Prevention and/or treatment of hearing loss or impairment
11679140 · 2023-06-20
Assignee
- Institut Pasteur (Paris, FR)
- Centre National De La Recherche Scientifique (Cnrs) (Paris, FR)
- Universite Clermont Auvergne (Clermont-Ferrand, FR)
- Sorbonne Universite (Paris, FR)
Inventors
- Christine Petit (Paris, FR)
- Paul Avan (Clermont-Ferrand, FR)
- Sedigheh Delmaghani (Paris, FR)
- Jean Defourny (Paris, FR)
- Asadollah Aghaie (Paris, FR)
- Saaid Safieddine (Paris, FR)
- Alice Emptoz (Paris, FR)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K48/0075
HUMAN NECESSITIES
C12N2710/10021
CHEMISTRY; METALLURGY
A61K8/64
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
C12N2710/10043
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
A61K8/64
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the use of gasdermin, in particular of gasdermin A, gasdermin B, gasdermin C, gasdermin D, DFNA5 or DFNB59 (or pejvakin), and more particularly pejvakin for modulating cellular redox homeostasis. A particularly preferred use of gasdermin, in particular of gasdermin A, gasdermin B, gasdermin C, gasdermin D, DFNA5 or DFNB59 (or pejvakin), and more particularly pejvakin in the context of the present invention is as an antioxidant. The present invention also concerns a virally-mediated gene therapy for restoring genetically-impaired auditory and vestibular functions in subjects suffering from an Usher syndrome. More precisely, this gene therapy takes advantage of an AAV2/8 vector expressing at least one USH1 gene product, preferably SANS.
Claims
1. A method of gene therapy for Usher syndrome, comprising administering an effective amount of a vector comprising a coding sequence for an USH1 gene product, which is the SANS gene product, to a subject in need thereof.
2. The method of claim 1, wherein the USH1 gene product is the SANS gene product having the amino acid sequence SEQ ID NO:49.
3. The method of claim 1, wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 47 and/or SEQ ID NO: 48.
4. The method of claim 1, wherein the USH1 gene product is the SANS gene product having the amino acid sequence SEQ ID NO:49, and wherein the vector comprises the nucleic acid sequence of SEQ ID NO: 47 and the nucleic acid sequence of SEQ ID NO: 48.
5. The method of claim 1, wherein the vector is a viral vector.
6. The method of claim 5, wherein the vector is administered by administering a viral particle comprising the vector to the subject.
7. The method of claim 5, wherein the vector is selected from the group consisting of lentivirus vectors, adenovirus vectors, and adeno-associated virus (AAV) vectors.
8. The method of claim 7, wherein the vector is an AAV vector.
9. The method of claim 8, wherein the vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10 vector.
10. The method of claim 8, wherein the vector is a AAV2/8 vector.
11. The method of claim 1, wherein the vector is administered by cochlear injection.
12. The method of claim 1, wherein administering the effective amount of the vector to the subject rescues auditory function.
13. The method of claim 1, wherein administering the effective amount of the vector to the subject rescues vestibular defects.
14. The method of claim 1, wherein the USH1 gene product is expressed in both inner hair cells (IHCs) and outer hair cells (OHCs) of the auditory system of the subject.
15. The method of claim 11, wherein administering the effective amount of the vector to the subject rescues auditory function.
16. The method of claim 11, wherein administering the effective amount of the vector to the subject rescues vestibular defects.
17. The method of claim 11, wherein the USH1 gene product is expressed in both inner hair cells (IHCs) and outer hair cells (OHCs) of the auditory system of the subject.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
BRIEF DESCRIPTION OF THE DRAWINGS
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
EXAMPLES
(24) I. Material and Methods
(25) Animal Handling
(26) Animals were housed in the Institut Pasteur animal facilities accredited by the French Ministry of Agriculture to perform experiments on live mice (accreditation 75-15-01, issued on Sep. 6, 2013 in appliance of the French and European regulations on care and protection of the Laboratory Animals (EC Directive 2010/63, French Law 2013-118, Feb. 6, 2013). The corresponding author confirms that protocols were approved by the veterinary staff of the Institut Pasteur animal facility, and were performed in compliance with the NIH Animal Welfare Insurance #A5476-01 issued on 31 Jul. 2012. C57Bl/6 wild-type mice were obtained from Janvier laboratories.
(27) Gene Targeting, Genotyping, and RT-PCR
(28) A targeting vector was designed, in which exon 2 of Pjvk and the neomycin selection cassette were flanked with loxP sites. A negative selection cassette coding for diphtheria toxin A fragment (DTA) was inserted at the 3′-end of the targeting Pjvk sequence (
(29) To obtain Pjvk conditional knockout mice (Pjvk.sup.fl/flMyo/5-cre.sup.+/−), in which expression of the deleted Pjvk was restricted to the inner ear sensory cells, mice carrying the floxed Pjvk allele were mated with transgenic mice expressing the cre-recombinase under the control of the myosin 15 gene promoter (Caberlotto et al., 2011). Analyses of the auditory function were performed in ubiquitous knock-out and conditional knockout mice. All studies were performed on mixed C57BL/6J-129/Sv genetic background.
(30) For RT-PCR analysis of the Pjvk transcript, total RNA was extracted from inner ears of Pjvk.sup.+/+ and Pjvk.sup.−/− P7 mice with NucleoSpin® RNA II (Macherey-Nagel). In the Pjvk.sup.+/+ mice, a transcript of 1059 bp in length was detected, while in the Pjvk.sup.−/− mice a transcript of 963 bp lacking the exon 2 sequence was detected.
(31) Audiological Studies in Mice
(32) Auditory tests were performed in an anechoic room. They consisted of distortion-product otoacoustic emissions (DPOAEs), auditory brainstem responses (ABRs), electrically-evoked brainstem responses (EEBRs), and cochlear potentials. Mice were anesthetized with an intraperitoneal injection of a ketamine and levomepromazin mixture (100 mg/kg: 5 mg/kg) and their core temperature was kept at 37° C. with the help of a servo-controlled heating pad. The DPOAE at frequency 2f.sub.1-f.sub.2 was recorded in response to two equal level primary tones, f.sub.1 and f.sub.2, with f.sub.2/f.sub.1=1.20 (CubeDis system, Mimosa Acoustics; ER10B microphone, Etymotic Res.). Frequency f.sub.2 was swept at 1/10.sup.th octave steps from 4 to 20 kHz, and DPOAE level was plotted against frequency f.sub.2 (primary tone levels increased from 20 to 70 dB SPL in 10 dB steps, then to 75 dB SPL). DPOAE threshold was defined as the smallest primary level giving rise to a detectable DPOAE. ABRs in response to calibrated short tone bursts in the 5-40 kHz range (repetition rate 17/s) were derived from the synchronous averaging of electroencephalograms recorded between subcutaneous stainless steel electrodes at the vertex and ipsilateral mastoid, with the help of a standard digital averaging system (CED1401+). A hundred responses to the tone bursts were averaged except within 10 dB of the ABR threshold (defined as the smallest tone-burst level giving rise to at least one repeatable wave above noise background level, 150 nV in an anesthetized animal), for which 300 tone bursts were used. Once ABR thresholds had been assessed, ABRs in response to 95 and 105 dB SPL tone bursts (100 averages) were collected for analysis of suprathreshold ABR waveforms, amplitudes and latencies. Controlled sound exposure was applied with the same acoustic probe used for ABRs without moving the sound system, so that pre- and post-exposure ABRs shared the same calibration. Intense stimuli were the same tone-bursts used for ABR measurements at 105 dB SPL, presented 1,000 times at the same repetition rate of 17/s.
(33) Electrical stimulations of the eighth cranial nerve were delivered by a silver electrode placed in the round-window niche and excited by biphasic electrical impulses (neutral electrode in neck muscles; peak amplitude of electrical stimulus about 0.5 V; duration of the positive and negative phases 150 microseconds; adjustable repetition rate). EEBRs were extracted using the same setup as for ABRs (Roux et al., 2006), in response to 100 electrical impulses presented with alternating polarities (repetition rate 17 Hz). EEBR threshold was defined as the smallest electrical amplitude eliciting repeatable waves above noise background level (the same as for ABRs), labelled from E II to E IV in reference to their ABR equivalents II-IV. Controlled electrical stimulation was applied at 5 dB above EEBR detection threshold with a 200 Hz repetition rate. Occasionally, the silver electrode on the round window served for recording Compound Action Potentials (CAPs) in response to the same tone-bursts used for ABR studies (averages of 32 presentations, repetition rates 17/s), prior to EEBR data collection. These recordings served to check that CAP thresholds and ABR thresholds were within 2 dB of each other at all frequencies, and the exact position of ABR wave I could be ascertained form the larger wave N1, its equivalent on CAP recordings. This was particularly important in mice with abnormally small wave I to avoid incorrect identifications (when wave I was reduced to a very small flattened deflection resembling a summating potential, the slightly larger wave II might have been mistakenly labelled wave I on ABR recordings, while wave N1, even when small, kept its characteristic shape).
(34) The round-window electrode also provided access to the cochlear microphonic potential (CM), with the same setting used for CAP measurements, except that the stimulus polarity was fixed for CM recordings, instead of alternating between rarefaction and condensation tone-bursts for CAP detection. CM is a far-field potential resulting from mechanoelectrical transduction currents through the OHCs at the basal end of the cochlea, near the collecting electrode, and is an oscillating change in electric potential at the stimulus frequency. Although its shape is closely similar to that of the stimulus that activates the sound-delivering earphone, it was easily separated from a possible electric artefact radiated by the earphone by its delay of about 0.5 ms after stimulus onset, in relation to sound propagation along the tubing system that connected the earphone to the ear canal of the mouse. Its peak-to-peak amplitude was measured for a stimulus of 5 kHz (a frequency much lower than the best frequency of the responding OHCs, so that CM was independent of their electromotility status) presented at 95 dB SPL.
(35) Recording of Mouse Vocalizations
(36) The protocol was adapted from the protocol described previously by Menuet et al. (2011). In brief, mice were placed in a polyethylene cage covered by a metal wire lid. A free field microphone (type 4192, ½-inch, Brüel & Kjaer) was placed 2 cm above the metal lid, in the centre of the cage. The microphone output was preamplified (Microphone power supply type 2801, Brüel & Kjaer) and digitized by the sound card of a computer (Dell D830; Dell Inc.) at the sampling rate of 192 kHz. Acoustic vocalizations in the 5-90 kHz frequency range were stored online by Adobe Audition 1.5 software. Their analysis was performed using software developed on Matlab (The MathWorks Inc., MA), allowing a spectrographic display of vocalizations in the time-frequency domain, from which the total time of vocalization, the average intensity of vocalizations, and the spectral complexity of vocalizations were determined.
(37) Stabulation of Mice in an Acoustically Quiet Environment
(38) Noting that most of the noise exposure of a young mouse comes from surrounding sound vocalizations (Ehret & Riecke, 2002), the pups were split from the same litters into three groups placed in isolated boxes. Separation was done before P10, that is several days before the onset of hearing in the mouse. Boxes were kept in quiet booths, shielded from the sound from other cages. In the first group, only 2 mice were kept in a cage with a foster mother; in the second group, 4 mice; and in the third group, the remaining (6 to 10) pups were left with their mother.
(39) Audiological Tests and Controlled Sound Exposure in Patients
(40) Informed consent was obtained from all the subjects included in the study. Clinical examination was carried out on the five affected subjects carrying the p.T54I mutation in PJVK, and 13 control patients with sensorineural hearing impairments of cochlear origin and matched auditory thresholds and extant otoacoustic emissions. Pure-tone audiometry was performed using air- and bone-transmitted tones. Hearing impairment was objectively assessed by means of ABRs and transient-evoked otoacoustic emissions (TEOAEs). To test the hearing hypervulnerability to sound in these patients, a minimal sound exposure eliciting ABRs was used. ABRs were first recorded in response to 250 impulse stimuli clicks (at a repetition rate of 20/s) at 99 dB above normal detection threshold (the maximum level with this equipment, a Vivosonic Integrity™ Version 4.50), that is, 20-30 dB above the ABR threshold in the tested ear. Then, averaging was extended to 500 and 1000 clicks, and the three averaged ABRs were compared as regards wave identification, amplitudes and latencies post click-onset. In control patients, averaging was prolonged until about 4000 responses to clicks had been collected. After a 10-min pause with no sound stimulus, the procedure was done all over again. TEOAEs were averaged just before the first ABR procedure, then just after, in response to 260 series of clicks presented at 40 dB above normal detection threshold (i.e., they were inaudible in patients). The so-called nonlinear TEOAE recording procedure was used (derived from the ILO88 system, Kemp, 2002), allowing genuine TEOAEs to be extracted from linear reflection artefacts from the middle ear and background noise to be evaluated. TEOAE responses were analysed in 1-kHz-wide bands centred on 1, 2, 3 and 4 kHz.
(41) Acoustic Overexposure for Quantification of Cochlear Transcripts in Mice
(42) Three-week old C57Bl/6 wild-type mice were used. The sound stimulation episode to which the animals were exposed consisted, in a first set of experiments, of a 1-hour pure tone overstimulation at 5-20 kHz with an intensity of 105 dB SPL. In the second set of experiments, the mice were submitted to a so-called “preconditioning sound exposure” that consisted of a bandpass-filtered white noise (BPWN) whose spectrum covered the interval 5-20 kHz, with a lower intensity of 90 dB SPL for 1 hour. The BPWN signal was generated using custom Matlab software (The Mathworks), and delivered by an amplifier to a set of four Ultrasonic Vifa speakers (Avisoft Bioacoustics). The speakers were attached to the tops of four custom-made, cylindrical sound-isolation chambers (15 cm in radius) in which the mice were enclosed. The noise intensity delivered by the speakers was calibrated with a BK4812 probe (Brüel & Kjaer) placed centrally at the bottom surfaces of the isolation chambers. The sound field inside each chamber varied by less than 10 dB over its bottom surface.
(43) Generation of an Anti-Pejvakin Monoclonal Antibody
(44) The coding sequence of the Pjvk cDNA (accession no. NM_001080711.2) 3′-end was amplified and cloned into a pGST-parallel-2 vector (derived from pGEX-4T-1; Amersham). The resulting construct, encoding the C-terminal region of pejvakin (residues 290-352; accession no. NP_001074180.1) fused to a N-terminal glutathione S-transferase (GST) tag, was transformed into E. coli BL21-Gold (DE3) competent cells (Stratagene). The pejvakin protein fragment was purified using a glutathione Sepharose 4B column, followed by size-exclusion chromatography and used as the antigen for immunization. Young (4-6 weeks old) Pjvk.sup.−/− mice were immunized with 15-50 mg of antigen by subcutaneous injection. Mice were bled from eye vein after 3 injections, and presence of the antibody in the plasma was tested by ELISA and western blot. Once plateau of antibody production was detected, hybridoma fusion was performed. Antibody titre was determined by ELISA.
(45) Treatment of Mouse Embryonic Fibroblasts with H.sub.2O.sub.2
(46) Fibroblasts were isolated from mouse embryos at embryonic day 13.5 and cultured as described by Xu (2005). The cells were incubated in DMEM (Gibco) supplemented with 0.1 mM β-mercaptoethanol, and 0.5 mM H.sub.2O.sub.2 for 4 hours at 37° C., under normoxic conditions (95% air). The culture medium was then replaced with H.sub.2O.sub.2-free medium. Cell viability was checked 18 hours after H.sub.2O.sub.2 treatment, by measuring mitochondrial reductase activity with the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Sigma M2128) assay. A polyclonal antibody against peroxisome membrane protein 70 (PMP70, Abcam ab3421) was used to label peroxisomes.
