Certain aryl pladienolide compounds and methods of use

Abstract

The present disclosure provides pladienolide compounds, pharmaceutical compositions containing such compounds, and pladienolide compounds for use in methods of medical treatment. These compounds may be useful in the treatment of cancer, particularly cancers in which agents that target the spliceosome and mutations therein are known to be useful. Also provided herein are pladienolide compounds for use in methods of treating cancers by administering at least one pladienolide compound disclosed herein and at least one additional therapy

Claims

1. A compound of Formula I: ##STR00403## and/or a pharmaceutically acceptable salt thereof, wherein: R.sup.1 is chosen from: ##STR00404## each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, C.sub.3-C.sub.8 cycloalkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, dimethylamino groups, and methoxy C.sub.1-C.sub.6 alkyl groups; R.sup.2, R.sup.4, and R.sup.6 are each independently chosen from hydrogen, hydroxyl groups, —O—R.sup.16 groups, and C.sub.1-C.sub.6 alkyl groups; R.sup.5 is chosen from hydrogen, hydroxyl groups, and —O—R.sup.16 groups; R.sup.9 and R.sup.13 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; R.sup.3, R.sup.7, and R.sup.8 are each independently chosen from hydrogen and C.sub.1-C.sub.3 alkyl groups; R.sup.10 is chosen from hydrogen, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 aminoalkyl groups, C.sub.1-C.sub.6 alkylamino groups, C.sub.1-C.sub.6 alkylcarboxylic acid groups, C.sub.3-C.sub.8 cycloalkyl groups, benzyl groups, C.sub.3-C.sub.8 heterocyclyl groups, —CH.sub.2—C.sub.3-C.sub.8-heterocyclyl groups, —C(O)—C.sub.3-C.sub.8 heterocyclyl groups, acyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, methoxy C.sub.1-C.sub.6 alkyl groups, —CD.sub.3, and —C(O)—NR.sup.11R.sup.12 groups; R.sup.11 and R.sup.12 are independently chosen from hydrogen, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 aminoalkyl groups, C.sub.1-C.sub.6 alkylamino groups, C.sub.3-C.sub.8 cycloalkyl groups, and C.sub.3-C.sub.8 heterocyclyl groups; V is —CH.sub.2—; W is chosen from 3 to 8 membered carbocycles and 3 to 10 membered heterocycles, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups; X is chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; Y is chosen from hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—; and each n is independently chosen from 0 to 4.

2. The compound of claim 1, wherein R.sup.1 is chosen from ##STR00405## each of which may be substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

3. The compound of claim 1, wherein R.sup.1 is chosen from ##STR00406## which may be substituted with 1 to 3 groups chosen from C.sub.1-C.sub.6 alkyl groups.

4. The compound of claim 1, wherein R.sup.1 is chosen from unsubstituted ##STR00407##

5. The compound of claim 1, wherein R.sup.2 is methyl and R.sup.3 is hydrogen.

6. The compound of claim 1, wherein R.sup.4 is hydrogen.

7. The compound of claim 1, wherein R.sup.6 is hydrogen and and R.sup.7 is methyl.

8. The compound of claim 1, wherein R.sup.8 is methyl.

9. The compound of claim 1, wherein W is chosen from a benzene ring, pyridine ring, benzimidazole ring, benzotriazole ring, indazole ring, 1,2,3,6-tetrahydropyridine ring, and imidazopyridine ring, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6alkyl groups, C.sub.1-C.sub.6alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups.

10. The compound of claim 1, wherein W is a benzene ring, which may be optionally substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

11. The compound of claim 1, wherein X and Y are each independently chosen from, ##STR00408## each each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

12. The compound of claim 1, wherein Y is hydrogen, and X is chosen from: ##STR00409## each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

13. The compound of claim 1, wherein the compound is chosen from: (i) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-piperazin-1-ylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-(4-methylpiperazin-1-yl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (iii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (iv) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-(1H-indazol-6-yl)prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (v) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-(1H-indazol-4-yl)prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (vi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(2-morpholin-4-ylpyridin-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (vii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(2-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (viii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(4-fluoro-3-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ix) [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (x) [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(2-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (xii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (xiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3R)-3-fluoropyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xvi) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-[(2R,6S)-2,6-dimethylmorpholin-4-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (xvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xviii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(3-methyl-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xix) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-morpholin-4-yl-5-(trifluoromethyl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-chloro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(2-hydroxyethyl)piperazine-1-carboxylate; (xxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate; (xxiii) [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3,4-dimethylpiperazine-1-carboxylate; (xxiv) [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-propan-2-ylpiperazine-1-carboxylate; (xxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-tert-butylpiperazine-1-carboxylate; (xxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cyclobutylpiperazine-1-carboxylate; (xxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cyclopentylpiperazine-1-carboxylate; (xxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3,5-difluorophenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(dimethylamino)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(4-hydroxypiperidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-(1-methylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(1R,5S)-8-oxa-3-azabicyclo[3.2.1]octan-3-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxa-7-azaspiro[3.4]octan-7-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3R)-3-hydroxypyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(3-oxopyrrolidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(oxan-4-yl)piperazine-1-carboxylate; (xxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-3-yl)carbamate; (xxxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(3-fluoroazetidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xxxix) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xl) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3-(dimethylamino)piperidine-1-carboxylate; (xli) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2S)-2-methylpyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xlii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxopyrrolidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xliii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2S)-2-methylpyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xliv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xlv) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xlvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(5-chloropyridin-3-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xlvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(pyridin-4-ylmethyl)carbamate; (xlviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3,5-dichlorophenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xlix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxo-1,2-thiazolidin-2-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (l) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(1,3-dimethylindazol-6-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (li) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxo-1,4-thiazinan-4-yl)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N,N-dimethylcarbamate; (lii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxo-1,4-thiazinan-4-yl)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (liii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] morpholine-4-carboxylate; (liv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate; (lv) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(1-methylindazol-6-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(3-oxomorpholin-4-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-(cyclopentylsulfamoyl)-2-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(4-methylsulfonylpiperazin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(4-fluoro-1H-indazol-6-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-imidazol-1-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl]4-methylpiperazine-1-carboxylate; (lxi) [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxii) [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (lxiii) [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (lxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxoimidazolidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[3-(2-hydroxyethyl)-2-oxoimidazolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[3-(2-fluoroethynyl)-2-oxoimidazolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[3-(2-morpholin-4-ylethyl)-2-oxoimidazolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[3-(cyclopropylmethyl)-2-oxoimidazolidin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxix) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2S)-2-methylmorpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxx) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-(2-methylmorpholin-4-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxi) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-[(2S,3R)-3-hydroxy-2-methylpentyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-[(2R,3R)-3-hydroxy-2-methylpentanoyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-morpholin-4-ylethylsulfonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4-ethenylsulfonylpiperazin-1-yl)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxv) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-methylmorpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(hydroxymethyl)morpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(hydroxymethyl)morpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxviii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(R2R)-2-(methylcarbamoyl)morpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxo-1,3-diazinan-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[3-(cyclopropylmethyl)-2-oxo-1,3-diazinan-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxi) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-[(2R)-2-hydroxypropanoyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazine-2-carboxylate; (lxxxiii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-methylmorpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(2-cyclopropyl-2-oxoethyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-oxo-2-pyrazin-2-ylethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxvi) [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyclopropylmethyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxviii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-imidazo[1,2-a]pyridin-6-ylprop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (lxxxix) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(7-methyl-1H-indazol-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xc) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-(cyclopropylsulfamoyl)-3-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xci) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-fluoro-5-(4-hydroxypiperidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xcii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(2,2,2-trifluoroethyl)piperazine-1-carboxylate; (xciii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-piperazin-1-ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xciv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4-formylpiperazin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xcv) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-(4-hydroxypiperidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xcvi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(6-methyl-1H-indazol-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xcvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(1,3-dimethylindazol-4-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (xcviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(1-azabicyclo[2.2.2]octan-3-yl)-N-methylcarbamate; (xcix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-(cyclopropylmethyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (c) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(2-hydroxyethyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ci) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(4-fluoro-1-methylindazol-6-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-[1-(pyridin-4-ylmethyl)pyrazol-4-yl]prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ciii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(1-methylpyrazol-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (civ) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)-3-oxopiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cv) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-methoxyethyl)-3-oxopiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cvi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[1-(1-methylpiperidin-4-yl)pyrazol-4-yl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2,2,2-trifluoroethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cviii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-methoxyacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(cyclopropanecarbonyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cx) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(4-methoxyphenyl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylpyrazol-4-yl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(4-pyridin-3-ylsulfonylpiperazin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6yl] 4-methylpiperazine-1-carboxylate; (cxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylimidazol-4-yl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-4-carboxylate; (cxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(cyclohexanecarbonyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylindol-6-yl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(oxan-4-yl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-2-(oxan-4-yl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxane-4-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-morpholin-4-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylimidazole-4-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(2-cyclopropylacetyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1,3-oxazole-5-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethylsulfonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxetan-3-ylsulfonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(oxetan-3-ylsulfonyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxvii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-(1-hydroxyisoquinolin-7-yl)prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxviii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[4-fluoro-1-[2-(methylamino)-2-oxoethyl]indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(2-oxo-2-pyrrolidin-1-ylethyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(2-morpholin-4-yl-2-oxoethyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyanomethyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-[2-(dimethylamino)-2-oxoethyl]-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyclopropylmethyl)-3-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxiv) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(3-methoxypropanoyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(3-hydroxypropyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(cyclopropylmethyl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-(cyclopropylmethyl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxxxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyclopropylmethyl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxl) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(oxan-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxli) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-2-(oxan-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxlii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-(2-methoxyethyl)benzimidazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxliii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxolane-3-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxliv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[1-[(2-methylpropan-2-yl)oxycarbonyl]piperidin-4-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxlv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(4-chlorophenyl)methyl]-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxlvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1-acetylpiperidin-4-yl)-7-fluorobenzimidazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxlvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(4-hydroxycyclohexyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxlviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(oxan-4-ylmethyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxlix) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-[(2S)-1-hydroxypropan-2-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cl) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-[(2S)-1-hydroxypropan-2-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cli) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-[(3S)-oxolane-3-carbonyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-[(3S)-oxolane-3-carbonyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cliii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxetane-3-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cliv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(3-methyloxetane-3-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(3-hydroxypropanoyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(4-methyloxan-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(1-methylsulfonylpiperidin-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxothian-4-yl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clix) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-(2-methoxyethyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1-acetylpiperidin-4-yl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[(3S)-oxan-3-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[(3S)-oxan-3-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[(3R,4S)-3-hydroxyoxan-4-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-cyclohexyl-7-fluorobenzotriazol-5-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxv) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-(4-methoxyphenyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxvi) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-[(4-methoxyphenyl)methyl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-chloro-5-fluorophenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl(oxan-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl(oxetan-3-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxx) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[methyl(oxan-4-yl)amino]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[methyl(oxetan-3-yl)amino]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1,1-dioxothian-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(1-methylsulfonylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-(1-methylsulfonylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxv) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-[ethyl-(1-methylsulfonylpiperidin-4-yl)amino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxvi) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(1-methylsulfonylpiperidin-4-yl)-propan-2-ylamino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-acetylpiperidin-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxviii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-(1-propanoylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxix) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[[1-(2-methoxyacetyl)piperidin-4-yl]-methylamino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-benzoylpiperidin-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(2,2,2-trifluoroacetyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-(1-propylsulfonylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-cyclopentylsulfonylpiperidin-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(1-methylimidazol-4-yl)sulfonylpiperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[[1-(benzenesulfonyl)piperidin-4-yl]-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-acetylpiperidin-4-yl)methyl-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[(1-methylsulfonylpiperidin-4-yl)methyl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(1,3-oxazole-5-carbonyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (clxxxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(pyrazine-2-carbonyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxc) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(1-methylimidazole-4-carbonyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxci) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(propan-2-ylcarbamoyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxcii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(propylcarbamoyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxciii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(phenylcarbamoyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxciv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(1-methylsulfonylpiperidin-4-yl)oxyphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxcv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(4,4-difluorocyclohexyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxcvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(1-methylsulfonylpiperidin-4-yl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxcvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxcviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(azetidin-1-ylsulfonyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cxcix) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(3R)-3-hydroxypyrrolidin-1-yl]sulfonylphenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cc) [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[(2S)-2-methylpyrrolidin-1-yl]sulfonylphenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cci) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(1-hydroxy-2-methylpropan-2-yl)sulfamoyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4,4-difluoropiperidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cciii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(4-methyl-3-pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cciv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(3,3-difluoropyrrolidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccv) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(5-pyrrolidin-1-ylsulfonylpyridin-3-yl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(3,3-difluoroazetidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccvii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[4-methyl-3-(2-oxopyrrolidin-1-yl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(tert-butylsulfamoyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccix) [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-[3-(propan-2-ylsulfamoyl)phenyl]prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccx) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-(ethylsulfamoyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-(4-methylpiperazin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxii) [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-(methylsulfamoyl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxiii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-piperidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxiv) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-cyclopropylsulfonylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(cyclopropylsulfonylamino)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(methanesulfonamido)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxviii) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-[(2-methoxyacetyl)amino]pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxix) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[1-[(2-methylpropan-2-yl)oxycarbonyl]-3,6-dihydro-2H-pyridin-5-yl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxx) [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(trideuteriomethyl)piperazine-1-carboxylate; (ccxxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(pyridin-4-ylmethyl)carbamate; (ccxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(pyrimidin-4-ylmethyl)carbamate; (ccxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] morpholine-4-carboxylate; (ccxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(dimethylamino)ethyl]carbamate; (ccxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methyl-1,4-diazepane-1-carboxylate; (ccxxvi) [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[(4-methoxyphenyl)methyl]carbamate; (ccxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; (ccxxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; (ccxxix) [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[(2S)-1-hydroxypropan-2-yl]carbamate; (ccxxx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3-oxopiperazine-1-carboxylate; (ccxxxi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3R)-3-fluoropyrrolidine-1-carboxylate; (ccxxxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,3,4-trimethylpiperazine-1-carboxylate; (ccxxxiii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate; (ccxxxiv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(2-hydroxyethyl)piperazine-1-carboxylate; (ccxxxv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] piperazine-1-carboxylate; (ccxxxvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cycloheptylpiperazine-1-carboxylate; (ccxxxvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-pyridin-4-ylpiperazine-1-carboxylate; (ccxxxviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cyclohexylpiperazine-1-carboxylate; (ccxxxix) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(4-hydroxyphenyl)ethyl]-N-methylcarbamate; (ccxl) (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-fluoro -5-morpholinophenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl 7-methyl-1,7-diazaspiro[3.5]nonane-1-carboxylate; (ccxli) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(3-morpholin-4-ylpropyl)carbamate; (ccxlii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(dimethylamino)ethyl]carbamate; (ccxliii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; (ccxliv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; (ccxlv) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(2-cyanoethyl)-N-methylcarbamate; (ccxlvi) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,3,4-trimethylpiperazine-1-carboxylate; (ccxlvii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3R)-3-fluoropyrrolidine-1-carboxylate; (ccxlviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(dimethylsulfamoylamino)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccxlix) [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2-methoxyacetyl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccl) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(2-cyclopropylacetyl)amino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (ccli) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-[(3-hydroxyphenyl)methyl]piperazine-1-carboxylate; (cclii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(pyridin-3-ylmethyl)piperazine-1-carboxylate; (ccliii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1-acetylpiperidin-4-yl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] piperazine-1-carboxylate; (ccliv) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[[(3R)-3-hydroxypyrrolidine-1-carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cclv) [3-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-6-(4-methylpiperazine-1-carbonyl)oxy-12-oxo-1-oxacyclododec-4-en-2-yl]prop-1-enyl]phenyl]methyl 2-oxa-7-azaspiro[3.4]octane-7-carboxylate; (cclvi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[2-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]pyridin-4-yl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cclvii) [3-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-6-(4-methylpiperazine-1-carbonyl)oxy-12-oxo-1-oxacyclododec-4-en-2-yl]prop-1-enyl]phenyl]methyl morpholine-4-carboxylate; (cclviii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(dimethylcarbamoyloxymethyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cclix) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[[(2R)-2-(hydroxymethyl)pyrrolidine-1-carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cclx) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[[(3R)-3-fluoropyrrolidine-1-carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cclxi) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(4-hydroxypiperidine-1-carbonyl)oxymethyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; (cclxii) [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (cclxiii) [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; (cclxiv) 2-[4-[3-fluoro-5-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-6-(piperazine-1-carbonyloxy)-1-oxacyclododec-4-en-2-yl]prop-1-enyl]phenyl]piperazin-1-yl]acetic acid; (cclxv) (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-(dimethylamino)phenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl4-methylpiperazine-1-carboxylate; (cclxvi) (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-(dimethylamino)phenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl piperazine-1-carboxylate; (cclxvii) (2S,3S,6R,7S,10R,E)-2-((E)-1-(5-chloropyridin-3-yl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-ylpiperazine-1-carboxylate; (cclxviii) (2S,3S,6R,7S,10R,E)-10-hydroxy-3,7-dimethyl-12-oxo-2-((E)-1-(3-(pyrrolidin-1-ylsulfonyl)phenyl)prop-1-en-2-yl)oxacyclododec-4-en-6-yl piperazine-1-carboxylate; and pharmaceutically acceptable salts thereof.

