Light-switchable gene expression system
09839698 · 2017-12-12
Assignee
Inventors
Cpc classification
A61K48/0083
HUMAN NECESSITIES
C12N15/63
CHEMISTRY; METALLURGY
C12N2830/001
CHEMISTRY; METALLURGY
International classification
C12N15/63
CHEMISTRY; METALLURGY
Abstract
Provided is a light-switchable gene expression system, comprising: a) a recombinant light-switchable transcription factor-encoding gene, said recombinant light-switchable transcription factor comprising a first polypeptide as the DNA bonding domain, a second polypeptide as the photosensitive domain, and a third polypeptide as the transcription regulatory domain; b) a target transcription unit comprising at least one reaction element recognized and bound by the first polypeptide, a promoter regulated by the third polypeptide and a nucleotide sequence to be transcribed. Also provided is an eukaryotic expression vector comprising said light-switchable gene expression system, and a method for regulating gene expression in a host cell by using the light-switchable gene expression system. Also provided is a reagent kit containing different elements of the light-switchable gene expression system. The light-switchable gene expression system has a quick, effective and powerful induction with little or no toxicity. It is safer than other inducers, and can spatiotemporally control gene expression.
Claims
1. A light-switchable gene expression system, comprising: a) a gene encoding a photosensitive recombinant light-switchable eukaryotic transcription factor, said recombinant light-switchable eukaryotic transcription factor is one protein including a first polypeptide as DNA-binding domain, a second polypeptide as light-switchable domain and a third polypeptide as transcriptional regulatory domain; b) a target transcription unit, including at least one reaction element recognized/bound by the first polypeptide, a promoter regulated by the third polypeptide and a nucleic acid sequence to be transcribed; wherein said second polypeptide is selected from LOV2 domain of Neurospora crassa VIVID, AsLOV2 domain of oat phytochrome gene 1 and AuLOV domain in Aureochrome1 of Stramenopile algae Vaucheria frigida.
2. The light-switchable gene expression system according to claim 1, wherein said first polypeptide, second polypeptide and third polypeptide were linked each other operatively and/or wherein said reaction element, promoter and nucleic acid sequence to be transcribed were linked each other operatively.
3. The light-switchable gene expression system according to claim 1, wherein said first polypeptide is selected from helix-turn-helix DNA-binding domain, zinc finger motif or zinc cluster DNA-binding domain, leucine zipper DNA-binding domain, winged helix DNA-binding domain, winged helix-turn-helix DNA-binding domain, helix-loop-helix DNA-binding domain, high mobility family DNA-binding domain and B3 DNA-binding domain.
4. The light-switchable gene expression system according to claim 3, wherein said first polypeptide is selected from DNA binding domain of yeast Gal4 protein.
5. The light-switchable gene expression system according to claim 1, wherein said third polypeptide is selected from transcriptional activation domains rich in acidic amino acids, transcriptional activation domains rich in proline, transcriptional activation domains rich in serine/threonine and transcriptional activation domains rich in glutamine, and Kruppel-retated box transcriptional repression domain.
6. The light-switchable gene expression system according to claim 5, wherein the third polypeptide is selected from transcriptional activation domains of the herpes simplex virus VP16 particle protein, transcriptional activation domains of yeast Gal4 protein, transcriptional activation domains of NF-κB p65 subunit, transcriptional activation domains of yeast general control protein 4, and Kruppel-retated box transcriptional repression domain of the zinc finger 354A protein.
7. The light-switchable gene expression system according to claim 1, further comprising a fourth polypeptide, i.e., nuclear localization signal peptide, which can promote the transportation of the recombinant light-switchable transcription factor into the nucleus, said fourth polypeptide links with the first, the second and the third polypeptides directly or via a linker peptide.
8. The light-switchable gene expression system according to claim 1, further comprising a fifth polypeptide regulated by hormones, said fifth polypeptide links with the first, the second and the third polypeptides directly or via a linker peptide.
9. The light-switchable gene expression system according to claim 1, wherein said reaction element is a DNA motif which can be specifically recognized and bound by the first polypeptide.
10. The light-switchable gene expression system according to claim 9, wherein said reaction element is selected from Gal4 binding element.
11. The light-switchable gene expression system according to claim 1, wherein the promoter is selected from the adenovirus late promoter, cytomegalovirus (CMV) minimal promoter, yeast Gal1 gene promoter and SV40 promoter.
12. The light-switchable gene expression system according to claim 1, wherein said first polypeptide and said second polypeptide constitute a light-switchable DNA-binding protein.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
PREFERABLE EMBODIMENTS
(49) The invention will be described in detail by using following examples. These examples are only used for the illustration of the invention without any restriction on the scope of protection. It is not difficult for those skilled in the art to successfully implement the invention on the basis of the examples with some modifications or alternatives. All these modifications or alternatives are within the scope of the attached claims.
(50) Methods, Equipment and Regents Used in the Examples
(51) The methods used in the samples were the routine methods of molecular biology cloning in genetic engineering and cell biology field, such as: Lab Ref: A handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench
written by Roskams, J. et al,
Molecular Cloning: A Laboratory Manual
(the third edition, August in 2002, Science press, Beijing) written by Sambrook J and Russell D W, and translated by Peitang Huang et al.; Chapters in book
Short protocols in Protein Science
(Science press, background) written by Coligan J. E. et al, and translated by Shentao Li et al.
(52) Eukaryotic expression vectors pEGFP-N1, pGADT7 and pGBKT7 were purchased from Clontech; pcDNA3.1 (+)-hygro and pYES2.1 TOPO were purchased from Invitrogen; and pG5luc, pBIND and pACT were purchased from Promega. pcDNA3.1 (+)-hygro and pEGFP-N1, both containing CMV promoter, were used to construct eukaryotic expression vectors that could express target gene in mammalian cells, pcDNA3.1 (+)-hygro had hygromycin resistance while pEGFP-N1 had neomycin resistance. pGADT7 contained the gene of Gal4 transcriptional activation domain, pBIND contained the gene of DNA binding domain of Gal4 from yeast, and pACT contained the gene of VP16 transcriptional activation domain. pG5luc contained Gal4 operon, TATA minimal promoter and firefly luciferase Fluc gene. pIRES-hrGFP (purchased from Stratagene) contained hrGFP gene, pGluc-basic from NEB contained Gluc gene, pTRIPZ from Openbiosystem contained the sequence of SV40 promoter and pCDFDuet1 from Novagen contained LacI gene.
(53) All the primers were synthesized, purified and identified via mass spectrometry by Shanghai Generay Biotech Co. Ltd. All the vectors obtained in the examples were verified via sequencing by BGI Company. Taq DNA polymerase used in the examples was purchased from DongSheng Biotech Company; pfu DNA polymerase was purchased from TianGen Biotech (Beijing) Co. LtD., and PrimeStar DNA polymerase was purchased from TaKaRa. All the three polymerases contained corresponding buffer and dNTP when purchased. Restriction enzyme such as BsrGI, Eco47III, BglII, PstI, HindIII, BamHI, et al., T4 ligase and T4 phosphatase (T4 PNK) were purchased, together with 10×Tango™ buffer, from Fermentas. CloneEZ PCR clone kit was purchased from GenScript (Nanjing). Unless otherwise mentioned, inorganic salt chemical reagents were purchased from Sinopharm Chemical Reagent Co.; Kanamycin, Ampicillin, PNPG, Streptozotocin (STZ) and Dithiothreitol (DTT) were purchased from Ameresco; Flavin adenosine dinucleotide (FAD), ATP and Imidazole were purchased from Alfa; Gluc-detecting kit was purchased from NEB. Potassium Salt of D-Luciferin was purchased from Synchem; EGTA was purchased from BBI; Trizol regent, Trpsin-EDTA, FBS, Lipofectamine2000, L-glutamine, sodium pyruvate, Opti-mem medium, Penicillin/Streptomycin-resistant antibiotics were purchased from Invitrogen; and amino acids was purchased from Sinopharm Chemical Reagent Co. unless mentioned, disposable equipments for cell culture were purchased from Corning. 20 mm diameter dishes for cell culture with glass bottom were purchased from NEST; 384 well white plates for luminescence detection and 384 well black plates for fluorescene detection were purchased from Grenier; and 96 well quadrate plates for cell culture was purchased from GE.
(54) The kit for DNA purification was purchased from BBI (Canada); common plasmid kit was purchased from TianGen Biotech (Beijing) Co. LtD.; transfection grade plasmid kit was purchased from Omega; RNA extraction kit was purchased from TianGen Biotech (Beijing) Co. LtD.; ImpromIIreverse transcription kit was purchased from Promega company; DC protein assay kit was purchased from Bio-rad; E. coli strain Mach1 was purchased from Invitrogen; E. coli strain JM109 was purchased from Promega; E. coli strain BL21(DE3) was purchased from Novagen; and HEK293, COS-7 and NIH3T3 cell lines were purchased from American Type Culture Collection (ATCC). Neurospora crassa was a gift of Bin Chen from School of Resources and Environment Science in Guangxi Normal University. AH109 strain was purchased from Clontech; BY4741 strain was purchased from Openbiosystem Company; Tebufenozide and 4-OHTamxoifen was purchased from Sigma and Mifepristone was purchased from Cayman.
(55) Main equipments: Biotek Synergy 2 multi-mode microplate reader (BioTek, US), X-15Rhigh speed refriger (Beckman, US), Microfuge22Rhigh speed refriger (Beckman, US), PCR Amplifier (Biometra, Germany), In-Vivo Multispectral System FX (Kodak, US), Luminometer (Sanwa, Japan), electrophoresis apparatus (shanghai Biocolor BioScience & Technology Co.), Eclipse Ti inverted microscope system (Nikon, Japan), four-use ultraviolet analyzer (Shanghai Jiapeng Co.), ACCU-CHEK Integra Glucose Meter (Roche).
(56) The meaning of abbreviations: h=hour, min=minute, s=second, μL=microliter, mL=milliliter, L=liter, bp=base pair, mM=millimole, μM=Micromolar.
