Detection of hepatitis B virus (HBV) DNA and methylated HBV DNA in urine of patients with HBV-associated hepatocellular carcinoma

Abstract

This application relates to a DNA marker for HBV-HCC detection and the methods, kits for quantitatively measuring the amount of HBV DNA and bisulfite treated HBV DNA, and methylated HBV DNA, and the aberrant methylation of the HBV genome for the used in the chronic HBV infected populations. Detection of the presence or absence of HCC, with elevated methylation levels in the one or more regions of DNA of the mammals as compared to the level of methylation in the one or more regions of DNA in the one or more control body fluids or tissues indicating the presence of the cancer, and the absence of elevated methylation levels indicating the absence of HCC.

Claims

1. A method of detecting presence or absence of hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC) in a mammal, comprising: (i) isolating DNA from one or more body fluids or tissues from said mammal; (ii) quantifying a level of HBV DNA by a real-time quantitative PCR, quantifying bisulfite converted HBV DNA by bisulfite specific PCR and quantifying methylation level of one or more regions of HBV DNA with a quantitative methylation assay; (iii) comparing the methylation level of the one or more regions of HBV DNA with the methylation level of the one or more regions of HBV DNA in one or more control body fluids or tissues from mammals known not to have HCC; and (iv) detecting the presence or absence of HCC, with an elevated methylation level in the one or more regions of HBV DNA as compared to the methylation level in the one or more regions of HBV DNA in the one or more control body fluids or tissues indicating the presence of HCC, and absence of elevated methylation levels indicating the absence of HCC; wherein the one or more regions of HBV DNA consist of CpG island 3, of the HBV genome; wherein a forward primer, a reverse primer and a probe for the real-time quantitative PCR are nucleotide sequences of SEQ ID No. 38, SEQ ID No. 39 and SEQ ID No. 40, respectively; wherein a forward primer, a reverse primer and a probe for the BSP are nucleotide sequences of SEQ ID No. 12, SEQ ID No. 13, and SEQ No. 14, respectively; wherein the MSP is a two-step MSP comprising a first step MSP and a second step MSP, and the one or more regions of HBV DNA comprise CpG island 3, wherein: a forward primer, a reverse primer for the first step MSP are nucleotide sequences of SEQ ID No. 18 and SEQ ID No. 16, respectively; and a forward primer, a reverse primer for the second step MSP are nucleotide sequences of SEQ ID No. 19 and SEQ ID No. 20, respectively.

2. A method of detecting presence or absence of hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC) in a mammal, comprising: (i) isolating DNA from one or more body fluids or tissues from said mammal; (ii) quantifying a level of HBV DNA by a real-time quantitative PCR, quantifying bisulfite converted HBV DNA by bisulfite specific PCR and quantifying methylation level of one or more regions of HBV DNA with a quantitative methylation assay; (iii) comparing the methylation level of the one or more regions of HBV DNA with the methylation level of the one or more regions of HBV DNA in one or more control body fluids or tissues from mammals known not to have HCC; and (iv) detecting the presence or absence of HCC, with an elevated methylation level in the one or more regions of HEY DNA as compared to the methylation level in the one or more regions of HBV DNA in the one or more control body fluids or tissues indicating the presence of HCC, and absence of elevated methylation levels indicating the absence of HCC; wherein the one or more regions of HBV DNA consists of CpG island 3 of the HBV genome; wherein a forward primer, a reverse primer and a probe for the real-time quantitative PCR are nucleotide sequences of SEQ ID No. 38, SEQ ID No. 39 and SEQ ID No. 40, respectively, wherein a forward primer, a reverse primer and a probe for the BSP are nucleotide sequences of SEQ ID No. 12, SEQ ID No. 13, and SEQ No. 14, respectively; wherein the MSP is a two-step MSP comprising a first step MSP and a second step MSP, and the one or more regions of HBV DNA consist of CpG island 3, wherein: a forward primer and a reverse primer for the first step MSP are nucleotide sequences of SEQ ID No. 21 and SEQ ID No. 22, respectively; and a forward primer, a reverse primer and a probe for the second step MSP are nucleotide sequences of SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 24, respectively.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a diagram of the HBV genome (NC_003977.1) indicating the location of the three CpG islands and the primers for PCR assays used in the present application.

(2) FIG. 2 is the methylation profile of the HBV genome by bisulfite sequencing of DNA isolated from cell cultures or liver tissues from HBV patients.

(3) FIG. 3 shows the quantitative analysis of HBV DNA methylation in infected diseased livers.

(4) FIG. 4 shows comparison of HBV and host gene methylation in HBV-HCC.

(5) FIG. 5 shows the comparison of the amount of methylated HBV CpG island 3 DNA determined by a short amplicon MSP assay, in urine of patients with HBV-related liver diseases.

(6) FIG. 6 shows the detection of methylated CpG 3 DNA by the a short amplicon MSP assay, in urine of patients with HBV infection as a biomarker to distinguish HCC from cirrhosis.

(7) FIG. 7 shows the detection of methylated CpG 3 DNA by a short amplicon MSP assay, in urine of patients with HBV infection as a biomarker to distinguish HCC from hepatitis+cirrhosis.

(8) FIG. 8 shows results using the protocol for quantification of bisulfite converted CpG island 1 of the HBV genome.

(9) FIG. 9 shows results using the protocol for the quantification of methylated CpG island 1 of the HBV genome.

(10) FIG. 10 shows results using the protocol for the quantification of bisulfite converted CpG island 2 of the HBV genome.

(11) FIG. 11 shows results using the protocol for the quantification of methylated CpG island 2 of the HBV genome.

(12) FIG. 12 shows results using the protocol for the quantification of bisulfite converted CpG island 3 of the HBV genome.

(13) FIG. 13 shows results using the protocol for the quantification of methylated CpG island 3 of the HBV genome.

(14) FIG. 14 shows results using the protocol for detection of circulation derived methylated CpG island 3 of the HBV genome by using HBV-MSP Short Amplicon Assay (mHBV).

(15) FIG. 15 shows results using the protocol for quantification of methylated CpG island 3 of the HBV genome by a short amplicon MSP assay that can be used for fragmented DNA.

(16) FIG. 16 shows results using the protocol for quantification of genomic CpG island 1 of the HBV genome.

(17) FIG. 17 shows results using the protocol for quantification of genomic CpG island 2 of the HBV genome.

(18) FIG. 18 shows results using the protocol for quantification of genomic CpG island 2 of the HBV genome.

(19) FIG. 19 shows results using the protocol for quantification of genomic CpG island 2 of the HBV genome.

(20) FIG. 20 shows results using the protocol for quantification of genomic CpG island 2 of the HBV genome.

(21) FIG. 21 shows results using the protocol for quantification of genomic CpG island 2 of the HBV genome.

(22) FIG. 22 shows results using the protocol for quantification of genomic CpG island 3 of the HBV genome.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

(23) The present subject matter may be understood more readily by reference to the following detailed description taken in connection with the accompanying examples, which form a part of this disclosure. It is to be understood that this invention is not limited to the specific devices, methods, applications, conditions or parameters described and/or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed invention.

(24) Also, as used in the specification including the appended claims, the singular forms “a,” “an,” and “the” include the plural, and reference to a particular numerical value includes at least that particular value, unless the context clearly dictates otherwise. The term “plurality,” as used herein, means more than one. When a range of values is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it is understood that the particular value forms another embodiment. All ranges are inclusive and combinable.

(25) Hepatitis B virus (HBV) is a hepatotropic virus causing hepatitis, cirrhosis and hepatocellular carcinoma (HCC). In patients, HBV DNA circulates in blood as virion DNA and exists in hepatocytes both as nuclear form (episomal cccDNA and integrated DNA) and as cytoplasmic core DNA form. It has been reported that HBV infection up-regulates DNA (cytosine-5) methyltransferases and thus induces epigenetic changes in the host cells. Understanding the methylation status of the HBV DNA in its different forms can potentially provide insight into the pathogenesis of HBV-related liver diseases including hepatocarcinogenesis. Previous studies conducted in patient serum and in cell cultures have demonstrated that the CpG islands of HBV virion DNA are in the unmethylated state, and cccDNA methylation has been extensively studied for its role in the regulation of transcription, but very few studies have investigated the methylation status of the HBV DNA in various disease stages of human liver tissues.

