Recombinant herpes simplex virus and use thereof
11680248 · 2023-06-20
Assignee
Inventors
- Chenghao Huang (Xiamen, CN)
- Yong Luo (Xiamen, CN)
- Quan Yuan (Xiamen, CN)
- Jun Zhang (Xiamen, CN)
- Ningshao Xia (Xiamen, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/16651
CHEMISTRY; METALLURGY
C12N2710/16621
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C12N2710/16643
CHEMISTRY; METALLURGY
A01K2207/12
HUMAN NECESSITIES
C12N2710/16622
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
The invention relates to the field of virology and tumor therapy. In particular, the present invention provides a recombinant herpes simplex virus (HSV) capable of specifically replicating at a high level in a tumor cell and effectively killing the tumor cell, but replicating at low levels in normal cells, thereby the recombinant herpes simplex virus of the present invention not only has high lethality against tumor cells, but also has significantly decreased side effects (especially neurotoxicity). Further, the present invention relates to a viral vector constructed based on the recombinant herpes simplex virus, a pharmaceutical composition comprising the recombinant herpes simplex virus or the viral vector, and the use of the recombinant herpes simplex virus or the viral vector. The recombinant herpes simplex virus of the present invention can be used to infect and kill tumor cells, and can be used for gene drug delivery into tumor cells for gene therapy.
Claims
1. A recombinant herpes simplex virus (HSV), which does not express a functional ICP0 protein and ICP34.5 protein; but is capable of expressing a functional UL43 protein, a functional UL41 protein, a functional UL48 protein, or any combination thereof; and wherein the genome of the recombinant HSV comprises the following modifications: two copies of the ICP0 gene each independently comprising a loss-of-function mutation or which is deleted or substituted with an exogenous nucleotide sequence; two copies of the ICP34.5 gene each independently comprising a loss-of-function mutation or which is deleted or substituted with an exogenous nucleotide sequence; and wherein the genome of the recombinant HSV further comprises a modification in which a native promoter of one or more HSV genes is substituted with a tumor-specific promoter.
2. The recombinant HSV according to claim 1, wherein the genome of the recombinant HSV comprises: (1) a UL43 gene capable of expressing a functional UL43 protein, (2) a UL41 gene capable of expressing a functional UL41 protein, (3) a UL48 gene capable of expressing a functional UL48 protein, or (4) any combination of (1) to (3).
3. The recombinant HSV according to claim 1, wherein the recombinant HSV further comprises an additional exogenous nucleotide sequence.
4. A viral vector, comprising the genome of the recombinant HSV according to claim 1.
5. An isolated host cell, which comprises one of the following: (1) the recombinant HSV according to claim 1, or (2) the genome of the recombinant HSV of claim 1, or (3) a viral vector comprising the genome of the recombinant HSV of claim 1.
6. A method of obtaining the recombinant HSV according to claim 1, comprising: (1) cultivating a host cell, which is infected with the recombinant HSV, or comprises a genome of the recombinant HSV, or is transfected with a viral vector comprising a genome of the recombinant HSV; (2) collecting and lysing the host cell after the host cell shows signs of infection, to obtain a lysate of the host cell; and (3) recovering the recombinant HSV from the lysate.
7. A pharmaceutical composition, which comprises one or more of the following and a pharmaceutically acceptable carrier or excipient: (1) the recombinant HSV according to claim 1, (2) the genome of the recombinant HSV of claim 1, and (3) a viral vector comprising the genome of the recombinant HSV of claim 1.
8. A method of treating a tumor, which comprises administering to a subject in need thereof a therapeutically effective amount of one or more of the following: (1) the recombinant HSV according to claim 1, (2) a viral vector comprising the genome of the recombinant HSV of claims 1, and (3) a pharmaceutical composition comprising the recombinant HSV of (1) or the viral vector of (2).
9. The recombinant HSV according to claim 1, wherein in the genome of the recombinant HSV: (1) the two copies of the ICP0 genes each independently comprises a loss-of-function mutation; and, the two copies of the ICP34.5 gene each independently comprises a loss-of-function mutation; or (2) the two copies of the ICP0 genes each independently comprises a loss-of-function mutation; and the two copies of the ICP34.5 gene are deleted; or (3) the two copies of the ICP0 genes each independently comprises a loss-of-function mutation; and the two copies of the ICP34.5 gene each is independently substituted with an exogenous nucleotide sequence; or (4) the two copies of the ICP0 gene are deleted; and, the two copies of the ICP34.5 gene each independently comprises a loss-of-function mutation; or (5) the two copies of the ICP0 gene are deleted; and the two copies of the ICP34.5 gene are deleted; or (6) the two copies of the ICP0 gene are deleted; and the two copies of the ICP34.5 gene each is independently substituted with an exogenous nucleotide sequence; or (7) the two copies of the ICP0 gene each is independently substituted with an exogenous nucleotide sequence; and, the two copies of the ICP34.5 gene each independently comprises a loss-of-function mutation; or (8) the two copies of the ICP0 gene each is independently substituted with an exogenous nucleotide sequence; and the two copies of ICP34.5 genes are deleted; or (9) the two copies of the ICP0 gene each is independently substituted with an exogenous nucleotide sequence; and the two copies of the ICP34.5 gene each is independently substituted with an exogenous nucleotide sequence.