(57) Some sequences used in the examples were obtained from NCBI (National Center for Biotechnology Information) or official websites or websites of companies selling commercial vectors with corresponding genes. Websites for searching gene sequences are as follows:
(58) Gluc (Gaussia luciferase): (http://www.ncbi.nlm.nih.gov/protein/AAG54095.1);
(59) hrGFP (humanized Renilla Green Fluorescent Protein):
(60) (http://www.ncbi.nlm.nih.gov/nuccore/AY613996.1);
(61) Fluc (firefly luciferase): (http://www.promega.com/vectors/pG5luc.txt);
(62) Gal4: (http://www.ncbi.nlm.nih.gov/nuccore/NC_001148?report=genbank&from=79711&to=82356&strand=true)
(63) VP16 (herpes simplex virus VP16 protein): (http://www.promega.com/vectors/pACT.txt);
(64) NF-κB p65: (http://www.ncbi.nlm.nih.gov/nuccore/23958349?report=GenBank);
(65) VIVID: (http://www.ncbi.nlm.nih.gov/nuccore/AF338412.1);
(66) Phototropin1: (http://www.ncbi.nlm.nih.gov/nucleotide/2754822?report=genbank&log$=nucltop&blast_rank=1&RID=P49RPCAR01S);
(67) Aureochrome1: (http://www.ncbi.nlm.nih.gov/nuccore/AB252504.1);
(68) Gcn4: (http://www.ncbi.nlm.nih.gov/nuccore/NC_001137?report=genbank&from=138918&to=139763&strand=true);
(69) LacI (repressor from Lac operon): (http://www.ncbi.nlm.nih.gov/nuccore/NC000913?report=genbank&from=365652&to=366734&strand=true);
(70) LexA: (http://biocyc.org/ecoli/sequence?type=GENE&object=EG10533);
(71) EYFP (enhanced yellow fluorescent protein): (http://www.ncbi.nlm.nih.gov/protein/37551795);
(72) BmEcR (Bombyx mori ecdysone receptor):
(73) http://www.ncbi.nlm.nih.gov/nucleotide/290560663?report=genbank&log$=nuchop&blast_rank=2&RID=K3Z8WXTW01R;
(74) hPR (human progesterone receptor):
(75) http://www.ncbi.nlm.nih.gov/nucleotide/321117149?report=genbank&log$=nucltop&blast_rank=1&RID=K3ZDKTB901R; and
(76) ER (estrogen receptor):
(77) http://www.ncbi.nlm.nih.gov/nucleotide/170295798?report=genbank&log$=nuchop&blast_rank=1&RID=K3ZPW1MT01R.
(78) Other gene sequences used in the examples were obtained from NCBI (National Center for Biotechnology Information) or Uniprot (Universal Protein Resource), and then were transferred to nucleotide sequences according to the codon preference of each species using software DNA design 2.0. Websites of searching gene sequences are:
(79) cI (repressor of λ operon) (http://www.uniprot.org/uniprot/P03034);
(80) TetR (Tn10 B class) (http://www.uniprot.org/uniprot/P04483); and
(81) mCherry (http://www.ncbi.nlm.nih.gov/nuccore/AY678264.1).
Example 1: Construction of Mammalian Cell Expression Vectors Containing the Recombinant Light-Switchable Transcription Factors Using VP16, p65 or KRAB as the Third Polypeptide
(82) Plasmids construction of this example is shown in
(83) Primers for the amplification of Gal4 gene:
(84) TABLE-US-00001 Forward primer (P1): 5′-CTTTTGGATCCAAGCGCTATGAAGCTACTGTCTTCTATCGAACA-3′ Reverse primer (P2): 5′-AGATCTGGTGGCGATGGATCTTTCCAGTCTTTCTAGCCTTGATT C-3′
(85) Primers for the amplification of VP16 gene:
(86) TABLE-US-00002 Forward primer (P3): 5′-CAGTACCCATACGATGTTCCAGATTACGCTGAATTCCCGGGGATCTC GAC-3′ Reverse primer (P4): 5′-AGAAATTCGAATGTACATGGCGATCCCGGACCC-3′
(87) Primers for the amplification of VIVID gene:
(88) TABLE-US-00003 Forward primer (P5): 5′-AGATCCATCGCCACCAGATCTCATACGCTCTACGCTCCCG-3′ Reverse primer (P6): 5′-TCTGGAACATCGTATGGGTACTGCAGTTCCGTTTCGCACTGGAAA C-3′
(89) Primers for removing introns of VIVID gene:
(90) Removing the first intron:
(91) TABLE-US-00004 Forward primer (P7) 5′-CAATACCACTATGACCCTCGAACCGCGCCC-3′ Reverse primer (P8): 5′-CTGATACGCCTCAACCTCCCATGGGTTCAT-3′
(92) Removing the second intron:
(93) TABLE-US-00005 Forward primer (P9) 5′-ATTCAGATTATGAACAGGCCAAACCCCC-3′ Reverse primer (P10): 5′-CAGATAGCCCATAATGTCATAACCGCCG-3′
(94) For subcloning the recombinant light-switchable transcription factor with p65 transcriptional activation domain as the third polypeptide, total mRNA was extracted from HEK293 cells by using Trizol reagent (Invitrogen) and converted into cDNA by using ImpromII reverse transcriptase (Promega). P65AD of NF-κB P65 gene was amplified by using primers P11 and P12 (see
(95) Primers for the amplification of p65 gene:
(96) TABLE-US-00006 Forward primer (P11): 5′-GAATTCCAGTACCTGCCAGATACAG-3′ Reverse primer (P12): 5'-TGTACATTAGGAGCTGATCTGACTCAGCAG-3′
(97) The artificial KRAB gene with EcoRI and BsrGI sites was synthesized by Generay Company (Shanghai) for subcloning recombinant light-switchable transcription factor with KRAB transcription repression domain as the third polypeptide. P65AD of pGAVP(C71V) described in example 2 was substituted with KRAB gene by double digestion, resulting mammalian cell expression vector named pGAVK(C71V), which contains the fusion protein gene of recombinant light-switchable transcription factor Gal4-VIVID-KRAB (C71V) (GAVK(C71V)) (SEQ. ID. No:57 (polynucleotide) and 58 (polypeptide)).
(98) All the constructs were verified by DNA sequencing. Plasmids were prepared in transfection grade.
Example 2: Construction of Mammalian Cell Expression Vectors Containing the Recombinant Light-Switchable Transcription Factors Using VIVID Mutants or AsLOV2 or AuLOV as the Second Polypeptide
(99) Refer to
(100) Primer sequences was as follows:
(101) TABLE-US-00007 pGAVP (C71V): Forward primer (P13): 5′-GTTGCTCTGATTCTGTGCG-3′ Reverse primer (P14): 5′-TGACGTGTCAACAGGTCCC-3′ pGAVP (Y50W): Forward primer (P15): 5′-GCTGATTCAGATTATGAACAGGC-3′ Reverse primer (P16): 5′-CAGCCCATAATGTCATAACCGC-3′ pGAVP (N56K): Forward primer (P17): 5′-GAGGCCAAACCCCCAAGTAG-3′ Reverse primer (P18): 5′-TTCATAATCTGAATCAGATAGCCC-3′
(102) GAVP (C71V) was constructed firstly and N56K mutation was introduced into VIVID (C71V) of GAVP (C71V) to obtain a double mutant-containing plasmid pGAVP (N56K+C71V) Recombinant light-switchable transcription factor GAVP (C71V), GAVP (N56K), GAVP (N56K+C71V) and GAVP (Y50W) fusion proteins have sequences of polypeptide, SEQ. ID. No: 34, 36, 38, 40, respectively, and the corresponding sequences of polynucleotide are SEQ. ID. No: 33, 35, 37, 39, respectively.
(103) For subcloning the recombinant light-switchable transcription factor with LOV2 domain of phototropin 1 (AsLOV2, a kind gift from Gardner lab, The University of Texas at Dallas) as the second polypeptide, AsLOV2 was PCR amplified using primers 19 and 20 (see
(104) Primers for the amplification of AsLOV2:
(105) TABLE-US-00008 Forward primer (P19): 5′-CTTTAGATCTTTCTTGGCTACTACACTTGAAC-3′ Reverse primer (P20): 5′-CTTTGAATTCACCTGATCCGCCACCAAGTTCTTTTGCCGCCTC-3′
(106) For subcloning the recombinant light-switchable transcription factor with LOV domain of Aureochrome (AuLOV, a kind gift from Hironao Kataoka lab, Ritsumeikan University) as the second polypeptide, AuLOV was PCR amplified by using primers 21 and 22 (see
(107) Primers for the amplification of AuLOV:
(108) TABLE-US-00009 Forward primer (P21): 5′-CTTTAGATCTCAGAATTTTGTGATAACTGAT-3′ Reverse primer (P22): 5′-CTTTGAATTCCACTAGCAACTTGGCGTAATC-3′
Example 3: Construction of Mammalian Cell Expression Vectors Containing the Recombinant Light-Switchable Transcription Factors Using Different Linkers Between the First Polypeptide and Second Polypeptide
(109) Refer to
(110) Primer sequences were as follows:
(111) TABLE-US-00010 pGAVP (WT)-9 Forward primer (P23): 5′-AGATCCATCGCCACCAGATCTCATACGCTCTACGCTCCCG-3′ Reverse primer (P24): 5′-CTTCCAGTCTTTCTAGCCTTGATTC-3′ pGAVP (WT)-11 Forward primer (P25): 5′-AGATCCATCGCCACCAGATCTCATACGCTCTACGCTCCCG-3′ Reverse primer (P26): 5′-GGATCCTCCACCACCTTCCAGTCTTTCTAGCCTTGATTC-3′ pGAVP (WT)-12 Forward primer (P27): 5′-TCATGAACCACAGATCTCATACGCTCTACGCTCCCGGCG-3′ Reverse primer(P28): 5′-CTTTCTGTTTCAGGTCGTTTTCCAGTCTTTCTAGCCTTG-3′
(112) All the constructs were verified by DNA sequencing. Plasmids were prepared in transfection grade.