(26) The discovery of the association between CpG island 3 methylation and HCC development is illustrated in FIGS. 3 to 7. FIG. 3 shows the methylation profile of CpG island 3 in different liver diseases including hepatitis, cirrhosis, and HCC by bisulfite PCR sequencing, suggesting that the methylation of the CpG island 3 is associated with HCC development; Thus, it can be a potential biomarker for the early detection of HCC and can be used for HCC screening using urine as body fluid as described in FIGS. 5 to 7.

(27) FIG. 1 is a diagram of the HBV genome (NC_003977.1) indicating the location of the three CpG islands and the primers for PCR assays used in the present application. Black rectangles represent the HBV regions; polymerase, enhancer II, basal core promoter, precore, preS and X gene. These regions correspond to the dashed line representing the HBV genome with vertical gray bars indicating nucleotide location. The three CpG islands are indicated by horizontal grey bars below the dashed line. The CpG site distribution in the HBV genome (solid black line) is depicted by vertical grey lines each representing an individual CpG site. The boxes with black borders on the CpG distribution map indicate the regions targeted by the bisulfite sequencing PCR and are enlarged below for better resolution of the CpG sites. The numbering of the CpG sites in the enlarged regions corresponds to that used in FIG. 2. The arrows below this enlarged bisulfite sequencing region indicate primer locations for the specified PCR assays. Detailed primer information is in Table 3. FIG. 1 shows CpG Islands reports potential CpG island regions using the method described by Gardiner-Garden and Frommer (1987). The calculation is performed using a 200 bp window moving across the sequence at 1 bp intervals. CpG islands are defined as sequence ranges where the Obs/Exp value is greater than 0.6 and the GC content is greater than 50%.

(28) As shown in FIG. 2, we did not detect methylation in virions. No detectable methylation was identified either in cytoplasmic core, the cccDNA/extra-chromosomal nuclear DNA isolated from HepDE19 cells, or the total DNA from the HepG2.2.15 cell culture. For the integrated DNA, when the DNA was derived from SNU-398 cells, which contain the transcriptionally repressed HBV genome, DNA methylation was detected in all the HBV DNA amplified by BS-PCR primers. When the integrated HBV DNA from Hep3B was analyzed, which is known to express the S antigen, preS and X transcripts, the HBV DNA was mostly unmethylated except for the CpG island 1, which was mostly methylated.

(29) As shown in FIG. 2, there are regions marked as “data unavailable” such as the CpG island 1 and the 5′ end of the CpG island 2 of the HBV genome in SNU-398 cells, and the middle of the CpG island 2 and CG3 of the HBV genome in Hep3B cells. These were the regions that BS-PCR reactions either failed to generate specific PCR products for DNA sequencing, or the sequencing data were unreadable despite multiple attempts. Many attempts using multiple sets of primers for both untreated and BS-treated DNA were unable to amplify detectable PCR products, perhaps due to the possibility that DNA sequences in these areas might be either deleted during HBV integration, or altered to the extent that none of the tested primers had sufficient homology to prime the PCR reaction. As compared to the reference genome, few nucleotide variants were noted in Hep3B and SNU-398 cells.

(30) To obtain the comprehensive methylation profiles for each CpG site of all three known CpG islands in the HBV genomes from both cell cultures and infected tissues, we chose to perform bisulfite PCR (BS-PCR) sequencing on a small set of tissue samples (8 hepatitis, 6 cirrhosis, and 12 HCC) based on the quantity of DNA available to us. The clinicopathological information is summarized in Supplementary Table S1 in Jain et. al., 2015. In order to design the suitable BS-specific primers, we began by performing the genotyping of the HBV DNA in each tissue sample. We then designed BS primers covering three CpG islands in various genotypes of the HBV genome, to amplify the BS-treated HBV DNA from cell cultures and tissue samples (FIG. 1, Table 1).

(31) FIG. 2 is the Methylation profile of the HBV genome by bisulfite sequencing of DNA isolated from cell cultures or liver tissues from HBV patients. Each box indicates one CpG site (filled, methylated; open, unmethylated; hatch, data unavailable; text, possible sequence variations at CpG site). Top panel shows the results from cell cultures—HepDES19 derived virion, core, cccDNA and total HepG2.215 DNA, followed by DNA isolated from two HBV-integrated HCC cell lines SNU-398 and Hep3B. Subsequent three panels show the results from clinical samples—hepatitis, cirrhosis and HCC aligned to HBV genotype C virus (NC_003977.1). Bottom panel shows results from total tumor tissue DNA (T), cccDNA from tumor (T.sub.C) and adjacent non-HCC tissue (N.sub.C). The genotype of each sample is indicated on the right.

(32) We next performed BS-PCR sequencing analysis on the disease tissues. As aforementioned, we developed a total of 24 sets of primers based on genotyping data, 10 sets for the CpG island 1, 12 sets for the CpG island 2, and 2 sets for the CpG island 3. Although we were able to generate specific PCR products from most of the HBV infected tissue DNA to obtain BS sequencing data for most of the CpG sites, there were still regions in the genomes that failed to be amplified, regardless of multiple attempts. Thus, the methylation status was unavailable for those regions, as indicated in the FIG. 2. Nevertheless, the information obtained is sufficient for statistical analysis of the methylation of each CpG island comparing HCC tissues to hepatitis and cirrhosis.

(33) To compare DNA methylation in different disease groups, we calculated the percentage of CpG sites that were found to contain detectable levels of methylation, which were analyzed for each disease group within each CpG island (Table 1). A low level of methylation was detected in all three CpG islands in the hepatitis samples (6.6%, 6%, and 17.5% in CpG island 1, CpG island 2 and CpG island 3, respectively), whereas, the HBV DNA detected in cirrhosis tissue was mostly unmethylated in CpG island 1 (0%) and CpG island 2 (0.8%), and a low level of methylation was found in CpG island 3 (10.8%). Interestingly, in the HCC samples, although a low percentage of methylation was detected in CpG island 1 and CpG island 2 (16.1% and 8%, respectively), 52.5% of the CpG sites in CpG island 3 were found to be methylated. Furthermore, every CpG site of CpG island 3, except for three, were found to be methylated in 6 of the 12 HCC samples that had methylation. Comparing these three CpG islands within HCC samples, the CpG island 3 is the most methylated (p<0.001, comparing CpG island 3 to CpG island 1 and CpG island 3 to CpG island 2, by Fisher's two-tailed exact test). When comparing the extent of methylation of CpG island 3 among three disease groups, HCC was significantly higher than that of hepatitis and cirrhosis (p<0.0001, Fisher's two-tailed exact test, Table 1). Similarly, HCC also had significantly higher levels of methylation in CpG island 1 and CpG island 2, as compared to hepatitis and cirrhosis (CpG island 1, p=0.0007; CpG island 2, p=0.0046, Fisher's two-tailed exact test, Table 1). There were few nucleotide variants with respect to the reference genome (Genbank # NC 003977.1), as noted in FIG. 2, which were mostly in CpG island 2 and the first 2 CpG sites of CpG island 1.

(34) TABLE-US-00001 TABLE 1 HBV DNA methylation in various HBV-infected livers by BS-PCR sequencing. CpG island Percent of methylated CpG sites.sup.ε 1 2 3 Hepatitis 6.6% (5/76) 6.0% (15/250) 17.5% (16/91) Cirrhosis 0% (0/60) 0.8% (2/236) 10.8% (7/65) HCC 16.1% (20/124) 8.0% (32/398) 52.5% (75/143) p value.sup.# 0.0007 0.0046 <0.0001 HCC vs. (Hepatitis and Cirrhosis) .sup.εThe percent of methylated CpG sites was calculated as the number of methylated CpG sites detected/total CpG sites with valid BS sequencing data (methylated + unmethylated) shown in FIG. 2. .sup.#Fisher's two-tailed exact test.