10. The recombinant HSV according to claim 9, wherein a) the loss-of-function mutation each is independently selected from the group consisting of: missense mutation, nonsense mutation, frameshift mutation, base deletion, base substitution, base addition, and any combination thereof; b) the exogenous nucleotide sequence each independently encodes a foreign protein selected from the group consisting of: fluorescent protein, immunomodulatory polypeptide, cytokine, chemokine, antibody, and cytotoxic peptide, or c) a combination of a) and b).
11. The recombinant HSV according to claim 10, having any one or more of the following: (1) the fluorescent protein is selected from the group consisting of green fluorescent protein, red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, and any combination thereof; (2) the immunomodulatory polypeptide is selected from the group consisting of CD40L, OX40L, inducible costimulatory molecule (ICOS), FTL3L, LIGHT, CD137L, CD70, 4-1BB, GITR, CD28, and any combination thereof; (3) the cytokine is selected from the group consisting of interleukin, interferon, tumor necrosis factor, colony stimulating factor, and any combination thereof; (4) the chemokine is selected from the group consisting of CCL2, RANTES, CCL7, CCL9, CCL10, CCL12, CCL15, CCL19, CCL21, CCL20, XCL-1, and any combination thereof; (5) the cytotoxic peptide is selected from the group consisting of thymidine kinase TK (TK/GCV), TRAIL, FasL, and any combination thereof; and (6) the antibody is selected from the group consisting of anti-PD-1 antibody, anti-PD-L1 antibody, anti-TIGIT antibody, anti-BTLA antibody, anti-CTLA-4 antibody, anti-Tim-3 antibody, anti-Lag-3 antibody, anti-CD137 antibody, anti-OX40 antibody, anti-GITR antibody, anti-CD73 antibody, anti-KIR antibody, anti-ICOS antibody, anti-CSF1R antibody, anti-EGFR antibody, anti-VEGFR antibody, anti-HER2 antibody, anti-PDGFR antibody, and any combination thereof.
12. The recombinant HSV according to claim 2, wherein the recombinant HSV is further characterized by: (1) one or more non-essential genes are deleted or mutated; (2) except for the two copies of the ICP0 gene and the two copies of the ICP34.5 gene, the genome of the recombinant HSV comprises all other genes of the wild-type HSV, and none of the other genes comprises a loss-of-function mutation; or (3) the tumor-specific promoter is a promoter of hTERT.
13. The recombinant HSV according to claim 12, characterized by any one or more of the following: (1) the non-essential gene is selected from the group consisting of UL3 gene, UL4 gene, UL14 gene, UL16 gene, UL21 gene, UL24 gene, UL31 gene, UL32 gene, US3 gene, UL51 gene, UL55 gene, UL56 gene, US2 gene, US12 gene, LAT gene, nucleotide fragment corresponding to SEQ ID NO: 23, and any combination thereof; (2) the non-essential gene comprises a loss-of-function mutation, or is substituted with an exogenous nucleotide sequence; and (3) the tumor-specific promoter is a promoter of hTERT having the sequence set forth in SEQ ID NO: 5.
14. The recombinant HSV according to claim 2, wherein the genome of the recombinant HSV further comprises one or more modifications selected from the group consisting of: (1) substitution of a native promoter of the VP5 gene with a tumor-specific promoter; (2) substitution of a native promoter of the ICP27 gene with a tumor-specific promoter; (3) substitution of a native promoter of the ICP4 gene with a tumor-specific promoter; and (4) deletion or mutation of one or more of the UL55 gene, the US2 gene, the LAT gene, and the nucleotide fragment corresponding to SEQ ID NO: 23.
15. The recombinant HSV according to claim 1, wherein the recombinant HSV is a recombinant HSV-1, a recombinant HSV-2, or an HSV-1/HSV-2 chimeric virus; or the recombinant HSV is derived from a HSV-1 strain KOS.
16. The recombinant HSV according to claim 3, wherein the additional exogenous nucleotide sequence encodes a foreign protein selected from the group consisting of fluorescent protein, immunomodulatory polypeptide, cytokine, chemokine, antibody, and cytotoxic peptide.
17. The isolated host cell according to claim 5, wherein the cell is a tumor cell selected from the group consisting of lung cancer cell, liver cancer cell, breast cancer cell, osteosarcoma cell, ovarian cancer cell, cervical cancer cell, prostate cancer cell, glioma cell, melanoma cell, colorectal cancer cell, and pancreatic cancer cell.
18. The pharmaceutical composition according to claim 7, characterized by any one or more of the following: (1) the pharmaceutical composition is formulated for treating a tumor; (2) the pharmaceutical composition is an injectable solution or a lyophilized powder; (3) the pharmaceutical composition comprises a therapeutically effective amount of the recombinant HSV or the genome of the recombinant HSV or the viral vector; (4) the pharmaceutical composition is a unit dose form; and (5) 10.sup.2-10.sup.9 pfu of the recombinant HSV is present per unit dose of the pharmaceutical composition.