Example 4: Construction of Mammalian Cell Expression Vectors Containing Transcription Units (with Different Target Gene)
(113) Refer to
(114) Expression vectors containing transcription units having Fluc, green fluorescent protein hrGFP or red fluorescent protein mCherry reporter gene were constructed as follows:
(115) Gluc gene of pU5Gluc vector has HindIII/BamHI restriction site at its two ends. Fluc gene of pG5luc was double digested by HindIII/BamHI and then ligated into pU5Gluc to obtain reporter vector pU5Fluc containing the transcription unit 5×UAS.sub.G-TATA-Fluc with Fluc reporter gene (SEQ. ID. No:86 (polynucleotide)).
(116) Similarly, hrGFP and mCherry genes were amplified from pIRES-hrGFP (Stratagene) and synthesized mCherry gene using primers P29-30 and P31-32, respectively, and inserted into pU5Gluc by HindIII/BamHI double digestion to obtain vectors pU5hrGFP and pU5mCherry, which contain transcription units 5×UAS.sub.G-TATA-hrGFP and 5×UAS.sub.G-TATA-mCherry (SEQ. ID. No:87 (polynucleotide) and SEQ. ID. No:88 (polynucleotide)), respectively.
(117) Primers for the amplification of hrGFP:
(118) TABLE-US-00011 Forward primer (P29): 5′-CTTAAGCTTGCCACCATGGTGAGCAAGCAGATCCTG-3′ Reverse primer (P30): 5′-CAAGGATCCTTACACCCACTCGTGCAGGC-3′
(119) Primers for the amplification of mCherry:
(120) TABLE-US-00012 Forward primer (P31): 5′-CTTAAGCTTGCCACCATGGTGAGCAAGGGCGAG-3′ Reverse primer (P32): 5′-CAAGGATCCCTACTTGTACAGCTCGTCCATG-3′
(121) For constructing expression vector containing the transcription unit with Simian virus 40 (SV40) promoter, SV40 promoter was amplified from pTRIPZ vector (Openbiosystem) using primers 33 and 34, and the obtained SV40 promoter fragment was inserted into pG5luc vector, which was digested with KpnI, by homologous recombination. The resulting vector pSU5Fluc contains the transcription unit with SV40 promoter (SEQ. ID. No:90 (polynucleotide)).
(122) TABLE-US-00013 Forward primer (P33): 5′-TCGATAGGTACCCTGTGGAATGTGTGTCAGTTAGGGT-3′ Reverse primer (P34): 5′-TCCGTCTAGAAACTCGGTACCAGCTTTTTGCAAAAGCCTAGGC-3′
(123) For constructing the expression vector containing the transcription unit with Insulin gene, Insulin gene containing HindIII and BamHI sites at its two ends was synthesized by Shanghai Generay Biotech Co. Ltd. pU5GLuc constructed in this sample was double digested by HindIII/BamHI sites and then the Gluc gene was replaced with Insulin gene, resulting the vector named pU5-Insulin (SEQ. ID. No:137 (polynucleotide), SEQ. ID. No:138 (polypeptide)).
(124) All the constructs were verified by DNA sequencing. Plasmids were prepared in transfection grade.
Example 5: Construction of Saccharomyces cerevisrae Expression Vector Containing the Recombinant Light-Switchable Transcription Factor with Gal4, LexA, cI, TetR or Gcn4 as the First Polypeptide
(125) Plasmids construction of this example is shown in
(126) In the experiment of recombination, primers for removing the multiple clone site and Gal4AD sequence of pGADT7:
(127) TABLE-US-00014 Forward primer (P35): 5′-AGGATCCTGAGCTCGAGCTGCAGATGAATC-3′ Reverse primer (P36): 5′-CATCTTTGCAAAGCTTGGAGTTGATTG-3′
(128) Primers for amplifying Gal4-VIVID (N56K+C71V):
(129) TABLE-US-00015 Forward primer (P37): 5′-AGCTTTGCAAAGATGAAGCTACTGTCTTC-3′ Reverse primer (P38): 5′-CGAGCTCAGGATCCTTCCGTTTCGCACTGG-3′
(130) Gal4AD gene was amplified from pGADT7 (Clontech company) by PCR using primers P39, P40 (containing nucleotide sequences encoding two different lengths of linkers) and P41, the obtained Gal4AD sequences contained two linkers with different lengths and were ligated into pGAD-GV(N56K+C71V) by BamHI/XhoI double digestion, the resulting vectors were named pGAD-GVG-L1(N56K+C71V) and pGAD-GVG-L2(N56K+C71V) containing Gal4-VIVID-Gal4AD-L1 (N56K+C71V) (SEQ. ID. No: 97 (polynucleotide), SEQ. ID. No:98 (polynucleotide)) and Gal4-VIVID-Gal4AD-L2(N56K+C71V) fusion protein genes (SEQ. ID. No:99 (polynucleotide), SEQ. ID. No:100 (polynucleotide)) with two different lengths of linkers, respectively (L1 and L2).
(131) The forward primers for amplifying two Gal4AD sequences with different length of linkers:
(132) TABLE-US-00016 Linker L1 (P39): 5′-CCCGGATCCGGTGGAGGTGGCTCCAATTTTAATCAAAGTGG-3′ Linker L2 (P40): 5′-CCCGGATCCGGTGGAGGTGGCTCCAATTTTAATCAAAGTGG-3′
(133) The common reverse primer (P41):
(134) TABLE-US-00017 5′-GGGCTCGAGTTACTCTTTTTTTGGGTTTGGTG-3′
(135) To obtain pGPMA vector with a stronger promoter PMA1 that can increase the expression level of recombinant transcription factor, pGADT7 was amplified by PCR using primers P42 and P43 to generate the linearized fragment that lost PADH1 promoter sequence. At the meanwhile, PMA1 promoter fragment was amplified from pZF1/2-FRET (a gift from David J. Eide laboratory, University of Wisconsin-Madison, USA) by PCR using primers P44 and P45 and cloned into the linearized pGADT7 vector by recombination to obtain pGPMA. Construction of the following plasmids was based on pGPMA: pGPMA vector was amplified by PCR using primers P46 and P47, and then similarly to construction of pGAD-GV (N56K+C71V), Gal4-VIVID (N56K+C71V) gene fragment was cloned into the linearized pGPMA by recombination, the obtained pGPMA-GV (N56K+C71V) contains fusion protein gene Gal4-VIVID (N56K+C71V), which could be used to construct following yeast expression vectors.
(136) To screen effective linkers for the following experiments, the effects of recombinant light-switchable factors with different linkers were determined. In detailed, Gal4AD was amplified from pGAD-GV (N56K+C71V) by PCR using primers P48-P54 that contain the nucleotide sequences encoding six kinds of linkers with different lengths, and then were ligated into pGPMA-GV(N56K+C71V) vector by BamHI/XhoI double digestion, the resulting vectors that contain fusion proteins Gal4-VIVID-Gal4AD-Ln(N56K+C71V) encoding genes with six kinds of linkers (L1, L2, L3, L4, L5 and L6) were named as pGPMA-GVG-L1 (N56K+C71V), pGPMA-GVG-L2 (N56K+C71V), pGPMA-GVG-L3 (N56K+C71V), pGPMA-GVG-L4 (N56K+C71V), pGPMA-GVG-L5 (N56K+C71V), pGPMA-GVG-L6 (N56K+C71V), respectively. Nucleotide sequences of these recombinant proteins are SEQ. ID. No:97, SEQ. ID. No:99, SEQ. ID. No:101, SEQ. ID. No:103, SEQ. ID. No:105 and SEQ. ID. No:107; Amino acid sequences were SEQ. ID. No:98, SEQ. ID. No:100, SEQ. ID. No:102, SEQ. ID. No:104, SEQ. ID. No:106 and SEQ. ID. No:108.