(35) FIG. 3 is the quantitative analysis of HBV DNA methylation in infected diseased livers. Scatter plots of the quantity of methylated HBV DNA detected by qMSP assays for each CpG island. Each data point represents one sample and is the average of two duplicate assays per input of 3000 copies of BS-actin DNA. p values indicate the statistical comparison between HCC and non-HCC (hepatitis and cirrhosis) samples for each CpG island by Mann-Whitney U test.

(36) To evaluate whether the extent of DNA methylation was associated with the progression of liver diseases, we developed quantitative MSP (qMSP) assays for each CpG island to measure the DNA methylation in a larger sample size. As some of the HBV infected tissues may not contain any detectable HBV DNA, each DNA sample was first subjected to the quantitative HBV DNA PCR assays for CpG island 1 and CpG island 3, as described in the Materials and Methods. Only samples positive for at least one HBV DNA assay were subjected to methylation analysis. The clinicopathological characteristics of the study subjects (74 HCC, 29 hepatitis and 13 cirrhosis) are listed in Supplementary Table S2 of Jain et. al., 2015. Three qMSP assays were performed to quantify the level of methylation for each of the three CpG islands. As shown in FIG. 3, there is no statistically significant difference (p>0.05, Mann Whitney U-test) between the methylation levels of HCC and non-HCC (hepatitis and cirrhosis) tissues in CpG island 1 and CpG island 2. In contrast, methylation of CG3 in HCC tissues (mean=1250.5, standard deviation=3504) was significantly higher than in non-HCC tissue (hepatitis and cirrhosis, mean=174.6, standard deviation=534) tissues (p<0.05, Mann Whitney U-test). Of the 74 HBV-HCC cases, 9 are HCV positive, 45 are HCV negative, and the HCV status of the remaining 20 is unknown. HCV infection is also known to cause aberrant methylation and can be a potential confounding factor. Hence, we compared the methylation levels of CpG island 3 in HBV-positive, HCV-negative HCC (n=45) to HBV-infected hepatitis and cirrhosis samples. The results confirmed that methylation of CpG island 3 in this subset of HCC tissues was still significantly higher than in hepatitis and cirrhosis tissues (p<=0.05, Mann Whitney U-test). We also observed no significant differences in the levels of CpG island 3 methylation in the HBV-HCC samples that were categorized by their HCV status (p=0.695, Kruskal Wallis test). Interestingly, we observed higher levels of methylation in CpG island 1 and CpG island 3 of hepatitis samples as compared to cirrhosis samples, although only methylation of CpG island 1 was significantly higher in hepatitis samples as compared to cirrhosis samples (p=0.05, Mann Whitney U test). No methylation was observed in either hepatitis or cirrhosis samples in CpG island 2.

(37) FIG. 4 shows comparison of HBV and host gene methylation in HBV-HCC. More specifically, it shows distribution of HBV and host genome methylation categorized by their serum alfa-fetoprotein (AFP) levels in HBV-HCC samples (n=68). Each column represents one sample. In the AFP row, filled rectangles indicate serum AFP greater than 20 ng/ml while open rectangles indicate a serum AFP level less than 20 ng/ml. Filled rectangles in mCpG1, mCpG2, mCpG3, mAPC, mGSTP1 and mRASSF1A indicate methylated status while open rectangles indicate no detectable methylation.

(38) It has been shown that HBV infection upregulates DNA methyltransferase activity, which leads to simultaneous methylation of HBV DNA and host CpG islands in cell culture experiments. DNA methylation of many tumor suppressor genes has been associated with carcinogenesis. Among these known tumor-associated, aberrant-methylation events, methylation of the APC, GSTP-1, and RASSF1A genes were found to be associated with HCC. It is therefore of interest to investigate whether the HBV DNA methylation correlates with these three HCC-associated host gene methylation events. BS-treated HCC DNA was subjected to previously developed quantitative MSP assays for these three genes (FIG. 4). The Spearman's rho test was used to determine the correlation co-efficiency (Table 2). When comparing methylation of genes within the host genome, there is a significant correlation (p<0.01) between either of the two host genes, and within the HBV genome in HBV-related HCC, there is also a significant correlation (p<0.01) between CpG island 1 and CpG island 3 of the HBV genome in HCC. The only significant correlation between HBV DNA and host genes was found between methylation of CpG island 3 and RASSF1A.

(39) TABLE-US-00002 TABLE 2 Correlation of DNA methylation of the HBV genome with three known HCC associated host genes in HCC tissue. mCpG1 mCpG3 mAPC mGSTP1 Genes Statistic (n = 74) (n= 74) (n = 71) (n = 71) mCpG3 Spearman's .471 (n = 74) rho p value <0.001 mAPC Spearman's 0.098 0.094 (n = 71) rho p value 0.418 0.435 mGSTP1 Spearman's 0.233 −0.008 .324 (n = 71) rho p value 0.051 0.947 0.006 mRASSF1A Spearman's 0.132 .269 .510 .513 (n = 71) rho p value 0.271 0.023 <0.001 <0.001

(40) Cell-free circulating DNA has been shown to reflect characteristics of tumor DNA (Chan et al., 2008; Diehl et al., 2008; Forshew et al., 2012; Pathak, Bhutani, Kumar, Mohan, & Guleria, 2006; Stroun, Anker, Lyautey, Lederrey, & Maurice, 1987; Stroun et al., 1989; Tsutsui et al., 2010; Utting, Werner, Dahse, Schubert, & Junker, 2002; Wong, Zhang, Lai, Lau, & Lo, 2003; Wu et al., 2002; Yen et al., 2009; Ziegler, Zangemeister-Wittke, & Stahel, 2002) and are mostly fragmented in 1-2 nucleosomal sizes in some body fluids such as plasma and urine. Attempts have been made to detect cancer genetically in blood, but developing a test of sufficient sensitivity has been challenging (Chan et al., 2008; Kirk et al., 2005; Lleonart et al., 2005; Tsutsui et al., 2010; Wong et al., 2003). Thus, technologies must be developed that would be capable of isolating circulating DNA in quantities sufficient for the analysis of biomarkers and of detecting circulating DNA markers with a sensitivity and specificity sufficient to translate the discovered biomarkers for application in HCC screening.

(41) Urine has been used as a source of reporter molecules for urinary tract diseases with great clinical benefit. Urine-based tests are non-invasive and very patient-friendly. The use of urine as a biological fluid for cancer detection is now possible with advances in molecular biomarker assays and recent findings that tumor-derived DNA in circulation can be detected in urine as low-molecular-weight (LMW) urine DNA, which is less than 300 bp in size (Su et al., 2004). A short amplicon MSP assay was developed (as described in the paragraph 61) to quantify the methylated HBV CpG island 3 DNA in urine and other body fluids. FIG. 5 shows the amount of methylated HBV CpG island 3 DNA determined by a short amplicon MSP assay (as described in the paragraph 61) in urine of patients with HBV-related liver diseases, compared with the amount of methylated HBV CpG island 3 in normal non-cancer subjects.

(42) FIG. 6 shows the detection of methylated CpG 3 DNA by a short amplicon MSP assay (as described in the paragraph 61), in urine of patients with HBV infection as a biomarker to distinguish HCC from cirrhosis. The ROC curve was constructed and area under the curve (AUROC) was 0.867. In this small cohort, the AUROC of serum AFP was 0.798.

(43) FIG. 7 shows the performance of methylated CpG 3 DNA as a DNA biomarker to distinguish HCC from non-HCC (hepatitis+cirrhosis) in urine of patients with HBV infection, assayed by a short amplicon MSP assay (as described in the paragraph 61). The ROC curve was constructed and AUROC was 0.923 to distinguish HCC from non-HCC in urine.

(44) The term “nucleotide amplification reaction” refers to any suitable procedure that amplifies a specific region of polynucleotides (target) using primers. See generally Kwoh et al., Am. Biotechnol. Lab. 8:14 (1990; Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173-1177 (1989); Lizardi et al., BioTechnology 6:1197-1202 (1988); Malek et al., Methods Mol. Biol., 28:253-260 (1994); and Sambrook et al., “Molecular Cloning: A laboratory Manual” (1989)).