14. A pharmaceutical composition comprising at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of claim 1.

15. The pharmaceutical composition of claim 14, wherein said composition is formulated for intravenous, oral, subcutaneous, or intramuscular administration.

16. A method of treating cancer in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of claim 1, wherein the cancer is chosen from myelodysplastic syndrome, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer, ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma, and lung cancer.

17. The method of claim 16, wherein said cancer is positive for one or more mutations in a spliceosome gene or protein.

18. The method of claim 17, wherein said spliceosome gene or protein is chosen from splicing factor 3B subunit 1 (SF3B1), U2 small nuclear RNA auxiliary factor 1 (U2AF1), serine/arginine-rich splicing factor 2 (SRSF2), zinc finger (CCCH type) RNA-binding motif and serine/arginine rich 2 (ZRSR2), pre-mRNA-processing-splicing factor 8 (PRPF8), U2 small nuclear RNA auxiliary factor 2 (U2AF2), splicing factor 1 (SF1), splicing factor 3a subunit 1 (SF3A1), PRP40 pre-mRNA processing factor 40 homolog B (PRPF40B), RNA binding motif protein 10 (RBM10), poly(rC) binding protein 1 (PCBP1), crooked neck pre-mRNA splicing factor 1 (CRNKL1), DEAH (Asp-Glu-Ala-His) box helicase 9 (DHX9), peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2), RNA binding motif protein 22 (RBM22), small nuclear ribonucleoprotein Sm D3 (SNRPD3), probable ATP-dependent RNA helicase DDX5 (DDX5), pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 (DHX15), and polyadenylate-binding protein 1 (PABPC1).

19. The method of claim 18, wherein the spliceosome gene or protein is splicing factor 3B subunit 1.

Description

EXAMPLES 1-268

(1) General:

(2) Microwave heating was done using a Biotage Emrys Liberator or Initiator microwave. Column chromatography was carried out using a Combiflash Rf200d (Teledyne ISCO). Solvent removal was carried out using either a Biichi rotary evaporator or a Genevac centrifugal evaporator. Preparative LC/MS was conducted using a Waters autopurifier and 19×100 mm XTerra 5-micron MS C18 column under acidic mobile phase condition. NMR spectra were recorded using a Varian 400 MHz spectrometer.

(3) When the term “inerted” is used to describe a reactor (e.g., a reaction vessel, flask, glass reactor, and the like) it is meant that the air in the reactor has been replaced with an essentially moisture-free or dry, inert gas (such as nitrogen, argon, and the like).

(4) General methods and experimentals for preparing compounds of the present disclosure are set forth below. The following abbreviations are used herein: MeOH: Methanol DMF: Dimethylformamide LHMDS: Lithium hexamethyldisilazide KHMDS: Potassium bis(trimethylsilyl)amide LCMS: Liquid chromatograph-mass spectrometry MS: Mass spectrometry HPLC: High pressure liquid chromatography UPLC: Ultra performance liquid chromatography LC: Liquid chromatography .sup.1H NMR: Proton nuclear magnetic resonance TBSCl: tert-Butyldimethylsilyl chloride THF: Tetrahydrofuran TLC: Thin-layer chromatography HBTU: Hexafluorophosphate benzotriazole tetramethyl uronium TEA: Triethylamine DCM: Dichloromethane DMSO: Dimethylsulfoxide ISCO: Automated chromatography (Combiflash RF200d) Hex: Hexanes EtOAc: Ethyl acetate DMAP: Dimethylaminopyridine NaOH: Sodium hydroxide MgSO.sub.4: Magnesium Sulfate HCl: Hydrochloric acid AcOH: Acetic acid AIBN: 2,2′-azobisisobutyronitrile NBS: N-bromosuccinimide Boc: N-tert-butoxycarbonyl TBDMS: t-butyldimethylsilyl TBAF: Tetrabutylammonium fluoride mCPBA: m-chloroperoxybenzoic acid

(5) Materials: The following compounds are commercially available and/or can be prepared in a number of ways well known to one skilled in the art of organic synthesis. More specifically, disclosed compounds can be prepared using the reactions and techniques described herein. In the description of the synthetic methods described below, it is to be understood that all proposed reaction conditions, including choice of solvent, reaction atmosphere, reaction temperature, duration of the experiment, and workup procedures, can be chosen to be the conditions standard for that reaction, unless otherwise indicated. It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule should be compatible with the reagents and reactions proposed. Substituents not compatible with the reaction conditions are apparent to one skilled in the art, and alternate methods are therefore indicated. The starting materials for the examples are either commercially available or are readily prepared by standard methods from known materials.

(6) LCMS Information

(7) Mobile phases: A (0.1% formic acid in H.sub.2O) and B (0.1% formic acid in acetonitrile).

(8) Gradient: B 5%.fwdarw.95% in 1.8 minutes.

(9) Column: Acquity BEH C18 column (1.7 um, 2.1×50 mm).

(10) U.S. Pat. Nos. 7,884,128 and 7,816,401, both entitled: Process for Total Synthesis of Pladienolide B and Pladienolide D, describe methods for synthesis of Pladienolide B and D. Synthesis of Pladienolide B and D may also be performed using methods known in the art and described in Kanada et al., “Total Synthesis of the Potent Antitumor Macrolides Pladienolide B and D,” Angew. Chem. Int. Ed. 46:4350-4355 (2007). Kanada et al. and PCT application publication WO 2003/099813, entitled: Novel Physiologically Active Substances, describe methods for the synthesis of E7107 (Compound 45 of WO '813) from Pladienolide D (11107D of WO '813). A corresponding U.S. Pat. No. is 7,550,503 to Kotake et al.