19. The method according to claim 8, characterized by any one or more of the following: (1) the tumor is selected from the group consisting of lung cancer, liver cancer, breast cancer, osteosarcoma, ovarian cancer, prostate cancer, glioma, melanoma, colorectal cancer, and pancreatic cancer; (2) the subject is a mammal; and (3) the subject is a human.
Description
DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
SPECIFIC MODELS FOR CARRYING OUT THE INVENTION
(21) The invention is described with reference to the following examples which are intended to illustrate, but not limit the invention.
(22) Unless otherwise specified, the molecular biology experimental methods, virological experimental methods, immunoassays, and zoological experimental methods used in the present application are all experimental methods conventionally used by those skilled in the art. For example, molecular biology experimental methods can be the methods described in: J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and F. M. Ausubel et al., Guide to Molecular Biology Experiments, 3rd edition, John Wiley & Sons, Inc., 1995. The reagents (e.g., enzymes, plasmids, and primers) used in the respective examples were purchased from commercial companies, and various reagents (e.g., enzymes) were used in accordance with the conditions recommended by the manufacturers. Those skilled in the art would understand that the examples are illustrative to the invention, and are not intended to limit the scope of the invention.
Example 1. Construction of Recombinant Virus OVN and OVH
(23) (1.1) Culture and Titer Determination of Herpes Simplex Virus Type 1 (HSV-1)
(24) Wild-type HSV-1 strain KOS was purchased from ATCC (Cat. No. VR-1493™), and its whole-genome information has been published in NCBI (GenBank: JQ673480.1). Cultured Vero cells (purchased from ATCC, USA, Cat. No. CCL-81™) were infected with the strain KOS at a MOI of 0.1. After 48 hours, all cells were collected by cell scraper and centrifuged to remove the cell culture medium. The obtained cell precipitate was resuspended in fresh complete medium and stored at −80° C. Subsequently, the cell suspension was repeatedly freeze-thawed (3 times), then centrifuged, and the supernatant was collected to obtain a virus solution. The virus solution was aliquoted and stored at −80° C.
(25) U-2 OS cells (purchased from ATCC, USA, catalogue number HTB-96™) were seeded in 6 cm culture plates at a density of 1×10.sup.6 cells. After the cells were grown into a monolayer, serial 10-fold dilutions of the virus solution obtained above were performed, and then the cells were infected with virus solutions (500 μl) of different dilution gradients, respectively. After 75 min of infection, the cell culture medium was discarded, 5 mL of fresh complete medium was added, and the cells were further cultured. After 2 h, 10 mL of methylcellulose medium was added, and the plate was placed in an incubator for 2 days. Subsequently, a basal medium comprising 0.01% neutral red was added into the plate and incubation was continued for 12 hr. After the completion of the culture, all the cell culture medium was discarded, and the plaques of the respective culture plates were counted. According to the number of plaques of each culture plate and the dilution factor of the virus solution, the virus titer was calculated according to the following formula: virus titer (PFU/mL)=number of plaques per plate×2×virus dilution factor.
(26) (1.2) Construction of Recombinant Plasmid
(27) The sequence (SEQ ID NO: 1) between the 33.sup.rd base (nt33) to the 5876.sup.th base (nt5876) of the wild type HSV-1 virus genome (GenBank: JQ673480.1) was cloned to the commercially available PUC57 vector (Shanghai Shenggong) using restriction enzymes SacI and PstI, thereby obtaining plasmid PUC57-F0. Subsequently, the sequence between the NcoI and SalI cleavage sites in the plasmid PUC57-F0 was substituted with the gene sequence of LacZ (SEQ ID NO: 2) using restriction endonucleases NcoI and SalI, thereby obtaining plasmid PUC57-d34.5/01acZ. Further, the sequence between the NcoI and SalI cleavage sites in the plasmid PUC57-F0 was also cut off, thereby obtaining plasmid PUC57-d34.5/0.
(28) (1.3) Construction and Identification of Recombinant Viruses OVN and OVH
(29) The construction strategies of the recombinant viruses OVN and OVH are shown in
(30) (1.3.1) Construction of Recombinant Virus d34.5/01acZ
(31) U-2 OS cells were seeded in 24-well plates at a density of 1×10.sup.5 cells per well and cultured overnight at 37° C. in a cell culture incubator. The recombinant plasmid PUC57-d34.5/01acZ was transfected into U-2 OS cells using transfection reagent lipofectamine 2000. After 24 h of transfection, the cells were infected with the virus strain KOS at a MOI of 3. After cytopathic effect was observed, the cells were harvested. The harvested cells were lysed by repeated freeze-thaw method, then centrifuged, and the supernatant was collected to obtain a virus solution. The virus titer of the obtained virus solution was measured.
(32) The harvested virus was inoculated into a culture plate in which monolayer of U-2 OS cells were grown. After culturing for 2 days, a basal medium comprising 0.01% neutral red and 100 ug/mL X-gal was uniformly added to the culture plate, and the cells were further cultured for 12 hr. Subsequently, blue plaques appearing on the culture plate were selected, and the virus obtained from the blue plaques was monoclonalized (3 times) to obtain the recombinant virus d34.5/01acZ. After being verified by sequencing, it was found that the two copies of the ICP34.5 and ICP0 genes in the recombinant virus d34.5/01acZ genome were substituted with the lacZ gene as compared to the strain KOS.