(45) A “detectable label” is a molecule or atom which can be conjugated to an antibody moiety to produce a molecule useful for diagnosis. Examples of detectable labels include chelators, photoactive agents, radioisotopes, fluorescent agents, paramagnetic ions, or other marker moieties.

(46) The term “effective amount,” in the context of treatment of a disease or disorder refers to the amount of such molecule that is sufficient to inhibit the occurrence or ameliorate one or more clinical or diagnostic symptoms of the disease or disorder in a subject. The term “effective regime” refers to a combination of amount of the agent being administered and dosage frequency adequate to accomplish treatment or prevention of the disease or disorder.

(47) Due to the imprecision of standard analytical methods, molecular weights and lengths of polymers are understood to be approximate values. When such a value is expressed as “about” X or “approximately” X, the stated value of X will be understood to be accurate to ±10%. are provided to assist in a further understanding of the inventions. Particular materials used, protocols and conditions are intended to be further illustrative of the inventions and should not be construed to limit the reasonable scope thereof.

(48) Provided herein is a suitable method for detecting the presence or absence of a cancer in an individual by determining the level of DNA mutations and aberrant DNA methylation from the individual, comparing the level of DNA mutations and aberrant DNA methylation with a baseline level of DNA mutations and methylation found in one or more control samples from individuals known not to have the cancer, and correlating a finding of elevated methylation and DNA mutations in the individual with an enhanced likelihood that the individual has cancer. The cancer can be hepatocellular carcinoma (HCC) and the control can be non-HCC sample. The examples of genetic DNA mutations (listed in Table 3) and aberrant DNA methylation markers (listed in Table 3) that can be used for HCC screening using urine as body fluid.

(49) Provided herein is a suitable method for detecting the presence or absence of HBV DNA in liver tissues or body fluids and whether the HBV DNA is methylated. The examples of oliogs used in each assay for detecting HBV DNA or bisulfite converted HBV DNA with the location of the oligos and conditions of the respective PCR reactions (listed in Table 3).

(50) TABLE-US-00003 TABLE 3 Primer/Probe sequences and reaction parameters for quantitative PCR assays HBV nt. Location (NC_003977.1) Assay Forward Reverse Probe/Detection format PCR conditions CpG Island 1 207-285 BSP HBV_BSC1F1: HBV_BSC1R3: BSC1TQ:[6FAM]TTATAA 95° C. 5 min, (95° C. GGTTTTTTTTGTTGAT CCCCCTAAAAA TATTATAGAGTTTAGA 10 s 50° C. 15 s, 72° C. 10 s) × AAGAATTT (SEQ ID ATTAAAAAAA TTYGTGGTGGA[BHQ1] 50 cycles NO: 1) A (SEQ ID NO: 2) (SEQ ID NO: 3) 293-402 MSP HBV_C1F2B: HBV_C1R5B: C1MSTQ:[6FAM] 95° C. 5 min, (95° C. 10 s 55° C. 30 s, ACGTGTTTTGGTTAA AATATAATAAA GTTTTTTAATTTGTTTT 72° C. 10 s) × 50 cycles AATTCGTAGTTTTTA ACGCCGCAAAC GGTTATCGTTGGATG (SEQ ID NO: 4) ACATC (SEQ ID [BHQ1] (SEQ ID NO: 6) NO: 5) CpG Island 2 1660-1733 BSP HBV_BSC2F1: HBV_BSC2R3: BSC2TQ:[6FAM]ATGTTA 95° C. 5 min, (95° C. GGATTTTTGGATTTTT CCAATCTTTAA AYGATYGATTTTGAGG 10 s 53° C. 15 s, 72° C. 10 s) × AGTAATGTT (SEQ ID ACAAACAATCT TATATTTTAA[BHQ1] 50 cycles NO: 7) TTAA (SEQ ID (SEQ ID NO: 9) NO: 8) 1502-1579 MSP HBV_C2MF3: HBV_C2MR3: SYBR Green 95° C. 5 min, (95° C. 10 s 52° C. 30 s, TGTCGTTTCGGTCGAT CACGATCCGAC 72° C. 10 s) × 45 cycles, melt [95° C. TAC (SEQ ID NO: 10) AAATAAAAA 5 s, 65° C. 60 s, 97° C. (SEQ ID NO: 11) continuous], 40° C. 30 s CpG Island 3 2161-2239 BSP HBV_BSC3F9: HBV_BSC3R9.10: C3BSTQ: 95° C. 10 min, (95° C. 10 s, 52° C. 30 s, TTATGTTAATGTTAAT TTCTCTTCCAA [6FAM]TTAgATAATTAT 72° C. 10 s) × 50 cycles ATGGGTTTAAA (SEQ AAATAAAACA Tg+Tgg+T+T+T+TA+TA+ ID NO: 12) A (SEQ ID T[BBQ] (SEQ ID NO: 14) NO: 13) 2270-2412 MSP HBV_MSP2F: HBV_MSP2R: C3AMSTQ: 95° C. 10 min, (95° C. 10 s, 53° C. 30 s, GTGTGGATTCGTATTT GACGATTAAAA AACCTACCTCGTCGTCT 72° C. 10 s) × 45 cycles TTTTC (SEQ ID NO: 15) CCTTCGTCT AACAACAAT (SEQ ID (SEQ ID NO: 16) NO: 17) 2370-2412 MSP- HBT_SMF1: HBV_MSP2R; N/A 95° C. 5 min, (95° C. 30 s, 50° C. 30 s, Step 1 GCTCTTCGTGGTGTG GACGATTAAAA 72° C. 30 s) × 27 cycles, 72° C. 4 min, GTGAAGAAGAATTTT CCTTCGTCT 4° C. Hold TTCGTTTC (SEQ ID NO (SEQ ID NO: 16) 18) MSP- HBV_S2F1: HBV_S2R1: SYBR Green 95° C. 5 min, (95° C. 10 s, 50° C. 15 s, Step 2 TGTGGTGAAGAAGAA GACGATTAAAA 72° C. 10 s) × 45 cycles, Melting curve, TT (SEQ ID NO: 19) CCTTC (SEQ ID 40° C. 30 s NO: 20) 2375-2430 MSP- C3.M_F1: C3.M_R3: N/A 95° C. 5 min, (95° C. 30 s, 50° C. 30 s, Step 1 AGAATTTTTTCGTTTC AAAATCTTCTA 72° C. 30 s) × 25/40 cycles; 72° C. 4 min, GTAGAC (SEQ ID NO: CGACGCGACG 4° C. hold 21) ATTAA (SEQ ID NO: 22) MSP- C3.M_F1: C3.M_R2: SYBR and Simple Probe 95° C. 5 min, (95° C. 10 s, 53° C. 30 s, Step 2 AGAATTTTTTCGTTTC CTACGACGCGA FLQ-CG3.MSP SP: 72° C. 10 s) × 45 cycles GTAGAC (SEQ ID CGATTAAAAC TCGTTTCGTAGACGAA NO: 21) (SEQ ID NO: 23) GGT--PH (SEQ ID NO: 24) CpG Island 1 246-309 HBV HBV240F3: HBVC240R1: HBV240 TaqMan: 95° C. 5 min, (95° C. 10 s, 54° C. 15 s, DNA GTCTAGACTCGTGGT TTTTGGCCAGG [6FAM]CAATTTTCTAGG 72° C. 10 s) × 45 cycles GGA (SEQ ID NO: 25) ACAC (SEQ ID GGGAGCACCCAC[BHQ1] NO: 26) (SEQ ID NO: 27) CpG Island 2 1583-1622 HBV_F_1583_1602: HBV_R_1604_1622: SYBR Green 95° C. 5 min, (95° C. 10 s 60° C. ACTTCGCTTCACCTCT CACGGTGGT 10 s, 72° C. 10 s) × 45 cycles, melt [95° C. GCAC (SEQ ID NO: 28) CTCCATGCTAC 5 s, 65° C. 60 s, 97° C. continuous], (SEQ ID NO: 29) 40° C. 30 s 1613-1671 HBV_F_1613_1629: HBVRev1671_1654_Chr21: SYBR Green 95° C. 5 min, (95° C. GACCACCGTGAACGC AGTCCAAGAGT 10 s 60° C. 10 s, 72° C. 10 s) × CC (SEQ ID NO: 30) CCTGTTGTGCA 45 cycles, melt [95° C. 5 s, 65° C. 60 s, AGACCTT (SEQ 97° C. continuous], 40° C. 30 s ID NO: 31) 1633-1680 HBV_F_1633_1653: HBV_R_1660_1680: SYBR Green 95° C. 5 min, (95° C. AGGTCTTGCCCAAGG TTGCTGAGA 10 s 60° C. 10 s, 72° C. 10 s) × TCTTAC (SEQ ID GTCCAAGAGTC 45 cycles, melt [95° C. 5 s, 65° C. NO: 32) C (SEQ ID 60 s, 97° C. continuous], 40° C. 30 s NO: 33) 1685-1719 HBV_F_1685_1719: HBV_R_1713_1740: SYBR Green 95° C. 5 min, (95° C. AACGACCGACCTTGA CTCCTCCCAGT 10 s 60° C. 10 s, 72° C. 10 s) × GGCATACTTC (SEQ ID CTTTAAACAAA 45 cycles, melt [95° C. 5 s, 65° C. 60 s, NO: 34) CAGTC (SED ID 97° C. continuous], 40° C. 30 s NO: 35) 1741-1791 TRGGGGAGGAGATAA ATGCCTACAGC SYBR Green 95° C. 5 min, (95° C. 10 s 65° C. 10 s, GGTTAAAGGTC (SEQ CTCCTAGTACA 72° C. 8 s) × 40 cycles, melt ID NO: 36) A (SEQ ID [95° C. 5 s, 65° C. 60 s, 97° C. NO: 37) continuous], 40° C. 30 s CpG Island 3 2294-2347 HBV gp4 Fwd3a1: HBV gp4 Rev3a: HBV gp4 Probe_53bp: 95° C. 5 min, (95° C. 10 s 58° C. 15 s, TACAGACCACCAAAT AACAACAGTA [6FAM]C+CTAT+C+T+T 72° C. 15 s) × 45 cycles GCC (SEQ ID NO: 38) GTTTCCGGAAG AT+CAA+CA+CTT+C[BHQ1] TGTTG (SEQ ID (SEQ ID NO: 40) NO: 39) “+” indicates LNA nucleotide “R” indicates A + G nucleotides