(47) Plasmids and DNA Transfections
(48) The full-length Pjvk cDNA was obtained by RT-PCR on a double-strand cDNA library prepared from organs of Corti of postnatal day 7 (P7) C57BL/6 mice, and then was cloned into the pIRES2-EGFP vector (Clontech). The mutant Pjvk clones (missense mutations) were prepared from the wild-type clone using QuikChange™ Site-Directed Mutagenesis kit (Stratagene). HeLa, COS-7, HEK293 cells were transiently transfected using Iipofectamine™ 2000 (Invitrogen), according to the manufacturer's instructions.
(49) Immunofluorescence Studies
(50) For cryosections, inner ears were dissected in PBS and fixed by immersion in 4% paraformaldehyde (PFA) in PBS for 2 hours at 4° C. The samples were decalcified in 10% EDTA in PBS, pH 7.4 for 4 days at 4° C., fixed again in 4% PFA in PBS for 1 hour, rinsed twice in PBS for 10 min, and immersed in 20% sucrose in PBS for 12 hours. They were embedded in Tissue Freezing Medium (Triangle Biomedical Sciences, USA). Cryostat sections (12 μm thick) were used for immunohistochemistry. An antibody against 4-hydroxy-2-nonenal (HNE) (Calbiochem) was used to detect the lipid oxidation products. For whole-mount immunolabelling analyses, the inner ears were fixed in 4% PFA in PBS, and the cochlear sensory areas (organ of Corti) were microdissected. The tissues were rinsed twice in PBS, then permeabilized and blocked by incubation in PBS containing 20% normal goat serum and 0.3% Triton X-100 for 1 hour at room temperature. For GFP detection, whole-mount cochleas were incubated with a mixture of rabbit anti-GFP antibody (Invitrogen) and chicken anti-GFP antibody (Abcam) in 1% bovine serum albumin (BSA) in PBS. A monoclonal antibody against parvalbumin (Sigma) was used to label auditory neurons. A polyclonal antibody against peroxisome membrane protein 70 (PMP70, Abcam) was used to label peroxisomes. Anti-myosin VI (Roux et al., 2009), anti-ribeye/CtBP2 (Santa Cruz), and anti-glutamate receptor 2 (GluR2, Invitrogen) antibodies were used to delimit the contours of IHCs, to label and count IHC ribbons, and to label post-synaptic glutamate receptors on the dendritic ends of cochlear ganglion neurons, respectively.
(51) For immunocytochemistry, HeLa, COS-7, HEK293, and HepG2 cells were fixed in 4% PFA for 15 min, washed in PBS, and incubated in NH.sub.4Cl 50 mM Triton X-100 0.2% solution for 15 min at room temperature (RT). After washing, cells were incubated in PBS—Normal Goat Serum 20% solution for 1 hour. Cells were incubated with the primary antibody in PBS-BSA 1% solution for 1 hour. Peroxisomes were labelled using a rabbit polyclonal antibody against peroxisome membrane protein 70 (PM P70, Abcam). Antibodies against mitochondrial import receptor subunit TOMM22 (Sigma) and lysosomal-associated membrane protein 1, LAM P1 (Abcam) were used to label mitochondria and lysosomes, respectively. The mouse monoclonal antibody against pejvakin (Pjvk-G21) was used to detect the subcellular location of pejvakin. Cells were then washed in PBS and incubated with the appropriate secondary antibody for 1 hour at RT.
(52) For immunofluorescence, the antibodies Atto-488- or Atto-647-conjugated goat anti-rabbit IgG, Atto-594-conjugated goat anti-mouse IgG (Sigma) and Alexa-Fluor-488-conjugated goat anti-chicken IgG (Invitrogen) were used. TRITC-conjugated phalloidin (Sigma) and DAPI (Sigma) were used to label actin and cell nuclei, respectively. Images were collected using a Zeiss LSM700 Meta confocal microscope (Carl Zeiss MicroImaging, Inc.). Automated quantification of peroxisomes was realised using the Particles Analysis plugin of Image) software (Collins, 2007). Data were expressed as a number of peroxisomes per 100 μm.sup.2, and enlarged peroxisomes were measured in two perpendicular directions using Image) software.
(53) Morphological Analyses and Peroxisome Staining
(54) For scanning electron microscopy studies, inner ears from adult mice were fixed by perfusion of the perilymphatic compartment with 2.5% phosphate-buffered glutaraldehyde, and rinsed in PBS. Cochleae were then microdissected, dehydrated in graded ethanol solutions, and dried up to critical point. Processed specimens were then mounted on aluminium stubs with colloidal silver adhesive and sputter-coated with gold palladium before imaging in a JSM-6700 F Jeol scanning electron microscope. Inner ears from a total of 10 Pjvk.sup.+/+ mice (three at P15, four at P30, three at P60), and 12 Pjvk.sup.−/− mice (three at P15, five at P30, four at P60) were analysed by scanning electron microscopy.
(55) For transmission electron microscopy studies, the cochleas were prepared as previously described (Thelen et al., 2009). They were fixed in 2.5% glutaraldehyde in 0.1 M Sörensen's buffer pH 7.4 for 2 hours at 4° C. After several washes in 0.1 M Sörensen's buffer pH 7.4, the samples were postfixed at 4° C. with 2% osmium tetroxide in Sörensen's buffer for 60 min. The selective staining of peroxisomes is adapted from (Angermüller & Fahimi, 1981). Briefly, the cochleas were fixed at 4° C. in 1% glutaraldehyde in 0.1 M cacodylate buffer pH 7.2 for 1 hour. After several washes in the same buffer, the samples were immersed in 2 mg/ml 3,3′-Diaminobenzidine (DAB) and 0.15% H.sub.2O.sub.2 in 0.05 M Teorell-Stenhagen buffer (T/S: 57 mM boric acid, 50 mM phosphoric acid, 35 mM citric acid, 345 mM NaOH) pH 10.5 for 45 min at 30° C. After several washes in T/S, the samples were postfixed at 4° C. with 2% osmium tetroxide in H.sub.2O for 60 min. All the cochleas were then washed in deionized water, dehydrated in graded ethanol solutions, and embedded in Epon (Epon-812, Electron Microscopy Sciences) for 48 hours at 60° C.
(56) Ultrathin sections (70 nm thick) were obtained using an ultramicrotome (Reichert Ultracut E) equipped with a diamond knife (Diatome), and mounted on copper grids coated with collodion. Sections for the morphological analysis were contrasted with uranyl acetate and lead citrate for 15 min each. Sections stained with DAB were contrasted with lead citrate for 15 min. The ultrathin sections were observed under a JEM-1400 transmission electron microscope (Jeol) at 80 kV and photographed with an 11 MegaPixel bottom-mounted TEM camera system (Quemesa, Olympus). The images were analysed via iTEM software (Olympus). The quantitative data were obtained using the same software.
(57) Microarray Analysis and Real-Time Quantitative PCR
(58) Total RNA was extracted from dissected organs of Corti of Pjvk.sup.−/− and wild-type P15 mice (an age at which no cellular defect could be detected in the organ of Corti of Pjvk.sup.−/− mice) using TRIzol reagent (Invitrogen), purified on Rneasy columns (Qiagen, Valencia, Calif.), and tested on an Agilent (Waldbronn, Germany) 2100 Bioanalyzer. Three biological replicates were run for each genotype. cRNAs obtained from 100 ng of RNA were amplified by using the GeneChip Expression Two-Cycle 3′ amplification system (Affymetrix, High Wycombe, U.K.). Fragmented biotin-labeled cRNA samples were hybridized to Affymetrix Mouse Gene ST 1.0 arrays. Following hybridization, the array was washed and stained according to the Affymetrix protocol. The stained array was scanned at 532 nm using an Affymetrix GeneChip Scanner 3000, producing CEL files for each array. Gene-level expression values were derived from the CEL file probe-level hybridization intensities using the model-based Robust Multichip Average algorithm (RMA) (Bolstad et al. 2003). Arrays were compared using the Local Pool Error test (Jain et al., 2003), and the P values were adjusted by using the Benjamini-Hochberg algorithm (Benjamini & Hochberg, 1995). The fold differences reflect the relative expression levels of the genes in the organs of Corti of Pjvk.sup.−/− mice normalized to the expression levels of the same genes in the organs of Corti of Pjvk.sup.+/+ mice.
(59) The fold changes of Mpv17, Dct, Gpx2, CypA, c-Fos, and Hsp70 transcripts between sound-exposed and unexposed cochleas were analysed by quantitative PCR. Cochleas were collected from unexposed and sound-exposed mice at 1 hour, 3 hours, 6 hours, and 18 hours after sound exposure. RNA was extracted from dissected organs of Corti using NucleoSpin® RNA II (Macherey-Nagel). Real-time quantitative PCR was performed using the Universal Probe Library (UPL) system from Roche. UPL probes were labelled with FAM, and the fluorescence was read with the Applied Biosystems 7500 Real-Time PCR System. The thermocycling conditions were 50° C. for 2 min followed by 95° C. for 2 min, and then 40 cycles at 95° C. for 15 s and 60° C. for 30 s. Three independent experiments were performed for each exposed or unexposed cochlea. Each assay was conducted for target transcript probe-set in a multiplex reaction in which glyceraldehyde-3-phosphate dehydrogenase (Gapdh) probe-set was used as an internal control. Relative levels of target transcript dosage were determined using the comparative CT method. The relative transcript copy number for each target transcript was calculated as 2.sup.−ΔΔCT. UPL probes and primers were indicated in the table below. To compare the transcription level of each gene in the organ of Corti of exposed and unexposed mice, statistical significance was assessed using the unpaired, Student's t-test.
(60) List of Primers and Probes Used for Quantitative PCR.
(61) TABLE-US-00001 UPL probe Forward primer Reverse primer Gene (Roche) (5′-3′) (5′-3′) Pjvk #60 CCAGTGCTCTCTGTCAGTGC TCTGTTCATCCATAAAATGAAACC (cat. no. (SEQ ID NO: 5) (SEQ ID NO: 6) 04688589001) Mpv17 #75 CGCACTCTGACCATGGTATC CCCGGGATTAAGTGGTCTAAA (cat. no. (SEQ ID NO: 7) (SEQ ID NO: 8) 04688988001) Dct #6 GGCTACAATTACGCCGTTG CACTGAGAGAGTTGTGGACCAA (cat. no. (SEQ ID NO: 9) (SEQ ID NO: 10) 04685032001) Gpx2 #2 (cat. no. GTTCTCGGCTTCCCTTGC TTCAGGATCTCCTCGTTCTGA 04684982001) (SEQ ID NO: 11) (SEQ ID NO: 12) CypA #46 ACGCCACTGTCGCTTTTC GCAAACAGCTCGAAGGAGAC (cat. no. (SEQ ID NO: 13) (SEQ ID NO: 14) 04688066001) c-Fos #26 GGCTCTCCTGTCAACACA GACCAGAGTGGGCTGCAC (cat. no. CA (SEQ ID NO: 15) (SEQ ID NO: 16) 04687574001) Hsp70 #80 GAAGACATATAGTCTAGC CCAAGACGTTTGTTTAAGACACTTT (cat. no. TGCCCAGT (SEQ ID NO: 18) 04689038001) (SEQ ID NO: 17) Gadph (cat. no. ATGGTGAAGGTCGGTGTG AATCTCCACTTTGCCACTGC 05046211001) (SEQ ID NO: 19) (SEQ ID NO: 20)
(62) Measurement of Total GSH and GSSG
(63) Total glutathione (GSH+GSSG) and oxidized glutathione (GSSG) levels were measured by the method of Rahman et al. (2006). Three independent experiments were performed. Cochleas and livers were collected from Pjvk.sup.+/+ and Pjvk.sup.−/− mice at 3 weeks of age. The tissues were quickly removed and placed in ice-cold 0.1 M potassium phosphate buffer with 5 mM EDTA disodium salt, pH 7.5 (KPE), and homogenized on ice-cold extraction buffer (0.1% Triton-X, 0.6% sulfosalicylic acid and 5% metaphosphoric acid in KPE). The homogenate was centrifuged at 8,000×g for 10 min at 4° C. The supernatant was used as lysate for assay. To measure GSSG only, reduced GSH was derivatized with 2-vinylpyridine. Measurement of GSH/GSSG levels was done by adding 5,5′-dithio-bis (2-nitrobenzoic acid) (DTNB) to the lysate. Both GSH and GSSG react with DTNB and form a yellow derivate 5′-thio-2-nitrobenzoic acid (TNB). The rates of TNB formation were calculated by spectrometry at 405 nm. The total GSH and GSSG concentrations in the samples were measured by using linear regression to calculate the values obtained from the standard curve. The GSH concentration was calculated by subtracting the GSSG concentration from the total GSH concentration.
(64) TBARS Assay for Quantification of Lipid Peroxidation
(65) To test the level of MDA, a by-product of lipid peroxidation, the TBARS assay kit was used (Cayman Chemical Company, Ann Arbor, Mich., USA). Three independent experiments were performed. For each assay, cochlear sensory areas were microdissected from 30 Pjvk.sup.+/+ and 30 Pjvk.sup.−/− mice. Cochlear tissue was homogenized on ice in RIPA buffer (50 mM Tris-HCl, pH 7.6, containing 150 mM NaCl, 1% NP-40 (Igepal), 0.5% sodium deoxycholate, and 0.1% SDS). Cochlear homogenate was used for the assay. The prescribed TBARS protocol was applied, in addition to the triplicate pipeting of MDA aliquots of known concentration to produce a standard curve. Fluorescence was read at excitation and emission wavelengths of 530 and 590 nm, respectively, using a Synergy 2 thermoregulated spectrophotometer plate reader (BioTek). The averaged values were used to determine MDA concentration from the MDA standard curve graph.
(66) AAV-Pjvk Viral Constructs and Intracochlear Viral Transduction
(67) To obtain AAV2/8-Pjvk-IRES-EGFP, the mouse Pjvk cDNA flanked by an IRES-EGFP reporter cDNA sequence was subcloned into the multiple cloning site of vector pENN.AAV.CB7.CI.RBG (PennVector P1044, Penn Medicine Vector Core—University of Pennsylvania School of Medicine). The virus production and titration were performed by Penn Medicine Vector Core. To product AAV8-Pjvk, mouse Pjvk cDNA was subcloned in a single promoter Ad.MAX™ shuttle vector (ITR-CAG-Dfnb59-WPRE-PolyA-ITR; SignaGen Laboratories). The virus packaging and titration were done by SignaGen Laboratories.
(68) Intracochlear viral transduction was carried out as described by Akil et al. (2012). Three-day old Pjvk.sup.−/− pups were anesthetized by hypothermia, and the left ear was approached through a dorsal incision. A small hole was made in the bulla with an 18G needle, and the round window membrane was gently punctured with a borosilicate capillary pipette. A fixed volume of AAV8-Pjvk or AAV2/8-Pjvk-IRES-EGFP (0.5 μl of a 1×10.sup.13 vg/ml) was then gently injected (during 1-2 min) into the perilymphatic compartment of the cochlea. After pulling out the pipette, the round window niche was quickly sealed with fascia and adipose tissue, and the bulla was sealed with dental cement. Auditory function was tested at P21 in treated and untreated ears by recording of ABR, DPOAEs, and EEBR.
(69) Antioxidant Treatment
(70) N-acetyl-L-cysteine (L-NAC; Sigma) or taurine (Sigma) was administrated to pregnant Pjvk.sup.−/− mice in the drinking water. A daily dose of 1% L-NAC or 2% taurine was given to the mother during and after pregnancy, so that pups received them from birth on by feeding on the mother's milk. The treatment was continued until P21, and the auditory function of the treated Pjvk.sup.−/− pups was tested at P21.
(71) Statistical Analyses
(72) After checking for data normality and homoscedasticity, statistical differences were evaluated using the Student's t-test and one-way ANOVA. A p value <0.05 was set for statistical significance.