(137) Primers for linearizing pGADT7 by PCR amplification:
(138) TABLE-US-00018 Forward primer (P42): 5′-AGCTTTGCAAAGATGGCCATGGAGGCCAGTGA-3′ Reverse primer (P43): 5′-CATGCAAGCAACGAAGCATCTGTGCTTCATTTTG-3′
(139) Primers for amplifying PMA1 promoter:
(140) TABLE-US-00019 Forward primer (P44): 5′-TTCGTTGCTTGCATGGCCAAGCTTCCTGAAAC-3′ Reverse primer (P45): 5′-CATCTTTGCAAAGCTGCTGGGGTATATTTTTTTTC-3′
(141) Primers for linearizing pGPMA by PCR amplification:
(142) TABLE-US-00020 Forward primer (P46): 5′-AGGATCCTGAGCTCGAGCTGCAGATGAATC-3′ Reverse primer (P47): 5′-CATCTTTGCAAAGCTGCTGGGGT-3′
(143) Forward primers for amplifying Gal4AD with six kinds of length of linkers:
(144) TABLE-US-00021 Linker L1 (P48): 5′-CCCGGATCCGGTGGAGGTGGCTCCAATTTTAATCAAAGTGG-3′ Linker L2 (P49): 5′-CCCGGATCCGGCGGTGGTGGATCAGGTGGAGGTGGCTCCAAT-3′ Linker L3 (P50): 5′-CCCGGATCCGGTGGATCAGGTGGAGG-3′ Linker L4 (P51): 5′-CCCGGATCCGGAAGCGGCGGTGGTGGATCAGG-3′ Linker L5 (P52): 5′-CCCGGATCCGGTGGCGGCGGAAGCGGCGGTGGTG-3′ Linker L6 (P53): 5′-CCCGGATCCGGCGGAGGTGGGGGCTCCGGTGGCGGCGGAAG-3′
(145) The common reverse primer (P54) is:
(146) TABLE-US-00022 5′-GGGCTCGAGTTACTCTTTTTTTGGGTTTGGTG-3′
(147) To construct yeast expression vector that contains recombinant light-switchable transcription factor NLS-LexA-VIVID-Gal4AD (N56K+C71V) (abbreviated to NLVG (N56K+C71V)) with LexA as the first peptide, LexA (1-87) was amplified from the genome of E. coli strain BL21 by PCR using primers P55 and P56 (see
(148) Primers for amplifying LexA (1-87):
(149) TABLE-US-00023 Forward primer (P55): 5′-GGTGGCTCTGGAGGCATGAAAGCGTTAACGGCCAGGC-3′ Reverse primer (P56): 5′-AGATCTCGGTTCACCGGCAGCCACACG-3′
(150) Primers for amplifying VIVID (N56K+C71V):
(151) TABLE-US-00024 Forward primer (P57): 5′-GGTGAACCGAGATCTCATACGCTCTACGCTCCC-3′ Reverse primer (P58): 5′-CGAGCTCAGGATCCTTCCGTTTCGCACTGG-3′
(152) Primers for amplifying NLS:
(153) TABLE-US-00025 Forward primer (P59): 5′-CCCGAATTCTGCAAAGATGGATAAAGCGGAATTAATTCC-3′ Reverse primer (P60): 5′-GCCTCCAGAGCCACCACCGGCGGCGGTACCC-3′
(154) Primers for linearizing pGPMA-GVG-L2 (N56K+C71V) by PCR amplification:
(155) TABLE-US-00026 Forward primer (P61): 5′-CCCGGATCCGGCGGTGGTGGATCAGG-3′ Reverse primer (P62): 5′-CCCGAATTCGCTGGGGTATATTTTTTTTC-3′
(156) To construct yeast expression vector that contains recombinant light-switchable transcription factor NLS-LacI-VIVID-Gal4AD (N56K+C71V) (abbreviated to NLcVG (N56K+C71V)) with LacI as the first polypeptide, DNA binding domain of LacI (1-62 amino acid) was amplified from commercial vector pCDFDuet1 (Novagen) by PCR using primers P63 and P64 (see
(157) Primers for amplifying the DNA binding domain of LacI:
(158) TABLE-US-00027 Forward primer (P63): 5′-GGCTCTGGAGGCATGAAACCAGTAACGTTATAC-3′ Reverse primer (P64): 5′-CCCAGATCTCAACGACTGTTTGCCCGCC-3′
(159) Primers for amplifying NLS:
(160) TABLE-US-00028 Forward primer (P65): 5′-CCCGAATTCATGGATAAAGCGGAATTAATTCC-3′ Reverse primer (P66): 5′-CCTCCAGAGCCACCGAACCGGCGGCGGTACCC-3′
(161) To construct yeast expression vector that contains recombinant light-switchable transcription factor NLS-cI-VIVID-Gal4AD(N56K+C71V) with cI as the first peptide, DNA binding domain of cI(1-102 amino acid) was synthesized by Shanghai Generay Biotech Co. Ltd. and amplified by PCR using primers P67 and P68 (see
(162) Primers for amplifying the DNA binding domain of cI:
(163) TABLE-US-00029 Forward primer (P67): 5′-GGTGGCTCTGGAGGCATGTCTACCAAGAAGAAAC-3′ Reverse primer (P68): 5′-CCCAGATCTATATTCTGACCTCAAAGACG-3′
(164) Primers for amplifying NLS:
(165) TABLE-US-00030 Forward primer (P69): 5′-CCCGAATTCTGCAAAGATGGATAAAGCGGAATTAATTCC-3′ Reverse primer (P70): 5′-GCCTCCAGAGCCACCACCGGCGGCGGTACCC-3′
(166) To construct yeast expression vector containing the recombinant light-switchable transcription factor NLS-TetR-VIVID-Gal4AD (N56K+C71V) (abbreviated to NTVG (N56K+C71V)) with TetR as the first peptide, DNA binding domain of TetR (1-63 amino acid) synthesized by Shanghai Generay Biotech Co. Ltd. was amplified by PCR using primers P71 and P72 (see
(167) Primers for amplifying the DNA binding domain of TetR:
(168) TABLE-US-00031 Forward primer (P71): 5′-GGTGGCTCTGGAGGCATGTCTAGGCTAGATAAG-3′ Reverse primer (P72): 5′-CCCAGATCTGGTGCCGTGTCTATCCAGCATCTC-3′
(169) Primers for amplifying NLS:
(170) TABLE-US-00032 Forward primer (P73): 5′-CCCGAATTCTGCAAAGATGGATAAAGCGGAATTAATTCC-3′ Reverse primer (P74): 5′-GCCTCCAGAGCCACCACCGGCGGCGGTACCC-3′
(171) All the constructs were verified by DNA sequencing. Plasmids were prepared for the following yeast transformation.
Example 6: Construction of Saccharomyces cerevisiae Expression Vectors Containing the Genes of Recombinant Light-Switchable Transcription Factors with VIVID Mutants or AsLOV2 as the Second Polypeptides
(172) Refer to
(173) Primers for amplifying VIVID or its mutants:
(174) TABLE-US-00033 Forward primer (P75): 5′-GGGAGATCTCATACGCTCTACGCTCCCG-3′ Reverse primer (P76): 5′-CGAGCTCAGGATCCTTCCGTTTCGCACTGG-3′
(175) To construct yeast expression vector containing the gene of recombinant light-switchable transcription factor Gal4-AsLOV2-Gal4AD (abbreviated to GLG) with AsLOV2 as the second polypeptide, pGPMA-GVG-L2(N56K+C71V) vector described in example 6 was double digested by BglII/BamHI to remove the VIVID(N56K+C71V) gene fragment, AsLOV2 gene was amplified from pGALP described in example 2 by PCR using primers P77 and P78 and ligated with pGPMA-GVG-L2(N56K+C71V) whose VIVID(N56K+C71V) gene fragment has been removed, the obtained expression vector was named as pGPMA-GLG containing the gene of recombinant light-switchable transcription factor GLG (SEQ. ID. No:119 (polynucleotide) and 120 (polypeptide)).
(176) Primers for amplifying AsLOV2:
(177) TABLE-US-00034 Forward primer (P77): 5′-CCCAGATCTTTCTTGGCTACTACACTT-3′ Reverse primer (P78): 5′-CCCGGATCCAAGTTCTTTTGCCGCCTC-3′
(178) All the constructs were verified by DNA sequencing. Plasmids were prepared for the following yeast transformation.
Example 7: Construction of Saccharomyces cerevisiae Expression Vectors Containing the Gene of Recombinant Light-Switchable Transcription Factor with VP16 or Gcn4 as the Third Polypeptide
(179) Plasmids construction of this example is shown in
(180) Primers for amplifying VIVID-VP16 (N56K+C71V):
(181) TABLE-US-00035 Forward primer (P79): 5′-GGGAGATCTCATACGCTCTACGCTCCCG-3′ Reverse primer (P80): 5′-GGGCTCGAGTGGCGATCCCGGACCCGGG-3′
(182) To construct yeast expression vector containing the gene of recombinant light-switchable transcription factor Gal4-VIVID-Gcn4 (N56K+C71V) (abbreviated to GVGc(N56K+C71V)) with Gcn4 as the third polypeptide, the gene fragment of Gcn4 transcriptional activation domain was amplified from the genome of yeast strain BY4741 by PCR using primers P81 and P82 (see
(183) Primers for amplifying Gcn4:
(184) TABLE-US-00036 Forward primer (P81): 5′-CCCGAATTCATGTCCGAATATCAGCCAAGT-3′ Reverse primer (P82): 5′-GGGCTCGAGTTAGGATTCAATTGCCTTATC-3′
(185) Primers for amplifying pGPMA-GVG-L2 (N56K+C71V):
(186) TABLE-US-00037 Forward primer (P83): 5′-AGGATCCTGAGCTCGAGCTGCAGATGAATC-3′ Reverse primer (P84): 5′-CCCGAATTCGGAGCCACCTCCACCTGATCCAC-3′
(187) All the constructs were verified by DNA sequencing. Plasmids were prepared for the following yeast transformation.
Example 8: Construction of Saccharomyces cerevisiae Expression Vectors Containing Target Transcription Units with the Reaction Elements of Gal4, LexA, CI, TetR or Gcn4
(188) Plasmid construction of this example is shown in
(189) Primers for linearizing pYES2.1 TOPO by PCR amplification:
(190) TABLE-US-00038 Forward primer (P85): 5′-CCCGAATTCAGGGCGAGCTTCGAGGTCACC-3′ Reverse primer (P86): 5′-CCCGGATCCGGGCGAGCTTAATATTCCCTATAG-3′
(191) Primers for amplifying EYFP:
(192) TABLE-US-00039 Forward primer (P87): 5′-CCCGGATCCAAAAAAATGGTGAGTAAAGGAG-3′ Reverse primer (P88): 5′-GGGGAATTCTTATTTGTATAGTTCATC-3′
(193) To detect the effects of target transcription units with different number of Gal4 reaction elements on the recombinant light-switchable transcription factor regulated EYFP gene transcription, yeast expression vectors containing target transcription units with different number of Gal4 reaction elements were constructed. pYE-EYFP constructed in this example contains five Gal4 reaction elements, i.e. 5×UAS.sub.G. pYE-EYFP was amplified by PCR using primers P89-P92, the obtained three pYE-EYFP vectors lacked one, two or four Gal4 recognition/binding sites in the target transcription unit, and were named as pYE-EYFP(1×UAS.sub.G), pYE-EYFP(3×UAS.sub.G) or pYE-EYFP(4×UAS.sub.G) containing the transcription unit 1×UAS.sub.G-Gal1-EYFP (SEQ. ID. No:122 (polynucleotide)), 3×UAS.sub.G-Gal1-EYFP (SEQ. ID. No: 123 (polynucleotide)) and 4×UAS.sub.G-Gal1-EYFP (SEQ. ID. No:124 (polynucleotide)), respectively. The forward primers for amplification are different, while the reverse primers are the same, their sequences are as following:
(194) TABLE-US-00040 Common reverse primer (P89): 5′-TACTAGTGGATCATCCCCACGCGCC-3′ Forward primer 1(90): 5′-CCCGAATTCAGGGCGAGCTTCGAGGTCACC-3′ Forward primer 2(P91): 5′-CCCGAATTCAGGGCGAGCTTCGAGGTCACC-3′ Forward primer 3(P92): 5′-CCCGAATTCAGGGCGAGCTTCGAGGTCACC-3′
(195) To detect the effect of recombinant light-switchable transcription factor with LexA as the first polypeptide, Saccharomyces cerevisiae expression vector containing target transcription unit with the LexA reaction element was constructed. pYE-EYFP in this example was amplified by PCR using primers P93 and P94 to remove the 5×UAS.sub.G sequence, the linearized vector was double digested by XhoI/HindIII sites and ligated with the fragment from the annealing product of primers P95 and P96. The resulting vector was named as pYEL4-EYFP containing the target transcription unit 4×LexA UAS-Gal1-EYFP (SEQ. ID. No:125 (polynucleotide)).