(51) Below is the detailed protocol for quantification of bisulfite converted CpG island 1 of the HBV genome (results shows in FIG. 8).

(52) TABLE-US-00004 Product Primer/Probe Sequence: 5′ to 3′ Size.sup.1 HBV_BSC1F1 (SEQ ID NO: 1) GGTTTTTTTTGTTGATAAGAATTT 79 bp HBV_BSC1R3 (SEQ ID NO: 2) CCCCCTAAAAAATTAAAAAAAA BSC1TQ (SEQ ID NO: 3) [6FAM]TTATAATATTATAGAGTTTAGATTYGTGGTGGA[BHQ1] Roche Light Cycler 480 - Template: Mono-color Hydrolysis Probe 95° C. 5 min, (95° C. 10 s 50° C. 15 s, 72° C. 10 s) × 50 cycles Component [Stock] [Final] uL/rxn DNA Template HBV Copy/ul LC480 Probe Master Mix 2x 1x 5 HepG2 BSF (500 copies) 0 HBV_BSC1_F1R3 10 uM   1 uM 1 Meth. HepG2.215 10 Probe (BSC1TQ)  1 uM 0.1 uM 1 Meth. HepG2.215 50 H.sub.2O — — 2 Meth. HepG2.215 100 DNA Template — — 1 Meth. HepG2.215 1000 Total: 10 Meth. HepG2.215 10000

(53) Below is the detailed protocol for the quantification of methylated CpG island 1 of the HBV genome (results shows in FIG. 9).

(54) TABLE-US-00005 Primer/Probe Sequence: 5′ to 3′ Product HBV_C1F2B (SEQ ID NO: 4) ACGTGTTTTGGTTAAAATTCGTAGTTTTTA 110 bp HBV_C1R5B (SEQ ID NO: 5) AATATAATAAAACGCCGCAAACACATC C1MSTQ (SEQ ID NO: 6) [6FAM]TTTTTTAATTTGTTTTGGTTATCGTTGGATG[BHQ1] Roche Light Cycler 480 - Template: Mono-color Hydrolysis Probe 95° C. 5 min, (95° C. 10 s 55° C. 30 s, 72° C. 10 s) × 50 cycles Component [Stock] [Final] uL/rxn DNA Template HBV copy/ul LC480 Probe Master Mix 2x 1x 5 HepG2 BSF (500 copies) 0 HBV_C1F2B_R5B 10 uM   1 uM 1 Meth. HepG2.215 1 Probe (C1MSTQ)  1 uM 0.1 uM 1 Meth. HepG2.215 5 H.sub.2O — — 2 Meth. HepG2.215 10 DNA Template — — 1 Meth. HepG2.215 50 Total: 10 Meth. HepG2.215 100 Meth. HepG2.215 1000

(55) Below is the detailed protocol for the quantification of bisulfite converted CpG island 2 of the HBV genome (results shows in FIG. 10).

(56) TABLE-US-00006 Primer/Probe Sequence: 5′ to 3′ Product HBV_BSC2F1 (SEQ ID NO: 7) GGATTTTTGGATTTTTAGTAATGTT 74 bp HBV_BSC2R3 (SEQ ID NO: 8) CCAATCTTTAAACAAACAATCTTTAA BSC2TQ (SEQ ID NO: 9) [6FAM]ATGTTAAYGATYGATTTTGAGGTATATTTTAA[BHQ1] Roche Light Cycler 480 - Template: Mono-color Hydrolysis Probe 95° C. 5 min, (95° C. 10 s 53° C. 15 s, 72° C. 10 s) × 50 cycles Component [Stock] [Final] uL/rxn DNA Template HBV Copy/ul LC480 Probe Master Mix 2x 1x 5 HepG2 BSF (500 copies) 0 HBV_BSC2_F1R3 10 uM   1 uM 1 Meth. HepG2.215 10 Probe (BSC2TQ)  1 uM 0.1 uM 1 Meth. HepG2.215 100 H.sub.2O — — 2 Meth. HepG2.215 500 DNA Template — — 1 Meth. HepG2.215 1000 Total: 10
Below is the detailed protocol for the quantification of methylated CpG island 2 of the HBV genome (results shows in FIG. 11).

(57) TABLE-US-00007 Primer Sequence: 5′ to 3′ Product HBV_C2MF3 (SEQ ID: 10) TGTCGTTTCGGTCGATTAC 78 bp HBV_C2MR3 (SEQ ID NO: 11) CACGATCCGACAAATAAAAA Roche Light Cycler 480 - Template: SYBR Green I 95° C. 5 min, (95° C. 10 s 52° C. 30 s, 72° C. 10 s) × 45 cycles, Melting curve, 40° C. 30 S Component [Stock] [Final] uL/reaction DNA Template HBV copy/ul LC480 SYBR Green 2x 1x 5 HepG2 BSF (500 copies) 0 Mix Meth. HepG2.215 5 HBV_C2MF3_R3 10 uM 1 uM 1 Meth. HepG2.215 10 H.sub.2O — — 3 Meth. HepG2.215 100 DNA Template — — 1 Meth. HepG2.215 1000 Total: 10 Meth. HepG2.215 10000 Meth. HepG2.215 20000

(58) Below is the detailed protocol for the quantification of bisulfate converted CpG island 3 of the HBV genome (results shows in FIG. 12).