(73) II. Results
(74) 1. Extreme Heterogeneity in Hearing Sensitivity in Pjvk.sup.−/− Mice
(75) Pejvakin-null mice, Pjvk.sup.−/−, carrying a deletion of exon 2 resulting in a frameshift at codon position 71 (p.G71fsX9) (
(76) 2. Hypervulnerability to Natural Acoustic Environment in Pjvk.sup.−/− Mice
(77) To gain insight into the origin of the considerable variations of Pjvk.sup.−/− auditory phenotypes, the ABR thresholds of the Pjvk.sup.−/− littermates were first examined from different crosses. Large variations were detected from one cross to another, which contrasted with only marginal differences between the Pjvk.sup.−/− littermates of individual crosses. This observation might be consistent with a phenotypic heterogeneity of genetic origin. However a careful observation pointed to an alternative explanation. ABR thresholds elevations tended to vary according to the number of pups in the litter (6 to 10); the larger this number, the more elevated ABR thresholds. This suggested that the natural acoustic environment resulting from pups' calls might have a deleterious effect on hearing of Pjvk.sup.−/− mice. Indeed pups are vocally very active from birth to about P20, when crowding around the mother, at the feeding time (Ehret & Riecke, 2002). To directly evaluate whether hearing of Pjvk.sup.−/− pups could be compromised by their vocalizations, large litters were randomly split in groups of 2, 4, 6 and 10 pups per cage kept with a foster mother, from P10 (i.e. before onset of hearing which occurs at P14). ABR thresholds at P21 showed a highly significant correlation (p<0.001) with the number of pups present in a given cage (
(78) Acoustic measurements showed that the most energetic pup calls, in a 12-pup litter, are harmonics of about 5 kHz that reach 105±5 dB SPL from P0 to P21, at the entrance of the ear canals of the pups. A 1-hour exposure is energetically equivalent to a continuous exposure of 42-50 s to the sound of a call. To directly test the effect of sound stimulation and evaluate its possible deleterious consequences on hearing in a controlled manner, 10-kHz 105 dB SPL tone-bursts (2-ms plateau stimulation separated by 60-ms silent intervals) were used, such that one thousand presentations of this stimulus are energetically equivalent to a 3-min stay in the natural environment of a 12-pup litter, whilst allowing ABRs to be monitored during exposure. This is referred as “controlled sound exposure” henceforth. ABR tests performed before and after controlled sound exposure to assess its effects negligibly contributed to the exposure, as they were limited to 50 repetitions each. Indeed, alone, they had no effect on Pjvk.sup.−/− mice hearing threshold (data not shown).
(79) In a sample of P30 old Pjvk.sup.−/− mice (n=8) with initial ABR thresholds inferior to 65 dB SPL, “controlled sound exposure” resulted in increased ABR thresholds in the 12-20 kHz frequency interval (corresponding to cochlear places where intense 10-kHz sound induces the largest hair-cell stimulations (Cody & Johnstone, 1981)). The ABR threshold increase was 21.7±10.3 dB (p<0.001) in Pjvk.sup.−/− mice whilst producing no effect in Pjvk.sup.+/+ mice (n=12) (2.2±2.4 dB, p=0.3) (
(80) 3. Hair Cells, Afferent Auditory Neurons and Neurons of Auditory Brainstem Pathways are Targets of the Pejvakin Defect.
(81) Which cells are the targets of the pejvakin defect, and are they all hypervulnerable to sound exposure? To address this issue, the outcomes of functional tests specific of various types of auditory cell were compared among Pjvk.sup.−/−, hair-cell conditional knock-out for pjvk (Pjvk.sup.fl/flMyo15-cre.sup.+/−) and Pjvk.sup.+/+ 2-3 weeks old mice, at baseline and after “controlled sound exposure”. Moreover, Electrically-Evoked Brainstem Responses (EEBR) to a direct electric stimulation of the auditory neurons, which test the response of the auditory pathway beyond the cochlea, was also analysed. A “controlled electric exposure” (as it will be named henceforth), an electric-impulse stimulation rate of 200/s for a 1-min duration was delivered, as compared to 16/s and 10-s duration of the stimulus used for the pre and post-exposure EEBRs.
(82) The inner hair cells (IHCs) are the genuine auditory sensory cells. Their responses to vibrations produced by tone bursts and amplified by the mechanical activity of OHCs trigger action potentials in the auditory neurons, which make up the auditory nerve. Synchronized action potentials in the peripheral part of this nerve generate ABR wave-I. In Pjvk.sup.fl/flMyo/5-cre.sup.+/−, as a result of pejvakin absence from the hair cells only, and stimulation condition in which the IHCs' response is made independent of the OHC activity by a sound stimulation intensity exceeding 90 dB SPL (Robles & Ruggero, 2001), ABR wave-I amplitude and latency specifically reflect IHC function. An increase of wave-I latency (1.58 ms in Pjvk.sup.fl/flMyo/5-cre.sup.+/− (n=20), vs. 1.32 ms in Pjvk.sup.+/+ littermates (n=30); p<0.001) and a decrease of wave-I amplitude (37% of the amplitude in control littermates; p<0.001), incriminate IHC dysfunction in the hearing impairment caused by pejvakin defect. “Controlled sound exposure” induced further decreases of ABR wave-I amplitude in Pjvk.sup.−/− and Pjvk.sup.fl/flMyo/5-cre.sup.+/− (48% and 55% of pre-exposure amplitude respectively compared to 108% in Pjvk.sup.+/+ mice, p<0.001;
(83) As shown above, OHCs, are also target cells of the pejvakin-defect. In Pjvk.sup.−/− mice with persisting DPOAEs (n=8), the “controlled sound exposure” produced an average increase in DPOAE threshold of 17.1±6.7 dB in the 12 to 20 kHz frequency interval (p<0.0001) whilst Pjvk.sup.+/+ mice (n=9) were unaffected (p=0.5) (
(84) To investigate the influence of the absence of pejvakin on neural conduction whilst excluding any confounding effect of cochlear damage, we compared EEBR waves E II and E IV (easiest to reliably measure owing to their sharpness) between Pjvk.sup.−/− and Pjvk.sup.fl/flMyo/5-cre.sup.+/− mice. The amplitudes of these waves did not differ (for wave E IV for example, average amplitudes were 2.6±1.8 μV in Pjvk.sup.−/− mice (n=18) as against 2.2±1.2 μV in Pjvk.sup.fl/flMyo/5-cre.sup.+/− mice (n=11); t-test, p=0.13). However upon controlled electric exposure, EEBR waves E II and E IV were reduced in amplitude by 41% and 47% respectively for at least 3 min, in Pjvk.sup.−/− mice (n=10; p=0.02 and p=0.012 respectively) (
(85) 4. Redox Metabolism Anomalies in the Absence of Pejvakin
(86) To address the pathogenesis of the hearing impairment of Pjvk.sup.−/− mice, it was first proceeded with the morphological analysis of their cochlea, by light microscopy on semithin sections and scanning (SEM) and transmission electron microscopy (TEM). On P15, hair cells and auditory neurons showed normal morphology and numbers. Notably, the OHC and IHC hair bundles, the mechanoreceptive structures to sound of the hair cells, analysed from P15 to P60 by SEM, and the ribbon synapses of the IHCs and their afferent auditory neurons studied by TEM, were unmodified (
(87) Since the above-described physiological anomalies were already present in a broad range of frequencies in Pjvk.sup.−/− mice at P15, i.e. well before any morphologically abnormal features could be detected, the hearing impairment of young Pjvk.sup.−/− mice can be attributed to functional defects.
(88) Possible changes in gene expression in Pjvk.sup.−/− organ of Corti, the cochlear sensorineural epithelium, were then investigated by microarrays in P15 old mice. Eighteen genes showed changes of their expression levels in Pjvk.sup.−/− mice above or below 1.5-fold relative to Pjvk.sup.+/+ mice. Major changes were found in four genes involved in redox metabolism, specifically, CypA, Gpx2, c-Dct, and, Mpv17, which encode cyclophilin A, glutathione peroxidase 2, c-dopachrome tautomerase and Mpv17, respectively. All these genes displayed a down-regulated expression in Pjvk.sup.−/− mice, a result confirmed by quantitative RT-PCR (qRT-PCR), and all encode proteins with antioxidant function. Glutathione peroxidase 2 and cyclophilin A are involved in the reduction of hydrogen peroxide (H.sub.2O.sub.2) into H.sub.2O, directly and indirectly via the activation of several peroxiredoxins, respectively (Lee et al., 2001; Evans & Halliwell, 1999). Although Mpv17 has a yet unknown activity, Mpv17-defect in both human and mouse results in a hepatocerebral mitochondrial DNA depletion syndrome with profound deafness (Binder et al., 1999) reported in the mutant mice and reactive oxygen species (ROS) accumulation (Meyer zum Gottesberge et al., 2001). Finally, c-dopachrome tautomerase decreases cell sensitivity to oxidative stress by increasing reduced glutathione (GSH) level, the major small antioxidant molecule of the cell (Michard Q et al, 2008a; 2008b). The antioxidant defence in the cochlea of 3 weeks old Pjvk.sup.−/− mice was then assessed by measuring the level of oxidized glutathione (GSSG) and the ratio between reduced and oxidized glutathione (GSH:GSSG). GSSG content was increased about 3 fold in Pjvk.sup.−/− cochlea compared to Pjvk.sup.+/+ (1.80±0.57 nmole/mg protein and 0.57±0.12 nmole/mg protein, respectively; unpaired t-test, p=0.01), whilst GSH level was moderately decreased in Pjvk.sup.−/− cochlea compared to Pjvk.sup.+/+ (4.91±0.80 nmole/mg protein and 6.42±0.92 nmole/mg protein, respectively; unpaired t-test, p=0.05). The ratio of GSH:GSSG decreased in Pjvk.sup.−/− cochlea compared to Pjvk.sup.+/+ cochlea (3.45±1.77 and 11.74±1.90 in Pjvk.sup.−/− and Pjvk.sup.+/+ cochlea, respectively; unpaired t-test, p<0.001) (
(89) The presence of possible ROS damage in Pjvk.sup.−/− mice was thus tested. Lipids are natural targets of oxidation by ROS; 4-hydroxy-2-nonenal (4-HNE), a by-product of lipid peroxidation, was not immunodetected in P15 Pjvk.sup.−/− cochlea but both the hair cells and cochlear ganglion neurons were labelled in P30 Pjvk.sup.−/− mice with a marked increase at P60 (
(90) 5. Pejvakin is a Peroxisomal Protein
(91) In order to assess the subcellular localization of pejvakin, HeLa cells were transfected with recombinant vectors expressing the GFP-tagged C-terminal or N-terminal regions of mouse pejvakin and obtained a diffuse labelling throughout the cytoplasm. Pejvakin detection by immunolabeling also turned out to be unsuccessful, as none of the antibodies (commercially available or generated in the lab), specifically recognized this protein. Considering the very limited sequence divergence of pejvakin amino-acid sequence among vertebrates, it was attempted to elicit an antibody response in Pjvk.sup.−/− mice. A monoclonal antibody (Pjvk-G21) was obtained, that revealed a punctuate immunostaining throughout the cytoplasm of transfected HeLa cells expressing pejvakin, absent in non-transfected cells. Co-staining with a marker of peroxisomes (peroxisome membrane protein 70, PM P70) revealed a strict colocalisation between pejvakin and peroxisomes (
(92) 6. Pejvakin Role in Peroxisome Proliferation
(93) In HepG2 cells, protrusions emerging from some peroxisomes, the first step of peroxisome biogenesis from pre-existing peroxisomes, were immunoreactive for pejvakin. String-of-beads structures corresponding to elongated and constricted peroxisomes, preceding final fission (Smith and Aitchison, 2013), were also pejvakin-immunoreactive, suggesting a role of this protein in peroxisome proliferation (
(94) Both the decrease of peroxisome density and the development of enlarged peroxisomes in cells expressing the mutated forms of pejvakin suggested that mutation in pjvk results in a defect of peroxisome proliferation.
(95) Based on these results, peroxisome distribution and morphology in Pjvk.sup.−/− mice were investigated. Peroxisomes in Pjvk.sup.−/− and Pjvk.sup.+/+ cochlea were labelled using catalase detection by 3,3′-diaminobenzidine (DAB) and analysed in transmission electron microscopy (TEM;
(96) Moreover peroxisomes just below the cuticular plate were slightly but significantly larger and also less numerous in Pjvk.sup.−/− compared to Pjvk.sup.+/+ mice (peroxisome area Pjvk.sup.+/+ 0.125 vs. Pjvk.sup.−/− 0.16 μm.sup.2, p<0.05, and peroxisomes at the cuticular plate/cell Pjvk.sup.+/+=2.45 vs Pjvk.sup.−/−=1.91) (
(97) Because Pjvk.sup.−/− mice displayed features of marked oxidative stress in the cochlea, we investigated the possible role of pejvakin in peroxisome proliferation in response to oxidative stress induced by H.sub.2O.sub.2 (Lopez-Huertas et al., 2000). Embryonic fibroblasts derived from Pjvk.sup.+/+ and Pjvk.sup.−/− mice were exposed to H.sub.2O.sub.2 (see Extended Experimental Procedures). In unexposed cells, the number of peroxisomes was similar between the two genotypes (t-test, p=0.82). After H.sub.2O.sub.2 treatment, it increased by 46% in Pjvk.sup.+/+ fibroblasts (p=0.004), but remained unchanged in Pjvk.sup.−/− fibroblasts (p=0.83), resulting in a statistically significant difference between the two genotypes (p<0.001;
(98) The lack of pejvakin thus results in an in vivo peroxisomal morphological defect that occurs after hearing onset.
(99) 7. Pjvk Transcriptional Regulation Belong to the Adaptive Response to Sound
(100) It was then asked whether this pathological condition was relevant to the cochlear physiological response to sound. Noise overexposure is known to induce oxidative stress due to the overproduction of oxygen species resulting from cellular hyperactivity that overwhelm the antioxidant defence of the cells. Could transcription of the pjvk gene be modulated by sound exposure? The level of Pjvk transcripts and of CypA, Gpx2, c-Dct, and Mpv17 transcripts, the down regulated genes observed in Pjvk.sup.−/− mice, were first measured in microdissected organs of Corti from non-stimulated and over-stimulated by sound (5-40 kHz, 105 dB SPL for 1 hour) P21 wild-type mice, at various times (1, 3, 6, and 18 hours) after the sound exposure, by qRT-PCR (
(101) In contrast to sound overexposure that produces a permanent auditory thresholds shift (PTS), exposure to low acoustic energy can result in a temporary thresholds elevation (TTS), which indicates a reversible stress of the cochlea. A TTS is evoked by sound preconditioning, which refers to a low energy sound stimulation that exerts a protective effect against a subsequent sound overexposure (Roy et al., 2013). To test whether pejvakin transcriptional up-regulation could also be implicated in sound-preconditioning, P21 mice were exposed to standard preconditioning sound stimulation (5-40 kHz at 90 dB SPL for 2 hours) (Roy et al., 2013), and the expression level of Pjvk, c-Dct, CypA was measured after 6 hours by qRT-PCR. Sound preconditioning up regulated the expression of Pjvk and CypA (2.69±0.42 fold and 3.99±1.32 fold, respectively) but not of c-Dct (
(102) 8. Hypervulnerability to Sound of DFNB59 Affected Patients
(103) Finally, it was asked whether hearing of DFNB59 patients was also hypervulnerable to sound exposure. Five patients carrying the p.T54I mutation who were living in Iran were tested (Delmaghani et al., 2006). Transient-evoked OAEs (TEOAEs) testing OHC function over a broad range of frequencies were analysed. All patients had bilateral broadband TEOAEs despite pure-tone audiograms showing severe hearing impairment (from 66 dB HL at 250 Hz to 84 dB at 8 kHz).