(33) (1.3.2) Construction of Recombinant Virus OVN (d34.5/0)
(34) U-2 OS cells were seeded in 24-well plates at a density of 1×10.sup.5 cells per well and cultured overnight at 37° C. in a cell culture incubator. The recombinant plasmid PUC57-d34.5/0 was transfected into U-2 OS cells using transfection reagent lipofectamine 2000. After 24 h of transfection, the cells were infected with the recombinant virus d34.5/01acZ at a MOI of 3. After cytopathic effect was observed, the cells were harvested. The harvested cells were lysed by repeated freeze-thaw method, then centrifuged, and the supernatant was collected to obtain a virus solution. The virus titer of the obtained virus solution was measured.
(35) The harvested virus was seeded into a culture plate in which monolayer of U-2 OS cells were grown. After culturing for 2 days, a basal medium comprising 0.01% neutral red and 100 ug/mL X-gal was uniformly added to the culture plate, and the cells were further cultured for 12 hr. Subsequently, white plaques appearing on the culture plate were selected, and the virus obtained from the white plaques was monoclonalized (3 times) to obtain the recombinant virus OVN (d34.5/0). After being verified by sequencing, the two copies of the lacZ gene had been deleted in the recombinant virus OVN (d34.5/0) genome as compared with the recombinant virus d34.5/01acZ; and the sequence of nt510 to nt5439 (SEQ ID NO: 6) and the sequence of nt120802 to nt125731 (SEQ ID NO: 6) of the wild type HSV-1 genome (GenBank: JQ673480.1) were deleted in the recombinant virus OVN (d34.5/0) as compared with the strain KOS.
(36) (1.3.3) Construction of Recombinant Virus OVH
(37) Sequence of base 112861 (nt112861) to 113422 (nt113422) (SEQ ID NO: 3) of the wild-type HSV-1 virus genome (GenBank: JQ673480.1) was cloned into the commercially available PUC57 vector by using restriction endonucleases SacI and PmeI, thereby obtaining plasmid PUC57-27p0. Subsequently, the sequence of base 113590 (nt113590) to base 115194 (nt115194) (SEQ ID NO: 4) of the wild-type HSV-1 viral genome (GenBank: JQ673480.1) was cloned into the plasmid PUC57-27p0 by using restriction enzymes SpeI and PstI, thereby obtaining plasmid PUC57-27p1. In the plasmid PUC57-27p1, the native promoter sequence of the ICP27 gene (nt113422 to nt113590 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been deleted.
(38) Subsequently, the sequence between the PmeI and SpeI cleavage sites in the plasmid PUC57-27p1 was substituted with the LacZ expression sequence (SEQ ID NO: 2), thereby obtaining plasmid PUC57-27p/lacZ. In addition, the sequence between the PmeI and SpeI cleavage sites in the plasmid PUC57-27p1 was substituted for the core promoter sequence of the adult telomerase reverse transcriptase hTERT (SEQ ID NO: 5; see, Takakura M, Kyo S, Kanaya T, et al. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells [J]. Cancer Res, 1999, 59 (3): 551-557), thereby obtaining plasmid PUC57-27p/htert. In the plasmid PUC57-27p/htert, the ICP27 gene was regulated by a tumor-specific promoter (i.e., the hTERT core promoter).
(39) Subsequently, referring to the construction methods described in (1.3.1) and (1.3.2), the recombinant virus OVN was used as a starting virus, and the hTERT core promoter sequence was introduced into the recombinant virus OVN genome by using the plasmids PUC57-27p/lacZ and PUC57-27p/htert for regulating the ICP27 gene, thereby constructing a recombinant virus OVH. After being verified by sequencing, the native promoter sequence of the ICP27 gene (nt113423 to nt113589 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been substituted by the hTERT core promoter (SEQ ID NO: 5) in the recombinant virus OVH genome as compared with the recombinant virus OVN.
(40) (1.4) Comparison of Recombinant Viruses OVN and OVH with Known Recombinant HSV Viruses
(41) Currently, a variety of recombinant HSV viruses had been developed for use in tumor therapy, including, for example, HSV1716, NV1020, G207, OncoVex.sup.GM-CSF (T-VEC), and the like. The genome modifications comprised in these recombinant HSV viruses and the recombinant viruses OVN and OVH of the present invention are summarized in Table 2 below.
(42) TABLE-US-00002 TABLE 2 Genome modifications comprised in various recombinant HSV viruses Name Genetic modification Country HSV1716 Deletion of dual copies of ICP34.5 UK NV1020 Deletion of 15 kb fragment at UL/US USA junction (i.e., deletion of single copies ICP34.5, ICP0, ICP4 and UL56) G207 Deletion of dual copies of ICP34.5 USA and ICP6 OncoVex.sup.GM-CSF Deletion of dual copies of ICP34.5 USA (T-VEC) and ICP47 OVN Deletion of dual copies of China (ICP34.5 and ICP0) OVH Deletion of dual copies of (ICP34.5 China and ICP0), and the native promoter of the ICP27 gene was substituted with the hTERT core promoter
(43)
Example 2. Characterization of Recombinant Viruses OVN and OVH
(44) The recombinant virus dICP0 was constructed with reference to the method described in Example 1, which had the deletion of two copies of the ICP0 gene as compared to the strain KOS. The virus strain KOS and the recombinant virus dICP0 were used as control viruses to characterize the recombinant viruses OVN and OVH.
