleic acid amplification product.

(55) In another aspect the present invention provides kits for one of the methods described herein. The kit optionally contain buffers, enzymes, and reagents for amplifying the CFTR nucleic acid via primer-directed amplification. The kit also may include one or more devices for detecting the presence or absence of particular mutant CF sequences in the amplified nucleic acid. Such devices may include one or more probes that hybridize to a mutant CF nucleic acid sequence, which may be attached to a bio-chip device, such as any of those described in U.S. Pat. No. 6,355,429. The bio-chip device optionally has at least one capture probe attached to a surface on the bio-chip that hybridizes to a mutant CF sequence. In preferred embodiments the bio-chip contains multiple probes, and most preferably contains at least one probe for a mutant CF sequence which, if present, would be amplified by a set of flanking primers. For example, if five pairs of flanking primers are used for amplification, the device would contain at least one CF mutant probe for each amplified product, or at least five probes. The kit also preferably contains instructions for using the components of the kit.

(56) The following examples serve to illustrate the present invention. These examples are in no way intended to limit the scope of the invention

EXAMPLES

Example 1: Sample Collection and Preparation

(57) Whole Blood:

(58) 5 cc of whole blood is collected in a lavender-top (EDTA) tube or yellow-top (ACD) tube. Green-top (Na Heparin) tubes are acceptable but less desirable. DNA is extracted from blood. 100 ng or more DNA is prepared in TE or sterile water.

(59) Amniotic Fluid:

(60) 10-15 cc of Amniotic Fluid is collected in a sterile plastic container.

(61) Cultured Cells:

(62) Two T-25 culture flasks with 80-100% confluent growth may be used.

(63) Chorionic Villi:

(64) 10-20 mg of Chorionic Villi are collected in a sterile container. 2-3 mL of sterile saline or tissue culture medium is added.

(65) Transport:

(66) Whole Blood, Amniotic Fluid, Cultured Cells and Chorionic Villi can be shipped at room temperature (18°-26° C.). Amniotic Fluid, Cultured Cells or Chorionic Villi preferably is used without refrigeration or freezing. Whole Blood and Extracted DNA can be shipped at 2°-10° C.

(67) Storage:

(68) Whole Blood, Amniotic Fluid and Extracted DNA are stored at 2°-10° C., Cultured Cells and Chorionic Villi are stored at room temperature (18°-26° C.).

(69) Stability:

(70) Whole Blood is generally stable for 8 days at room temperature (18°-26° C.) or 8 days refrigerated at 2°-10° C. Amniotic Fluid, Cultured Cells, and Chorionic Villi are generally processed to obtain DNA within 24 hours of receipt. Extracted DNA is stable for at least 1 year at 2°-10° C.

Example 2: Amplification from DNA

(71) Polymerase chain reaction (PCR) primer pairs were designed using the CFTR gene sequences in EMBL/Genbank (Accession Nos. M55106-M55131). Each PCR primer for the 32 separate PCR reactions contains either an M13 forward linker sequence or an M13 reverse linker sequence as appropriate to allow universal sequence reaction priming. Individual PCR reactions are performed in 96-well microtiter plates under the same conditions for each amplicon. Subsequently, the PCR products are purified with the Millipore Montage™ PCR.sub.96 Cleanup kit (Millipore, Bedford, Mass.) on a Beckman BioMek 2,000 biorobot. Further details are provided in Strom et al., 2003 Genetics in Medicine 5(1):9-14.

(72) In general, individual amplifications are prepared in a volume of 13.5 μl which is added to the 96 well microtiter plates. Each amplification volume contained 2 μl of the nucleic acid sample (generally 10-100 ng of DNA), 11.5 μl of PCR-Enzyme Mix (PCR-Enzyme mix stock is prepared with 11.3 μl master mix, 0.25 μl MgCl.sub.2 (from 25 mM stock), and 0.2 μl of FasStar Taq (source for last two reagents was Roche Applied science, Cat. No. 2 032 937). Master mix contained primers, Roche PCR buffer with MgCl.sub.2, Roche GC rich solution (cat. No. 2 032 937), bovine serum albumin (BSA) (New England BioLabs, Cat no. B9001B), and NTPs (Amersham Biosciences, Cat no. 27-2032-01).

(73) The final concentration in the PCR for MgCl.sub.2 was 2.859 mM, for BSA is 0.725 μg/μl, and for each dNTP is 0.362 mM. Primer final concentrations varied from about 0.29 μM to about 0.036 μM.

(74) PCR is conducted using the following temperature profile: step 1: 96° C. for 15 minutes; step 2: 94° C. for 15 seconds; step 3: decrease at 0.5° C./second to 56° C.; step 4: 56° C. for 20 seconds; step 5: increase at 0.3° C./second to 72° C., step 6: 72° C. for 30 seconds; step 7: increase 0.5° C. up to 94° C.; step 8: repeat steps 2 to 7 thirty three times; step 9: 72° C. for 5 minutes; step 10: 4° C. hold (to stop the reaction).

Example 3: Detection of CF Mutations

(75) The purified PCR products are diluted to approximately 10 ng/μL and cycle sequencing reactions are performed with an ABI Prism Big Dye™ Terminator v3.0 cycle sequencing reaction kit (Applied Biosystems, Foster City, Calif.) according to the manufacturer's protocol. The DNA primers used for the sequencing reaction are M13 forward and reverse primers as appropriate. Big Dye™ Terminator reaction products are purified by the Millipore Montage™ Seq.sub.96 Sequencing Reaction Cleanup kit on a biorobot and analyzed on an ABI Prism 3100 Genetic Analyzer. Sequences obtained are examined for the presence of mutations by using ABI SeqScape v1.1 software. Both strands of DNA are sequenced.

(76) All PCR reactions, purifications, and cycle sequencing reactions are performed in 96-well microtiter plates using biorobots to avoid errors introduced by manual setups. Loading of samples onto the capillary sequencer is also automated. One plate is sufficient to perform the entire sequencing reaction for a single patient. Theoretically, if all reactions were successful, the entire sequences for a single patient could be obtained in 24-48 hours after receipt of blood. In practice, however, one or more reactions must be repeated because of frequent polymorphisms in intron 8 and 6a and failed reactions.

(77) The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

(78) Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.

(79) The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising”, “including,” containing”, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

(80) The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.