(196) Primers for linearizing pYE-EYFP by PCR amplification:
(197) TABLE-US-00041 Forward primer (P93): 5′-CCCAAGCTTTAATGCGATTAGTTTTTTAG-3′ Reverse primer (P94): 5′-TAGGCTCGAGCCCACGCGCCCTGTAGCGC-3′
(198) Primers for annealing:
(199) TABLE-US-00042 Forward primer (P95): 5′-TCGAGGGCGTTCGTCCTCACTGTATGATCATACAGTCTGTATATAT ATACAGTACTGTATGATCATACAGGTTCCTGAAACGCAGATGTGCCTAC TGTATATATATACAGTAACAATAAAGATTCA-3′ Reverse primer (P96): 5′-AGCTTGAATCTTTATTGTTACTGTATATATATACAGTAGGCACATC TGCGTTTCAGGAACCTGTATGATCATACAGTACTGTATATATATACAGA CTGTATGATCATACAGTGAGGACGAACGCCC-3′
(200) To detect the effect of recombinant light-switchable transcription factor with LacI as the first polypeptide, Saccharomyces cerevisiae expression vector containing target transcription unit with the LacI reaction element was constructed. pYEL4-EYFP in this example was double digested by XhoI/HindIII sites and ligated with the fragment from the annealing product of primers P97 and P98, the resulting vector was named as pYELc4-EYFP that contains the target transcription unit 4×LacI UAS-Gal1-EYFP (SEQ. ID. No: 126 (polynucleotide)).
(201) Primers for annealing:
(202) TABLE-US-00043 Forward primer (P97): 5′-TCGAGAATTGTGAGCGGATAACAATTGTAATTGTGAGCGGATAACA ATTATTTGAATTGTGAGCGGATAACAATTGTAATTGTGAGCGGATAACA ATTA-3′ Reverse primer (P98): 5′-AGCTTAATTGTTATCCGCTCACAATTACAATTGTTATCCGCTCACA ATTCAAATAATTGTTATCCGCTCACAATTACAATTGTTATCCGCTCACA ATTC-3′
(203) To detect the effect of recombinant light-switchable transcription factor with cI as the first polypeptide of cI, Saccharomyces cerevisiae expression vector containing target transcription unit with the cI reaction element was constructed. pYEL4-EYFP in this example was double digested by XhoI/HindIII sites and ligated with the fragment from the annealing product of primers P99 and P100, the resulting vector was named as pYEP.sub.R-EYFP that contains the target transcription unit P.sub.RUAS-Gal1-EYFP (SEQ. ID. No:127 (polynucleotide)).
(204) Primers for annealing:
(205) TABLE-US-00044 Forward primer (P99): 5′-TCGAGTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCG TGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGA-3′ Reverse primer (P100): 5′-AGCTTCAACCATTATCACCGCCAGAGGTAAAATAGTCAACACGC ACGGTGTTAGATATTTATCCCTTGCGGTGATAGATTTAC-3′
(206) To detect the effect of recombinant light-switchable transcription factor with TetR as the first polypeptide, Saccharomyces cerevisiae expression vector containing target transcription unit with the TetR reaction element was constructed. pYEL4-EYFP in this example was double digested by XhoI/HindIII sites and ligated with the fragment from the annealing product of primers P101 and P102, the resulting vector was named as pYET4-EYFP that contains the transcription unit 4×TetR UAS-Gal1-EYFP (SEQ. ID. No:128 (polynucleotide)).
(207) Primers for annealing:
(208) TABLE-US-00045 Forward primer (P101): 5′-TCGAGCCACTCCCTATCAGTGATAGAGAAAAGTCCACTCCCTATCA GTGATAGAGAAAAGTCCACTCCCTATCAGTGATAGAGAAAAGTCCACTC CCTATCAGTGATAGAGAAAAGTA-3′ Reverse primer (P102): 5′-AGCTTACTTTTCTCTATCACTGATAGGGAGTGGACTTTTCTCTATC ACTGATAGGGAGTGGACTTTTCTCTATCACTGATAGGGAGTGGACTTTT CTCTATCACTGATAGGGAGTGGC-3′
Example 9: Construction of Mammalian Cell Expression Vectors Containing Recombinant Hormone and Light Dual-Regulated Transcription Factors with Different Fifth Polypeptides
(209) Refer to
(210) Primer sequences were as following:
(211) TABLE-US-00046 pGAVPEcR: Forward primer (P103): GACTACGCGTATGAGGCCTGAATGTGTCATACAG Reverse primer (P104): GACTACTAGTTAGCACCACCGGGTTGGTG pGAVPER: Forward primer (P105): GACTACGCGTTCTGCTGGAGACATGAGAGCTG Reverse primer (P106): GACTACTAGTAGCTGTGGCAGGGAAACCC pGAVPhPR: Forward primer (P107): GACTACGCGTAAAAAGTTCAATAAAGTCAGAGTTGTG Reverse primer (P108): GACTACTAGTAGCAATAACTTCAGACATCATTTCTG
Example 10: Regulation of Gene Expression by Recombinant Light-Switchable Transcription Factor in Mammalian Cells
(212) All of cell lines used in this example were cultured in CO.sub.2 incubator in DMEM containing 10% fetal bovine serum (FBS) and penicillin-streptomycin, and subcultured when cell density reach 80-90% confluence. Transfection was carried out by following the Lipofectamine 2000 manual. Fluc assay was carried out refer to “Molecular biology experiment reference manual” (Jane Roskams); Gluc activity was determined by using BioLux® Gaussia Luciferase Assay Kit (NEB) according to the manufacturer's instruction. Sample 11, 13, 14 and 15 also utilized the same experiment methods.
(213) Fluc was used as the reporter gene to test light-regulated gene expression by recombinant light-switchable transcription factor with VIVID and its mutants as the second polypeptide. HEK293 cells with 90-95% density were seeded into two identical 48 well plates 16 h before transfection, pU5Fluc described in sample 4 with pGAVV(WT) or pGAVP(WT) or pGAVP(C71V) or pGAVP(Y50W) or pGAVP(N56K) or pGAVP(C71V+N56K) or pEGFP-N1 described in sample 2 was co-transfected into HEK293 cells, manipulation of the two plates was the same. Then one plate was cultured in darkness, while the other was illuminated for 1 s every 30 s 6 h after transfection, the light source was blue LED above mentioned, Fluc activity was determined 22 h after illumination. The result showed that Fluc activity of cells without recombinant light-switchable transcription factor and dark group cells with light-switchable transcription factor almost equaled to untransfected cells, while light group cells expressing these recombinant light-switchable transcription factors showed higher Fluc expression than dark group, which indicated that these light-switchable transcription factors could regulate the target gene expression level in cells. In detailed, the target gene expression in cells expressing GAVP(WT) after illumination was 13-fold greater than the dark group; light-regulated Fluc expression level mediated by GAVP(WT) was dozen of times than GAVV(WT), indicating GAVP(WT) transcription factor with p65AD as the third polypeptide had stronger induction capacity (
(214) The system in the invention can be applied to a variety of mammalian cells. Fluc was used as the reporter gene, pGAVP(N56K+C71V) and pU5Fluc vectors were co-transfected into NIH3T3 or COS-7 cell lines, cells culture, transfection, blue light induction, cell manipulation and determination of the expressed Fluc were the same as the description in the first paragraph of this example. The result indicated that the cell expressing GAVP (N56K+C71V) could activate the target gene (Flue) expression after light irradiation in NIH3T3 or COS-7 cell lines (
(215) To detect the regulation of gene expression by recombinant light-switchable transcription factor with AsLOV2 as the second polypeptide in mammalian cells, Fluc was used as the reporter gene to detect the regulation of gene expression by the recombinant light-switchable transcription factor Gal4-AsLOV2-p65 (abbreviated to GALP). pU5Fluc with pGALP constructed in sample 2 were co-transfect into HEK293, cells culture, transfection, blue light induction, cell manipulation and determination of the expressed Fluc were the same as the description in the first paragraph of this example. The result showed that Fluc expression of light group was lower that dark group, which was approximately half of the dark group, indicating that the recombinant light-switchable transcription factor GALP could decrease the target gene expression after light illumination (
(216) To detect the regulation of gene expression by recombinant light-switchable transcription factor with AuLOV as the second polypeptide in mammalian cells, Fluc was used as the reporter gene to detect the regulation of gene expression by the recombinant light-switchable transcription factor Gal4-AuLOV-p65 (abbreviated to GAAP). pU5Fluc with pGAAP constructed in sample 2 were co-transfect into HEK293, cells culture, transfection, blue light induction, cell manipulation and determination of the expressed Fluc were the same as the description in the first paragraph of this example. The result showed that Fluc gene expression of light group was higher that dark group, indicating that the recombinant light-switchable transcription factor GAAP could increase the target gene expression after light illumination (
(217) To detect the regulation of gene expression by recombinant light-switchable transcription factor with KRAB as the third polypeptide in mammalian cells, the effect of recombinant light-switchable transcription factor GAVK (C71V) on gene expression upon light exposure was detected. pU5Fluc vector constructed in sample 4 and pGAVK (C71V) vector constructed in sample 1 were co-transfected into HEK293 cells, cells culture, transfection, blue light induction, cell manipulation and determination of the expressed Fluc were the same as the description in the first paragraph of this example. The result indicated that the recombinant light-switchable transcription factor GAVK (C71V) could decrease Fluc expression level after light illumination (
Example 11: Regulation of Gene Expression by Recombinant Light-Switchable Transactivation Factor in Stable Cell Line
(218) To establish stable cell line expressing light-switchable transcription factor GAVP (C71V), pGAVP(C71V) vector described in example 2 was transfected into HEK293 cells, cells were and seeded into 100 mm dish 48 h after transfection. 24 h later, media was refreshed using medium with additional 600 μg/mL G418 and repeated every two days in the following 3 weeks. After that, 10 monoclonal cell lines were selected by serial dilution in the survival cells. These monoclonal cell lines were seeded into 48 well plate, and transfected with pU5Fluc vector constructed in sample 4 to detect whether these cell lines expressed the recombinant light-switchable transcription factor, if yes, cells could express Fluc gene after light illumination. Blue light induction, cell manipulation and determination of the expressed Fluc were the same as sample 10. The result showed that, clone 2, 4, 5, 6, 9 contained the recombinant light-switchable transcription factor; clone 2 showed the highest Fluc expression level after illumination, the induction ratio was approximate 30-fold which was similar to transient transfection of the recombinant light-switchable transcription factor. These results indicated that the recombinant light-switchable transcription factor gene integrated into the genome could regulate the expression level of target gene (