(45) The gene deletions in the recombinant viruses OVN, OVH and dICP0 were verified by PCR. Briefly, the PCR was carried out using primers for specific amplification of ICP0 gene, ICP34.5 gene, ICP27 gene or hTERT core promoter and using the genome of the virus strain KOS, OVN, OVH or dICP0 as a template. The primers used in the PCR are summarized in Table 3.
(46) TABLE-US-00003 TABLE 3 Primer sequences SEQ ID Primer NO: name Sequence (5′-3′) 9 ICP0-F GACGTGTGCGCCGTGTGCACGGATGA 10 ICP0-R ACTCTGTTCTTGGTTCGCGGCCTGAGCCA 11 ICP34.5-F ATGGCCCGCCGCCGCCATCGC 12 ICP34.5-R TTAGACCGAGTTCGCCGGGC 13 ICP27-F ATGGCGACTGACATTGATATGCTAATTGA 14 ICP27-R CTAAAACAGGGAGTTGCAATAAAAATATTTGC 15 htertp-F CTCCCAGTGGATTCGCGGGCACAGAC 16 htertp-R CTGCCTGAAACTCGCGCCGCGAGGA
(47) After the reaction was completed, the PCR product was analyzed by gel electrophoresis. The results are shown in
(48) The results in
(49) In addition, the gene expression (mRNA) of cells after infection with KOS, OVN, OVH or dICP0 was also analyzed by using real-time quantitative PCR. Briefly, the U-2 OS host cells were infected with KOS, OVN, OVH and dICP0, respectively. After cytopathic effect was observed, the cells were harvested and total mRNA was extracted. The total mRNA was reverse transcribed into cDNA, and real-time quantitative PCR was carried out using primers specifically amplifying the ICP0 gene, the ICP34.5 gene or the ICP27 gene, respectively. The result is shown in
(50)
Example 3. Evaluation of Replication Ability and Killing Ability of Recombinant Virus OVN/OVH
(51) Normal cells (L-O2 cells) and tumor cells (U-2 OS cells) in logarithmic growth phase were seeded in 6 cm culture plates at a density of 5-7.5×10.sup.6 cells/plate. Subsequently, the cultured cells were infected with the virus KOS, OVN, OVH or dICP0 at a MOI of 1. After 48 hours of infection, the state of the cells was observed under a microscope and photographed. Subsequently, the virus-infected cells were digested, and the survival rate of the cells was calculated by trypan blue staining. Cell survival rate (%)=(number of viable cells after infection with virus)/(number of control cells not infected with virus)×100. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. In addition, the virus titers at different time points after infection of normal cells (L-O2 cells) and tumor cells (U-2 OS cells) with virus KOS, OVN, OVH or dICP0 were determined with reference to the protocol described in Example 1. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in
(52)
(53)
(54)
(55) The experimental results in
(56) In addition, the killing abilities of the recombinant viruses OVN and OVH to various tumor cells were also determined with reference to the method described above. Briefly, tumor cells in good state and in logarithmic growth phase were seeded in 6 cm culture plates at a density of 5-7.5×10.sup.6 cells/plate. Subsequently, the cultured tumor cells were infected with the virus OVN or OVH at a MOI of 1. After 48 hours of infection, the infected tumor cells were digested, and the survival rate of the tumor cells was calculated by trypan blue staining. In this experiment, the cells without being infected with virus were used as controls. Cell survival rate (%)=(number of viable cells after infection with virus)/(number of control cells not infected with virus)×100. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in
(57)
Example 4. Evaluation of Neurotoxicity and In Vivo Safety of Recombinant Virus OVN/OVH
(58) Herpes viruses are neurotoxic and neurologically latent, with the greatest danger being the ability to infect the central nervous system of humans or animals, leading to serious side effects such as encephalitis. Therefore, the most direct and sensitive way to assess the safety of herpes viruses is to inject the virus intracranially into young mice and assess the direct killing of the mouse central nervous system by the virus. In this example, we evaluated the neurotoxicity and safety of various recombinant HSV-1 viruses in mice using a mouse encephalitis model induced by intracranial injection of virus.
(59) Briefly, 4-6 weeks old BALB/c female mice (n=10) were used as experimental subjects, and 20 μl of virus was slowly injected intracranially at the left anterior lobe of brain, near the junction of coronal suture and sagittal suture. After the injection, the incidence and survival of the mice were observed every day.
(60) The results show that when intracranial injection of 1×10.sup.4 PFU of wild-type virus KOS, 100% of the mice developed moderate to severe side effects; after the onset of disease, the mice were often accompanied by symptoms such as hair rising, anorexia, cold, dilatory, and even paralyzed; and 100% of mice died within 4-6 days after virus injection (
(61) When a high dose (1×10.sup.7 PFU) of virus OVN was injected intracranially, no mice (0/10) died during the entire experimental period, and the survival rate of the mice was 100%. This indicates that compared with the wild-type virus KOS and the recombinant virus dICP0, the neurotoxicity of the virus OVN was significantly decreased, the safety in vivo was remarkably improved, and the doses used could be increased by at least 1000 times and 100 times, respectively.