EXEMPLIFIED SYNTHESIS OF COMPOUNDS

(11) The exemplified compounds were prepared according to either General Scheme A, involving intermediates without a hydroxyl group at the C6 position, or General Scheme B, involving intermediates with a hydroxyl group at the C6 position.

(12) ##STR00030##

(13) Step-1: To a solution of (3S,4S,E)-1-iodo-2,4-dimethylhexa-1,5-dien-3-ol (001, 5.03 g, 19.966 mmol) and (3R,6S)-3-((tert-butyldimethylsilyl)oxy)-6-methylnon-8-enoic acid (002, 5.0 g, 16.638 mmol) in dry DCM (84 ml, 1297.798 mmol), was added EDC (8.29 g, 43.26 mmol), DMAP (0.407 g, 3.328 mmol), and followed by TEA (6.96 ml, 49.915 mmol). The reaction solution was stirred at room temperature overnight. LCMS suggested full conversion of acid. The reaction was quenched with water and then extracted by DCM (3×100 ml). Combined organic layer was dried over sodium sulfate, filtered, and concentrated in vacuum. Purified crude product via ISCO on a 0-20% gradient to give product (3R,6S)-(3S,4S,E)-1-iodo-2,4-dimethylhexa-1,5-dien-3-yl 3-((tert-butyldimethylsilyl)oxy)-6-methylnon-8-enoate (003, 7.5 g, 14.03 mmol, 84% yield) as colorless oil.

(14) Step-2: A solution of (3R,6S)-(3S,4S,E)-1-iodo-2,4-dimethylhexa-1,5-dien-3-yl 3-((tert-butyldimethylsilyl)oxy)-6-methylnon-8-enoate (002, 6.5 g, 12.159 mmol) and benzoquinone (0.066 g, 0.608 mmol) in TOLUENE (1296 ml, 9.38 mM) was degassed for 15 minutes. Then added Hoveyda-Grubbs II catalyst (0.762 g, 1.216 mmol)) and stirred at 50° C. under nitrogen for 6 hours. Reaction mixture was filtered through a celite pad, washed with excess toluene, and then concentrated. The crude reaction mixture was purified via ISCO on a 0-20% Hex:EtOAc to give product (4R,7S,11S,12S,E)-4-((tert-butyldimethylsilyl)oxy)-12-((E)-1-iodoprop-1-en-2-yl)-7,11-dimethyloxacyclododec-9-en-2-one (004, 5.71 g, 11.27 mmol, 93% yield) as off-white oil.

(15) Step-3: (4R,7S,11S,12S,E)-4-((tert-butyldimethylsilyl)oxy)-12-((E)-1-iodoprop-1-en-2-yl)-7,11-dimethyloxacyclododec-9-en-2-one (004, 6.15 g, 11.27 mmol) was dissolved in Dioxane (520 mL) and degassed, selenium dioxide (4.05 g, 36.477 mmol) was added. The mixture was warmed to 80° C. and stirred for 5 hrs. LCMS suggested completion of reaction. The reaction mixture was diluted with ethyl acetate and washed by saturated NaHCO3. Dried with Na2SO4, filtered, and concentrated in vacuo. The reaction mixtur ewas purified via ISCO on a 0-30% Hex:EtOAc gradient to give (4R,7S,8R,11S,12S,E)-4-((tert-butyldimethylsilyl)oxy)-8-hydroxy-12-((E)-1-iodoprop-1-en-2-yl)-7,11 -dimethyloxacyclododec-9-en-2-one (005, 5.5 g, 10.53 mmol).

(16) Step-4: To a solution of (4R,7S,8R,11S,12S,E)-4-((tert-butyldimethylsilyl)oxy)-8-hydroxy-12-((E)-1-iodoprop-1-en-2-yl)-7,11-dimethyloxacyclododec-9-en-2-one (005, 2.5 g, 4.784 mmol) in DCM (0.406 g, 4.784 mmol) was added DMAP (0.117 g, 0.957 mmol), triethylamine (2.046 ml, 14.353 mmol) and 4-Nitrophenyl chloroformate (1.447 g, 7.177 mmol). The resulting yellowish suspension was stirred for 5 h. Reaction mixture was concentrated and purified via ISCO on a 0-15% Hex:EtOAc gradient to give the product (2S,3S,6R,7S,10R,E)-10-((tert-butyldimethylsilyl)oxy)-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl (4-nitrophenyl) carbonate (006, 3.15 g, 4.58 mmol, 96% yield).

(17) Step-5: To a solution of (2S,3S,6R,7S,10R,E)-10-((tert-butyldimethylsilyl)oxy)-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl (4-nitrophenyl) carbonate (006, 2.1 g, 3.054 mmol) in DCM (0.259 g, 3.054 mmol) was added DMAP (0.373 g, 3.054 mmol) and 1-methylpiperazine (0.459 g, 4.581 mmol). The resulting yellowish suspension was stirred for 3 hrs. Reaction mixture was concentrated and applied to ISCO on a 0-15% DCM:MeOH to give the product (2S,3S,6R,7S,10R,E)-10-((tert-butyldimethylsilyl)oxy)-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (007, 1.89 g, 2.91 mmol, 95% yield).

(18) Step-6: To a solution of (2S,3S,6R,7S,10R,E)-10-((tert-butyldimethylsilyl)oxy)-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (007, 1.8 g, 2.775 mmol) in methanol (0.089 g, 2.775 mmol), was added 4-methylbenzenesulfonic acid hydrate (0.528 g, 2.775 mmol) at room temperature After 2 h, the reaction was quenched with TEA (0.560 g, 5.55 mmol). Concentrate the reaction mixture and diluted in DCM 300 mL then wash by brine (3×50 mL). The organic extraction was concentrated and applied to ISCO on a 0-15% DCM:MeOH to give the product (2S,3S,6R,7S,10R,E)-10-hydroxy-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (008, 1.4 g, 2.62 mmol, 94% yield).

(19) Step-7: To a solution of (2S,3S,6R,7S,10R,E)-10-hydroxy-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (009, 15.0 mg, 0.029 mmol) and aryl boronic acid (010, 0.035 mmol) was added silver oxide (19 mg, 0.086 mmol) and Pd(0) (3.3 mg, 0.003 mmol). The mixture was heated to 60° C. for 5 h. LCMS suggested full conversion of 009. The mixture was cooled, filtered through a short plug of celite and concentrated. The crude reaction mixture was applied to ISCO on a 0-10% DCM:MeOH to give products (010, 0.019 mmol, 68.4% yield).

(20) ##STR00031##

(21) Steps 1-3 follow steps 1-3 from Scheme 1, respectively.

(22) Step-4: To a stirred solution of 015 and 016 in 1,4-dioxane/water (3:1) were added 3.0 eq Ag.sub.2O and 0.1 eq tetrakis(triphenylphosphine)palladium(0). The mixture was degassed and heated to 100° C. for 2 hrs. Upon completion by UPLC, the mixture was cooled to room temperature and filtered to afford compound 017 as a mixture of two diastereomers (isomers A and B). Isomers A and B were separately isolated by column chromatography eluting with a 0-100% EtOAc/hexanes gradient then a 0-20% MeOH/DCM gradient.

(23) Steps 5 and 6 follow steps 4 and 5 from Scheme 1, respectively.

(24) Step-7: To a solution of 018 in methanol, p-toluenesulfonic acid monohydrate was added at room temperature. After 2 hours, the reaction was quenched with excess Et.sub.3N and concentrated. The solution was extracted with EtOAc, washed with NaHCO.sub.3 and brine, dried with Na.sub.2SO.sub.4, filtered, and concentrated. The crude product mixture was purified via column chromatography on silica gel to afford compound 019.

(25) Compounds 1-85 (Table 4) were prepared by the general methods of Procedures 1-10.

(26) Synthesis of Brominated Aryl Intermediates:

(27) Procedure 1.

(28) ##STR00032##

(29) To 1-bromo-3,5-difluorobenzene in DMSO was added Cs.sub.2CO.sub.3 or Hunig's base (2.5 eq) and amine (1.5 eq). The mixture was microwave heated in a sealed tube at the desired temperature for 1.5 h. The reaction was diluted with EtOAc, filtered, and concentrated in vacuo to give the crude product. The crude product was purified via column chromatography on silica gel.

(30) Procedure 2.

(31) ##STR00033##

(32) To a solution of amine in DMF at rt was added 2-bromoethylether (1.2 eq.) and Hunig's base (3.0 eq.). The mixture was microwave heated to 140° C. in a sealed tube for 24 h. The reaction was cooled, quenched with aqueous NaHCO.sub.3, extracted with EtOAc, washed with brine, dried with Na2SO4, filtered and concentrated in vacuo to give the crude product. The crude product was purified via column chromatography on silica gel.

(33) Synthesis of Pinacol Boronate Intermediates:

(34) Procedure 3.

(35) ##STR00034##

(36) To a degassed solution of 1-(3-bromo-5-fluorophenyl)pyrrolidine in 1,4-dioxane (0.1 M) was added potassium acetate (2.0 eq), diborolane(1.2 eq) and PdCl.sub.2(dppf).sub.2 (0.05 eq). The mixture was heated to reflux while the reaction was monitered by LC. After 5 h, aqueous workup resulted in the crude product. Column chromatography on silica gel afforded 1-(3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)pyrrolidine.

(37) Synthesis of Suzuki Coupling Intermediates:

(38) Procedure 4.

(39) ##STR00035##

(40) To a stirred solution of Iodide 1 and Pinacol Boronate in p-dioxane were added 3.0 eq silver oxide (or K.sub.2CO.sub.3) and 0.1 eq tetrakis(triphenylphosphine)palladium(0). The mixture was degassed and heated to 80° C. for 90 minutes. Upon completion by UPLC, the reaction mixture was cooled to room temperature, filtered, and concentrated. Purification by column chromatography eluting with a 0-20% MeOH/DCM gradient afforded the Aryl Pladienolide coupling product.

(41) Procedure 5:

(42) ##STR00036##

(43) To a stirred solution of Iodide 1 and Pinacol Boronate in p-dioxane/H.sub.2O (3:1) were added 2.0 eq K.sub.2CO.sub.3 and 0.1 eq Pd(dppf)Cl.sub.2. The mixture was degassed and heated to 80° C. for 1 h. Upon completion by UPLC, the reaction mixture was cooled to room temperature, filtered, and concentrated. Purification by column chromatography eluting with a 0-20% MeOH/DCM gradient afforded the Aryl Pladienolide coupling product.

(44) Procedure 6.

(45) ##STR00037##

(46) To a stirred solution of boronate (e.g., Boronate 1, above) and Bromobenzene 1 in 1,4-dioxane/water (3:1) were added 3.0 eq potassium carbonate (or Ag.sub.2O) and 0.1 eq Pd(PPh.sub.3).sub.4(or PddppfCl.sub.2). The mixture was degassed and heated to 100° C. for 2 hrs. Upon completion by UPLC, the mixture was cooled to room temperature, filtered, and purified by column chromatography eluting with a 0-100% EtOAc/hexanes gradient then a 0-20% MeOH/DCM gradient afforded the Aryl Pladienolide coupling product.

(47) Procedure 7.

(48) ##STR00038##

(49) To a degassed solution of 1.5 eq Bromobenzene 1 in 1,4-dioxane were added 3.0 eq potassium acetate, 2.0 eq diborolane and 0.2 eq Pd(dppf)Cl.sub.2. The mixture was heated to reflux while the reaction was monitered by LC. After 5 h, the reaction was cooled. 3.0 eq Ag.sub.2O, 0.2 eq Pd(PPh.sub.3).sub.4 and a solution of 1.0 eq Iodide 2 were added. The mixture was degassed and heated to 80° C. for 2 h. The mixture was cooled, and direct column chromatography on silica gel afforded the Aryl Pladienolide coupling product.