(59) TABLE-US-00008 Primer Name Sequence: 5′ to 3′ Product HBV_BSC3F9 (SEQ ID NO: 12) TTATGTTAATGTTAATATGGGTTTAAA 79 bp HBV_BSC3R9.10 (SEQ ID NO: 13) TTCTCTTCCAAAAATAAAACAA C3BSTQ (SEQ ID NO: 14) 6FAM-TTAgATAATTATTg+Tgg+T+T+T+TA+TA+T--BBQ Roche Light Cycler 480 - Template: Mono Color Hydrolysis Probe I 95° C. 10 min, (95° C. 10 s, 52° C. 30 s, 72° C. 10 s) × 50 cycles Component [Stock] [Final] uL/rxn DNA Template HBV copy/ul.sup.1 LC480 Probe Master Mix 2x 1x 5 water 0 HBV_BF9_R9.10 10 uM   1 uM 1 HepG2 BSF (500 copies) 0 Probe (C3BSTQ)  1 uM 0.1 uM 1 Meth. HepG2.215 50 H.sub.2O — — 2 Meth. HepG2.215 100 DNA Template — — 1 Meth. HepG2.215 1000 Total: 10 Meth. HepG2.215 10000

(60) Below is the detailed protocol for the quantification of methylated CpG island 3 of the HBV genome (results shows in FIG. 13).

(61) TABLE-US-00009 Primer Name Sequence: 5′ to 3′ Product HBV_MSP2F (SEQ ID NO: 15) GTGTGGATTCGTATTTTTTTC 143 bp HBV_MSP2R (SEQ ID NO: 16) GACGATTAAAACCTTCGTCT C3AMSTQ (SEQ ID NO: 17) AACCTACCTCGTCGTCTAACAACAAT Roche Light Cycler 480 - Template: Mono Color Hydrolysis Probe I 95° C. 10 min, (95° C. 10 s, 53° C. 30 s, 72° C. 10 s) × 45 cycles Component [Stock] [Final] uL/rxn DNA Template HBV Copy/ul LC480 Probe Master Mix 2x 1x 5 water 0 HBV_MSP2F_2R 10 uM   1 uM 1 HepG2 BSF (500 copies) 0 Probe (C3AMSTQ)  1 uM 0.1 uM 1 Meth. HepG2.215 50 H.sub.2O — — 2 Meth. HepG2.215 100 DNA Template — — 1 Meth. HepG2.215 1000 Total: 10 Meth. HepG2.215 10000

(62) Below is the detailed protocol for detection of circulation derived methylated CpG island 3 of the HBV genome by using HBV-MSP Short Amplicon Assay (mHBV) Target Amplicon Size: 42 bp (results shows in FIG. 14).

(63) TABLE-US-00010 Primer Name Sequence: 5′ to 3′ Product HBV_SMF1 (SEQ ID NO: 18) GCTCTTCGTGGTGTGGTGAAGAAGAATTTTTTCGTTTC 42 bp HBV_MSP2R (SEQ ID NO: 16) GACGATTAAAACCTTCGTCT HBV_S2F1 (SEQ ID NO: 19) TGTGGTGAAGAAGAATT HBV_S2R1 (SEQ ID NO: 20) GACGATTAAAACCTTC 1st PCR: Product size - 60 bp Component Stock Concentration Final Concentration uL/reaction 10X PCR Buffer 10X 1X 1 dNTP 2.5 mM each 250 uM each 0.8 HBT_SMF1/MSP2R 10 uM 1 uM 1 HotStart Taq Plus 5 U/uL 1 U/reaction 0.2 DNA Template — — 1 H.sub.2O — — 6 Total 10 Eppendorf Thermal Cycler: 95° C. 5 min, (95° C. 30 s, 50° C. 30 s, 72° C. 30 s) × 27 cycles, 72° C. 4 min, 4° C. Hold *Dilute 1st PCR products 1:10 by adding 90 uL H.sub.2O to each tube. 2nd PCR: Product size - 45 bp Component Stock Concentration Final Concentration uL/reaction LC480 SYBR Green Mix 2X 1X 5 HBV_S2F1/R1 10 uM 1 uM 1 1st PCR Product (1:10) — — 1 H.sub.2O — — 3 Total 10 Roche LightCycler 480 - Template: SYBR Green I 95° C. 5 min, (95° C. 10 s, 50° C. 15 s, 72° C. 10 s) × 45 cycles, Melting curve, 40° C. 30 s

(64) Below is the detailed protocol for quantification of methylated CpG island 3 of the HBV genome by a short amplicon MSP assay that can be used for fragmented DNA (results shows in FIG. 15).

(65) TABLE-US-00011 Primer Name Sequence: 5′ to 3′ Product C3.M_F1 (SEQ ID NO: 21) AGAATTTTTTCGTTTCGTAGAC 55 bp C3.M_R3 (SEQ ID NO: 22) AAAATCTTCTACGACGCGACGATTAA C3.M_R2 (SEQ ID NO: 23) CTACGACGCGACGATTAAAAC CG3.MSP SP (SEQ ID NO: 24) FLQ-TCgTTTCgTAgACgAAggT--PH First Step: Hotstart TAQ Plus Amplification: Eppendorf Vapo Protect Thermocycler - Program Template: Hotstart 95° C. 5 min, (95° C. 30 s, 50° C. 30 s, 72° C. 30 s) × 27 Pause + 40 cycles; 72° C. 4 min, 4° C. hold After 27 cycles, take out 1 uL and dilute with 9 ul H2O (2nd step template), put back remaining reaction volume for 40 cycles (melt template) Second step: Roche Light Cycler 480 - Template: SybrGreen 95° C. 5 min, (95° C. 10 s, 53° C. 30 s, 72° C. 10 s) × 45 cycles Melt step: Roche Light Cycler 480 - Template: Simple Probe 95° C. 1 min, 95° C. 60 s, 40° C. 120 s, 95° C. continuous; 40° C. 30 s Hotstart TAQ Plus Amplification Component [Stock] [Final] uL/rxn DNA Template BSF HBV Copy/ul HotStart TAQ Plus 2x 1x 5 water 0 C3.M_F1/R3 10 uM 1 uM 1 Meth. HepG2 (200 copies) 0 H.sub.2O — — 1 Meth. HepG2.215* 3 DNA Template — — 1 Meth. HepG2.215* 10 Total: 10 Meth. HepG2.215* 100 Meth. HepG2.215* 1000 Meth. HepG2.215* 10000 *In background of Meth. HepG2 200 cp Sybrgreen qPCR (2nd step) Simple Probe Melt Component [Stock] [Final] uL/rxn Component [Stock] [Final] uL/rxn LC480 Sybrgreen 2x 1x 5 CG3.MSP SP 2 uM 0.2 uM 1 Master H.sub.2O — — 5 C3.M_F1/R2 10 uM 1 uM 1 DNA Template — — 4 H.sub.2O — — 1 (Hotstart TAQ DNA Template — — 1 amplification Total: 10 PCR product) Total: 10

(66) Below is the detailed protocol for quantification of genomic CpG island 1 of the HBV genome (results shows in FIG. 16).

(67) TABLE-US-00012 Product Primer/Probe Sequence: 5′ to 3′ Size HBV240F3 (SEQ ID NO: 25) GTCTAGACTCGTGGTGGA 64 bp HBVC240R1 (SEQ ID NO: 26) TTTTGGCCAGGACAC HBV240 TaqMan (SEQ ID NO: 27) [6FAM]CAATTTTCTAGGGGGAGCACCCAC[BHQ1] Roche Light Cycler 480 - Template: Mono-color Hydrolysis Probe 95° C. 5 min, (95° C. 10 s 54° C. 10 s, 64° C. 15 s) × 45 cycles Component [Stock] [Final] uL/rxn DNA Template HBV Copy/ul LC480 Probe Master Mix 2x 1x 5 PSP65 HBV + HepG2 0.1 ng/ul 1.5E8 HBV240F3/C240R1 10 uM   .5 uM 0.5 PSP65 HBV + HepG2 0.1 ng/ul 1.5E7 Probe (HBV240 TaqMan)  3 uM 0.15 uM 0.5 PSP65 HBV + HepG2 0.1 ng/ul 1.5E6 H.sub.2O — — 2 PSP65 HBV + HepG2 0.1 ng/ul 1.5E5 DNA Template — — 1 PSP65 HBV + HepG2 0.1 ng/ul 1.5E4 Total: 10 PSP65 HBV + HepG2 0.1 ng/ul 1.5E3 PSP65 HBV + HepG2 0.1 ng/ul 1.5E2 PSP65 HBV + HepG2 0.1 ng/ul 1.5E1 PSP65 HBV + HepG2 0.1 ng/ul 1.5 H2O + HepG2

(68) Below is the detailed protocol for quantification of genomic CpG island 2 of the HBV genome (results shows in FIG. 17).