(62) When a higher dose (4×10.sup.7 PFU) of virus OVN was injected intracranially, only one mouse (1/10) died during the entire experimental period, and the mouse survival rate was 90%. This indicates that the virus OVN had a half-lethal dose higher than 4×10.sup.7 PFU in mice, and thus had excellent in vivo safety.
(63) When 4×10.sup.7 PFU of virus OVH was injected intracranially, no mice (0/10) died during the entire experimental period, and the mouse survival rate was 100%. And, more importantly, the mice did not show any adverse reactions throughout the experimental period. This indicates that the virus OVH had further significantly decreased neurotoxicity and further significantly improved the safety in vivo, as compared to the virus OVN.
(64) The above experimental results show that the viruses OVN and OVH of the present invention have low neurotoxicity, high safety in vivo, and have broad application prospects.
Example 5. Evaluation of Therapeutic Potential of Recombinant Virus OVN/OVH
(65) Tumor cells (Huh7 and Hepal-6) were cultured in complete medium comprising 10% calf serum in a 37° C., 5% CO.sub.2 incubator. When the cells were grown to logarithmic growth phase, the cells were digested with 0.05% trypsin and washed with PBS to obtain a cell suspension (cell density of 5×10.sup.7/mL) resuspended in PBS.
(66) 0.1 mL of Huh7 cell suspension was inoculated subcutaneously into the right flank of each of 5-6 weeks old nude mice. When the tumor on mouse back grew to 6 mm×6 mm (tumor volume was approximately 100 mm.sup.3), the mice were grouped (n=8/group) and treatment was started (Day 0). The treatment regimen was as follows: 1×10.sup.7 PFU virus (OVN or OVH) or the same volume of DMEM (used as a control) was injected intratumorally, once every 3 days, for a total of 3 injections.
(67) 0.1 mL of Hepal-6 cell suspension was inoculated subcutaneously on the left and right flanks of each of 5-week-old mice (C57BL/6). When the tumor on mouse back grew to 6 mm×6 mm (tumor volume was approximately about 100 mm.sup.3), the mice were grouped and treatment was started. The treatment regimen was as follows: 1×10.sup.7 PFU virus (OVN or OVH) or the same volume of DMEM was injected intratumorally, once every 3 days, for a total of 3 injections.
(68) The status of mice was monitored every 3 days and the tumor size was measured using an electronic vernier caliper. Tumor volume and tumor inhibition rate were calculated according to the following formula:
V(volume)=[L×(W).sup.2]/2; L represents a long diameter, and W represents a short diameter.
Tumor inhibition rate=(tumor volume of control group−tumor volume of experimental group)/tumor volume of control group×100%.
(69) The experimental results are summarized in
(70)
(71)
(72) These experimental results have confirmed that the viruses OVN and OVH of the present invention have significant potential for treating tumors in vivo, and have broad application prospects.
Example 6. Construction and Characterization of Other Recombinant Viruses (1)
(73) In this example, a series of derived recombinant viruses were constructed based on the recombinant viruses OVN and OVH.
(74) Referring to the method described in Example 1 (particularly 1.3.1 to 1.3.3), the recombinant virus OVN was used as the starting virus, and the hTERT core promoter sequence was introduced into the recombinant virus OVN genome by the recombinant plasmid for regulating the VP5 gene or the ICP4 gene, thereby constructing recombinant viruses OVH1 and OVH2.
(75) After being verified by sequencing, the native promoter sequence of the VP5 gene (nt40729 to nt40475 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5) in the recombinant virus OVH1 genome compared with the recombinant virus OVN; in the recombinant virus OVH2 genome, the native promoter sequence of the ICP4 gene (nt146151 to nt146867 and nt131706 to nt130990 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5).
(76)
(77) Further, referring to the method described in Example 1 (particularly 1.3.1 to 1.3.3), the recombinant virus d34.5/01acZ was used as the starting virus, and the nucleotide sequence encoding the GFP protein (SEQ ID NO: 7) and the nucleotide sequence encoding the anti-human PD-1 single chain antibody (SEQ ID NO: 8) were introduced into the recombinant virus d34.5/01acZ genome to replace the lacZ gene by using recombinant plasmids, thereby constructing and obtaining the recombinant viruses OVN-GFP And OVN-PD-1-scfv. After being verified by sequencing, compared with the recombinant virus d34.5/01acZ, in the recombinant virus OVN-GFP genome, the two copies of the lacZ gene had been substituted with the nucleotide sequence encoding the GFP protein (i.e., in the genome of the recombinant virus OVN-GFP, the sequence of nt510 to nt5439 and the sequence of nt120802 to nt125731 of the wild-type HSV-1 genome (GenBank: JQ673480.1) were substituted with the nucleotide sequence encoding the GFP protein); in the genome of the recombinant virus OVN-PD-1-scfv, the two copies of the lacZ gene had been substituted with the nucleotide sequence encoding the PD-1 single-chain antibody (i.e., in the genome of the recombinant virus OVN-PD-1-scfv, the sequence of nt510 to nt5439 and the sequence of nt120802 to nt125731 of the wild-type HSV-1 genome (GenBank: JQ673480.1) were substituted with the nucleotide sequence encoding the PD-1 single chain antibody).