Example 12: Regulation of Gene Expression by Recombinant Light-Switchable Transcription Factors in Saccharomyces cerevisiae Cells
(219) Protocol for the detection of fluorescent protein EYFP expressed by yeast cells: clones on the transformed plate were picked and incubated at 240 rpm and 30° C. in incubator shakers under darkness. 500 μl of the overnight cultured cells was diluted into two tubes with 4.5 mL fresh YPDA medium, one was illuminated by blue light exposure while the other was kept in darkness, the cells were kept at 240 rpm and 30° C. until the OD600 reached 0.8-1.0. 500 μl of the cultured cells was harvested in 1.5 mL tube and centrifuged at 4000 rpm for 5 min, then the supernatant was discarded and cells were washed with 1 mL PBS for twice. The cells were suspended to the OD600 around 0.5 using PBS. (Ensure the accuracy of the fluorescence determination). 100 μl of the supernatant was added to the 96-well black plate, the fluorescence was measured by Synergy 2 multi-mode microplate reader (BioTek) with excitation wavelength of 485±20 nm and emission wavelength of 528±20 nm. Each data point represents the average of 3 replicates. To detect the effect of recombinant light-switchable transcription factor GVG-L2 (N56K+C71V) constructed in sample 5 on regulation of gene expression in yeast cells, the effect of GVG-L2 (N56K+C71V) on the expression of EYFP upon blue light exposure was measured. pGPMA-GVG-L2(N56K+C71V) constructed in example 5 and pYE-EYFP constructed in example 8 were co-transformed into AH109 strain, co-transformation of empty pGPMA vector and pYE-EYFP into AH109 cell was used as the control. The EYFP fluorescence of the cells upon blue light exposure or under darkness was measured; the result indicated that the recombinant light-switchable transcription factor GVG-L2 (N56K+C71V) could increase the expression level of EYFP in AH109 cells upon blue light exposure (
(220) To detect the effect of recombinant light-switchable transcription factor GVVP (N56K+C71V) on the regulation of gene expression in yeast cells, the effect of GVVP (N56K+C71V) described in example 7 on the expression of EYFP upon blue light exposure was measured. pGPMA-GVVP (N56K+C71V) described in example 7 and pYE-EYFP described in example 8 were co-transformed into AH109 strain, co-transformation of empty pGPMA vector and pYE-EYFP into AH109 cell was used as the control. The EYFP fluorescence of the cells upon blue light exposure or under darkness was measured. The result showed that the recombinant light-switchable transcription factor GVVP (N56K+C71V could effectively increase the expression level of EYFP in AH109 cells upon blue light exposure (
(221) To detect the effect of recombinant light-switchable transcription factor GVGc (N56K+C71V) on the regulation of gene expression in yeast cells, the effect of GVGc (N56K+C71V) described in example 7 on the expression of LacZ upon blue light exposure was measured. pGPMA-GVGc (N56K+C71V) described in example 7 was transformed into AH109 strain, transformation of empty pGPMA vector into AH109 cell was used as the control. The expression level of LacZ of the cells upon blue light exposure or under darkness was measured according to the Yeast protocols handbook
from Clontech Company. The result indicated that the recombinant light-switchable transcription factor GVGc (N56K+C71V) effectively increased the expression level of LacZ in AH109 cells, the induction ratio could reach nearly 10 folds (
(222) To detect the effects of recombinant light-switchable transcription factor GVG(N56K+C17V) containing different linkers on the regulation of gene expression in yeast cells, pGPMA-GVG-L1 (N56K+C71V), pGPMA-GVG-L2 (N56K+C71V), pGPMA-GVG-L3 (N56K+C71V), pGPMA-GVG-L4 (N56K+C71V), pGPMA-GVG-L5 (N56K+C71V) or pGPMA-GVG-L6 (N56K+C71V) was transformed into AH109 strain, transformation of empty pGPMA vector into AH109 cell was used as the control. The expression level of LacZ of the cells upon blue light exposure or under darkness was measured. The results showed that all the recombinant light-switchable factor GVG(N56K+C17V) with different linkers could regulate the LacZ expression but had different expression level of LacZ, recombinant light-switchable factors with linker L1, L3 and L6 had the higher expression level of LacZ, i.e. they had the highest activation capacity after light illumination. (
(223) To detect the effects of different expression levels of recombinant light-switchable transcription factor Gal4-VIVID-Gal4AD on the regulation of gene expression in yeast cells, pGAD-GVG-L1 (N56K+C71V), pGAD-GVG-L2 (N56K+C71V), pGPMA-GVG-L1 (N56K+C71V) or pGPMA-GVG-L2 (N56K+C71V) was co-transformed with pYE-EYFP described in example 8 into AH109 strain, The EYFP fluorescence of the cells upon blue light exposure or under darkness was measured. The EYFP expression level regulated by Gal4-VIVID-Gal4AD under PMA1 promoter was higher than ADH1 promoter probably due to that PMA promoter had stronger initiation capacity than ADH1 promoter. The result indicated more Gal4-VIVID-Gal4AD resulted in higher expression level of EYFP in AH109 cells at the same conditions (
(224) To detect the effects of the recombinant light-switchable transcription factors Gal4-VIVID-Gal4AD with VIVID mutants on the regulation of gene expression in yeast cells, pGPMA-GVG (WT), pGPMA-GVG(C71V) or pGPMA-GVG(Y50W) was co-transformed with pYE-EYFP described in example 8 into AH109 cells, co-transformation of empty pGPMA vector and pYE-EYFP into AH109 cell was used as the control. The EYFP fluorescence of the cells upon blue light exposure or under darkness was measured. The results showed that all the recombinant light-switchable transcription factors Gal4-VIVID-Gal4AD with different VIVID mutants we tested could increase the expression level of EYFP (
(225) To detect the effect of the recombinant light-switchable transcription factor GLG on the regulation of gene expression in yeast cells, pGPMA-GLG described in example 6 was transformed into AH109 strain, transformation of empty pGPMA vector into AH109 cell was used as the control. The expression level of LacZ of the cells upon blue light exposure or under darkness was measured. The result demonstrated that GLG could decrease the expression level of LacZ in AH109 cells; the induction ratio was about 0.8 fold (
(226) To detect the effects of recombinant light-switchable transcription factor on the regulation of EYFP expression when the target transcription unit contained different number of Gal4 reaction element, pYE-EYFP(1×UAS.sub.G), pYE-EYFP(3×UAS.sub.G), pYE-EYFP(4×UAS.sub.G) or pYE-EYFP were co-transformed with pGPMA-GVG(N56K+C71V) described in example 5 into BY4741 strain. The EYFP fluorescence of the cells upon blue light exposure or under darkness was measured. The result indicated that the EYFP expression level decreased along with the reduced number of Gal4 recognition elements at the same conditions, but the induction ratio remained almost the same (
(227) To detect the effects of recombinant light-switchable transcription factors NLVG(N56K+C71V), NLcVG(N56K+C71V), NCVG(N56K+C71V) or NTVG(N56K+C71V) on the regulation of gene expression in yeast cells, pGPMA-NLVG(N56K+C71V), pGPMA-NLcVG(N56K+C71V), pGPMA-NCVG(N56K+C71V) or pGPMA-NTVG(N56K+C71V) were co-transformed with pYEL4-EYFP, pYELc4-EYFP, pYEP.sub.R-EYFP or pYET4-EYFP into AH109 cells, respectively. The EYFP fluorescence of the cells upon blue light exposure or under darkness was measured. The result showed that all the four recombinant light-switchable transcription factors could increase the expression level of EYFP after blue light illumination while NLVG (N56K+C71V) had the highest induction ratio (
Example 13: Characteristics of Gene Expression Regulation by the Recombinant Light-Switchable Transcription Factor Upon Light Illumination
(228) Time course and reversibility of light-switchable transcription factor regulated gene expression were tested by co-transfection of pGAVP (N56K+C71V) constructed in sample 2 and pU5Gluc constructed in sample 4 into HEK293 cells, cells were seeded into 3 plates and their culture and transfection were the same. Two of the three plates were given illumination 10 h after transfection for 1 s every 30 s, and one of the two plates was transferred to darkness 15 h after illumination for reversibility study. The last one was kept in dark all the time as dark group sample. Samples were collected for Gluc assay at indicated time under red LED light according to sample 11. The result showed that Gluc expression level increased significantly after light illumination in recombinant light-switchable transcription factor GAVP (N56K+C71V) expressing cells. The induction ratio could achieve 30-fold, 100-fold after 3 h, 12 h illumination, respectively. For the reversibility sample (light-dark), Gluc expression gradually decreased and stopped 15 h after turning the light off (
(229) To evaluate the gene expression regulated by light-switchable transcription factor in different light irradiance, pGAVP (N56K+C71V) constructed in sample 3 and pU5Fluc vector were co-transfected into HEK293 cells, the cells were divided into two plates, cell sample at the same conditions had three replicates, one plate was illuminated 6 h after transfection for 1 s every 30 s, neutral density filters were used to adjust the light intensity (Light intensity determine by a laminator (Sanwa)). 22 h after illumination, the cells were lysed and Fluc activity was determined. The result showed that recombinant light-switchable transcription factor GAVP(N56K+C71V) induced Fluc expression level depended on light intensity, demonstrating that gene expression level regulated by the recombinant light-switchable transcription factor in this invention depended on light intensity (