(104) To test their possible hearing hypervulnerability to sound, a minimal sound exposure eliciting ABRs was used. ABR waves were clearly identified in response to 250 impulse stimuli—clicks—at 99 dB above normal detection threshold. Extending sound exposure to 1000 stimulus presentations (the standard clinical procedure for ABR recording), spectacularly affected ABR waves. The equivalent of mouse ABR-wave IV, wave V, the most reliably spotted wave after the shortest sound exposure, 250 clicks, exhibited after 500 then 1000 clicks, a progressive decrease in amplitude (to 39±30% of its initial amplitude,
(105) Therefore, in DFNB59 patients as in pejvakin-deficient mice, IHC, OHC, and neuronal responses are affected by abnormally low energy sound-exposure.
(106) These results predicted that sound-exposure would lead to peroxisome proliferation in the auditory system of wild-type mice. Six hours after exposure (5-40 kHz, 105 dB SPL for 1 hour), the numbers of peroxisomes were unchanged (34.5±0.8 and 35.9±1.0, mean±SEM, per IHC from unexposed and sound-exposed mice, respectively, n=75 cells from 6 mice; t-test, p=0.25). However, at 48 hours, they had markedly increased, by a factor of 2.3, in both IHCs and OHCs (84.7±5.0 per IHC and 16.5±1.0 per OHC, n=90 cells and n=150 cells from 6 mice, respectively) compared to unexposed mice (36.8±3.0 per IHC and 7.3±0.4 per OHC, n=90 cells and n=150 cells from 6 mice, respectively; t-test, p<0.0001 for both comparisons). The number of peroxisomes had also increased, by 35%, in the dendrites of primary auditory neurons (1.7±0.1 and 2.3±0.2 peroxisomes per μm of neurite length, n=40 neurites from 5 unexposed and 5 sound-exposed Pjvk.sup.+/+ mice, respectively; t-test, p=0.003;
(107) 9. Therapeutic Approaches of the DFNB9 Form of Deafness
(108) The above results validate Pjvk.sup.−/− mice as a model to investigate therapeutic approaches for human deafness. Based on these results, the effect of antioxidants was tested on the auditory function of Pjvk.sup.−/− mice. N-acetyl cysteine, the most common antioxidant, and taurine, were ingested by mothers during and after pregnancy so that pups received them from birth on by feeding on the mother's milk. When tested around P21, treated Pjvk.sup.−/− pups (n=21) raised in batches of about 10, i.e., maximally exposed to natural sound exposure, had for most of them, no DPOAE, thus N-acetyl cysteine and taurin had no beneficial effect on OHCs. The ABR thresholds were however slightly improved only in NAC-treated Pjvk.sup.−/− pups compared to those of untreated Pjvk.sup.−/− pups (n=24) (e.g. at 10 kHz, 72.2±9.3 dB SPL, as against 84.4±6.3 dB SPL, p<0.001) (
(109) Because a full recovery of the neural phenotype was obtained by intracochlear injection of AAV8 expressing the murine Pjvk cDNA, the potential of AAV2/8, which transduces hair cells exclusively, to rescue the hair-cell phenotype was tested in Pjvk.sup.−/− mice (n=7). Auditory function of Pjvk.sup.−/− mice injected on P3 by this vector expressing the pejvakin cDNA (mPjvk-IRES-GFP) were examined at P21 and the percentage of transduced by IHC and OHC in every cochlea was evaluated by the fluorescence of GFP. A partial reversion of OHC function with detectable DPOAEs was obtained, with a decrease in DPOAE thresholds (from 80 dB in untreated ears, to 57.1±14.7 dB in treated ears), with a highly significant linear correlation (R.sup.2=0.72, p<0.001) with the number of GFP-tagged OHCs in the treated ear (
(110) Finally, the effect of the transduction of Pjvk.sup.−/− IHCs by AAV2/8-Pjvk-IRES-EGFP on their peroxisomes was investigated. Before sound-exposure, the numbers of peroxisomes in IHCs of P21 Pjvk.sup.−/− and AAV2/8-Pjvk-IRES-EGFP injected Pjvk.sup.−/− mice did not differ from that of Pjvk.sup.+/+ mice (30.5±1.9, 32.3±2.1, and 36.8±3.0 peroxisomes, mean±SEM per IHC, n=60 cells from 4 Pjvk.sup.−/− and 4 AAV2/8-Pjvk Pjvk.sup.−/− mice, and n=90 cells from 6 Pjvk.sup.+/+ mice, respectively; t-test, p=0.11 and p=0.30, respectively). By contrast, 48 hours after sound-exposure (5-40 kHz) at 105 dB SPL for 1 hour, the number of peroxisomes had decreased by 63% in Pjvk.sup.−/− IHCs (30.5±1.9 and 11.2±1.3 peroxisomes per IHC, n=75 cells from 5 unexposed and 5 sound-exposed Pjvk.sup.−/− mice, respectively; t-test, p<0.0001), and enlarged PMP70-labeled structures were present close to the nucleus (
(111) These results show that gene therapy approaches could provide protective or therapeutic opportunities in DFNB59 affected patients.
(112) Discussion
(113) Noise overexposure is a major and increasingly prevalent cause of hearing loss accounted for by the overcrowding of the towns and the overuse of portable music players by younger children, worldwide. Noise-induced hearing loss (NIHL), considered as the most preventable and treatable/remediable hearing impairment, currently does not benefit of efficient therapeutic intervention. This situation echoes the still limited information regarding its underlying pathogenic processes as well as its genetic susceptibility. The above-disclosed results uncovered a new origin of NIHL by showing that pejvakin defect in mouse and human (DFNB59 patients) leads to a hypervulnerability to sound due to a peroxisomal deficiency. No such a hypersensitivity to sound has ever been reported. This study introduces the peroxisome as a key regulatory organelle of the redox homeostasis of the auditory system, pivotal to cope with ROS overproduction induced by high acoustic energy. It shows that pejvakin is involved in peroxisome proliferation. This understanding pinpoints hearing impairment in DFNB59 patients as calling for a specific management and suggests that pejvakin and the proteins of its associated networks may be useful for preventing and curing NIHL.
(114) Acoustic energy is the main factor that determines the damaging effects of exposure to loud sounds. The so-called Lex index for workplace noise exposure has been introduced to calculate the energies delivered by sounds of different levels and time courses in order to evaluate and compare their detrimental potential (see material and methods). The legal limit in western countries varies from 80 to 90 dBA Lex, an acoustic energy not leading to a permanent threshold shift (PTS). In Pjvk.sup.−/− mice a single exposure to a 63 dBA Lex produces an about 30 dB hearing threshold elevation. As the dB scale is a logarithmic one, a 3-dB increase translates in a two-fold increase in energy, and a 10-dB increase in a ten-fold increase in energy. Up until now, the lowest dBA Lex reported as producing an elevation of the hearing threshold in wild type mice of the same background strain as Pjvk.sup.−/− mutants was 73 dB (10 times fold more energetic) (Housley G, 2013). Moreover it was a temporary threshold shift (TTS) of only 18 dB with a recovery time constant of twelve hours compared to the threshold shift of 30 dB with a recovery time constant of about one week in Pjvk.sup.−/− mice. The second observation herein made, is that the natural acoustic environment of a mouse litter, due to pup cries in relation to feeding and crowding, is about 83 dBA Lex in a cage of 10 pups (100 times fold more energetic than the sound exposure affecting hearing threshold of Pjvk.sup.−/− mice) during the few days from the onset of hearing to weaning. This possible effect of this natural exposure to high acoustic energy has been overlooked so far in the studies carried out on NIHL. Based on the present results, it should be systematically taken into account in future works addressing the origin of the variability of the hearing threshold in the mouse. Because transduction in hair cells begins to operate more and more efficiently with the progressive increase of the endocochlear potential from P5 to P17 (Sadanaga and Morimitsu, 1995), this raises the possibility that hearing loss in Pjvk.sup.−/− mice might be due entirely to naturally occurring sound exposure. Consistently when mouse pups are kept in small numbers (pups n=2) with foster mothers and in quiet rooms, their hearing thresholds is 30 dB lower, on average (and 60 dB lower, in some individuals) than their littermates maintained in their regular sound environment. DFNB59 patients, who carry deleterious mutations in PJVK, also display an astonishing sound sensitivity, since it is evidenced under the standard conditions used in clinics to record ABRs in response to impulse sounds. At a 57 dBA Lex, these sounds, routinely used for audiological diagnosis at much higher levels induced in all tested DFNB59 patients large changes in their evoked responses, with an increase in latency of all identifiable waves, which often exceeded 0.5 ms for wave V, and a two- to three-fold decrease in amplitude of these waves. Such changes are never observed in a sample of 13 patients with matched hearing thresholds and auditory profile could be exposed to at least four times as much acoustic energy without suffering any change in latency or amplitude of their auditory evoked potentials. These hearing features unique to DFNB59 patients, and akin to auditory fatigue, were reversible after 10 min in silence.
(115) The effects of loud sound of excessive energy are two-pronged, —mechanical alterations affecting the stereocilia bundles including inter-stereociliary links and the cell-cell junctions of the auditory hair cells and—cellular hyperactivity related disturbances leading to an excessive release of glutamate by the IHC synapses that results in excitotoxicity, characterized by a swelling of the post-synaptic dendrites of their afferent neurons. A strong emphasis is increasingly placed/put on the contribution of oxidative stress to NIHL, a condition in which the production of ROS, including oxygen-based free radicals and hydrogen peroxide, H.sub.2O.sub.2, exceeds the capacity of the antioxidant defence systems, and subsequently creates oxidative cellular damages of DNA, proteins and lipids becoming progressively irreversible (Henderson et al., 2006). Superoxide radical (O.sub.2..sup.−) and the hydroxyl radical (OH.sup.−), have indeed been observed in the cochlea after noise exposure (Yamane et al., 1995; Ohlemiller et al., 1999b; Ohinata et al., 2000; Yamashita et al., 2004). Also supporting the key role of the oxidative stress in NIHL, defect in Cu/Zn superoxide dismutase, SOD1 that converts O.sub.2..sup.− in H.sub.2O.sub.2 (Ohlemiller et al., 1999a), and in glutathione peroxidase 1 (Gpx1) that reduces H.sub.2O.sub.2 in H.sub.2O (Ohlemiller et al., 2000), both proposed to lead to H.sub.2O.sub.2 accumulation, and an increase of susceptibility to NIHL. The present work establishes that the defect in pejvakin impacts the cellular redox status of the auditory system followed by ROS induced cellular damages: (i) in Pjvk.sup.−/− mice already at P15, whilst no morphological anomalies can be detected, the down regulated expression of Mpv17, CypA, Gpx2 and c-Dct indicate that the organ of Corti is submitted to an oxidative stress: an increase of ROS production (Mpv17) and a decrease in the reduction of H.sub.2O.sub.2 (CypA, Gpx2, c-Dct) then converted in OH by the Haber-Weiss and the Fenton reactions, are indeed predicted (ii) at around P21, markers the oxidative stress, the increase in GSSG as well the decrease in GSH:GSSG ratio, are observed (iii) at P30, lipid peroxidation by OH in hair cells and auditory neurons reveals ROS induced cellular damage (iv) hair cell and auditory neuron loss present throughout the cochlea but the apical region from P60 onwards (data not shown). OHCs, display an especially high vulnerability to noise, whilst IHCs are also susceptible but to a lesser degree (Wang et al., 2002). Sound vulnerability is well known to extend to the primary auditory neurons (that compose the spiral ganglion nerve) (Kujawa and Liberman, 2009), as well as the central auditory pathways including the cochlear nucleus, the inferior colliculus and even the auditory cortex (Imig and Durhan, 2005; Basta et al., 2005; Pienkowski and Eggermont, 2009). Of note Pjvk.sup.−/− mice, Pjvk.sup.fl/flMyo/5-cre.sup.+/− mice and rescuing targeted to auditory neurons or hair cells, unambiguously show that all the cells here explored, the sensory hair cells (with a more pronounced effect on the OHCs), the primary auditory neurons and neurons of the brainstem, are indeed hypervulnerable to sound in the absence of pejvakin.
(116) Noise exposure highly solicits the mitochondrial activity to generate large amount of ATP through aerobic respiration which in parallel produces ROS (Ohlemiller et al., 1999b) and its intermediate of formation, H.sub.2O.sub.2. In particular, O.sub.2..sup.−, a by-product of the mitochondrial oxidative phosphorylation, is generated through the capture of an electron (derived from the activity of complex I and complex III) by molecular oxygen, O.sub.2. Recent results further documented this ROS production by showing that the decrease of mitochondrial NAD.sup.+ induced by noise exposure, reduces the activity of sirtuin 3, a mitochondrial NAD.sup.+-dependent deacetylating/deacylating enzyme which is essential to the functioning of numerous mitochondrial enzymes (He et al., 2012; Han and Someya, 2013).
(117) The association of pejvakin with peroxisomes and the structural alterations of peroxisomes in Pjvk.sup.−/− mice, including the presence peroxisome-derived matrix in the perinuclear region, reminiscent of the translocation of damaged mitochondria at the same emplacement (Okatsu et al., 2010), unveiled the first peroxisomal origin of an isolated form of inherited deafness. This peroxisomal deficiency in addition underlies an auditory phenotypic variability that has no equivalent so far, and that can be attributed to a hypersensitivity to natural environmental noise. No attention has been payed to this organelle in the auditory system so far, with the exception of a recent report indicating that cultured organ of Corti in the presence of a proteasome inhibitor leads to hair cell degeneration associated with peroxisome dysfunction (Lee et al., 2015). In the various forms of Zellweger syndrome, the most severe peroxisome biogenesis disorders (peroxisomes can be undetectable), sensory hearing impairment has been reported. Probably due to the focus on the associated impaired vital functions which includes a ubiquitous failure of neuronal conduction, auditory tests have not been extended beyond ABRs threshold measurements. The defective neuronal conduction has been attributed to the faulty synthesis of two essential components of the myelin sheaths, plasmalogens and DHA (docosahexaenoic acid), which is critically dependent on peroxisomes, and this conclusion extended to the pathogenesis of the hearing defect. Our results suggest that this hypothesis should be revisited. Contrary to peroxins defective in Zellweger syndrome, our results point to an essential role of pejvakin, restricted to cells of the auditory pathway. This is in line with the well-known extreme diversity of the peroxisomes in shape, density and protein/enzyme equipment and concentration, from one cell type to another, which may explain that, although expressed in a large variety of cells, pejvakin may be essential only in a few. Also contrary to peroxins, pejvakin is dispensable for the constitutive biogenesis of peroxisomes, and the structural failures of this organelle become apparent only in the context of the redox stress elicited by sound. In principle, sound hypervulnerability of Pjvk.sup.−/− mice may be the manifestation of an exacerbation by sound of pre-existing redox homeostasis failure, with at ultimate stage, perinuclear inclusions containing catalase and probably other factors too, contributing to cell degeneration. However Pjvk transcriptional up-regulation in wild type mice, immediately upon a sound exposure, whether being traumatic (leading to PTS) or protective (leading to PTS) that is likely involving in the immediate adaptive antioxidant response to noise, pinpoints the existence of a peroxisomal response as part of the physiological response to high acoustic energy. The ability of the peroxisomes to rapidly adapt to the demand created by changes in environmental and physiological conditions, thanks to a panel of possible adjustments (dynamic shape and size changes, proliferation, degradation, and modification of their molecular content), grants them with an amazing functional plasticity. These organelles, actively contribute to cellular redox homeostasis by producing (by its rich content in oxidases, SOD1, and SOD2) and degrading H.sub.2O.sub.2 (02 being possibly also involved in this transduction) by peroxidases (Schrader and Fahimi, 2006; Bonekamp and Schrader, 2009; Fransen et al., 2012).