(50) Synthesis of Amidization Products:

(51) Procedure 8.

(52) ##STR00039##

(53) To a solution of Carbonate 1 in DCM was 3.0 eq triethylamine and 2.0 eq Amine 1. The resulting yellowish suspension was stirred for 12 hours until Carbonate 1 had disappeared. The reaction mixture was concentrated to give the crude product, and the Aryl Pladienolide Carbamate product was isolated via liquid chromatography.

(54) Procedure 9.

(55) ##STR00040##

(56) To a solution of Amine 2 and Carboxylic Acid 1 (1.2 eq) in DMSO at room temperature was added HBTU (1.2 eq) and triethylamine (1.5 eq). The solution was stirred for 5 hours at room temperature. Water was added in to quench the reaction, which was then extracted with EtOAc, washed with brine, and concentrated in vacuo to give the crude product. The resulting Aryl Pladienolide Amide product was purified via column chromatography on silica gel.

(57) Procedure 10.

(58) ##STR00041##

(59) To a solution of the Amine 2 in DCM were added 1.2 eq Sulfonyl Chloride 1, 3.0 eq Hunig's base, and 0.1 eq DMAP. The mixture was stirred at room temperature until Amine 2 was consumed. The reaction was quenched with water, extracted with EtOAc, washed with brine, dried over Na.sub.2SO.sub.4, filtered, and concentrated to give the crude product. The Aryl Pladienolide Sulfonamide product was purified via column chromatography on silica gel.