(230) To evaluate the gene expression regulated by light-switchable transcription factor in different illumination frequencies, pGAVP (N56K+C71V) vector and pU5Fluc vector were co-transfected into HEK293 cells, the cells were divided into three plates, cell sample at the same conditions had three replicates. Cells were illuminated 6 h after transfection for 1 s every 30 s, 1 s every 60 s, 1 s every 120 s, respectively. 22 h after illumination, the cells were lysed and Fluc activity was determined. The result showed that Fluc activity was the highest when illuminated is every 30 s and was the lowest when illuminated 1 s every 120 s, indicating that higher frequency of light illumination could result in higher gene expression level when the light intensity was the same (
(231) To observe recombinant light-switchable transcription factor regulated gene expression, mCherry and hrGFP were used as the reporter genes, pGAVP (N56K+C71V) and pU5mCherry or pU5hrGFP were co-transfected into HEK293 cells. 10 h after transfection, cells were illuminated for 20 s every 10 min. 24 h later, images were taken using an Eclipse Ti inverted microscope system (Nikon). The results were shown in Short protocols in Protein Science
written by Coligan J. E. et al, and translated by Shentao Li et al, page 303-307. The result was shown in
(232) Transcription level of recombinant light-switchable transcription factor induced gene transcription was evaluated by RT-PCR (reverse transcriptional PCR). pGAVP (N56K+C71V) constructed in sample 2 and pU5Fluc constructed in sample 4 were co-transfected into HEK293 cells in 24 well plates, cell culture, transfection and induction method were the same as described in example 10. Total RNA of these samples was extracted using RNA isolation kit according to the instructions (Tiangen). RNA concentration was determined and 0.5 μg RNA was reverse transcripted into cDNA using ImpromII reverse transcriptase. Refer to P109 and P110 for primers for Flue, and refer to P111 and P112 for primers for internal reference gene actin. Approach of RT-PCR was the same as routine PCR using Taq DNA polymerase with 1 kb/min for 28 cycles. The result showed that no visible band was observed when cells transfected with pU5Fluc or pGAVP (N56K+C71V) alone, and a bright band existed in co-transfection and light irradiation cells but only a faint band in dark cells, indicating that recombinant light-switchable transcription factor GAVP (N56K+C71V) could activate gene transcription after light illumination, there was significant difference between samples kept in darkness and in light (
(233) RT-PCR primer for Flue gene:
(234) TABLE-US-00047 Forward primer (P109): 5′-GAGATACGCCCTGGTTCCTG-3′ Reverse primer (P110): 5′-CGAAATGCCCATACTGTTGAG-3′
(235) RT-PCR primer for Actin gene:
(236) TABLE-US-00048 Forward primer (P111): 5′-CATGTACGTTGCTATCCAGGC-3′ Reverse primer (P112): 5′-CTCCTTAATGTCACGCACGAT-3′
Example 14: Regulation Gene Expression by Recombinant Light-Hormone Dual-Regulated Transcription Factors in Mammalian Cells
(237) To evaluate gene expression regulated by recombinant light-hormone dual-regulated transcription factors, Glue was used as the reporter gene to detect the gene expression regulated by light and ligand of EcR, ER or hPR in HEK293 cells. pU5Gluc with pGAVPEcR, pGAVPER or pGAVPhPR constructed in sample 9 were co-transfected into two identical plates of HEK293 cells. Cells were cultured in the dark for 8 hours, ligands of receptors (EcR: Tebufenozide; ER: 4-OHTamxoifen; the hPR: Mifepristone) were added at the final concentration of 1 μM under red light illumination; then one plate was wrapped in aluminum foil and placed in dark while the other was illuminated for 1 s every 30 s. After 22 h induction, medium was collected and Glue activity was analyzed. Cells transfected with pU5Gluc and pEGFP-N1 containing no recombinant light-switchable transcription factor was used as negative control. The result showed that Glue activity of cells in negative control group was very low both in dark and in light conditions, Glue activity of cells with those three recombinant light-hormone dual-regulated transcription factors were higher in the presence of both light and hormone than cells in dark condition without ligand or cells in dark condition with ligand or cells in light condition without ligand, indicating the recombinant light-hormone dual-regulated transcription factors could utilize light and hormone to co-regulated gene expression in cells. In detailed, Gluc activity of cells transfected with pGAVPEcR, pGAVPER or pGAVPhPR in the absence of ligand and in dark conditions was extremely low and was similar to the cells containing no recombinant light-hormone dual-regulated transcription factors, Gluc activity in HEK293 cells increased 4-5 folds with light illumination but no ligand or in the presence of ligand but without light, while in the presence of both light and ligand (EcR: Tebufenozide; ER: 4-OHTamxoifen; hPR: Mifepriston), Gluc activity increased 1000, 500, 60 folds in pGAVPEcR, pGAVPER, pGAVPhPR expressing cells respectively (
Example 15: Spatiotemporally Regulate Gene Expression by Recombinant Light-Switchable Transcription Factors in Mammalian Cells
(238) On the one hand, neutral density filter as photomask was used to study recombinant light-switchable transcription factors regulated gene expression in spatiotemporal resolution. mCherry was used as the reporter gene, pU5mCherry vector and pGAVP (N56K+C71V) vector were co-transfected into HEK293 cells in 96 quadrate well plate. 10 h after transfection, cells were illuminated by blue light for 1 s every 30 s, graded light intensity was adjusted by neutral density filter. 24 h after illumination, the medium was removed and the imaging was conducted using the In-Vivo Multispectral System FX (Kodak) with 550 nm excitation and 600 nm emission filters for the mCherry, image was collected in 4×4 binning for 5 min exposure. The result indicated that cells showed graded expression level by neutral density filter adjustment, and mCherry achieved the highest expression level when no neutral density filter was added (
(239) On the other hand, to display spatiotemporally regulated gene expression capacity, printed laser transparency film was used as photomask to “take photos” for cells. A “ECUST” pattern was printed and a gradient slider on laser transparency film using a laser printer was used as photomask, the light intensity of transparent space detected by a luminator was 30 times more than the black space. HEK293 cells were seeded in glass bottom dish (NEST), pU5mCherry with pGAVP (N56K+C71V) were co-transfected and the photomask was pasted on the bottom of the dish, the cells were illuminated 10 h after transfection for 1 s every 30 s. 24 h after illumination, the medium was removed and the imaging was conducted using the In-Vivo Multispectral System FX (Kodak) with 550 nm excitation and 600 nm emission filters for the mCherry, image was collected in 4×4 binning for 5 min exposure. The result showed that the mCherry fluorescence image of the cells had the pattern of the original image used as the mask, that was an “ECUST” and a gradient slider (
Example 16: Characteristics of Recombinant Light-Switchable DNA Binding Protein and DNA Recognization/Binding Analysis
(240) To evaluate spectrum and DNA binding capacity of the recombinant light-switchable DNA binding protein in this invention, the recombinant light-switchable DNA binding protein was purified first. Gal4-VIVID(WT) was amplified from pGAVP(WT) described in sample 2 by PCR using primers P113 and P114 and ligated into pET28a by NdeI/XhoI digestion, the resulting vector was named as pET28a-GAV(WT) containing recombinant protein GAV(WT), there is a His-tag in its N-terminal for nickel ion affinity chromatograph.
(241) TABLE-US-00049 Forward primer (P113): 5′-CTTTCATATGATGAAGCTACTGTCTTCTATCGAAC-3′ Reverse primer (P114): 5′-CTTTCTCGAGTTATTCCGTTTCGCACTGGAAACCCATG-3′
(242) pET28a-GAV (WT) was transformed into JM109 (DE3) competent cell, a positive clone was picked for GAV (WT) expression, the expressed protein was purified using 1 ml Hitrap column (GE Healthcare), and further desalting by 5 ml Hitrap Desalting column (GE Healthcare). The purified protein with 90% purity identified by SDS-PAGE was kept in 20 mM Hepes, 150 mM NaCl, 20 μM ZnCl.sub.2, 10% glycerol, pH7.5 and in dark at 4° C. (
(243) For analysis of the spectrum of GAV (WT), protein was kept at 4° C. for 30 h for recovering back to the dark state. 40 μL sample was added into 384 UV-star plate in dim red light (light intensity<0.05 W/cm.sup.2), absorbance spectrum was determined from 300 nm to 700 nm by Synergy 2 multi-mode microplate reader (BioTek). Then the sample was irradiated by blue light (460-470 nm, 0.4 W/cm.sup.2) for 5 min and the spectrum was determined. It has been reported that dark state of wild type VIVID-36 has peaks in 428 nm, 450 nm, 478 nm and only a 390 nm peak in light state [Zoltowski, B. D. et al, Science 316 (5827), 1054-1057 (2007)]. The result showed that spectrum of GAV (WT) was similar to VIVID-36, indicating that recombinant protein GAV (WT) retained the absorbance spectrum of wild-type VIVID-36 (
(244) DNA recognization/binding capacity of recombinant protein GAV(WT) was evaluated by EMSA, protein was kept in 4° C. for 30 h for recovering back to the dark state. DNA probe was as follows:
(245) TABLE-US-00050 Sense strand (P105): 5′-TCTTCGGAGGGCTGTCACCCGAATATA-3′, Anti-sense strand (P106): 5′-ACCGGAGGACAGTCCTCCGG-3′,
(246) To obtain double strand DNA probe, DNA was diluted to 10 μM, 1:1 mixed and annealed in PCR instrument which began from 95° C. for 5 min and reduced 1° C. every minute from 95° C. to 25° C. GAV (WT) protein was diluted in RnB (20 mM Hepes 7.5, 50 mM NaCl, 100 μg/mL BSA) by 2 fold serial dilution. Protein and DNA (125 μM) were mixed with an additional 5% w/v Ficol and divided into two replicates, one was illuminated by blue light and the other was kept in darkness at room temperature for 30 min. After incubation, the two samples were loaded onto two 6% polyacryamide gel in 0.5× Tris-borate-EDTA (TBE) buffer and run at 100V for 30-50 min at 4° C. upon light exposure or in darkness, then the gels were stained by Gelred nucleic acid gel stain. The result was shown in
Sample 17: The Study of Light-Switchable Gene Expression System on the Gene Therapy of Type I Diabetic Mice
(247) 1. Establishment of Type I diabetic mice models induced by Streptozotocin (STZ).