(69) TABLE-US-00013 Primer/Probe Sequence: 5′ to 3′ Product Size HBV_F_1583_1602 (SEQ ID NO: 28) ACTTCGCTTCACCTCTGCAC 39 bp HBV_R_1604_1622 (SEQ ID NO: 29) CACGGTGGTCTCCATGCTAC Roche Light Cycler 480 - Template: SYBR Green 95° C. 5 min, (95° C. 10 s 60° C. 10 s, 72° C. 10 s) × 45 cycles, melt [95° C. 5 s, 65° C. 60 s, 97° C. continuous, 40 C. 30 s Component [Stock] [Final] uL/rxn DNA Template HBV Copy/ul LC480 SYBR Green 2x 1x 5 pspHBV 1000 cp + HepG2 1 ng 1000 HBV 10 uM 1 uM 1 pspHBV 100 cp + HepG2 1 ng 100 F1583_1603/R_1604_1622 pspHBV 10 cp + HepG2 1 ng 10 H.sub.2O — — 3 pspHBV 1 cp + HepG2 1 ng 1 DNA Template — — 1 H2O Total: 10

(70) Below is the detailed protocol for quantification of genomic CpG island 2 of the HBV genome (results shows in FIG. 18).

(71) TABLE-US-00014 Product Primer/Probe Sequence: 5′ to 3′ Size HBV_F_1613_1629 (SEQ ID NO: 30) GACCACCGTGAACGCCC 58 bp HBVRev1671_1654_Chr21 (SEQ ID NO: 31) AGTCCAAGAGTCCTGTTGTGCAAGACCTT Roche Light Cycler 480 - Template: SYBR Green 95° C. 5 min, (95° C. 10 s 60° C. 10 s, 72° C. 10 s) × 45 cycles, melt [95° C. 5 s, 65° C. 60 s, 97° C. continuous], 40 C. 30 s uL/ Component [Stock] [Final] rxn DNA Template HBV Copy/ul LC480 SYBR Green 2x 1x 5 pspHBV 1000 cp + HepG2 1 ng 1000 HBV_F_1613_1629/ 10 uM 1 uM 1 pspHBV 100 cp + HepG2 1 ng 100 HBVRev1671_1654_Chr21 pspHBV 10 cp + HepG2 1 ng 10 H.sub.2O — — 3 pspHBV 1 cp + HepG2 1 ng 1 DNA Template — — 1 H2O Total: 10

(72) Below is the detailed protocol for quantification of genomic CpG island 2 of the HBV genome (results shows in FIG. 19).

(73) TABLE-US-00015 Primers Sequence: 5′ to 3′ Product Size HBV_F_1633_1653 (SEQ ID NO: 32) AGGTCTTGCCCAAGGTCTTAC 47 bp HBV_R_1660_1680 (SEQ ID NO: 33) TTGCTGAGAGTCCAAGAGTCC Roche Light Cycler 480 - Template: SYBR Green 95° C. 5 min, (95° C. 10 s 60° C. 10 s, 72° C. 10 s) × 45 cycles, melt [95° C. 5 s, 65° C. 60 s, 97° C. continuous], 40 C. 30 s uL/ Component [Stock] [Final] rxn DNA Template HBV Copy/ul LC480 SYBR Green 2x 1x 5 pspHBV 1000 cp + HepG2 1000 HBV 10 uM 1 uM 1 1 ng F1633_1653/R_1660_1680 pspHBV 100 cp + HepG2 1 ng 100 H.sub.2O — — 3 pspHBV 10 cp + HepG2 1 ng 10 DNA Template — — 1 pspHBV 1 cp + HepG2 1 ng 1 Total: 10 H2O

(74) Below is the detailed protocol for quantification of genomic CpG island 2 of the HBV genome (results shows in FIG. 20).

(75) TABLE-US-00016 Product Primer/Probe Sequence: 5′ to 3′ Size HBV_F_1685_1719 (SEQ ID NO: 34) AACGACCGACCTTGAGGCATACTTC 55 bp HBV_R_1713_1740 (SEQ ID NO: 35) CTCCTCCCAGTCTTTAAACAAACAGTC Roche Light Cycler 480 - Template: SYBR Green 95° C. 5 min, (95° C. 10 s 60° C. 10 s, 72° C. 10 s) × 45 cycles, melt [95° C. 5 s, 65° C. 60 s, 97° C. continuous], 40 C. 30 s uL/ HBV Component [Stock] [Final] rxn DNA Template Copy/ul LC480 SYBR Green 2x 1x 5 pspHBV 100 cp + HepG2 1 ng 100 HBV_F_1685_1719/R_1713_1740 10 uM 1 uM 1 pspHBV 10 cp + HepG2 1 ng 10 H.sub.2O — — 3 pspHBV 1 cp + HepG2 1 ng 1 DNA Template — — 1 H2O Total: 10

(76) Below is the detailed protocol for quantification of genomic CpG island 2 of the HBV genome (results shows in FIG. 21).

(77) TABLE-US-00017 Primer/Probe Sequence: 5′ to 3′ Product Size HBV_F_1741_1767 (SEQ ID NO: 36) TRGGGGAGGAGATAAGGTTAAAGGTC 50 bp HBV_R_1768_1791 SEQ ID NO: 37) ATGCCTACAGCCTCCTAGTACAA Roche Light Cycler 480 - Template: SYBR Green 95° C. 5 min, (95° C. 10 s 65° C. 10 s, 72° C. 8 s) × 40 cycles, melt [95° C. 5 s, 65° C. 60 s, 97° C. continuous], 40 C. 30 s uL/ Component [Stock] [Final] rxn DNA Template HBV Copy/ul LC480 Sybrgreen Master 2x 1x 5 PSP65 HBV + HepG2 1 ng/ul 1.0E4 HBV_F_1741_1767/R_1768_1791 10 uM 1 uM 1 PSP65 HBV + HepG2 1 ng/ul 1.0E3 H.sub.2O — — 3 PSP65 HBV + HepG2 1 ng/ul 1.0E2 DNA Template — — 1 PSP65 HBV + HepG2 1 ng/ul 1.0E1 Total: 10 H2O

(78) Below is the detailed protocol for quantification of genomic CpG island 3 of the HBV genome (results shows in FIG. 22).

(79) TABLE-US-00018 Product Primer/Probe Sequence: 5′ to 3′ Size HBV gp4 Fwd3a1 (SEQ ID NO: 38) TACAGACCACCAAATGCC 54 bp HBV gp4 Rev3a (SEQ ID NO: 39) AACAACAGTAGTTTCCGGAAGTGTTGA HBV gp4 Probe_53bp (SEQ ID NO: 40) [6FAM] C+CTAT+C+T+TA T+CAA+CA+CTT+C [BHQ1] “+” indicates LNA nucleotide Roche Light Cycler 480 - Template: Mono-color Hydrolysis Probe 95° C. 5 min, (95° C. 10 s 65° C. 10 s, 72° C. 15 s) × 40 cycles Component [Stock] [Final] uL/rxn DNA Template HBV Copy/ul LC480 Probe Master 2x 1x 5 PSP65 HBV + HepG2 1 ng/ul 1.0E7 Mix PSP65 HBV + HepG2 1 ng/ul 1.0E6 HBV240F3/C240R1 10 uM    1 uM 1 PSP65 HBV + HepG2 1 ng/ul 1.0E5 Probe (HBV240  2 uM 0.15 uM .75 PSP65 HBV + HepG2 1 ng/ul 1.0E4 TaqMan) PSP65 HBV + HepG2 1 ng/ul 1.0E3 H.sub.2O — — 2.25 PSP65 HBV + HepG2 1 ng/ul 1.0E2 DNA Template — — 1 PSP65 HBV + HepG2 1 ng/ul 1.0E1 Total: 10 PSP65 HBV + HepG2 1 ng/ul 1.0 HepG2 1 ng/ul H2O

(80) All references cited in this application are incorporated by reference into this application in their entireties.