(60) TABLE-US-00004 TABLE 4 Characterization of Compounds 1-85 and 265-267 Ex. Structure and IUPAC Chemical Name Characterization 1 LCMS (ESI, m/z), 569.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.04 (t, J = 6.53 Hz, 6 H) 1.15-1.29 (m, 2 H) 1.49- 1.58 (m, 1 H) 1.80-1.89 (m, 1 H) 1.92 (d, J = 1.13 Hz, 3 H) 1.94-2.01 (m, 1 H) 2.34 (s, 3 H) 2.40 (br s, 4 H) 2.55- 2.64 (m, 2 H) 2.65-2.73 (m, 1 H) 2.97-3.12 (m, 4 H) 3.14-3.28 (m, 4 H) 3.48-5.28 (m, 5 H) 3.71-3.85 (m, 1 H) 4.90 (t, J = 10.10 Hz, 1 H) 5.29 (d, J = 10.67 Hz, 1 H) 5.40 (dd, J = 15.00, 9.60 Hz, 1 H) 5.61 (dd, J = 14.93, 9.91 Hz, 1 H) 6.57 (s, 1 H) 6.77-6.87 (m, 3 H) 7.24 (t, J = 8.09 Hz, 1 H) 2 LCMS (ESI, m/z), 583.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CD.sub.3OD) δ ppm 0.92 (d, J = 6.78 Hz, 3 H) 0.97 (d, J = 6.78 Hz, 3 H) 1.21-1.39 (m, 2 H) 1.49-1.67 (m, 2 H) 1.81 (d, J = 1.13 Hz, 3 H) 1.89-2.02 (m, 1 H) 2.41 (dd, J = 14.05, 5.40 Hz, 1 H) 2.52-2.65 (m, 2 H) 2.85 (s, 3 H) 2.91 (s, 3 H) 3.10-3.28 (m, 12 H) 3.32-3.50 (m, 4 H) 3.70-3.85 (m, 1 H) 4.78-4.84 (m, 1 H), 5.09 (d, J = 10.54 Hz, 1 H) 5.39-5.62 (m, 2 H) 6.48-6.56 (m, 1 H) 6.80-6.93 (m, 3 H) 7.16-7.26 (m, 1 H) 3 LCMS (ESI, m/z), 588.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (d, J = 6.90 Hz, 3 H) 0.95 (d, J = 6.90 Hz, 3 H) 1.15-1.29 (m, 2 H) 1.43 (ddd, J = 13.52, 9.69, 3.76 Hz, 1 H) 1.74 (br d, J = 3.51 Hz, 2 H) 1.81 (s, 3 H) 1.83-1.92 (m, 1 H) 2.24 (s, 3 H) 2.30 (br s, 4 H) 2.41-2.67 (m, 3 H) 3.00-3.17 (m, 4 H) 3.42 (br s, 4 H) 3.66 (br s, 1 H) 3.77-3.83 (m, 4 H) 4.82 (t, J = 10.04 Hz, 1 H) 5.20 (d, J = 10.54 Hz, 1 H) 5.34 (dd, J = 14.93, 9.66 Hz, 1 H) 5.53 (dd, J = 15.06, 9.91 Hz, 1 H) 6.32-6.60 (m, 4 H) 4 LCMS (ESI, m/z), 525.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.94 (d, J = 2.76 Hz, 3 H) 0.96 (d, J = 2.76 Hz, 3 H) 1.15-1.29 (m, 2 H) 1.40-1.50 (m, 1 H) 1.68-1.80 (m, 1 H) 1.83-1.93 (m, 1 H) 1.86 (d, J = 1.13 Hz, 3 H) 2.24 (s, 3 H) 2.27-2.39 (m, 4 H) 2.46- 2.64 (m, 3 H) 3.43 (br s, 4 H) 3.60- 3.98 (m, 2 H) 4.84 (t, J = 10.04 Hz, 1 H) 5.26 (d, J = 10.67 Hz, 1 H) 5.31- 5.41 (m, 1 H) 5.56 (dd, J = 15.06, 9.91 Hz, 1 H) 6.67 (s, 1 H) 7.04 (d, J = 8.41 Hz, 1 H) 7.33 (s, 1 H) 7.65 (d, J = 8.28 Hz, 1 H) 1.99 (s, 1 H) 9.91-10.32 (m, 1 H) 5 LCMS (ESI, m/z), 525.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.02 (d, J = 6.90 Hz, 3 H) 1.06 (d, J = 6.78 Hz, 3 H) 1.22-1.36 (m, 2 H) 1.47- 1.56 (m, 1 H) 1.77-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.90-2.01 (m, 1 H) 2.30 (s, 3 H) 2.37 (br s, 4 H) 2.53-2.73 (m, 3 H) 3.31-3.61 (m, 4 H) 3.75 (br s, 2 H) 4.91 (t, J = 10.04 Hz, 1 H) 5.38-5.49 (m, 2 H) 5.63 (dd, J = 15.06, 9.91 Hz, 1 H) 6.92 (s, 1 H) 7.06 (d, J = 6.65 Hz, 1 H) 7.34-7.46 (m, 2 H) 8.03 (s, 1 H) 9.95-10.34 (m, 1 H) 6 LCMS (ESI, m/z), 571.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.00 (t, J = 6.84 Hz, 6 H) 1.19-1.31 (m, 2 H) 1.42-1.55 (m, 1 H) 1.74-1.84 (m, 1 H) 1.87 (d, J = 1.00 Hz, 3 H) 1.88- 1.97 (m, 1 H) 2.31 (s, 3 H) 2.38 (br s, 4 H) 2.50-2.70 (m, 3 H) 3.40-3.60 (m, 8 H) 3.69-3.78 (m, 1 H) 3.79-3.88 (m, 4 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.26 (d, J = 10.67 Hz, 1 H) 5.35-5.46 (m, 1 H) 5.59 (dd, J = 15.00, 9.85 Hz, 1 H) 6.46 (s, 2 H) 6.57 (d, J = 5.27 Hz, 1 H) 8.15 (d, J = 5.14 Hz, 1 H) 7 LCMS (ESI, m/z), 588.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.00 (d, J = 1.76 Hz, 3 H) 1.02 (d, J = 1.76 Hz, 3 H) 1.21-1.32 (m, 2 H) 1.43-1.55 (m, 1 H) 1.76 (s, 3 H) 1.78-1.86 (m, 1 H) 1.89-1.98 (m, 1 H) 2.30 (s, 3 H) 2.36 (br s, 4 H) 2.48-2.70 (m, 3 H) 3.02-3.12 (m, 4 H) 3.41-3.56 (m, 5 H) 3.67-3.77 (m, 1 H) 3.84-3.89 (m, 4 H) 4.89 (t, J = 10.04 Hz, 1 H) 5.31 (d, J = 10.92 Hz, 1 H) 5.40 (dd, J = 15.00, 9.72 Hz, 1 H) 5.60 (dd, J = 14.93, 10.04 Hz, 1 H) 6.50 (s, 1 H) 6.73 (dd, J = 6.09, 2.95 Hz, 1 H) 6.76-6.82 (m, 1 H) 6.97 (t, J = 9.10 Hz, 1 H) 8 LCMS (ESI, m/z), 588.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.99 (d, J = 4.02 Hz, 3 H) 1.01 (d, J = 3.89 Hz, 3 H) 1.16-1.35 (m, 2 H) 1.43-1.55 (m, 1 H) 1.75-1.84 (m, 1 H) 1.86 (s, 3 H) 1.90-2.00 (m, 2 H) 2.51 (s, 3 H) 2.50-2.88 (m, 3 H) 2.64-2.76 (m, 4 H) 3.05-3.11 (m, 4 H) 3.58-3.76 (m, 5 H) 3.84-3.91 (m, 4 H) 4.89 (t, J = 10.10 Hz, 1 H) 5.27 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 14.93, 9.54 Hz, 1 H) 5.61 (dd, J = 14.93, 9.91 Hz, 1 H) 6.52 (s, 1 H) 6.78-6.83 (m, 1 H) 6.85- 6.90 (m, 1 H) 6.96-7.04 (m, 1 H) 9 0 LCMS (ESI, m/z), 583.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.00 (t, J = 6.21 Hz, 6 H) 1.20-1.35 (m, 2 H) 1.41-1.57 (m, 1 H) 1.72-1.84 (m, 1 H) 1.88 (d, J = 1.25 Hz, 3 H) 1.90- 1.98 (m, 1 H) 2.23 (td, J = 13.11, 6.15 Hz, 2 H) 2.30 (s, 3 H) 2.37 (br s, 4 H) 2.50 (s, 3 H) 2.52-2.70 (m, 3 H) 3.08- 3.20 (m, 1 H) 3.23-3.34 (m, 1 H) 3.37-3.45 (m, 2 H) 3.45-3.57 (m, 5 H) 3.67-3.75 (m, 1 H) 4.89 (t, J = 10.04 Hz, 1 H) 5.28 (d, J = 10.67 Hz, 1 H) 5.39 (dd, J = 15.00, 9.72 Hz, 1 H) 5.61 (dd, J = 15.00, 9.98 Hz, 1 H) 6.39-6.49 (m, 2 H) 6.56 (s, 1 H) 6.62 (d, J = 7.65 Hz, 1 H) 7.18 (t, J = 7.78 Hz, 1 H) 10 LCMS (ESI, m/z), 583.6 [M + H].sup.+ 11 LCMS (ESI, m/z), 656.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.99 (d, J = 5.02 Hz, 3 H) 1.01 (d, J = 5.02 Hz, 3 H) 1.18-1.36 (m, 2 H) 1.41-1.69 (m, 6 H) 1.76 (s, 3 H) 1.77-1.84 (m, 1 H) 1.85-2.22 (m, 6 H) 2.45-2.60 (m, 2 H) 2.62-2.69 (m, 1 H) 2.72-3.00 (m, 6 H) 3.02-3.12 (m, 4 H) 3.34-3.44 (m, 1 H) 3.69-3.77 (m, 1 H) 3.80-3.89 (m, 4 H) 4.20-4.36 (m, 2 H) 4.86 (t, J = 10.10 Hz, 1 H) 5.31 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.12, 9.72 Hz, 1 H) 5.60 (dd, J = 15.06, 9.91 Hz, 1 H) 6.50 (s, 1 H) 6.73 (dd, J = 6.15, 3.01 Hz, 1 H) 6.76-6.83 (m, 1 H) 6.92- 7.00 (m, 1 H) 12 LCMS (ESI, m/z), 631.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.98 (d, J = 6.65 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.21-1.46 (m, 2 H) 1.54-1.70 (m, 2 H) 1.86 (d, J = 1.13 Hz, 3 H) 1.89-2.02 (m, 1 H) 2.30 (s, 3 H) 2.36- 2.43 (m, 4 H) 2.44-2.51 (m, 1 H) 2.56- 2.68 (m, 4 H) 2.69-2.76 (m, 4 H) 3.20- 3.26 (m, 4 H) 3.44-3.57 (m, 4 H) 3.73 (t, J = 5.90 Hz, 2 H) 3.77-3.84 (m, 1 H) 4.78-4.83 (m, 1 H) 5.13 (d, J = 10.67 Hz, 1 H) 5.43-5.60 (m, 2 H) 6.48 (br d, J = 9.29 Hz, 1 H) 6.52- 6.66 (m, 3 H) 13 LCMS (ESI, m/z), 699.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (br d, J = 6.78 Hz, 3 H) 1.24-1.55 (m, 6 H) 1.56-1.72 (m, 6 H) 1.86 (d, J = 1.13 Hz, 3 H) 1.87-2.01 (m, 3 H) 2.39-2.52 (m, 1 H) 2.54-2.71 (m, 13 H) 2.72- 2.88 (m, 2 H) 3.16-3.27 (m, 4 H) 3.72 (t, J = 6.02 Hz, 2 H) 3.77-3.87 (m, 1 H) 4.07-4.29 (m, 2 H) 4.76-4.83 (m, 1 H) 5.13 (d, J = 10.67 Hz, 1 H) 5.42- 5.64 (m, 2 H) 6.47 (br d, J = 9.03 Hz, 1 H) 6.52-6.68 (m, 3 H) 14 LCMS (ESI, m/z), 590.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.99 (d, J = 3.89 Hz, 3 H) 1.00 (d, J = 3.89 Hz, 3 H) 1.15-1.33 (m, 2 H) 1.45-1.54 (m, 1 H) 1.75-1.84 (m, 1 H) 1.88 (d, J = 1.13 Hz, 3 H) 1.93 1.90-1.99 (m, 1 H) 2.07-2.27 (m, 1 H) 2.32-2.44 (m, 4 H) 2.52 (s, 3 H) 2.54-2.60 (m, 2 H) 2.62-2.68 (m, 1 H) 2.73 (br s, 4 H) 3.36-3.63 (m, 5 H) 3.64-3.76 (m, 5 H) 4.89 (t, J = 10.10 Hz, 1 H) 5.27 (d, J = 10.67 Hz, 1 H) 5.39 (dd, J = 14.93, 9.79 Hz, 1 H) 5.61 (dd, J = 15.00, 9.98 Hz, 1 H) 6.12-6.22 (m, 2 H) 6.31-6.39 (m, 1 H) 6.49-5.54 (m, 1 H) 15 LCMS (ESI, m/z), 602.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.90 (d, J = 6.65 Hz, 3 H) 1.00 (d, J = 6.78 Hz, 3 H) 1.16-1.32 (m, 2 H) 1.45-1.54 (m, 1 H) 1.70-1.84 (m, 1 H) 1.88 (d, J = 1.13 Hz, 3 H) 1.90-1.96 (m, 1 H) 1.98-2.14 (m, 2 H) 2.31 (s, 3 H) 2.39 (br s, 4 H) 2.50-2.61 (m, 2 H) 2.62- 2.71 (m, 1 H) 3.07-3.22 (m, 1 H) 3.34-3.57 (m, 6 H) 3.58-3.69 (m, 3 H) 3.69-3.77 (m, 1 H) 3.79-3.86 (m, 1 H) 4.89 (t, J = 10.10 Hz, 1 H) 5.26 (d, J = 10.67 Hz, 1 H) 5.39 (dd, J = 15.06, 9.66 Hz, 1 H) 5.60 (dd, J = 15.00, 9.98 Hz, 1 H) 6.24-6.42 (m, 3 H) 6.50 (s, 1 H) 16 LCMS (ESI, m/z), 684.