(248) (1) Male Kunming (KM) mice (Four-week-old, ˜20 g body weight, FUDAN University) were dealt with sufficient water but no food overnight, and were weighed and labeled the next day.
(249) (2) Citrate solution (0.1 M, pH 5) was prepared as injection solution of STZ and placed on ice away from light.
(250) (3) Streptozotocin (STZ) was intraperitoneally injected into the mice at a dose of 150 mg.Math.kg.sup.−1 body weight.
(251) (4) The mice were fed with sufficient water and food and 10% sugar solution overnight.
(252) (5) The mice were fed with sufficient water and food without 10% sugar solution in the next two weeks.
(253) (6) After 5-7 days, the glucose levels of each mouse were determined using the ACCU-CHEK Integra Glucose Meter (Roche), and mice with glucose levels of approximately 30 mM (Type I diabetic mice) were selected for use in the following experiment.
(254) 2. Drug administration: 20 μg of pU5-insulin described in example 4 and 10 μg of pGAVP (C71V+N56K) described in example 2 were tail intravenously injected into the selected mice in 5-7 seconds (the injection volume was 0.12 ml/g, about 3 mL each mice), the vectors were dissolved in Ringer's solution (147 mM NaCl, 4 mM KCl, 1.13 mM CaCl.sub.2). The control vector was pGAVPO (C108S) described in example 2.
(255) 3. Determination of blood glucose levels: a shaver was utilized to shave off most of the fur firstly, and then cotton ball was dipped with 8% sodium sulfide to remove the residual fur. The residual sodium sulfide was washed off with warm water and dried the skin of abdomen. The mice were illuminated under blue light with 90 mW cm.sup.−2 intensity without food for 8 h, and then the mice were allowed to rest in darkness for another 4 hours with sufficient food. The blood glucose levels of each mouse were determined using the ACCU-CHEK Integra Glucose Meter (Roche).
(256)
(257) It will be understood that the dosages, reaction conditions, etc., in the examples are approximate values unless noted otherwise, and they can be exactly changed base on the situations to obtain similar results. All of the professional terms used in the Description, except those specially defined, have identical meanings to those known by persons skilled in the art. All the references referred to are incorporated into the application as a whole. The preferable embodiments are only exemplified for the illustration of the invention. Those skilled in the art can adopt similar methods or materials to obtain similar results. All the changes and modifications are within the scope of the attached claims.
REFERENCES
(258) 1. Gossen, M. and H. Bujard, Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA, 1992. 89(12): p. 5547-51. 2. Gossen, M., et al., Transcriptional activation by tetracyclines in mammalian cells. Science, 1995. 268(5218): p. 1766-9. 3. Fussenegger, M., et al., Streptogramin-based gene regulation systems for mammalian cells. Nat Biotechnol, 2000. 18(11): p. 1203-8. 4. Wang, Y., et al., A regulatory system for use in gene transfer. Proc Natl Acad Sci USA, 1994. 91(17): p. 8180-4. 5. Weber, W., et al., Gas-inducible transgene expression in mammalian cells and mice. Nat Biotechnol, 2004. 22(11): p. 1440-4. 6. Keyes, W. M. and A. A. Mills, Inducible systems see the light. Trends Biotechnol, 2003. 21(2): p. 53-5. 7. Kamei, Y., et al., Infrared laser-mediated gene induction in targeted single cells in vivo. Nat Methods, 2009. 6(1): p. 79-81. 8. Rivera, V. M., et al., A humanized system for pharmacologic control of gene expression. Nat Med, 1996. 2(9): p. 1028-32. 9. Shimizu-Sato, S., et al., A light-switchable gene promoter system. Nat Biotechnol, 2002. 20(10): p. 1041-4. 10. Yazawa, M., et al., Induction of protein-protein interactions in live cells using light. Nat Biotechnol, 2009. 27(10): p. 941-5. 11. Kennedy, M. J., et al., Rapid blue-light-mediated induction of protein interactions in living cells. Nat Methods, 2010. 12. Fleer, R., Engineering yeast for high level expression. Curr Opin Biotechnol, 1992. 3(5): p. 486-96. 13. Smith, G. E., M. D. Summers, and M. J. Fraser, Production of human beta interferon in insect cells infected with a baculovirus expression vector. Mol Cell Biol, 1983. 3(12): p. 2156-65. 14. Luckow, V. A. and M. D. Summers, High level expression of nonfused foreign genes with Autographa californica nuclear polyhedrosis virus expression vectors. Virology, 1989. 170(1): p. 31-9. 15. Pinkert, C. A., et al., An albumin enhancer located 10 kb upstream functions along with its promoter to direct efficient, liver-specific expression in transgenic mice. Genes Dev, 1987. 1(3): p. 268-76. 16. Calame, K. and S. Eaton, Transcriptional controlling elements in the immunoglobulin and T cell receptor loci. Adv Immunol, 1988. 43: p. 235-75. 17. Winoto, A. and D. Baltimore, A novel, inducible and T cell-specific enhancer located at the 3′ end of the T cell receptor alpha locus. EMBO J, 1989. 8(3): p. 729-33. 18. Banerji, J., L. Olson, and W. Schaffner, A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell, 1983. 33(3): p. 729-40. 19. Queen, C. and D. Baltimore, Immunoglobulin gene transcription is activated by downstream sequence elements. Cell, 1983. 33(3): p. 741-8. 20. Talbott, R. L., et al., Nucleotide sequence and genomic organization of feline immunodeficiency virus. Proc Natl Acad Sci USA, 1989. 86(15): p. 5743-7. 21. Edlund, T., et al., Cell-specific expression of the rat insulin gene: evidence for role of two distinct 5′ flanking elements. Science, 1985. 230(4728): p. 912-6. 22. Kessel, M. and P. Gruss, Murine developmental control genes. Science, 1990. 249(4967): p. 374-9. 23. Camper, S. A. and S. M. Tilghman, Postnatal repression of the alpha-fetoprotein gene is enhancer independent. Genes Dev, 1989. 3(4): p. 537-46. 24. Marmorstein, R., et al., DNA recognition by GAL4: structure of a protein-DNA complex. Nature, 1992. 356(6368): p. 408-14. 25. Fogh, R. H., et al., Solution structure of the LexA repressor DNA binding domain determined by 1H NMR spectroscopy. EMBO J, 1994. 13(17): p. 3936-44. 26. Lewis, M., et al., Crystal structure of the lactose operon repressor and its complexes with DNA and inducer. Science, 1996. 271(5253): p. 1247-54. 27. Burz, D. S., et al., Self-assembly of bacteriophage lambda cI repressor: effects of single-site mutations on the monomer-dimer equilibrium. Biochemistry, 1994. 33(28): p. 8399-405. 28. Hu, J. C., et al., Sequence requirements for coiled-coils: analysis with lambda repressor-GCN4 leucine zipper fusions. Science, 1990. 250(4986): p. 1400-3. 29. Wissmann, A., et al., Amino acids determining operator binding specificity in the helix-turn-helix motif of Tn10 Tet repressor. EMBO J, 1991. 10(13): p. 4145-52. 30. Ramos, J. L., et al., The TetR family of transcriptional repressors. Microbiol Mol Biol Rev, 2005. 69(2): p. 326-56. 31. Peter, E., B. Dick, and S. A. Baeurle, Mechanism of signal transduction of the LOV2-Jalpha photosensor from Avena sativa. Nat Commun, 2010. 1(8): p. 122. 32. Takahashi, F., et al., AUREOCHROME, a photoreceptor required for photomorphogenesis in stramenopiles. Proc Natl Acad Sci USA, 2007. 104(49): p. 19625-30. 33. Seipel, K., O. Georgiev, and W. Schaffner, Different activation domains stimulate transcription from remote (‘enhancer’) and proximal (‘promoter’) positions. EMBO J, 1992. 11(13): p. 4961-8. 34. Peng, H., et al., Biochemical analysis of the Kruppel-associated box (KRAB) transcriptional repression domain. J Biol Chem, 2000. 275(24): p. 18000-10. 35. Wang, Y., et al., Positive and negative regulation of gene expression in eukaryotic cells with an inducible transcriptional regulator. Gene Ther, 1997. 4(5): p. 432-41. 36. Drysdale, C. M., et al., The transcriptional activator GCN4 contains multiple activation domains that are critically dependent on hydrophobic amino acids. Mol Cell Biol, 1995. 15(3): p. 1220-33. 37. Fanara, P., et al., Quantitative analysis of nuclear localization signal (NLS)-importin alpha interaction through fluorescence depolarization. Evidence for auto-inhibitory regulation of NLS binding. J Biol Chem, 2000. 275(28): p. 21218-23. 38. Zoltowski, B. D., et al., Conformational switching in the fungal light sensor Vivid. Science, 2007. 316(5827): p. 1054-7.