(118) Transfection experiments indicate that pejvakin is involved in peroxisome proliferation. Although its exact role in this process cannot be directly inferred from the changes of peroxisome shapes observed upon expression of mutated forms of pejvakin, the observed enlarged and spherical-like PMP70 positive structures, indicates the involvement of pejvakin in the pathway leading to the formation of new peroxisomes from pre-existing peroxisomes. This pathway, referred to as growth and fission cycle, is faster than the other one, the de novo formation in which peroxisomes form from endoplasmic reticulum derived vesicles (for a review see Smith and Aitchison, 2013). The growth and fission cycle involves the emergence of an elongation from pre-existing spherical peroxisomes. This elongation process is mediated by Pex11β and Pex11α (Delille et al., 2010; Koch et al., 2010; Li et al., 2002; Schrader et al., 1998), which consistently were associated with 70% and 55% of the pejvakin stained peroxisomes in HepG2 cells. Moreover, stress-induced peroxisome formation pathway, involves the recruitment of COP1, which promotes membrane protrusion at the elongation initiation site (Lay et al., 2006; Passreiter et al., 1998), where pejvakin colocalises. Altogether the present results provide evidence that sound-stress evokes a pejvakin-dependent peroxisomal response that leads to the generation of new peroxisomes from pre-existing ones. They also involve the peroxisome in redox signalling pathway elicited by sound, that likely uses H.sub.2O.sub.2, as signal molecule. In coherence, H.sub.2O.sub.2 has been shown to up-regulate the expression of peroxisome biogenesis genes (Lopez-Huertas et al., 2000) and induced elongation of the peroxisomes has been blocked by antioxidants (Schrader et al., 1999). Other roles could be ensured by this pejvakin-dependent stress-induced proliferation of peroxisomes, such as a matrix import of ROS degrading or scavenging molecules within peroxisomes (Motley, 2007) or a regulation of the activity of their redox enzymes by their changes in shape (Lizana, 2008). Of note, whilst peroxisome proliferation has been reported either to induce oxidative stress (Reddy et al., 1980) or to reduce ROS production (Santos et al., 2005; Diano et al., 2011), the rapid transcriptional up regulation response already set up one hour after sound exposure and in addition observed under PTS generating conditions, as well as the early massive oxidative stress detected in Pjvk.sup.−/− mice, argue for an antioxidant role of pejvakin-dependent peroxisomal proliferation in the context of noise-induced oxidative stress. Finally, the transcriptional down-regulation of CypA encoding cyclophilin A and c-Dct encoding the dopachrome tautomerase, in Pjvk.sup.−/− mice and conversely, their transcriptional up-regulation (limited to the highest energy sound tested for c-Dct) associated with the transcriptional up-regulation of Pjvk in response to sound exposure in wild type mice, indicates that these proteins may belong to the same redox homeostasis pathway.
(119) The conclusion is that as a result of peroxisomal deficiency, ROS metabolism is perturbed enough, so that sound of normally harmless energy can become harmful, has never been brought forward or tested, as done here in DFNB59 patients and Pjvk.sup.−/− mice. In patients, conventional intervention in case of sensorineural hearing impairment includes sound amplification by hearing aids and cochlear implant fitting, depending on the degree of impairment. However, conventional hearing aids, routinely used in severely hearing-impaired patients, might have harmful results in DFNB59 patients, as exposure to amplified sound is expected to lead to long-lasting damage to cochlear sensory cells and auditory neurons. Cochlear implant, an acoustico-electronic device that bypasses the cochlea and delivers a direct electrical stimulation to the primary auditory neurons, which is particularly beneficial for patients affected by profound deafness of cochlear origin, should similarly increase ROS in these neurons, thereby threatening their long-term survival. In both cases, specific protection against the production or the effects of the ROS is anticipated to be mandatory. However, used alone in the absence of pejvakin, N-acetyl cysteine, the most effective antioxidant drug here observed, had only a limited impact on the sensory hair cells although it reduces some adverse effects of controlled sound exposures in Pjvk.sup.−/− mice, restoring in particular the number of auditory neurons able to respond in synchrony to a loud tone-burst. Molecules targeting ROS metabolism might thus provide some benefice to DFNB59 patients. Moreover, our results on AAV-mediated Pjvk-cDNA transfer in Pjvk.sup.−/− mice clearly show that gene therapy has the potential to fully protect all these cells. Finally, after an acoustic trauma, subjects often experience protracted worsening of their hearing lesions in relation to disrupted ROS cellular homeostasis, which Pjvk gene therapy could improve.
(120) Gene Therapy for Treating Usher Syndrome
Background of the Invention
(121) As yet described above, hearing impairment—herein defined as referring to any hearing defect that can either be congenital or not—is a major concern and a serious burden for Public health.
(122) The early-onset forms of severe deafness are mostly genetic in origin and are frequently due to sensory hair cells defect.
(123) In particular, Usher syndrome (USH) is an autosomal recessive disease that affects both the inner ear and the retina. It is the most frequent cause of hereditary deaf-blindness, affecting 1 child in 25,000.
(124) The following three USH clinical subtypes have been defined: USH type I (USH1), the most severe, involves severe to profound congenital sensorineural deafness, constant vestibular dysfunction and retinitis pigmentosa with prepubertal onset; USH2 differing from USH1 mainly in the deafness being less severe, the absence of vestibular dysfunction and the onset of retinitis pigmentosa after puberty; and USH3 differing from USH1 and USH2 in the progressiveness of hearing loss and the occasional presence of vestibular dysfunction.
(125) USH1 is genetically heterogeneous. Seven loci responsible for this disease have been defined and called USH1A-G, with four of the corresponding genes having been identified: USH1B, C, D and F. USH1B encodes the actin-based motor protein myosin Vila. USH1C encodes harmonin which is a PDZ domain-containing protein. Mutations in the genes encoding two cadherin-related proteins, cadherin 23 and procadherin 15, have been shown to cause USH1D and USH1F, respectively.
(126) Studies of USH1G-affected families allowed to identify SANS, the human orthologue of the gene defective in Jackson shaker (js) mutant mice, as the causative gene (Mustapha et al., 2002; Weil et al., 2003).
(127) Current clinical approaches to remedy hearing impairment, in particular USH, include hearing aids for mild to moderate impairments and cochlear implants for severe to profound impairments. These existing solutions are however not curative treatments and are not adapted to noisy environments.
(128) There is thus a need in the art for therapeutic approaches to cure genetic forms of human deafness with or without balance defects, in particular USH, yet in particular USH1G.
(129) In this aim, the present inventors studied Ush1g knock-out mice (Ush1g.sup.−/− model as described in Caberlotto et al., 2011). This study allowed them to provide a virally-mediated gene therapy for restoring genetically-impaired auditory and vestibular functions. More precisely, their results show that it is possible to efficiently target hair cells and to restore the normal morphology of both cochlear and vestibular hair bundles, which is shown to be critical for auditory and balance functions.
(130) These findings have major therapeutic implications, as described below.
DETAILED DESCRIPTION OF THE INVENTION
(131) In Vivo Administration of a USH1 Gene Product: Vectors
(132) According to the present invention, an USH1 gene product, preferably the SANS protein, is administered to a subject in need thereof by in vivo gene therapy wherein the gene product/protein of interest is produced in situ in the appropriate auditory cells.
(133) Two alternative strategies for gene therapy can be contemplated for treating subjects in need thereof. One strategy is to administer a vector encoding the gene of interest directly to the subject. The second is to use cells that have been i) removed from the subject and ii) treated ex vivo with a vector expressing the gene of interest; these cells are then re-administered to the same subject.
(134) As used herein, the term “subjects” is intended to mean humans or non-human mammals such as primates, cats, dogs, swine, cattle, sheep, goats, horses, rabbits, rats, mice and the like. In a preferred embodiment, said subjects are human subjects. This definition applies to all aspects and embodiments of the present invention.
(135) Thus, in an aspect, the present invention relates to vectors expressing at least one USH1 gene product, in particular AAV2/8 vectors expressing at least one USH1 gene product, preferably expressing at least the SANS gene product.
(136) In one embodiment, the AAV2/8 vector of the invention comprises a nucleic acid sequence encoding at least one USH1 gene product, preferably encoding at least the SANS gene product.
(137) In another embodiment, the AAV2/8 vector of the invention comprises at least one nucleic acid sequence of an USH1 gene, preferably at least the SANS gene.
(138) According to the present invention, the vector is of interest as it is capable of expressing a functional protein.
(139) As indicated, the vector of the invention is a viral vector that is able to transfect the cells of the auditory pathway and, more specifically, to target hair cells.
(140) Among well-known viral vectors, adeno-associated viruses (AAV) vectors display several advantages such as i) a long lasting expression of synthesized genes (Cooper et al, 2006), ii) a low risk for pathogenic reactions (because they are artificially manufactured and not ototoxic), iii) they trigger low immunogenic response, and iv) they do not integrate the human genome (Kaplitt et al., 1994). AAV is therefore preferred to produce in situ a functional USH1 gene product in order to efficiently cure USH1 syndrome.
(141) The Inventors could show that AAV serotypes have different cell tropism in the cochlea. Accordingly, they could select an AAV2/8 configuration (i.e., vectors having the nucleotide sequence of an AAV2 genome that is modified so as to encode AAV8 capsid proteins) as being the most efficient to target hair cells (
(142) Thus, in the context of the present invention, the vector expressing an USH1 gene product, preferably expressing the SANS protein, yet preferably expressing the SANS protein of amino acid sequence SEQ ID NO:49, is an AAV2/8 vector, preferably comprising a viral nucleic acid sequence SEQ ID NO:47 and/or SEQ ID NO:48.
(143) In one embodiment, the AAV2/8 vector of the invention comprises a viral nucleic acid sequence of SEQ ID NO:47 and/or SEQ ID NO:48.
(144) Advantageously, the AAV2/8 vector of the invention comprises both viral nucleic acid sequences SEQ ID NO:47 and SEQ ID NO:48, both of them forming an empty AAV2/8 vector, wherein a USH1 gene is in turn incorporated.
(145) In one embodiment, said USH1 gene is the SANS gene product having the amino acid sequence SEQ ID NO:49.
(146) In another aspect, the present invention also relates to a vector as described above, for use as a medicament.
(147) In Vivo Administration of a USH1 Gene Product: Viral Particles
(148) In another aspect, the present invention relates to viral particles comprising at least one vector as described above.
(149) Advantageously, the viral particles of the invention are infectious viral particles.
(150) In yet another aspect, the present invention relates to such viral particles, for use as a medicament.
(151) Pharmaceutical Compositions
(152) Vectors and/or viral particles of the invention as described above can be incorporated into pharmaceutical compositions suitable for an administration to a subject.
(153) Accordingly, another aspect of the present invention concerns a pharmaceutical composition comprising at least one vector of the invention and/or at least one viral particle of the invention, and a pharmaceutically acceptable carrier.
(154) As used herein, the term “pharmaceutically acceptable carrier” refers to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. In many cases, it can be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers can further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the vector(s) and/or viral particle(s) or of the pharmaceutical compositions containing same. This definition applies to all aspects and embodiments of the present invention.
(155) The pharmaceutical compositions of the invention may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. The form used depends on the intended mode of administration and therapeutic application. Typical compositions are in the form of injectable or infusible solutions.
(156) Pharmaceutical compositions typically must be sterile and stable under the conditions of manufacture and storage. The pharmaceutical composition of the invention is preferably formulated as a solution, microemulsion, dispersion, liposome, or other ordered structure suitable to high drug concentration. Sterile injectable solutions can be prepared by incorporating the vector(s) and/or the viral particle(s) of the invention in the required amount in an appropriate solvent optionally with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the vector(s) and/or the viral particle(s) of the invention into a sterile vehicle that contains a basic dispersion medium and optionally other ingredients from those enumerated above, as required. In the case of sterile lyophilized powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and spray-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The proper fluidity of a solution can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prolonged absorption of injectable compositions can be achieved by including an agent in the compositions that delays absorption, for example, monostearate salts and/or gelatine.
(157) In the context of the invention, the typical mode of administration of the composition of the invention is a local administration, or intratympanic (in the middle ear) or intracochlear, or parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular, intrathecal). In one example, the pharmaceutical composition of the invention is delivered to a specific location using stereostatic delivery, particularly through the tympanic membrane or mastoid into the middle ear of a subject. In one example, the pharmaceutical composition of the invention is injected in the cochlea of a subject.
(158) In another example, the pharmaceutical composition of the invention is administered by intravenous infusion or injection. In another example, the pharmaceutical composition of the invention is administered by intramuscular or subcutaneous injection. In another example, the composition of the invention is administered perorally.
(159) Preferably, the pharmaceutical composition of the invention is injectable, yet preferably it is injectable in the cochlea of a subject.
(160) The pharmaceutical compositions of the invention include a “therapeutically effective amount” of the vectors and/or the viral particles of the invention. A “therapeutically effective amount” refers to the amount of the vectors and/or the viral particles of the invention that is effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result in a subject in need thereof, in this case to efficiently treat hearing impairment, preferably USH1 syndrome, yet preferably USH1G syndrome, without unacceptable toxicity or undesirable side effects.
(161) A therapeutically effective amount of the vectors and/or the viral particles of the invention can vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of said vectors and/or said viral particles to elicit a desired response in same. A therapeutically effective amount can also be one in which any toxic or detrimental effects of the vectors and/or the viral particles are outweighed by the therapeutically beneficial effects.
(162) Dosage regimens can be adjusted to provide the optimum desired response (e.g., to cure USH1G syndrome). For example, a single bolus can be administered, several divided doses can be administered over time or the dose can be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It can be especially advantageous to formulate injectable compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit containing a predetermined quantity of the vector(s) and/or the viral particle(s) of the invention calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms can be dictated by and directly dependent on (a) the unique characteristics of the vector(s) and/or the viral particle(s) and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of formulating such vector(s) and/or the viral particle(s) for treating Usher syndrome, in particular USH1 syndrome, preferably USH1G syndrome, in a subject in need thereof.
(163) Use for Treating USH1 Hearing Impairment
(164) A further aspect of the present invention relates to vectors and/or viral particles and/or pharmaceutical compositions as described above, for use in a method for treating Usher syndrome in a subject in need thereof.
(165) In other words, the present invention relates to the use of a vector and/or a viral particle and/or a pharmaceutical composition, in a method for treating Usher syndrome in a subject in need thereof.
(166) These methods preferably comprise an injection, preferably a cochlear injection, of said vector.
(167) Yet in other words, the present invention relates to a method for treating Usher syndrome in a subject in need thereof, comprising administering to said subject, preferably by injection, a vector and/or a viral particle and/or a pharmaceutical composition. In a particular embodiment, said injection is a cochlear injection.
(168) In another aspect, the present invention relates to the use of the vectors and/or the viral particles of the invention for manufacturing pharmaceutical compositions intended to treat subjects suffering from Usher syndrome, in particular from USH1 syndrome, preferably from USH1G syndrome.
(169) Preferably, said pharmaceutical compositions are as described above.
(170) Kit
(171) In another aspect, the present invention relates to a kit comprising, in one or more containers in a single package, at least one vector and/or at least one viral particle and/or at least one pharmaceutical composition as described above, and means for injecting said vector(s) and/or viral particle(s) and/or pharmaceutical composition(s).
(172) Accordingly, the vector(s) and/or the viral particle(s) and or the pharmaceutical composition(s) in the kit are capable of expressing at least one USH1 gene product, preferably of expressing the SANS gene product, advantageously for use in a method for treating Usher syndrome, in particular USH1 syndrome, preferably USH1G syndrome in a subject in need thereof.