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 3.39 Hz, 3 H) 1.00 (d, J = 3.26 Hz, 3 H) 1.07-1.17 (m, 1 H) 1.18-1.33 (m, 10 H) 1.42-1.54 (m, 1 H) 1.54-1.71 (m, 5 H) 1.74-1.83(m, 1 H) 1.87 (s, 3 H) 1.89-1.97 (m, 1 H) 1.98-2.12 (m, 2 H) 2.32-2.46 (m, 2 H) 2.51- 2.69 (m, 3 H) 2.70-2.84 (m, 2 H) 2.85-3.18 (m, 5 H) 3.33-3.44 (m, 2 H) 3.70-3.85 (m, 3 H) 4.22-4.40 (m, 2 H) 4.86 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 15.00, 9.85 Hz, 1 H) 6.41- 6.54 (m, 4 H) 17 LCMS (ESI, m/z), 615.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.95-1.05 (m, 6 H) 1.18-1.31 (m, 2 H) 1.42-1.54 (m, 1 H) 1.70-1.84 (m, 1 H) 1.88 (d, J = 1.13 Hz, 3 H) 1.90-1.96 (m, 1 H) 2.17-2.25 (m, 2 H) 2.30 (s, 3 H) 2.32 (s, 6 H) 2.33-2.43 (m, 5 H) 2.48-2.70 (m, 3 H) 2.80-2.97 (m, 1 H) 3.15 (t, J = 8.53 Hz, 1 H) 3.29 (td, J = 9.44, 6.84 Hz, 1 H) 3.36-3.44 (m, 2 H) 3.45- 3.56 (m, 4 H) 3.67-3.75 (m, 1 H) 4.86 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 15.00, 9.85 Hz, 1 H) 6.08-6.16 (m, 2 H) 6.32 (br d, J = 9.66 Hz, 1 H) 6.47-6.54 (m, 1 H) 18 LCMS (ESI, m/z), 584.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.87- 0.92 (m, 6 H) 1.09-1.34 (m, 3 H) 1.40-1.56 (m, 2 H) 1.80 (s, 3 H) 1.95- 2.05 (m, 2 H) 2.14-2.37 (m, 8 H) 2.50 (s, 3 H) 3.05-3.10 (m, 4 H) 3.30-3.39 (m, 4 H) 3.69-3.75 (m, 5 H) 4.61 (d, J = 5.40 Hz, 1 H) 4.66-4.77 (m, 1 H) 4.99 (d, J = 10.29 Hz, 1 H) 5.37-5.50 (m, 2 H) 6.45 (s, 1 H) 6.51-6.71 (m, 3 H) 19 0 LCMS (ESI, m/z), 584.6 [M + H].sup.+ 20 LCMS (ESI, m/z), 604.5 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.89 (d, J = 6.65 Hz, 6 H) 1.16-1.33 (m, 3 H) 1.38-1.55 (m, 2 H) 1.81 (s, 3 H) 2.16 (s, 3 H) 2.20-2.35 (m, 7 H) 3.07-3.17 (m, 4 H) 3.32-3.53 (m, 4 H) 3.68- 3.78 (m, 5 H) 4.64 (d, J = 5.14 Hz, 1 H) 4.69 (t, J = 9.47 Hz, 1 H) 4.99 (d, J = 10.54 Hz, 1 H) 5.31-5.54 (m, 2 H) 6.46 (s, 1 H) 6.72-6.80 (m, 2 H) 6.86 (s, 1 H) 21 LCMS (ESI, m/z), 618.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.89 (dd, J = 6.59, 2.07 Hz, 6 H) 1.13-1.33 (m, 3 H) 1.40-1.51 (m, 2 H) 1.82 (s, 3 H) 2.23-2.44 (m, 9 H) 3.08-3.18 (m, 4 H) 3.26-3.56 (m, 6 H) 3.66-3.77 (m, 5 H) 4.40-4.49 (m, 1 H) 4.63 (d, J = 5.02 Hz, 1 H) 4.69 (t, J = 9.47 Hz, 1 H) 4.98 (d, J = 10.67 Hz, 1 H) 5.34-5.51 (m, 2 H) 6.43-6.56 (m, 2 H) 6.60- 6.70 (m, 2 H) 22 LCMS (ESI, m/z), 616.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.88 (dd, J = 6.53, 2.89 Hz, 6 H) 1.16-1.30 (m, 4 H) 1.38-1.52 (m, 4 H) 1.63-1.74 (m, 1 H) 1.82 (s, 3 H) 1.90-2.05 (m, 2 H) 2.17 (s, 3 H) 2.25-2.38 (m, 1 H) 2.48- 2.52 (m, 3 H) 2.69 (s, 3 H) 2.79-2.87 (m, 2 H) 3.09-3.17 (m, 4 H) 3.66-3.76 (m, 5 H) 4.64 (br s, 1 H) 4.66-4.73 (m, 1 H) 4.98 (d, J = 10.92 Hz, 1 H) 5.42 (dd, J = 16.12, 8.47 Hz, 2 H) 6.36-6.57 (m, 2 H) 6.59-6.74 (m, 2 H) 23 LCMS (ESI, m/z), 602.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.88 (dd, J = 6.65, 3.89 Hz, 6 H) 0.96 (d, J = 6.40 Hz, 3 H) 1.16-1.30 (m, 3 H) 1.37-1.54 (m, 2 H) 1.81 (s, 3 H) 1.92- 2.04 (m, 1 H) 2.22-2.34 (m, 2 H) 2.35-2.46 (m, 3 H) 2.50 (s, 3 H) 3.06- 3.21 (m, 4 H) 3.29-3.41 (m, 4 H) 3.67-3.80 (m, 5 H) 4.64-4.72 (m, 2 H) 4.97 (d, J = 10.29 Hz, 1 H) 5.32- 5.53 (m, 2 H) 6.39-6.56 (m, 2 H) 6.59-6.74 (m, 2 H) 24 LCMS (ESI, m/z), 616.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.88 (dd, J = 6.40, 3.89 Hz, 6 H) 1.00 (s, 6 H) 1.17-1.32 (m, 3 H) 1.41-1.52 (m, 2 H) 1.81 (s, 3 H) 1.93-2.07 (m, 1 H) 2.20-2.37 (m, 2 H) 2.41-2.47 (m, 5 H) 3.09-3.15 (m, 4 H) 3.27-3.39 (m, 4 H) 3.68-3.77 (m, 5 H) 4.64-4.72 (m, 2 H) 4.97 (d, J = 10.54 Hz, 1 H) 5.35- 5.51 (m, 2 H) 6.40-6.59 (m, 2 H) 6.59-6.72 (m, 2 H) 25 LCMS (ESI, m/z), 630.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.08 (s, 9 H) 0.89 (dd, J = 6.71, 3.70 Hz, 6 H) 1.17-1.32 (m, 2 H) 1.41-1.52 (m, 2 H) 1.55-1.68 (m, 1 H) 1.81 (s, 3 H) 1.95- 2.12 (m, 1 H) 2.24-2.35 (m, 2 H) 2.41- 2.48 (m, 4 H) 3.03-3.17 (m, 4 H) 3.24- 3.35 (m, 4 H) 3.68-3.82 (m, 5 H) 4.58- 4.75 (m, 2 H) 4.98 (d, J = 10.04 Hz, 1 H) 5.35-5.55 (m, 2 H) 6.44-6.55 (s, 2 H) 6.60-6.75 (m, 2 H) 26 LCMS (ESI, m/z), 628.6 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.85- 0.90 (m, 6 H) 1.14-1.35 (m, 5 H) 1.39-1.51 (m, 4 H) 1.52-1.63 (m, 1 H) 1.70-1.76 (m, 1 H) 1.80 (s, 3 H) 1.93- 2.05 (m, 1 H) 2.22-2.47 (m, 7 H) 3.08-3.15 (m, 4 H) 3.23-3.38 (m, 4 H) 3.67-3.80 (m, 5 H) 4.50-4.81 (m, 2 H) 4.97 (d, J = 10.67 Hz, 1 H) 5.34-5.54 (m, 2 H) 6.46 (s, 2 H) 6.62 (s, 2 H) 27 LCMS (ESI, m/z), 642.7 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 0.85- 0.95 (m, 6 H) 1.14-1.33 (m, 4 H) 1.38-1.52 (m, 6 H) 1.53-1.65 (m, 2 H) 1.67-1.76 (m, 1 H) 1.80 (s, 3 H) 1.89-2.08 (m, 1 H) 2.19-2.36 (m, 2 H) 2.39-2.50 (m, 5 H) 3.08-3.15 (m, 4 H) 3.36-3.52 (m, 4 H) 3.68-3.76 (m, 5 H) 4.61-4.77 (m, 2 H) 4.97 (d, J = 10.79 Hz, 1 H) 5.35-5.50 (m, 2 H) 6.42-6.56 (m, 2 H) 6.60-6.70 (m, 2 H) 28 LCMS (ESI, m/z), 521.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.20-1.32 (m, 2 H) 1.42-1.56 (m, 1 H) 1.75-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.89-1.98 (m, 1 H) 2.30 (s, 3 H) 2.36 (br s, 4 H) 2.49-2.70 (m, 3 H) 3.34 (br s, 1 H) 3.49 (br s, 4 H) 3.71 (s, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.53- 5.65 (m, 1 H) 6.49 (s, 1 H) 6.62-6.73 (m, 1 H) 6.74-6.82 (m, 2 H) 29 0 LCMS (ESI, m/z), 546.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (t, J = 6.84 Hz, 6 H) 1.21-1.30 (m, 2 H) 1.43-1.55 (m, 1 H) 1.70-1.82 (m, 1 H) 1.88 (br d, J = 1.25 Hz, 3 H) 1.90-1.97 (m, 1 H) 2.35 (s, 3 H) 2.46 (br s, 4 H) 2.51-2.68 (m, 3 H) 2.94 (s, 6 H) 3.50- 3.61 (m, 4 H) 3.68-3.78 (m, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.26 (m, t, J = 10.67 Hz, 1 H) 5.39 (dd, J = 14.93, 9.66 Hz, 1 H) 5.60 (dd, J = 15.00, 9.85 Hz, 1 H) 6.18-6.43 (m, 3 H) 6.51 (s, 1 H) 30 LCMS (ESI, m/z), 602.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (t, J = 6.71 Hz, 6 H) 1.19-1.31 (m, 2 H) 1.42-1.55 (m, 1 H) 1.59-1.72 (m, 2 H) 1.75-1.84 (m, 1 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.89-2.02 (m, 3 H) 2.44 (s, 3 H) 2.49-2.70 (m, 8 H) 2.92-3.01 (m, 2 H) 3.50-3.67 (m, 6 H) 3.67-3.78 (m, 1 H) 3.88 (tt, J = 8.56, 4.05 Hz, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.00, 9.72 Hz, 1 H) 5.60 (dd, J = 15.06, 9.91 Hz, 1 H) 6.41-6.52 (m, 3 H) 6.54 (s, 1 H) 31 LCMS (ESI, m/z), 629.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.02 (t, J = 6.78 Hz, 6 H) 1.18-1.36 (m, 2 H) 1.46-1.57 (m, 1 H) 1.76-1.92 (m, 6 H) 1.91-2.00 (m, 1 H) 2.22-2.39 (m, 2 H) 2.50 (s, 3 H) 2.54-2.66 (m, 3 H) 2.66-2.77 (m, 8 H) 2.81 (s, 3 H) 3.53-3.89 (m, 9 H) 4.91 (t, J = 10.10 Hz, 1 H) 5.28 (d, J = 10.54 Hz, 1 H) 5.42 (dd, J = 15.00, 9.72 Hz, 1 H) 5.62 (dd, J = 14.81, 9.91 Hz, 1 H) 6.31-6.47 (m, 3 H) 6.52 (s, 1 H) 32 LCMS (ESI, m/z), 614.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (t, J = 6.15 Hz, 6 H) 1.18-1.32 (m, 2 H) 1.46-1.57 (m, 1 H) 1.73-1.84 (m, 1 H) 1.86 (s, 3 H) 1.88-2.04 (m, 5 H) 2.45-2.70 (m, 6 H) 2.76-2.93 (m, 4 H) 2.99-3.10 (m, 2 H) 3.16-3.36 (m, 2 H) 3.55-3.77 (m, 5 H) 4.39-4.55 (m, 2 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.38 (dd, J = 14.87, 9.72 Hz, 1 H) 5.60 (dd, J = 15.00, 9.98 Hz, 1 H) 6.35-6.42 (m, 2 H) 6.45 (br d, J = 9.03 Hz, 1 H) 6.50 (s, 1 H) 33 LCMS (ESI, m/z), 614.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (d, J = 6.78 Hz, 6 H) 1.19-1.34 (m, 2 H) 1.43-1.55 (m, 1 H) 1.70-1.82 (m, 1 H) 1.88 (br d, J = 1.25 Hz, 3 H) 1.91- 1.99 (m, 1 H) 2.31 (t, J = 6.90 Hz, 2 H) 2.49-2.70 (m, 3 H) 2.78 (s, 3 H) 2.89-3.22 (m, 4 H) 3.30 (t, J = 6.90 Hz, 3 H) 3.53 (s, 2 H) 3.68-3.78 (m, 1 H) 3.80-4.10 (m, 4 H) 4.61-4.67 (m, 2 H) 4.67-4.76 (m, 2 H) 4.89 (t, J = 10.16 Hz, 1 H) 5.26 (d, J = 10.67 Hz, 1 H) 5.38 (dd, J = 15.06, 9.79 Hz, 1 H) 5.61 (dd, J = 15.00, 9.98 Hz, 1 H) 6.09-6.18 (m, 2 H) 6.30-6.37 (m, 1 H) 6.50 (s, 1 H) 34 LCMS (ESI, m/z), 588.