REFERENCES CITED

(81) Chan, K. C. A., Lai, P. B. S., Mok, T. S. K., Chan, H. L. Y., Ding, C., Yeung, S. W., & Lo, Y. M. D. (2008). Quantitative Analysis of Circulating Methylated DNA as a Biomarker for Hepatocellular Carcinoma. Clinical Chemistry, 54(9), 1528-1536. Diehl, F., Schmidt, K., Choti, M. A., Romans, K., Goodman, S., Li, M., . . . Diaz Jr, L. A. (2008). Circulating mutant DNA to assess tumor dynamics. Nat Med, 14(9), 985-990. El-Serag, H. B., & Mason, A. C. (1999). Rising incidence of hepatocellular carcinoma in the United States. New Engl J Med, 340, 745-750. Forshew, T., Murtaza, M., Parkinson, C., Gale, D., Tsui, D. W. Y., Kaper, F., . . . Rosenfeld, N. (2012). Noninvasive Identification and Monitoring of Cancer Mutations by Targeted Deep Sequencing of Plasma DNA. Science Translational Medicine, 4(136), 136ra168. doi: 10.1126/scitranslmed.3003726 Guo, Y., Li, Y., Mu, S., Zhang, J., & Yan, Z. (2009). Evidence that methylation of hepatitis B virus covalently closed circular DNA in liver tissues of patients with chronic hepatitis B modulates HBV replication. Journal of Medical Virology, 81(7), 1177-1183. doi: 10.1002/jmv.21525 Jain S, Chang T. T., Chen S. T., Boldbaatar B, Clemens A., Lin S. Y., Yan R., Hu C. T., Guo H. T., Block T. M., Song W. & Su Y. H. (2015). Comprehensive DNA methylation analysis of hepatitis B virus genome in infected liver tissues. Nature Scientific Reports |5:10478| DOI: 10.1038/srep 10478 Kaur, P., Paliwal, A., Durantel, D., Hainaut, P., Scoazec, J.-Y., Zoulim, F., . . . Herceg, Z. (2010). DNA Methylation of Hepatitis B Virus (HBV) Genome Associated with the Development of Hepatocellular Carcinoma and Occult HBV Infection. Journal of Infectious Diseases, 202(5), 700-704. doi: 10.1086/655398 Kim, J. W., Lee, S. H., Park, Y. S., Hwang, J. H., Jeong, S. H., Kim, N., & Lee, D. H. (2011). Replicative Activity of Hepatitis B Virus Is Negatively Associated with Methylation of Covalently Closed Circular DNA in Advanced Hepatitis B Virus Infection. Intervirology, 54(6), 316-325. Kirk, G. D., Lesi, O. A., Mendy, M., Szymanska, K., Whittle, H., Goedert, J. J., . . . Montesano, R. (2005). 249ser TP53 mutation in plasma DNA, hepatitis B viral infection, and risk of hepatocellular carcinoma. Oncogene, 24(38), 5858-5867. Klintmalm, G. B. (1998). Liver transplantation for hepatocellular carcinoma: a registry report of the impact of tumor characteristics on outcome. Annals of Surgery, 228(4), 479-490. Lleonart, M. E., Kirk, G. D., Villar, S., Lesi, 0. A., Dasgupta, A., Goedert, J. J., . . . Friesen, M. D. (2005). Quantitative analysis of plasma TP53 249Ser-mutated DNA by electrospray ionization mass spectrometry. Cancer Epidemiology, Biomarkers and Prevention, 14(12), 2956-2962. Moolla, N., Kew, M., & Arbuthnot, P. (2002). Regulatory elements of hepatitis B virus transcription. Journal of Viral Hepatitis, 9(5), 323-331. doi: 10.1046/j.1365-2893.2002.00381.x Pathak, A. K., Bhutani, M., Kumar, S., Mohan, A., & Guleria, R. (2006). Circulating cell-free DNA in plasma/serum of lung cancer patients as a potential screening and prognostic tool. Clinical Chemistry, 52(10), 1833-1842. Stroun, M., Anker, P., Lyautey, J., Lederrey, C., & Maurice, P. A. (1987). Isolation and characterization of DNA from the plasma of cancer patients. Eur. J. Cancer & Clin Oncol., 23, 707-712. Stroun, M., Anker, P., Maurice, P., Lyautey, J., Lederrey, C., & Beljanski, M. (1989). Neoplastic characteristics of the DNA found in the plasma of cancer patients. Oncology, 46, 318-322. Su, Y. H., Wang, M., Brenner, D. E., Ng, A., Melkonyan, H., Umansky, S., . . . Block, T. M. (2004). Human urine contains small, 150 to 250 nucleotide-sized, soluble DNA derived from the circulation and may be useful in the detection of colorectal cancer. Journal of Molecular Diagnostics, 6(2), 101-107. Tsutsui, M., Iizuka, N., Moribe, T., Miura, T., Kimura, N., Tamatsukuri, S., . . . Oka, M. (2010). Methylated cyclin D2 gene circulating in the blood as a prognosis predictor of hepatocellular carcinoma. Clinica Chimica Acta, 411(7-8), 516-520. Utting, M., Werner, W., Dahse, R., Schubert, J., & Junker, K. (2002). Microsatellite Analysis of Free Tumor DNA in Urine, Serum, and Plasma of Patients: A Minimally Invasive Method for the Detection of Bladder Cancer. Clinical Cancer Research, 8, 35-40. Vivekanandan, P., Thomas, D., & Torbenson, M. (2008). Hepatitis B viral DNA is methylated in liver tissues. Journal of Viral Hepatitis, 15(2), 103-107. Wong, I. H. N., Zhang, J., Lai, P. B. S., Lau, W. Y., & Lo, Y. M. D. (2003). Quantitative analysis of tumor-derived methylated p16INK4a sequences in plasma, serum, and blood cells of hepatocellular carcinoma patients. Clinical Cancer Research, 9, 1047-1052. Wu, T.-L., Zhang, D., Chia, J.-H., Tsao, K.-C., Sun, C.-F., & Wu, J. T. (2002). Cell-free DNA: measurement in various carcinomas and establishment of normal reference range. Clinica Chimica Acta, 321(1-2), 77-87. Yen, L.-C., Yeh, Y.-S., Chen, C.-W., Wang, H.-M., Tsai, H.-L., Lu, C.-Y., . . . Wang, J.-Y. (2009). Detection of KRAS Oncogene in Peripheral Blood as a Predictor of the Response to Cetuximab Plus Chemotherapy in Patients with Metastatic Colorectal Cancer. Clinical Cancer Research, 15(13), 4508-4513. doi: 10.1158/1078-0432.ccr-08-3179 Zhang, X., Hou, J., & Lu, M. (2013). Regulation of Hepatitis B virus Replication by Epigenetic Mechanisms and MicroRNAs. [Mini Review]. Frontiers in Genetics, 4. doi: 10.3389/fgene.2013.00202 Zhang, Y., Li, C., Zhang, Y., Zhu, H., Kang, Y., Liu, H., . . . Zhang, J. (2013). Comparative Analysis of CpG Islands among HBV Genotypes. PLoS ONE, 8(2), e56711. doi: 10.1371/journal.pone.0056711 Ziegler, A., Zangemeister-Wittke, U., & Stahel, R. A. (2002). Circulating DNA: a new diagnostic gold mine? Cancer Treatment Reviews, 28, 255-271.