(173) In one embodiment, the means for injecting said vector(s) and/or viral particle(s) and/or pharmaceutical composition(s) as provided in the kit of the invention include or are means for a cochlear injection of said vector(s) and/or viral particle(s) and/or pharmaceutical composition(s).
(174) Particular kits according to the present invention further comprise a means for communicating information and/or instructions and/or recommendations to allow a proper use of the kits' elements.
Examples
(175) I. Material and Methods
(176) Animals
(177) Experiments on mice were carried out according to Institut National de la Santé et de la Recherche Médicale and Institut Pasteur welfare guidelines.
(178) Animals were housed in the Institut Pasteur animal facilities accredited by the French Ministry of Agriculture to perform experiments on live mice.
(179) Knockout sans mice (Ush1g.sup.−/−) were generated, as described in Caberlotto et al., 2011, in C57BL/6-129/Sv strain mice. Intracochlear injections were achieved on P2-P3 aged-mice.
(180) Viral Construction
(181) Recombinant AAV vectors were obtained from Penn Vector Core (Perelman, Philadelphia, Pa., USA) and SignaGen Laboratories (Bethesda, Md., USA) containing a CMV or CAG promoter driving expression of eGFP. AAV2/1-CAG-GFP and AAV2/1-CMV-GFP were produced at a titer of 1.2×10.sup.12 genome copies (gc)/mL by SignaGen Laboratories. AAV2/1-CAG-GFP-rhodopsine at a titer of 1.4×10.sup.13 gc/m L by Penn Vector Core. The AAV2/2-CAG-GFP was produced at a titer of 6.4×10.sup.13 gc/mL, by Penn Vector Core. The AAV2/5-CMV=-GFP was produced at a titer of 1.13×10.sup.13 gc/mL, by Penn Vector Core. The AAV2/8-CAG produced by SignaGen Laboratories at a titer of 1.6×10.sup.12 gc/m L. And the AAV2/8-CAG from Penn Vector Core had a titer of 1.4×10.sup.13 gc/m L.
(182) Murine Sans cDNA flanked by an IRES eGFP reporter cDNA sequence was subcloned into the multiple cloning site of the pENN.AAV.CB6.PI.rBG vector (Penn Vector p1045, Penn Medicine Vector Core).
(183) Vectors were generated by transient transfection of HEK293 cells using three plasmids: the cis ITR-containing plasmid, the trans plasmid encoding AAV replicase and capsid genes and the adenoviral helper plasmid. The recombinant vectors were purified by tangential flow filtration followed by iodixanol gradient purification and buffer exchange (Upenn website).
(184) Concentrated AAV2/8-mSANS-IRES-eGFP titer was 1.47×10.sup.13 genomes copies per mL.
(185) Virus aliquots were stored at −80° C. and thawed prior to surgery.
(186) Transfection in MDCK Cells (p1045 SANS IRES GFP, AAV2/8 SANS IRES GFP)
(187) MDCK cell lines were cultured in Dulbecco's modified Eagle medium (DMEM, Gibco) supplemented with 10% foetal bovine serum, 1% penicillin-streptomycin antibiotics and 1% fungizone antimycotic.
(188) Both plasmid and virus forms containing mSANS.IRES.eGFP in MDCK cells were tested. For the plasmid, cells were transfected with Lipofectamine 2000 (Invitrogen). For the vector form cells were directly transfected without reagent. Cells were fixed 24 h after transfection with 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS) for 20 minutes. Cells were rinsed three times for 10 minutes in PBS, permeabilized in PBS containing 0.3 TritonX-100 supplemented with NH.sub.4Cl, and blocked with PBS containing 20% normal goat serum (NGS). Then cells were processed for immunochemistry with chicken anti-GFP (Abcam, 1:250) in PBS containing 1% of bovine serum albumin (BSA) overnight. After washing three times for 10 minutes in PBS, cells were incubated 1 hour in ATTO-488 conjugated goat anti-chicken IgG antibody (Sigma-Aldrich, 1:500 dilution). Actin was labelled with ATTO-647N-conjugated phalloidin (Sigma-Aldrich, 1:200 dilution). Samples were then mounted in Fluorsave (Calbiochem, USA).
(189) Intracochlear Injection
(190) Animal protocols were approved by animal care and use of committee of Pasteur Institute.
(191) Intracochlear viral transduction was carried out as described by Akil et al. (2012). After anesthesia on ice, a left postauricular incision was made, and using two landmarks including the cochlear basal turn and the stapedia artery, the otic bulla was exposed and then opened. Next, a glass micropipette of 10 μm outer tip diameter containing 2 μl of the viral vector was inserted into the round window membrane (RWM). The viral preparation was then gently injected through the round window. After pulling out the pipette, the hole in the RWM was plugged with connective tissue and the incision sealed with biological glue (3M Vetbond).
(192) Immunofluorescence
(193) After dissection, mice cochleae were perfused with 4% PFA in PBS for 45 minutes at 4° C. Cochleae were further microdissected, rinsed three times for 10 minutes, incubated 1 hour at room temperature in PBS containing 20% NGS and 0.3% Triton X-100, and incubated overnight with the primary rabbit antibody anti-Sans (Caberlotto et al., 2011), and/or chicken anti-GFP (Abcam, 1:250) in PBS containing 1% of NGS. Cochleae were rinsed three times for 10 minutes in PBS, and then incubated for 1 hour in ATTO-550 conjugated goat anti-rabbit IgG antibody (Sigma-Aldrich, 1:500 dilution) and ATTO-488 conjugated goat anti-chicken IgG antibody (Sigma-Aldrich, 1:500 dilution). Actin was labelled with ATTO-647N-conjugated phalloidin (Sigma-Aldrich, 1:200 dilution). Samples were then mounted in Fluorsave (Calbiochem, USA). The z-stack images were captured with a x63 Plan Apochromat oil immersion lens (NA 1.4) using a Zeiss LSM-700 confocal microscope and processed using Zeiss LSM image browser.
(194) Hair Cell Counting
(195) To evaluate the rate of transduction, the expression of eGFP used as a gene reporter was analysed in mice injected with the viral construction. For counting, the total number of inner or outer hair cells positive for eGFP was divided by the total number of inner or outer hair cells existing in the tissue, detectable by rhodamine phalloidin staining. For mature stages, rate of transduction was calculated in middle turn and apex of each cochlea.
(196) Electrophysiological Recordings
(197) Electrophysiological cell recordings were performed on cochlear and utricular explants from mice at P8 as previously described (Michalski, 2009). Cochlea and utricule were finely dissected, placed under nylon meshes and observed under a x40 water-immersion Olympus objective mounted on an Axioscope Zeiss microscope.
(198) Extracellular and dissecting solutions were identical and composed of 146 mM NaCl, 5.8 mM KCl, 1.5 mM CaCl.sub.2), 0.7 mM NaH2PO4, 2 mM Na-pyruvate, 10 mM glucose and 10 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES; pH=7.4, 305 mosmol/kg). Intracellular solution contained 130 mM KCl, 10 mM NaCl, 3.5 mM MgCl2, 1 mM ethyleneglycoltetraacetic acid (EGTA), 5 mM K2ATP, 0.5 mM GTP and 5 mM HEPES (pH=7.3, 290 mosmol/kg). Borosilicate patch pipettes (2-3 MO) were approached parallel to the hair cell rows through a hole in the reticular lamina. During this step, extracellular solution was abundantly perfused to avoid contact between EGTA and the transduction apparatus, which is sensitive to calcium chelators. Hair cells were whole-cell voltage clamped at room temperature (20-25° C.) at 80 mV using an EPC-9 patch clamp amplifier and the Patchmaster software (HEKA, Lambrecht, Germany). No correction was made for liquid junction potential. Series resistance was always below 10 MΩ and was compensated to 70%. Data were sampled at 100 kHz and filtered at 10 kHz (8-pole Bessel). Each hair bundle was mechanically stimulated by applying axial step displacements with a rigid glass rod that had been fire-polished prior to the experiment to yield a tip diameter of 2-3 μm. The probe was systematically positioned against the top of the hair bundle in the bundle's plane of bilateral symmetry towards the tallest row of stereocilia at an angle of ˜30° relative to the cell apical surface. The probe used for mechanical stimulation of the hair bundles was secured to a stacktype piezo-electric actuator (PA8/12; Piezosystem Jenas) driven by a low-voltage power supply (30V300, Piezosystem Jena). As measured offline with a displacement monitor containing photodiodes, the first two milliseconds of the time course of probe motion were well described by an exponential rise with a time constant of 100 ms.
(199) Data were analyzed in Matlab, version 7.0 (MathWorks). Po(X) curves were fitted with a three-state Boltzmann relation. For sensitivity measurements, the mean value of the three-state Boltzmann relation derivative was calculated for displacements corresponding to P0 values between 0.2 and 0.8.
(200) Audiological Tests
(201) Auditory Brainstem Responses (ABR) were recorded and analysed as described previously (Le Calvez et al., 1998). Mice were anesthetized with xylazine and ketamine, and places in a sound-attenuated room. Three electrodes were placed at the vertex and ipsilateral mastoid, with the lower back as the earth. Pure tone stimuli at 5, 10, 15, 20, 32 and 40 KHz were used. Sounds level between 10 dB and 100 dB in 10 dB steps were tested. ABR thresholds were determined about 20 days after injection. Thresholds were determined as the lowest stimulus level resulting in recognizable waves.
(202) Distortion product otoacoustic emissions (DPOAEs) were collected in the ear canal using a microphone. Two simultaneous pure tone stimuli, at frequencies f1 and f2, were used with the same levels, from 30 to 75 dB SPL in 5 dB steps. The f2 frequency was swept from 5 to 20 kHz in ⅛.sup.th octave steps, with fl chosen such that the frequency ratio f2/f1 was 1.20. Only the cubic difference tone at 2f1-f2, the most prominent one from the ear, was measured (Le Calvez et al., 1998). Statistical significance was tested by the two-tailed unpaired t test with Welch's correction.
(203) Cochlear microphonic (CM) responses to a 5 kHz pure tone stimulus at 105 dB SPL were collected between an electrode inserted in the round window and the vertex. The response from the electrodes was amplified (gain 10 000), filtered, digitally converted and averaged using a comprised-data acquisition system.
(204) Behavioral Analysis
(205) Firstly, mice were observed in cage to evaluate signs like circling or head bobbing. Then various tests were performed on mice, to assess the vestibular function before and after intracochlear injection, as described in Hardisty-Hughes et al., 2010. The trunk curl test was performed by holding the mouse by the tail and observing whether the mouse reached a horizontal surface or curls its trunk toward its tail. Mice's equilibrium was also evaluated with the platform test, were mice are positioned upon a platform (height: 29 cm, platform: 7 cm×7 cm) and the number of fells of the mouse was counted over a period of 1 min.
(206) The contact righting test was realized by placing the mouse into a closed clear tube and observing if the mouse re-orientates when the tube was rotated through 180°. The swimming ability of each mouse in a container filled of 24-26° C. water was also scored. Finally, the circling behavior was evaluated with a tracking software system (Ethovision de Noldus Information Technology, Wageningen, The Netherlands+Lentz et al., 2013). Turns in clockwise and counter clockwise were counted.
(207) Scanning Electron Microscopy
(208) Scanning electron microscopy (SEM) analyzes were realized to assess the morphology of cochlear and vestibular hair bundles after intracochlear injections. Organs of Corti were finely dissected and fixed in 2.5% glutaraldehyde in 0.1M aqueous sodium cacodylate solution at room temperature. Then samples were rinsed in cacodylate 0.1M three times for 1-2 minutes, and incubated alternatively in 1% osmium tetroxide and 0.1M thiocarbohydrazide (OTOTO), with water washing between each incubation. Cochleae were then dehydrated in graded series of ethanol and critical point dried. Observations were done by field emission scanning electron microscopy with Jeol JSM6700F operating at 3 kV.
(209) II. Results
(210) Evaluation of AAV Mediated Transgene Expression, Tropism and Promoters Efficiency in Cochlear Hair Cell
(211) The AAV are on the top of a list of promising gene delivery carrier for gene therapy for human diseases. The main advantages of the AAV virus are their capacity to infect non-dividing cells, the absence of immune response and long-term transgene expression. The AAV serotypes identified up to date display variable cell tropism. The ability of several AAV to transduce sensory hair cell in odor was evaluated to determine which AAV would best transduce the inner ear sensory cells.
(212) To this end, transgene expression and cellular distribution of several AAV pseudotypes were investigated after intracochlear injection. Wild type mice were subjected to the viral cochlear delivery, through the round window membrane (RWM), at postnatal day 2-3 (P2-3). Left cochleae were injected with either AAV1, AAV2/1, AAV2/2, AAV2/5 or with AAV2/8, encoding the green fluorescent protein (GFP) as a gene reporter, at titers ranged from 1.2×10.sup.12 to 6.4×10.sup.13 genome copies (gc)/m L. Six days after the injection, organs of Corti were microdissected and immunolabelled for otoferlin, a protein highly expressed in IHCs, and for GFP. All the tested AAVs were able to transduce cells within the cochlea, but with different cochlear cell tropism and transduction rates. Interestingly, two AAV with the same serotype and promoter (CAG or CMV) but from different suppliers did not transduce the same cell within the cochlea. In fact, while the AAV2/1 from SignaGen Laboratories mainly transduced supporting cells, (
(213) Next, the effects of surgery and of the cochlear injection of the viral preparation through the round window membrane on the development of auditory function were assessed. The auditory brainstem responses (ABRs) were examined at different frequencies (from 4 kHz to 40 kHz), fourteen days after the injection. In the twelve treated mice, ABR hearing thresholds of the injected ear recorded at the frequencies tested did not differ significantly from those of the control ear (
(214) AAV2/8-SANS-IRES-GFP Transduced MDCK Cells
(215) The coding sequence for the murine sans cDNA was subcloned into AAV2 genome downstream of internal ribosome entry sites (IRES) eGFP cDNA sequence. The expression cassette was flanked with AAV2 inverted terminal repeats (ITRsp) and pseudotyping strategy was used to produce AAV2 vectors packaged with AAV8. To evaluate the relative expression efficiencies of this viral particle and to assess specificity of sans protein expressed, MDCK cells were plated on coverslips and infected with AAV2/8-sans-IRES-GFP using MOI (Multiplicity Of Infection) of 10,000. Sans expression was then probed by immunohistochemistry using a specific anti sans antibody, and the transduced cell were quantified. The results show that all cells expressing GFP also expressed sans, and that AAV2/8-sans-IRES-GFP transduced an average of 90% of MDCK cells (
(216) Gene Therapy Restored Sans Expression and Targeting in Inner Ear Hair Cells of Ush1g.sup.−/− Mice
(217) Having established the efficiency of the AAV2/8-sans in vitro, the expression of AAV2/8-sans was investigated in the cochlea in vivo. To this end, 2 μL of AAV2/8-sans were injected through the round window membrane into one ear of wild type mice. Eight days after inoculation, organs of Corti, from the injected and the contralateral cochlea, were microdissected, immunolabelled for GFP. Positive eGFP-hair cells were then counted. The transduction rate of both IHCs and OHCs upon cochlear injection of the AAV2/8-sans was comparable to that observed for AAV2/8-GFP. Indeed, the hair cell transduction efficacy of AVV2/8-sans displayed a basoapical gradient higher at the apex than at the base. In addition the number of the transduced IHCs was much greater than OHC regardless of the cochlear region. The viral transduction efficiency tended to be higher in the apical turn. The rate of the transduced IHC was about 87% at the apex and gradually declined to 45% at the base. The rate of the transduced OHCs was about 33% at the apex and gradually declined to 25% at the base (
(218) The ability of AAV2/8-sans to restore the normal expression and targeting of the protein in cochlear and vestibular hair cell of the Ush1g−/− mice was tested. To this end, several Ush1g−/− mice were subjected to cochlear injection of the AAV2/8-sans viral particle as described above. To monitor vector-mediated sans expression, the mice were sacrificed 5 days after injection and the organ of Corti and the vestibule were subjected to double immunostaining for GFP and sans, using previously characterized antibodies (Caberlotto, 2011). A widespread expression of GFP was observed in both IHC and OHCs of the injected cochleas. Remarkably, in all GFP positive cells, sans immuolabelling was evident in both IHC and OHC where it was readily localized at the tip of the hair cell stereocilia. These observations are consistent with what has been reported for the native protein. These observations demonstrate that GFP and sans protein are transduced independently, enabling the normal targeting the later to the stereocilia.