(78) Further, the recombinant virus OVN-GFP and OVN-PD-1-scfv were used as the starting viruses, and the hTERT core promoter sequence was introduced into the starting virus genome to regulate the ICP27 gene by using plasmids PUC57-27p/lacZ and PUC57-27p/htert, thereby constructing and obtaining recombinant viruses OVH-GFP and OVH-PD-1-scfv.
(79) After being verified by sequencing, compared with recombinant virus OVN-GFP, the native promoter sequence of the ICP27 gene (nt113423 to nt113589 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) in the recombinant virus OVH-GFP genome had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5). Compared with the recombinant virus OVN-PD-1-scfv, the native promoter sequence of the ICP27 gene (nt113423 to nt113589 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) in the recombinant virus OVH-PD-1-scfv genome had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5).
(80)
(81) U-2 OS cells (purchased from ATCC, USA, item number HTB-96™) were seeded in 6 cm culture plates at a density of 1×10.sup.6 cells. After the cells were grown into a monolayer, the cells were infected with the recombinant viruses OVN-GFP and OVH-GFP, respectively. After cytopathic effect was observed, the cells infected with the recombinant viruses OVN-GFP and OVH-GFP were observed under a fluorescence microscope. The results are shown in
(82) U-2 OS cells (purchased from ATCC, USA, catalogue number HTB-96™) were seeded in 6 cm culture plates at a density of 1×10.sup.6 cells. After the cells were grown into a monolayer, the cells were infected with the recombinant viruses OVH and OVH-PD-1-scfv, respectively. The culture supernatants of the cells were harvested for after 24 h and 48 h of infection, respectively, for subsequent analysis. The supernatant collected 48 h after infection was subjected to serial 2-fold gradient dilutions, and the ability of supernatant of each dilution to inhibit interaction between PD-1 and PD-L1 was determined by an ELISA method based on competition between PD-1 single-chain antibody and PD-L1 protein for binding to PD-1 protein. In addition, the abilities of the supernatants collected at 24 h and 48 h after infection to bind PD-1 was also determined by an ELISA method based on the reactivity between PD-1 single-chain antibody and PD-1 protein. The experimental results are shown in
(83)
(84) The experimental results of
(85) In addition, the abilities of the recombinant viruses OVH and OVH-PD-1-scfv to treat tumors were also verified in mice (C57BL/6) inoculated with Hepal-6 cells according to the method described in Example 5. The results are shown in
(86)
(87) These experimental results confirm that the recombinant viruses OVH-PD-1-scfv and OVH of the present invention have significant potential for treating tumors in vivo, and have broad application prospects.
Example 7. Construction and Characterization of Other Recombinant Viruses (2)
(88) In this example, a series of derived recombinant viruses were constructed based on the recombinant virus OVN. Briefly, with reference to the method described in Example 1 (especially 1.3.1 to 1.3.3), the recombinant virus OVN was used as the starting virus, and the non-essential gene UL41, UL43, UL48, UL55, US2, LAT or NF in the recombinant virus OVN genome was deleted by using recombinant plasmids, respectively, thereby constructing and obtaining recombinant viruses OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF.
(89) According the verification by sequencing, compared with the recombinant virus OVN, the recombinant virus OVN-dUL41 genome had a deletion of the UL41 (vhs) gene (GenBank: AFE62869.1; corresponding to nt91088 to nt92557 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUL43 genome had a deletion of the UL43 gene (GenBank: AFE62871.1; corresponding to nt94721 to nt95968 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUL48 genome had a deletion of the UL48 (VMW65) gene (GenBank: AFE62876.1; corresponding to nt103527 to nt104999 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUL55 genome had a deletion of the UL55 gene (GenBank: AFE62884.1; corresponding to nt115418-nt115978 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUS2 genome had a deletion of the US2 gene (GenBank: AFE62890.1; corresponds to nt133911 to nt134786 of the wild-type HSV-1 genome (GenBank: JQ673480.1); the recombinant virus OVN-dLAT genome had a deletion of the LAT gene (corresponding to nt4781 to nt7062 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); and, the recombinant virus OVN-dNF genome had a deletion of the nucleotide fragment (NF) (corresponding to nt5853 to nt7485 of the wild-type HSV-1 genome (GenBank: JQ673480.1)).
(90) Alternatively, CRISPR technology can also be used, for example, by designing specific sgRNA primers and using the commercially available LentiCRISPR v2 vector (Addgene), the non-essential gene UL41, UL43, UL48, UL55, US2, LAT or NF in the recombinant virus OVN genome could be deleted, respectively.
(91) Information on the non-essential genes UL41, UL43, UL48, UL55, US2, LAT and NF is also provided in Table 4.