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 5.52 Hz, 3 H) 1.00 (d, J = 5.52 Hz, 3 H) 1.19-1.34 (m, 2 H) 1.43-1.55 (m, 1 H) 1.73-1.84 (m, 1 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.90-1.97 (m, 1 H) 2.05-2.19 (m, 2 H) 2.46 (s, 3 H) 2.51-2.59 (m, 3 H) 2.60-2.68 (m, 4 H) 3.25 (d, J = 10.54 Hz, 1 H) 3.34 (td, J = 8.91, 3.26 Hz, 1 H) 3.43-3.53 (m, 2 H) 3.62 (br s, 4 H) 3.70-3.79 (m, 1 H) 4.54-4.66 (m, 1 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.26 (d, J = 10.67 Hz, 1 H) 5.39 (dd, J = 14.93, 9.54 Hz, 1 H) 5.60 (dd, J = 14.93, 9.91 Hz, 1 H) 6.10-6.22 (m, 2 H) 6.29-6.37 (m, 1 H) 6.51 (s, 1 H) 35 LCMS (ESI, m/z), 586.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.88-1.06 (m, 6 H) 1.19-1.34 (m, 2 H) 1.41- 1.56 (m, 1 H) 1.73-1.85 (m, 1 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.91-2.01 (m, 1 H) 2.49-2.90 (m, 10 H) 3.35- 3.56 (m, 2 H) 3.59-3.82 (m, 7 H) 4.10-4.35 (m, 2 H) 4.89 (br t, J = 10.10 Hz, 1 H) 5.27 (d, J = 10.79 Hz, 1 H) 5.34-5.43 (m, 1 H) 5.62 (br dd, J = 14.56, 9.79 Hz, 1 H) 6.17-6.32 (m, 1 H) 6.47 (br d, J = 9.41 Hz, 1 H) 6.53 (s, 1 H) 36 LCMS (ESI, m/z), 658.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (d, J = 6.78 Hz, 6 H) 1.17-1.32 (m, 2 H) 1.41-1.58 (m, 1 H) 1.71-1.85 (m, 3 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.89-1.97 (m, 1 H) 1.99-2.14 (m, 2 H) 2.48- 2.60 (m, 3 H) 2.60-2.69 (m, 1 H) 3.02 (br s, 4 H) 3.12-3.24 (m, 5 H) 3.41 (br t, J = 11.42 Hz, 2 H) 3.63-3.78 (m, 1 H) 3.81-3.87 (m, 4 H) 3.92 (br s, 4 H) 4.05-4.16 (m, 2 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.38 (dd, J = 15.00, 9.73 Hz, 1 H) 5.60 (dd, J = 15.00, 9.98 Hz, 1 H) 6.44-6.60 (m, 4 H) 37 LCMS (ESI, m/z), 616.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.89-1.09 (m, 6 H) 1.17-1.35 (m, 2 H) 1.40-1.60 (m, 3 H) 1.71-1.86 (m, 2 H) 1.87 (s, 3 H) 1.88-2.00 (m, 2 H) 2.25-2.45 (m, 2 H) 2.49-2.67 (m, 4 H) 2.71 (s, 3 H) 2.82 (s, 3 H) 2.88-3.03 (m, 2 H) 3.13-3.20 (m, 4 H) 3.67-3.77 (m, 1 H) 3.81-3.91 (m, 4 H) 4.21-4.63 (m, 1 H) 4.80-4.93 (m, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.35-5.45 (m, 1 H) 5.58 (dd, J = 14.93, 10.04 Hz, 1 H) 6.36-6.66 (m, 4 H) 38 LCMS (ESI, m/z), 576.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.65 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.27-1.47 (m, 2 H) 1.56-1.73 (m, 2 H) 1.86 (d, J = 1.00 Hz, 3 H) 1.91- 2.03 (m, 1 H) 2.30 (s, 3 H) 2.36-2.43 (m, 4 H) 2.43-2.53 (m, 1 H) 2.58-2.70 (m, 2 H) 3.38-3.57 (m, 6 H) 3.73-3.98 (m, 3 H) 4.17 (m, 2 H) 4.82 (m, 1 H) 5.13 (d, J = 10.54 Hz, 1 H) 5.43-5.62 (m, 2 H) 6.07-6.19 (m, 2 H) 6.34- 6.42 (m, 1 H) 6.49-6.54 (m, 1 H) 39 0 LCMS (ESI, m/z), 601.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.27-1.47 (m, 2 H) 1.64 (br s, 2 H) 1.87 (d, J = 1.00 Hz, 3 H) 1.90-2.01 (m, 2 H) 2.02-2.16 (m, 1 H) 2.31 (s, 3 H) 2.35-2.52 (m, 6 H) 2.56-2.70 (m, 4 H) 3.33-3.38 (m, 2 H) 3.45-3.59 (m, 6 H) 3.66-3.75 (m, 1 H) 3.76-3.85 (m, 1 H) 479-4.84 (m, 1 H) 5.13 (d, J = 10.67 Hz, 1 H) 5.44-5.62 (m, 2 H) 6.19-6.32 (m, 2 H) 6.33-6.39 (m, 1 H) 6.53 (s, 1 H) 40 LCMS (ESI, m/z), 616.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.91-1.05 (m, 6 H) 1.17-1.35 (m, 3 H) 1.42- 1.61 (m, 3 H) 1.73-1.83 (m, 2 H) 1.87 (s, 3 H) 1.86-2.03 (m, 1 H) 2.29- 2.46 (m, 1 H) 2.50-2.68 (m, 3 H) 2.78 (br s, 6 H) 2.87-2.98 (m, 1 H) 3.01- 3.11 (m, 1 H) 3.12-3.21 (m, 4 H) 3.59-3.78 (m, 1 H) 3.80-3.91 (m, 3 H) 3.99-4.23 (m, 1 H) 4.36-4.66 (m, 1 H) 4.73-5.00 (m, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.33-5.47 (m, 1 H) 5.52-5.73 (m, 1 H) 6.31-6.58 (m, 4 H) 41 LCMS (ESI, m/z), 586.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.95-1.03 (m, 6 H) 1.16 (d, J = 6.27 Hz, 3 H) 1.21-1.33 (m, 2 H) 1.40-1.56 (m, 1 H) 1.67-1.746 (m, 1 H) 1.74-1.84 (m, 1 H) 1.89 (s, 3 H) 1.92-1.99 (m, 1 H) 1.99-2.13 (m, 3 H) 2.48-2.60 (m, 2 H) 2.62-2.70 (m, 1 H) 2.76 (s, 3 H) 2.90- 3.10 (m, 4 H) 3.10-3.24 (m, 1 H) 3.32-3.44 (m, 1 H) 3.67-3.77 (m, 1 H) 3.79-3.86 (m, 1 H) 3.86-4.05 (m, 4 H) 4.89 (br t, J = 10.10 Hz, 1 H) 5.27 (d, J = 10.54 Hz, 1 H) 5.32-5.44 (m, 1 H) 5.55-5.68 (m, 1 H) 6.09-6.22 (m, 2 H) 6.28 (br d, J = 9.54 Hz, 1 H) 6.50 (s, 1 H) 42 LCMS (ESI, m/z), 586.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.00 (d, J = 6.78 Hz, 3 H) 1.16-1.32 (m, 2 H) 1.40-1.54 (m, 1 H) 1.74-1.82 (m, 1 H) 1.89 (d, J = 1.25 Hz, 3 H) 1.90-1.97 (m, 1 H) 2.09-2.22 (m, 2 H) 2.29 (s, 3 H) 2.24- 2.33 (m, 4 H) 2.50-2.70 (m, 5 H) 3.24- 3.35 (m, 1 H) 3.35-3.50 (m, 4 H) 3.60- 3.70 (m, 1 H) 3.84 (t, J = 7.03 Hz, 2 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.26 (d, J = 10.67 Hz, 1 H) 5.36-5.45 (m, 1 H) 5.52 (dd, J = 15.00, 9.98 Hz, 1 H) 6.53 (s, 1 H) 6.72-6.83 (m, 1 H) 7.27-7.30 (m, 1 H) 7.35-7.41 (m, 1 H) 43 LCMS (ESI, m/z), x586.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (br d, J = 5.27 Hz, 6 H) 1.17 (d, J = 6.27 Hz, 3 H) 1.21-1.33 (m, 2 H) 1.40-1.56 (m, 1 H) 1.67-1.746 (m, 1 H) 1.74-1.84 (m, 1 H) 1.89 (s, 3 H) 1.92-1.99 (m, 1 H) 1.99-2.13 (m, 3 H) 2.48-2.60 (m, 2 H) 2.62-2.70 (m, 1 H) 2.76 (s, 3 H) 2.90- 3.10 (m, 4 H) 3.10-3.24 (m, 1 H) 3.32- 3.44 (m, 1 H) 3.67-3.77 (m, 1 H) 3.79- 3.86 (m, 1 H) 3.86-4.05 (m, 4 H) 4.89 (br t, J = 10.10 Hz, 1 H) 5.27 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 14.93, 9.54 Hz, 1 H) 5.60 (dd, J = 14.93, 9.91 Hz, 1 H) 6.10-6.23 (m, 2 H) 6.28 (br d, J = 9.54 Hz, 1 H) 6.50 (s, 1 H) 44 LCMS (ESI, m/z), 602.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (d, J = 6.65 Hz, 5 H) 1.18-1.35 (m, 2 H) 1.42-1.51 (m, 1 H) 1.72-1.84 (m, 1 H) 1.88 (s, 3 H) 1.91-1.97 (m, 1 H) 1.97- 2.19 (m, 4 H) 2.47-2.68 (m, 3 H) 2.71- 2.88 (m, 5 H) 3.12-3.22 (m, 1 H) 3.34- 3.55 (m, 4 H) 3.62-3.79 (m, 5 H) 3.80- 3.90 (m, 1 H) 4.10-4.34 (m, 2 H) 4.89 (br t, J = 10.04 Hz, 1 H) 5.26 (d, J = 10.54 Hz, 1 H) 5.38 (br dd, J = 14.62, 9.60 Hz, 1 H) 5.61 (dd, J = 14.81, 9.91 Hz, 1 H) 6.29-6.44 (m, 3 H) 6.51 (s, 1 H) 45 LCMS (ESI, m/z), 601.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.90 Hz, 3 H) 1.00 (d, J = 7.03 Hz, 3 H) 1.17-1.32 (m, 2 H) 1.43-1.55 (m, 1 H) 1.72-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.88-1.97 (m, 2 H) 2.18- 2.28 (m, 1 H) 2.30 (s, 3 H) 2.38 (br s, 4 H) 2.49 (s, 3 H) 2.51-2.60 (m, 2 H) 2.60-2.69 (m, 1 H) 2.94-3.18 (m, 5 H) 3.24-3.35 (m, 1 H) 3.37-3.59 (m, 5 H) 3.67-3.79 (m, 1 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.39 (dd, J = 15.06, 9.66 Hz, 2 H) 5.59 (dd, J = 15.06, 9.91 Hz, 2 H) 6.06-6.21 (m, 2 H) 6.28-6.37 (m, 1 H) 6.50 (s, 1 H) 46 LCMS (ESI, m/z), 520.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (d, J = 5.40 Hz, 3 H) 1.01 (d, J = 5.27 Hz, 3 H) 1.17-1.33 (m, 2 H) 1.42-1.55 (m, 1 H) 1.74-1.85 (m, 1 H) 1.89 (s, 3 H) 1.90-1.98 (m, 1 H) 2.32 (s, 3 H) 2.39 (br s, 4 H) 2.50-2.78 (m, 3 H) 3.25- 3.37 (m, 1 H) 3.50 (br s, 4 H) 3.73 (br s, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.28 (d, J = 10.67 Hz, 1 H) 5.41 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 15.00, 9.85 Hz, 1 H) 6.35-6.64 (m, 1 H) 7.49-7.68 (m, 1 H) 8.40 (d, J = 1.38 Hz, 1 H) 8.44 (d, J = 2.13 Hz, 1 H) 47 LCMS (ESI, m/z), 610.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.83-1.11 (m, 6 H) 1.14-1.35 (m, 1 H) 1.35-1.60 (m, 1 H) 1.67-1.84 (m, 1 H) 1.87 (s, 3 H) 1.94-2.07 (m, 1 H) 2.49-2.75 (m, 3 H) 2.86-3.05 (m, 3 H) 3.08-3.25 (m, 4 H) 3.63-3.78 (m, 1 H) 3.81-3.94 (m, 4 H) 4.45-4.69 (m, 2 H) 4.92 (t, J = 9.91 Hz, 1 H) 5.19-5.53 (m, 2 H) 5.57-5.70 (m, 1 H) 6.41-6.59 (m, 4 H) 7.28-7.49 (m, 2 H) 8.49-8.78 (m, 2 H) 48 LCMS (ESI, m/z), 553.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.00 (d, J = 6.78 Hz, 3 H) 1.18-1.32 (m, 2 H) 1.40-1.54 (m, 1 H) 1.74-1.83 (m, 1 H) 1.85 (d, J = 1.13 Hz, 3 H) 1.89-1.97 (m, 1 H) 2.29 (s, 3 H) 2.36 (br s, 4 H) 2.47- 2.71 (m, 3 H) 3.26-3.40 (m, 1 H) 3.48 (br s, 4 H) 3.63-3.80 (m, 1 H) 4.87 (t, J = 10.10 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.58 (dd, J = 15.00, 9.85 Hz, 1 H) 6.46 (s, 1 H) 7.13 (d, J = 1.76 Hz, 2 H) 7.24 (t, J = 1.82 Hz, 1 H) 49 0 LCMS (ESI, m/z), 604.