(219) Sans Gene Therapy Prevents Cochlear and Vestibular Hair Cell Stereocilia Degeneration in Ush1g.sup.−/− Mice
(220) The Ush1g−/− mice are characterized by profound congenital sensorineural deafness and severe balance defect. In these mice, the sensory hair cell of both the vestibule and the cochlea displayed abnormal hair bundle, including fused and decreased numbers of stereocilia, dissociation of hair bundles fragmented or flat stereocilia, and the kinocilia misposition. The most striking feature is the loss of the staircase pattern due to the loss the middle and the short rows of inner and outer hair cell. Therefore, it was verified whether the normal expression and targeting of the protein sans in the inner ear hair cell of the Ush1g−/− mice prevents the abnormal morphological features of their stereocilia and kinocilia to take place. On P8, organs of Corti and utricules of the Ush1g.sup.−/− mice treated ear were microdissected and processed for scanning electron microscopy to closely scrutinized stereocilia morphology at high resolution. The bundle architecture of hair cells was preserved in all transduced hair cell at a degree reminiscent of the transduction rate observed using GFP expression as proxy (
(221) Sans Gene Therapy Rescue the Mechanosensory Transduction of Ush1g−/− Mice Hair Cells In Vivo.
(222) To evaluate if the restored hair bundle by sans gene therapy are functional, mechanoelectrical transduction (MET) currents were recorded from both IHCs and OHCs of Ush1g.sup.−/− mice, five days after treatment. In untreated Ush1g.sup.−/− mice, MET currents were nearly absent in both cochlear hair cells (Caberlotto, 2011) (111±31 pA for IHCs (n=5), and 47±6 pA for OHCs (n=4)). However, maximal amplitudes of MET currents of treated Ush1g.sup.−/− mice were comparable to currents observed in wild type mice (763±128 pA for IHCs (n=3), and 721±97 pA for OHCs (n=4)). The average (±SEM) peak sensory transduction current for rescued IHCs was 424±70 pA (n=11), and 641±35 pA for OHCs (n=12) (
(223) Sans Gene Therapy Rescued the Auditory Function
(224) To evaluate if sans-transduced cells can rescue auditory function, AAV2/8-sans was injected in Ush1g.sup.−/− mice, and hearing was probed by in vivo audiometric tests: auditory brainstem responses (ABR), which explore activities of IHCs and OHCs, distortion-product otoacoustic emissions (DPOAEs), which involve OHC MET channel function (Avan et al, 2013), and cochlear microphonics (CM), which record phasic extracellular potentials reflecting MET currents in the OHCs of the basal region of the cochlea. These auditory tests were recorded between 15 to 35 days after treatment.
(225) According to early studies, uninjected Ush1g.sup.−/− mice showed a lack of identifiable ABR waves for all sound frequencies, indicating profound deafness (Caberlotto, 2011). Moreover, DPOAEs and CM were not detected in these mice. However, injection of AAV2/8-sans in Ush1g.sup.−/− mice led to a significant hearing recovery. Indeed, a partial restore of hearing was observed mainly for low-frequencies of 20-25 dB (5-15 kHz), and a lower restore 5-10 dB for high-frequencies (20-32 KHz) (
(226) Thus, a single intracochlear injection of AAV2/8-sans is sufficient to restore a hearing function in Ush1g.sup.−/− mice.
(227) To circumvent the early morphogenetic defect present in the hair bundles of Ush1g.sup.−/− mice, ABR of Ush1g.sup.f/f Myo15-Cre.sup.−/− mice was also probed (Caberlotto, 2011). In these mice, Ush1g is deleted postnatally, under the control of the Myo15 promoter, specific for auditory hair cells. Thus, the viral particle is injected before the deletion of sans. Caberlotto et al., showed that these mice are profoundly deaf from P13, for all sound frequencies. Nonetheless, the delivery of AAV2/8-sans through the RWM at P2, resulted in higher ABR thresholds, of about 30-40 dB for low-frequencies (5-15 kHz), than in Ush1g.sup.−/− rescued mice.
(228) Sans Gene Therapy Completely Corrected the Vestibular Defect
(229) After having evaluated the morphological restore of vestibular hair bundles, the vestibular function, i.e. the behavior of treated Ush1g.sup.−/− mice was studied. In fact, Ush1g.sup.−/− mice are characterized by vestibular defects, which result in circling and head tossing (Caberlotto et al., 2011). This phenotype was no longer observed in all treated Ush1g.sup.−/− mice at mature stages. To deepen these observations, various behavioral tests were performed. During the platform test, the heterozygous mice never fall over a period of 1 min, as the treated Ush1g.sup.−/− mice. Uninjected mice deficient for sans did not hold on platform more than few seconds. The trunk-curl test showed that treated mutant mice, as heterozygous mice, reached the surface without curling its trunk toward its tail. On the contrary, untreated Ush1g.sup.−/− mice cur the trunk and did not reach the surface. The contact righting test strengthened that treated Ush1g.sup.−/− mice, as heterozygous mice, had no vestibular dysfunction because they could re-orientates perfectly after a rotation of the tube, unlike the untreated mice deficient for sans. Finally, by scoring swim test (0=swim; 1=irregular swim; 2=immobile floating; 3=underwater tumbling, Hardisty-Hughes et al., 2010) it was noted that treated Ush1g.sup.−/− mice swum with no difficulty (score 0=swim), like heterozygous mice, while untreated Ush1g.sup.−/− mice drowned very rapidly (score 3=underwater tumbling). Treated Ush1g.sup.−/− mice did not show any circling behavior, like heterozygous mice, as shown by videotracking mice in an open-field chamber (3 turns during 2 min for treated Ush1g.sup.−/− mice vs. 23 turns for uninjected Ush1g.sup.−/− mice,
(230) It is important to consider that these tests were also achieved for injected heterozygous mice, and that they behaved as non-injected heterozygous mice, showing that the injection through the RWM did not impair the vestibular function.
(231) These behavioral analyses show that sans gene therapy completely restores the vestibular function.
REFERENCES
(232) Akil, O., Seal, R. P., Burke, K., Wang, C., Alemi, A., During, M., Edwards, R. H., Lustig, L. R. (2012). Restoration of hearing in the VGLUT3 knockout mouse using virally mediated gene therapy. Neuron 75(2), 283-93. Akino K, Toyota M, Suzuki H, Imai T, Maruyama R, Kusano M, Nishikawa N, Watanabe Y, Sasaki Y, Abe T, Yamamoto E, Tarasawa I, Sonoda T, Mori M, Imai K, Shinomura Y, Tokino T (2007). Identification of DFNA5 as a target of epigenetic inactivation in gastric cancer. Cancer Sci. 98(1):88-95. Angermüller, S., and Fahimi, H. D. (1981). Selective cytochemical localization of peroxidase, cytochrome oxidase and catalase in rat liver with 3,3′-diaminobenzidine. Histochemistry 71(1), 33-44. Basta, D., Tzschentke, B., and Ernst, A. (2005). Noise-induced cell death in the mouse medial geniculate body and primary auditory cortex. Neuroscience letters 381, 199-204. Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. Roy. Statist. Soc. Ser. B. 57, 289-300. Binder, C. J., Weiher, H., Exner, M., Kerjaschki, D. (1999). Glomerular overproduction of oxygen radicals in Mpv17 gene-inactivated mice causes podocyte foot process flattening and proteinuria: A model of steroid-resistant nephrosis sensitive to radical scavenger therapy. Am. J. Pathol. 154(4), 1067-75. Bischoff A M, Luijendijk M W, Huygen P L, van Duijnhoven G, De Leenheer E M, Oudesluijs G G, Van Laer L, Cremers F P, Cremers C W, Kremer H (2004). A novel mutation identified in the DFNA5 gene in a Dutch family: a clinical and genetic evaluation. Audiol Neurootol. 9(1):34-46. Bolstad, B. M., Irizarry, R. A., Astrand, M., Speed, T. P. (2003). A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19(2), 185-93. Bonekamp, N. A., Volkl, A., Fahimi, H. D., and Schrader, M. (2009). Reactive oxygen species and peroxisomes: struggling for balance. BioFactors 35, 346-355. Borck, G., Rainshtein, L., Hellman-Aharony, S., Volk, A. E., Friedrich, K., Taub, E., Magal, N., Kanaan, M., Kubisch, C., Shohat, M., Basel-Vanagaite, L. (2012). High frequency of autosomal-recessive DFNB59 hearing loss in an isolated Arab population in Israel. Clin Genet. 82(3), 271-6. Caberlotto, E., Michel, V., Foucher, I., Bahloul, A., Goodyear, R. J., Pepermans, E., Michalski, N., Perfettini, I., Alegria-Prévot, O., Chardenoux, S., Do Cruzeiro, M., et al. (2011). Usher type 1G protein sans is a critical component of the tip-link complex, a structure controlling actin polymerization in stereocilia. Proc. Natl. Acad. Sci. USA 108(14), 5825-30. Chai Y, Chen D, Wang X, Wu H, Yang T (2014). A novel splice site mutation in DFNA5 causes late-onset progressive non-syndromic hearing loss in a Chinese family. Int J Pediatr Otorhinolaryngol. 78(8):1265-8. Cheng J, Han D Y, Dai P, Sun H J, Tao R, Sun Q, Yan D, Qin W, Wang H Y, Ouyang X M, Yang S Z, Cao J Y, Feng G Y, Du L L, Zhang Y Z, Zhai S Q, Yang W Y, Liu X Z, He L, Yuan H J (2007). A novel DFNA5 mutation, IVS8+4 A>G, in the splice donor site of intron 8 causes late-onset non-syndromic hearing loss in a Chinese family. Clin Genet. 72(5):471-7. Cody, A. R., and Johnstone, B. M. (1981). Acoustic trauma: Single neuron basis for the “half-octave shift”. J. Acoust. Soc. Am. 70, 707-711. Collin, R. W., Kalay, E., Oostrik, J., Caylan, R., Wollnik, B., Arslan, S., den Hollander, A. I., Birinci, Y., Lichtner, P., Strom, T. M. (2007). Involvement of DFNB59 mutations in autosomal recessive nonsyndromic hearing impairment. Hum. Mutat. 28(7), 718-23. Collins, T. J. (2007). Image) for microscopy. Biotechniques 43, 25-30. Cooper, L. B., Chan D K, Roediger F C, Shaffer B R, Fraser J F, Musatov S, Selesnick S H, Kaplitt M G. AAV-mediated delivery of the caspase inhibitor XIAP protects against cisplatin ototoxicity. Otol Neurotol. 2006 June; 27(4):484-90 Delille, H. K., Agricola, B., Guimaraes, S. C., Borta, H., Luers, G. H., Fransen, M., and Schrader, M. (2010). Pex11pbeta-mediated growth and division of mammalian peroxisomes follows a maturation pathway. Journal of cell science 123, 2750-2762. Delmaghani, S., del Castillo, F. J., Michel, V., Leibovici, M., Aghaie, A., Ron, U., Van Laer, L., Ben-Tal, N., Van Camp, G., Weil, D., et al. (2006). Mutations in the gene encoding pejvakin, a newly identified protein of the afferent auditory pathway, cause DFNB59 auditory neuropathy. Nat. Genet. 38, 770-8. Diano, S., Liu, Z. W., Jeong, J. K., Dietrich, M. O., Ruan, H. B., Kim, E., Suyama, S., Kelly, K., Gyengesi, E., Arbiser, J. L., et al. (2011). Peroxisome proliferation-associated control of reactive oxygen species sets melanocortin tone and feeding in diet-induced obesity. Nat Med 17, 1121-1127. Dobie, R. A. (2005) Audiometric Threshold Shift Definitions: Simulations and Suggestions, Ear and Hearing 26(1) 62-77 Ebermann, I., Walger, M., Scholl, H. P., Charbel Issa, P., Lüke, C., Nürnberg, G., Lang-Roth, R., Becker, C., Nürnberg, P., Bolz, H. J. (2007). Truncating mutation of the DFNB59 gene causes cochlear hearing impairment and central vestibular dysfunction. Hum. Mutat. 28(6), 571-7. Ehret, G., and Riecke, S. (2002). Mice and humans perceive multiharmonic communication sounds in the same way. Proc. Natl. Acad. Sci. USA 99(1), 479-482. Evans, P., and Halliwell, B. (1999). Free radicals and hearing. Cause, consequence, and criteria. Ann. NY Acad. Sci. 884, 19-40. Fransen, M., Nordgren, M., Wang, B., and Apanasets, O. (2012). Role of peroxisomes in ROS/RNS-metabolism: implications for human disease. Biochim Biophys Acta 1822, 1363-1373. Han, C., and Someya, S. (2013). Mouse models of age-related mitochondrial neurosensory hearing loss. Molecular and cellular neurosciences 55, 95-100. Hashemzadeh Chaleshtori, M., Simpson, M. A., Farrokhi, E., Dolati, M., Hoghooghi Rad, L., Amani Geshnigani, S., Crosby, A. H. (2007). Novel mutations in the pejvakin gene are associated with autosomal recessive non-syndromic hearing loss in Iranian families. Clin. Genet. 72(3), 261-3. He, W., Newman, J. C., Wang, M. Z., Ho, L., and Verdin, E. (2012). Mitochondrial sirtuins: regulators of protein acylation and metabolism. Trends in endocrinology and metabolism: TEM 23, 467-476. Henderson, D., Bielefeld, E. C., Harris, K. C., and Hu, B. H. (2006). The role of oxidative stress in noise-induced hearing loss. Ear and hearing 27, 1-19. Housley, G. D., Morton-Jones, R., Vlajkovic, S. M., Telang, R. S., Paramananthasivam, V., Tadros, S. F., Wong, A. C., Froud, K. E., Cederholm, J. M., Sivakumaran, Y., et al. (2013). ATP-gated ion channels mediate adaptation to elevated sound levels. Proc Natl Acad Sci USA. 110(18), 7494-9. Imig, T. J., and Durham, D. (2005). Effect of unilateral noise exposure on the tonotopic distribution of spontaneous activity in the cochlear nucleus and inferior colliculus in the cortically intact and decorticate rat. The Journal of comparative neurology 490, 391-413. Jain, N., Thatte, J., Braciale, T., Ley K., O'Connell, M., Lee, J. K. (2003). Local-pooled-error test for identifying differentially expressed genes with a small number of replicated microarrays. Bioinformatics 19(15), 1945-51. Janero, D. R. (1990). Malondialdehyde and thiobarbituric acid-reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radic. Biol. Med. 9(6), 515-40. Kaplitt, M. G., Leone P, Samulski R J, Xiao X, Pfaff D W, O'Malley K L, During M J. Long-term gene expression and phenotypic correction using adeno-associated virus vectors in the mammalian brain. Nat Genet. 