(92) TABLE-US-00004 TABLE 4 Information on non-essential genes Gene name GenBank No. Sites in genome SEQ ID NO: UL41 (vhs) AFE62869.1 nt91088-nt92557 17 UL43 AFE62871.1 nt94721-nt95968 18 UL48 (VMW65) AFE62876.1 nt103527-nt104999 19 UL55 AFE62884.1 nt115418-nt115978 20 US2 AFE62890.1 nt133911-nt134786 21 LAT Derived from nt4781-nt7062 22 JQ673480.1 Nucleotide fragment Derived from nt5853-nt7485 23 (NF) JQ673480.1
(93) Tumor cells (U-2 OS cells) in good condition and in logarithmic growth phase were seeded in 6 cm culture plates at a density of 5-7.5×10.sup.6 cells/plate. Subsequently, the cultured cells were infected with the recombinant virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF, respectively, at a MOI of 0.01. After 60 h of infection, the virus titer of the above recombinant virus was determined by referring to the protocol described in Example 1. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in
(94)
(95) TABLE-US-00005 TABLE 5 Viral titers of recombinant viruses after 60 h of infection of U-2 OS cells Recombinant virus Viral titer (pfu/ml) Recombinant virus Viral titer (pfu/ml) OVN 1.01 × 10.sup.8 ± 8.54 × 10.sup.6 OVN-dUL55 1.05 × 10.sup.8 ± 5.00 × 10.sup.6 OVN-dUL41 1.80 × 10.sup.5 ± 2.65 × 10.sup.4 OVN-dUS2 1.18 × 10.sup.8 ± 2.89 × 10.sup.6 OVN-dUL43 1.83 × 10.sup.6 ± 2.89 × 10.sup.5 OVN-dLAT 1.07 × 10.sup.8 ± 5.77 × 10.sup.6 OVN-dUL48 3.37 × 10.sup.4 ± 3.21 × 10.sup.3 OVN-dNF 1.02 × 10.sup.8 ± 7.64 × 10.sup.6
(96) These results indicate that the viruses OVN, OVN-dUL55, OVN-dUS2, OVN-dLAT, and OVN-dNF were capable of replicating at high levels in tumor cells (e.g., U-2 OS cells); whereas the replication abilities of the viruses OVN-dUL43, OVN-dUL41 and OVN-dUL48 in tumor cells (e.g., U-2 OS cells) were significantly decreased. For example, in U-2 OS cells, the replication abilities of the viruses OVN-dUL41, OVN-dUL43 and OVN-dUL48 were decreased by about 561 times, 55 times, and 3×10.sup.3 times, respectively, as compared to the virus OVN.
(97) In addition, the cultured normal cells (L-O2 cells) or tumor cells (U-2 OS cells) were infected with the recombinant virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF, respectively, at a MOI of 0.5. After 72 hours of infection, the survival rate of the cells was determined. A 3-well replicate was set for each set of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in
(98)
(99) The results of
(100) The results in
(101) The killing rates of these recombinant viruses against L-O2 and U-2 OS cells are also provided in Table 6.
(102) TABLE-US-00006 TABLE 6 Killing rates of recombinant viruses against L-O2 cells and U-2 OS cells Killing rate Recombinant virus L-O2 cells U-2 OS cells OVN 90.00% ± 1.00% 0.87% ± 0.71% OVN-dUL41 82.33% ± 0.58% 76.00% ± 2.65% OVN-dUL43 89.00% ± 1.00% 52.67% ± 0.58% OVN-dUL48 85.67% ± 1.15% 68.33% ± 0.58% OVN-dUL55 90.33% ± 0.58% 0.90% ± 0.10% OVN-dUS2 90.67% ± 0.58% 0.77% ± 0.06% OVN-dLAT 90.33% ± 0.58% 0.46% ± 0.05% OVN-dNF 91.67% ± 0.58% 0.90% ± 0.10%
(103) These results indicate that, similar to the virus OVN, the viruses OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF had only very limited killing activity to normal cells (e.g., L-O2 cells), whereas their killing abilities to tumor cells (e.g., U-2 OS cells) were extremely high; this indicates that the four recombinant viruses were equivalent to the virus OVN. Compared with the virus OVN, the viruses OVN-dUL41 and OVH-dUL48 not only had enhanced killing ability to normal cells (e.g., L-O2 cells), but also had significantly decreased killing ability to tumor cells (e.g., U-2 OS cells); which indicate that the two recombinant viruses had increased toxicity to normal cells and decreased antitumor activity. Although the killing activity of the virus OVN-dUL43 to normal cells (e.g., L-O2 cells) was not significantly enhanced as compared with the virus OVN, its killing activity to tumor cells (e.g., U-2 OS cells) was significantly decreased.
(104) Specifically, in normal cells, the killing abilities of the viruses OVN-dUL41, OVN-dUL43 and OVH-dUL48 were increased by about 7.67%, 1.00%, and 4.33%, respectively, as compared to the virus OVN. In tumor cells, the killing abilities of the viruses OVN-dUL41, OVN-dUL43 and OVH-dUL48 were decreased by about 75.13%, 51.80% and 67.46%, respectively, as compared to the virus OVN.
(105) The above experimental results indicate that in the recombinant HSV virus of the present invention, non-essential genes other than UL41, UL43 and UL48 (e.g., UL55, US2, LAT and NF) may be further modified, for example, inserted with a loss-of-function mutation, or deleted.
(106) Although the specific embodiments of the invention have been described in detail, it would be understood by those skilled in the art that various modifications and changes can be made in the details of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.