1994 October; 8(2):148-54. Kayagaki N, Stowe I B, Lee B L, O'Rourke K, Anderson K, Warming S, Cuellar T, Haley B, Roose-Girma M, Phung Q T, Liu P S, Lill J R, Li H, Wu J, Kummerfeld S, Zhang J, Lee W P, Snipas S J, Salvesen G S, Morris L X, Fitzgerald L, Zhang Y, Bertram E M, Goodnow C C, Dixit V M (2015). Caspase-11 cleaves gasdermin D for non-canonical inflammasome signaling. Nature. September 16. doi: 10.1038/nature15541. Kim M S, Lebron C, Nagpal J K, Chae Y K, Chang X, Huang Y, Chuang T, Yamashita K, Trink B, Ratovitski E A, Califano J A, Sidransky D (2008). Methylation of the DFNA5 increases risk of lymph node metastasis in human breast cancer. Biochem Biophys Res Commun. 370(1):38-43. Kim M S, Chang X, Yamashita K, Nagpal J K, Baek J H, Wu G, Trink B, Ratovitski E A, Mori M, Sidransky D (2008). Aberrant promoter methylation and tumor suppressive activity of the DFNA5 gene in colorectal carcinoma. Oncogene. 27(25):3624-34. Kemp, D. T. (2002). Otoacoustic emissions, their origin in cochlear function, and use. Br. Med. Bull. 63, 223-241. Koch, J., Pranjic, K., Huber, A., Ellinger, A., Hartig, A., Kragler, F., and Brocard, C. (2010). PEX11 family members are membrane elongation factors that coordinate peroxisome proliferation and maintenance. Journal of cell science 123, 3389-3400. Kress, C., Vandormael-Pournin, S., Baldacci, P., Cohen-Tannoudji, M., Babinet, C. (1998). Nonpermissiviness for mouse embryonic stem (ES) cell derivation circumvented by a single backcross to 129/Sv strain: establishment of ES cell lines bearing the Omd conditional lethal mutation. Mamm. Genome 9, 998-1001. Kujawa, S. G., and Liberman, M. C. (2009). Adding insult to injury: cochlear nerve degeneration after “temporary” noise-induced hearing loss. The Journal of neuroscience the official journal of the Society for Neuroscience 29, 14077-14085. Lallemand, Y., Luria, V., Haffner-Krausz, R., Lonai, P. (1998). Maternally expressed PGK-cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res. 7, 105-112. Lay, D., Gorgas, K., and Just, W. W. (2006). Peroxisome biogenesis: where Arf and coatomer might be involved. Biochim Biophys Acta 1763, 1678-1687. Lee, S P., Hwang, Y. S., Kim, Y. J., Kwon, K. S., Kim, H. J., Kim, K., Chae, H. Z. (2001). Cyclophilin A binds to peroxiredoxins and activates its peroxidase activity. J. Biol. Chem. 276(32), 29826-32. Lee, J. N., Kim, S. G., Lim, J. Y., Kim, S. J., Choe, S. K., and Park, R. (2015). Proteasome inhibitors induce auditory hair cell death through peroxisome dysfunction. Biochemical and biophysical research communications 456, 269-274. Li, X., Baumgart, E., Dong, G. X., Morrell, J. C., Jimenez-Sanchez, G., Valle, D., Smith, K. D., and Gould, S. J. (2002). PEX11alpha is required for peroxisome proliferation in response to 4-phenylbutyrate but is dispensable for peroxisome proliferator-activated receptor alpha-mediated peroxisome proliferation. Molecular and cellular biology 22, 8226-8240. Li-Yang M N, Shen X F, Wei Q J, Yao J, Lu Y J, Cao X, Xing G Q (2015). IVS8+1 DelG, a Novel Splice Site Mutation Causing DFNA5 Deafness in a Chinese Family. Chin Med J (Engl). 128(18):2510-2515. Lizana, L., Bauer, B., and Orwar, O. (2008). Controlling the rates of biochemical reactions and signaling networks by shape and volume changes. Proceedings of the National Academy of Sciences of the United States of America 105, 4099-4104. Lopez-Huertas, E., Charlton, W. L., Johnson, B., Graham, I. A., and Baker, A. (2000). Stress induces peroxisome biogenesis genes. The EMBO journal 19, 6770-6777. Matise, M. P., Auerbach, W., Joyner, A. (1999). Production of targeted embryonic stem cell clones. In: Joyner A, ed. Gene targeting. A practical approach. Oxford: Oxford University Press; p. 101-132. Menuet, C., Cazals, Y., Gestreau, C., Borghgraef, P., Gielis, L., Dutschmann, M., Van Leuven, F., Hilaire, G. (2011). Age-Related Impairment of Ultrasonic Vocalization in Tau.P301L Mice: Possible Implication for Progressive Language Disorders. PloS One 6(10), e25770. Meyer zum Gottesberge, A. M., Felix, H., Reuter, A., Weiher, H. (2001). Ultrastructural and physiological defects in the cochlea of the Mpv17 mouse strain. A comparison between young and old adult animals. Hear. Res. 156(1-2), 69-80. Michard, Q., Commo, S., Belaidi, J. P., Alleaume, A. M., Michelet, J. F., Daronnat, E., Eilstein, J., Duche, D., Marrot, L., Bernard, B. A. (2008b). TRP-2 specifically decreases WM35 cell sensitivity to oxidative stress. Free Radic. Biol. Med. 44(6), 1023-31. Michard, Q., Commo, S., Rocchetti, J., El Houari, F., Alleaume, A. M., Wakamatsu, K., Ito, S., Bernard, B. A. (2008a). TRP-2 expression protects HEK cells from dopamine- and hydroquinone-induced toxicity. Free Radic. Biol. Med. 45(7), 1002-10. Motley, A. M., and Hettema, E. H. (2007). Yeast peroxisomes multiply by growth and division. J Cell Biol 178, 399-410. Mujtaba, G., Bukhari, I., Fatima, A., Naz, S. (2012). A p.C343S missense mutation in PJVK causes progressive hearing loss. Gene 504(1), 98-101. Needleman, S. B., and Wunsch, C. D. (1970). A general method applicable to the search for similaritis in the amino acid sequence of two proteins. J. Mol. Biol. 48(3), 443-453. Nishio A, Noguchi Y, Sato T, Naruse T K, Kimura A, Takagi A, Kitamura K (2014). A DFNA5 mutation identified in Japanese families with autosomal dominant hereditary hearing loss. Ann Hum Genet. 78(2):83-91. Ohinata, Y., Miller, J. M., Altschuler, R. A., and Schacht, J. (2000). Intense noise induces formation of vasoactive lipid peroxidation products in the cochlea. Brain research 878, 163-173. Ohlemiller, K. K., McFadden, S. L., Ding, D. L., Flood, D. G., Reaume, A. G., Hoffman, E. K., Scott, R. W., Wright, J. S., Putcha, G. V., and Salvi, R. J. (1999a). Targeted deletion of the cytosolic Cu/Zn-superoxide dismutase gene (Sod1) increases susceptibility to noise-induced hearing loss. Audiology & neuro-otology 4, 237-246. Ohlemiller, K. K., Wright, J. S., and Dugan, L. L. (1999b). Early elevation of cochlear reactive oxygen species following noise exposure. Audiol Neurootol 4, 229-236. Ohlemiller, K. K., McFadden, S. L., Ding, D. L., Lear, P. M., and Ho, Y. S. (2000). Targeted mutation of the gene for cellular glutathione peroxidase (Gpx1) increases noise-induced hearing loss in mice. Journal of the Association for Research in Otolaryngology: JARO 1, 243-254. Okatsu, K., Saisho, K., Shimanuki, M., Nakada, K., shiara, H., Sou, Y. S., Kimura, M., Sato, S., Hattori, N., Komatsu, M., et al. (2010). p62/SQSTM1 cooperates with Parkin for perinuclear clustering of depolarized mitochondria. Genes to cells: devoted to molecular & cellular mechanisms 15, 887-900. Op de Beeck K, Van Camp G, Thys S, Cools N, Callebaut I, Vrijens K, Van Nassauw L, Van Tendeloo V F, Timmermans J P, Van Laer L (2011). The DFNA5 gene, responsible for hearing loss and involved in cancer, encodes a novel apoptosis-inducing protein. Eur J Hum Genet. 19(9):965-73. Park H J, Cho H J, Baek J I, Ben-Yosef T, Kwon T J, Griffith A J, Kim U K (2010). Evidence for a founder mutation causing DFNA5 hearing loss in East Asians. J Hum Genet. 55(1):59-62. Passreiter, M., Anton, M., Lay, D., Frank, R., Harter, C., Wieland, F. T., Gorgas, K., and Just, W. W. (1998). Peroxisome biogenesis: involvement of ARF and coatomer. J Cell Biol 141, 373-383. Pienkowski, M., and Eggermont, J. J. (2009). Long-term, partially-reversible reorganization of frequency tuning in mature cat primary auditory cortex can be induced by passive exposure to moderate-level sounds. Hearing research 257, 24-40. Rahman, I., Kode, A., and Biswas, S. K. (2006). Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat. Protoc. 1, 3159-3165. Reddy, J. K., Azarnoff, D. L., and Hignite, C. E. (1980). Hypolipidaemic hepatic peroxisome proliferators form a novel class of chemical carcinogens. Nature 283, 397-398. Robles, L., and Ruggero M. A. (2001). Mechanics of the mammalian cochlea. Physiol Rev. 81(3), 1305-52. Roux, I., Safieddine, S., Nouvian, R., Grati, M., Simmler, M. C., Bahloul, A., Perfettini, I., Le Gall, M., Rostaing, P., Hamard, G., et al. (2006). Otoferlin, defective in a human deafness form, is essential for exocytosis at the auditory ribbon synapse. Cell 127(2), 277-89. Roux, I., Hosie, S., Johnson, S. L., Bahloul, A., Cayet, N., Nouaille, S., Kros, C. J., Petit, C., and Safieddine, S. (2009). Myosin VI is required for the proper maturation and function of inner hair cell ribbon synapses. Hum. Mol. Genet. 18, 4615-4628. Roy, S., Ryals, M. M., Van den Bruele, A. B., Fitzgerald, T. S., Cunningham, L. L. (2013). Sound preconditioning therapy inhibits ototoxic hearing loss in mice. J. Clin. Invest. 123(11), 4945-9. Sadanaga, M., and Morimitsu, T. (1995). Development of endocochlear potential and its negative component in mouse cochlea. Hearing research 89, 155-161. Saeki and Sasaki (2011) «Endothelium and epithelium» ISBN 978-1-61470-874-2, Ed. J. Carrasco and M. Mota, pp 193-211, © 2012 Nova Science Publishers. Santos, M. J., Quintanilla, R. A., Toro, A., Grandy, R., Dinamarca, M. C., Godoy, J. A., and Inestrosa, N. C. (2005). Peroxisomal proliferation protects from beta-amyloid neurodegeneration. The Journal of biological chemistry 280, 41057-41068. Schrader, M., and Fahimi, H. D. (2006). Peroxisomes and oxidative stress. Biochim Biophys Acta 1763, 1755-1766. Schrader, M., Reuber, B. E., Morrell, J. C., Jimenez-Sanchez, G., Obie, C., Stroh, T. A., Valle, D., Schroer, T. A., and Gould, S. J. (1998). Expression of PEX11beta mediates peroxisome proliferation in the absence of extracellular stimuli. The Journal of biological chemistry 273, 29607-29614. Schrader, M., Wodopia, R., and Fahimi, H. D. (1999). Induction of tubular peroxisomes by UV irradiation and reactive oxygen species in HepG2 cells. J Histochem Cytochem 47, 1141-1148. Schwander, M., Sczaniecka, A., Grillet, N., Bailey, J. S., Avenarius, M., Najmabadi, H., Steffy, B. M., Federe, G. C., Lagler, E. A., Banan, R. (2007). A forward genetics screen in mice identifies recessive deafness traits and reveals that pejvakin is essential for outer hair cell function. J. Neurosci. 27(9), 2163-75. Shi J, Zhao Y, Wang K, Shi X, Wang Y, Huang H, Zhuang Y, Cai T, Wang F, Shao F (2015). Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. September 16. doi: 10.1038/nature15514. [Epub ahead of print] Shi P, Tang A, Xian L, Hou S, Zou D, Lv Y, Huang Z, Wang Q, Song A, Lin Z, Gao X (2015). Loss of conserved Gsdma3 self-regulation causes autophagy and cell death. Biochem J. 468(2):325-36. Smith, J. J., and Aitchison, J. D. (2013). Peroxisomes take shape. Nat Rev Mol Cell Biol 14, 803-817. Tang, X. D., Garcia, M. L., Heinemann, S. H., and Hoshi, T. (2004). Reactive oxygen species impair Slo1 BK channel function by altering cysteine-mediated calcium sensing. Nat. Struct. Mol. Biol. 11, 171-178. Thelen, N., Breuskin, I., Malgrange, B., Thiry, M. (2009). Early identification of inner pillar cells during rat cochlear development. Cell Tissue Res. 337, 1-14. Tran, C., Hewson, S., Steinberg, S. J., Mercimek-Mahmutoglu, S. (2014). Late-onset Zellweger spectrum disorder caused by PEX6 mutations mimicking X-linked adrenoleukodystrophy. Pediatr Neurol. 51(2), 262-5. Van Laer L, Huizing E H, Verstreken M, van Zuijlen D, Wauters J G, Bossuyt R I, Van de Heyning P, McGuirt W T, Smith R J, Willems P J, Legan P K, Richardson G P, Van Camp G (1998). Nonsyndromic hearing impairment is associated with a mutation in DFNA5. Nat Genet. 20(2):194-7. Wang, Y., Hirose, K., and Liberman, M. C. (2002). Dynamics of noise-induced cellular injury and repair in the mouse cochlea. Journal of the Association for Research in Otolaryngology: JARO 3, 248-268. Wang C J, Tang L, Shen D W, Wang C, Yuan Q Y, Gao W, Wang Y K, Xu R H, Zhang H (2013). The expression and regulation of DFNA5 in human hepatocellular carcinoma DFNA5 in hepatocellular carcinoma. Mol Biol Rep. 40(12):6525-31. Yamane, H., Nakai, Y., Takayama, M., Iguchi, H., Nakagawa, T., and Kojima, A. (1995). Appearance of free radicals in the guinea pig inner ear after noise-induced acoustic trauma. Eur Arch Otorhinolaryngol 252, 504-508. Yamashita, D., Jiang, H. Y., Schacht, J., and Miller, J. M. (2004). Delayed production of free radicals following noise exposure. Brain research 1019, 201-209. Yu C, Meng X, Zhang S, Zhao G, Hu L, Kong X (2003). A 3-nucleotide deletion in the polypyrimidine tract of intron 7 of the DFNA5 gene causes nonsyndromic hearing impairment in a Chinese family. Genomics. 82(5):575-9. Zhang, Q. J., Lan, L., Li, N., Qi, Y., Zong, L., Shi, W., Yu, L., Wang, H., Yang, J., Xie, L. Y., et al. (2015). Identification of a novel mutation of PJVK in the Chinese non-syndromic hearing loss population with low prevalence of the PJVK mutations. Acta oto-laryngologica 135, 211-216. Avan P, Büki B, Petit C. (2013). Auditory distortions: origins and functions. Physiol Rev. October; 93(4):1563-619. Hardisty-Hughes R E, Parker A, Brown S D (2010). A hearing and vestibular phenotyping pipeline to identify mouse mutants with hearing impairment. Nat Protoc., January; 5(1):177-90. Le Calvez S, Avan P, Gilain L, Romand R., (1998) Hear Res. June; 120(1-2):37-50. Michalski N, Michel V, Caberlotto E, Lefèvre G M, van Aken A F, Tinevez J Y, Bizard E, Houbron C, Weil D, Hardelin J P, Richardson G P, Kros O, Martin P, Petit C. 2009, Harm onin-b, an actin-binding scaffold protein, is involved in the adaptation of mechanoelectrical transduction by sensory hair cells. Pflugers Arch November; 459(1):115-30. Mustapha et al., 2002. Hum. Genet. Vol. 110, 348-350. Weil et al., 2003. Human Molecular Genetics vol. 12, no. 5, 463-471.