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.00 (t, J = 6.71 Hz, 6 H) 1.18-1.32(m, 2 H) 1.44- 1.55 (m, 1 H) 1.73-1.84 (m, 1 H) 1.88 (d, J = 1.25 Hz, 3 H) 1.90-2.00 (m, 1 H) 2.30 (s, 3 H) 2.37 (br s, 4 H) 2.49-2.60 (m, 4 H) 2.61-2.74 (m, 1 H) 3.39 (t, J = 7.53 Hz, 2 H) 3.49 (br s, 4 H) 3.67- 3.75 (m, 1 H) 3.78 (t, J = 6.59 Hz, 2 H) 4.89 (t, J = 10.04 Hz, 1 H) 5.28 (d, J = 10.54 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.60 (dd, J = 15.00, 9.85 Hz, 1 H) 6.56 (s, 1 H) 7.03-7.09 (m, 1 H) 7.12-7.22 (m, 2 H) 7.29-7.37 (m, 1 H) 50 LCMS (ESI, m/z), 553.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.04 (d, J = 7.03 Hz, 3 H) 1.06 (d, J = 6.90 Hz, 3 H) 1.22-1.36 (m, 2 H) 1.47-1.55 (m, 1 H) 1.75-1.89 (m, 1 H) 1.93-2.01 (m, 4 H) 2.33 (s, 3 H) 2.39 (br s, 4 H) 2.54-2.74 (m, 6 H) 3.44 (br d, J = 10.79 Hz, 1 H) 3.52 (br s, 4 H) 3.69- 3.82 (m, 1 H) 4.01 (s, 3 H) 4.92 (t, J = 10.04 Hz, 1 H) 5.35 (d, J = 10.67 Hz, 1 H) 5.44 (dd, J = 14.93, 9.66 Hz, 1 H) 5.65 (dd, J = 15.06, 9.91 Hz, 1 H) 6.77 (s, 1 H) 7.06 (dd, J = 8.41, 1.13 Hz, 1 H) 7.21 (s, 1 H) 7.61 (d, J = 8.28 Hz, 1 H) 51 LCMS (ESI, m/z), 581.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (d, J = 6.90 Hz, 3 H) 1.15-1.33 (m, 2 H) 1.40-1.56 (m, 1 H) 1.72-1.84 (m, 1 H) 1.86 (d, J = 1.13 Hz, 3 H) 1.89-2.06 (m, 1 H) 2.48-2.68 (m, 3 H) 2.90 (s, 6 H) 3.02-3.17 (m, 4 H) 3.69-3.78 (m, 1 H) 3.82-3.95 (m, 4 H) 4.85 (t, J = 10.04 Hz, 1 H) 5.24 (d, J = 10.54 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.58 (dd, J = 15.00, 9.85 Hz, 1 H) 6.43-6.53 (m, 3 H) 6.57 (br d, J = 9.29 Hz, 1 H) 52 LCMS (ESI, m/z), 636.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.00 (t, J = 6.84 Hz, 6 H) 1.21-1.31 (m, 2 H) 1.45-1.55 (m, 1 H) 1.72-1.84 (m, 1 H) 1.87 (s, 3 H) 1.90-1.99 (m, 1 H) 2.40 (s, 3 H) 2.48-2.70 (m, 7 H) 3.04-3.16 (m, 4 H) 3.50-3.66 (m, 5 H) 3.69-3.79 (m, 1 H) 3.81-3.88 (m, 4 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.29 Hz, 1 H)) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 14.87, 10.10 Hz, 1 H) 6.46-6.52 (m, 3 H) 6.54-6.62 (m, 1 H) 53 LCMS (ESI, m/z), 618.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.90 Hz, 3 H) 1.01 (d, J = 6.90 Hz, 3 H) 1.17-1.33 (m, 2 H) 1.41- 1.55 (m, 1 H) 1.74-1.84 (m, 1 H) 1.86 (d, J = 1.00 Hz, 3 H) 1.90-2.03 (m, 1 H) 2.49-2.59 (m, 2 H) 2.60- 2.66 (m, 3 H) 2.66-2.74 (m, 4 H) 3.16-3.28 (m, 4 H) 3.39-3.52 (m, 4 H) 3.60-3.78 (m, 7 H) 4.89 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.60 (dd, J = 15.06, 9.91 Hz, 1 H) 6.40-6.63 (m, 4 H) 54 LCMS (ESI, m/z), 659.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.97 (d, J = 6.78 Hz, 3 H) 1.00 (d, J = 6.78 Hz, 3 H) 1.14-1.31 (m, 2 H) 1.43-1.55 (m, 1 H) 1.56-1.69 (m, 2 H) 1.72-1.84 (m, 3 H) 1.86 (d, J = 1.25 Hz, 3 H) 1.89-1.99 (m, 1 H) 2.02 (s, 3 H) 2.05- 2.17 (m, 2 H) 2.30 (s, 3 H) 2.45-2.58 (m, 2 H) 2.59-2.63 (m, 3 H) 2.64-2.70 (m, 4 H) 2.77 (s, 3 H) 2.92-3.00 (m, 2 H) 3.16-3.26 (m, 4 H) 3.63-3.69 (m, 2 H) 3.70-3.77 (m, 1 H) 4.88 (t, J = 9.98 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.58 (dd, J = 14.93, 9.91 Hz, 1 H) 6.37-6.58 (m, 4 H) 55 LCMS (ESI, m/z), 539.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.01 (d, J = 6.78 Hz, 3 H) 1.03-1.06 (m, 3 H) 1.23- 1.30 (m, 2 H) 1.46-1.57 (m, 1 H) 1.75- 1.86 (m, 2 H) 1.98-1.98 (m, 4 H) 2.36 (s, 3 H) 2.40-2.51 (m, 4 H) 2.53-2.71 (m, 3 H) 3.44-3.61 (m, 4 H) 3.70-3.78 (m, 1 H) 4.06 (s, 3 H) 4.90 (t, J = 10.16 Hz, 1 H) 5.33 (d, J = 10.54 Hz, 1 H) 5.41 (dd, J = 15.00, 9.72 Hz, 1 H) 5.63 (dd, J = 15.06, 9.91 Hz, 1 H) 6.75 (s, 1 H) 7.07 (dd, J = 8.41, 1.13 Hz, 1 H) 7.67 (d, J = 8.91 Hz, 1 H) 7.94 (d, J = 1.00 Hz, 1 H) 56 LCMS (ESI, m/z), 602.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.00 (d, J = 6.90 Hz, 3 H) 1.17-1.32 (m, 2 H) 1.41-1.52 (m, 1 H) 1.75-1.85 (m, H) 1.88 (d, J = 1.38 Hz, 3 H) 1.93 (br s, 1 H) 2.39 (br s, 3 H) 2.43-2.72 (m, 7 H) 3.50-3.62 (m, 4 H) 3.63-3.68 (m, 1 H) 3.70-3.80 (m, 3 H) 4.01-4.06 (m, 2 H) 4.54 (s, 2 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 14.93, 9.91 Hz, 1 H) 6.53 (s, 1 H) 6.87-6.95 (m, 1 H) 6.97-7.02 (m, 1 H) 7.05 (s, 1 H) 57 LCMS (ESI, m/z), 650.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (d, J = 4.64 Hz, 3 H) 1.01 (d, J = 4.64 Hz, 3 H) 1.18-1.31 (m, 3 H) 1.32-1.43 (m, 2 H) 1.44-1.56 (m, 3 H) 1.57-1.70 (m, 2 H) 1.72-1.85 (m, 3 H) 1.90 (d, J = 1.13 Hz, 3 H) 1.92-1.98 (m, 1 H) 2.40 (s, 3 H) 2.44-2.73 (m, 7 H) 3.47-3.69 (m, 5 H) 3.69-3.80 (m, 1 H) 4.71 (d, J = 7.53 Hz, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.26 (d, J = 10.54 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 15.00, 9.85 Hz, 1 H) 6.56 (s, 1 H) 7.00-7.19 (m, 2 H) 7.86 (s, 1 H) 58 LCMS (ESI, m/z), 665.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (t, J = 6.71 Hz, 6 H) 1.26 (br t, J = 7.15 Hz, 6 H) 1.17-1.32 (m, 2 H) 1.44-1.54 (m, 1 H) 1.71-1.84 (m, 1 H) 1.86 (d, J = 1.13 Hz, 3 H) 1.89-1.99 (m, 1 H) 2.43 (br s, 3 H) 2.49-2.68 (m, 7 H) 2.83 (s, 3 H) 3.23-3.32 (m, 4 H) 3.34- 3.45 (m, 4 H) 3.52-3.68 (m, 4 H) 3.68-3.79 (m, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 14.93, 9.66 Hz, 1 H) 5.59 (dd, J = 15.06, 9.91 Hz, 1 H) 6.44-6.65 (m, 4 H) 59 00 LCMS (ESI, m/z), 543.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.00 (d, J = 5.02 Hz, 3 H) 1.02 (br d, J = 4.89 Hz, 3 H) 1.19-1.36 (m, 2 H) 1.41-1.59 (m, 1 H) 1.75-1.86 (m, 1 H) 1.92 (d, J = 1.13 Hz, 3 H) 1.93-1.98 (m, 1 H) 2.47- 2.87 (m, 10 H) 3.30-3.45 (m, 1 H) 3.62-3.98 (m, 5 H) 4.89 (t, J = 10.10 Hz, 1 H) 5.29 (d, J = 10.54 Hz, 1 H) 55.39 (dd, J = 14.93, 9.66 Hz, 1 H) 5.62 (dd, J = 14.93, 9.91 Hz, 1 H) 6.66 (s, 1 H) 6.76 (d, J = 10.67 Hz, 1 H) 7.16 (s, 1 H) 8.11 (s, 1 H) 60 01 LCMS (ESI, m/z), 569.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.01 (dd, J = J = 6.84,1.19 Hz, 6 H) 1.19-1.34 (m, 2 H) 1.44-1.55 (m, 1 H) 1.72-1.85 (m, 1 H) 1.91 (d, J = 1.25 Hz, 3 H) 1.92- 1.98 (m, 1 H) 2.37 (br s, 3 H) 2.47 (br s, 4 H) 2.53-2.71 (m, 3 H) 3.33 (br s, 1 H) 3.45-3.67 (m, 4 H) 3.73 (br s, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.28 (d, J = 10.67 Hz, 1 H) 5.41 (dd, J = 14.93, 9.66 Hz, 1 H) 5.60 (dd, J = 14.93, 9.91 Hz, 1 H) 6.57 (s, 1 H) 6.96-7.04 (m, 2 H) 7.06-7.11 (m, 1 H) 7.19-7.24 (m, 1 H) 7.26 (s, 1 H) 7.81-7.92 (m, 1 H) 61 02 LCMS (ESI, m/z), 604.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (br d, J = 6.78 Hz, 3 H) 1.08-1.18 (m, 2 H) 1.23 (br s, 3 H) 1.41-1.48 (m, 1 H) 1.73-1.79 (m, 1 H) 1.86 (s, 3 H) 2.45-2.69 (m, 7 H) 2.70-2.93 (m, 3 H) 3.11-3.27 (m, 4 H) 3.63-4.02 (m, 8 H) 4.34-4.52 (m, 1 H) 5.00 (br d, J = 9.66 Hz, 1 H) 5.15 (br d, J = 10.16 Hz, 1 H) 5.50-5.65 (m, 1 H) 5.69-5.81 (m, 1 H) 6.39-6.61 (m, 4 H) 62 03 LCMS (ESI, m/z), 672.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.97 (d, J = 6.78 Hz, 3 H) 1.16-1.30 (m, 5 H) 1.32-1.41 (m, 2 H) 1.50-1.61 (m, 1 H) 1.64-1.74 (m, 5 H) 1.81-1.88 (m, 5 H) 2.02-2.08 (m, 2 H) 2.36-2.48 (m, 2 H) 2.52-2.67 (m, 3 H) 2.67-2.92 (m, 2 H) 3.08-3.22 (m, 5 H) 3.36-3.52 (m, 3 H) 3.59-3.68 (m, 1 H) 3.71-3.78 (m, 1 H) 3.80-3.86 (m, 4 H) 4.31 (s, 1 H) 4.99 (d, J = 9.41 Hz, 1 H) 5.25 (d, J = 10.79 Hz, 1 H) 5.56-5.79 (m, 3 H) 6.41-6.57 (m, 4 H) 63 04 LCMS (ESI, m/z), 672.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.95 (d, J = 6.78 Hz, 3 H) 1.11-1.30 (m, 5 H) 1.37- 1.51 (m, 3 H) 1.55-1.75 (s, 5 H) 1.79- 1.82 (m, 1 H) 1.84 (br d, J = 1.00 Hz, 3 H) 1.87-1.92 (m, 1 H) 2.02-2.08 (m, 2 H) 2.46-2.66 (m, 5 H) 2.71-2.91 (m, 3 H) 3.07-3.18 (m, 4 H) 3.34-3.50 (m, 3 H) 3.78-3.89 (m, 4 H) 4.25-4.43 (m, 2 H) 4.95 (d, J = 9.79 Hz, 1 H) 5.12 (d, J = 10.79 Hz, 1 H) 5.55 (dd, J = 15.06, 9.91 Hz, 1 H) 5.74 (dd, J = 15.62, 9.98 Hz, 1 H) 6.35-6.56 (m, 4 H) 64 05 LCMS (ESI, m/z), 587.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.96 (d, J = 5.02 Hz, 3 H) 0.98 (d, J = 5.02 Hz, 4 H) 1.16-1.29 (m, 2 H) 1.41-1.54 (m, 1 H) 1.82-1.85 (m, 1 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.89-1.94 (m, 1 H) 2.52 (br s, 3 H) 2.50-2.68 (m, 7 H) 3.52- 3.78 (m, 7 H) 3.84-4.00 (m, 2 H) 4.72 (s, 1 H) 4.86 (t, J =10.10 Hz, 1 H) 5.24 (d, J = 10.67 Hz, 1 H) 5.37 (dd, J = 15.00, 9.72 Hz, 1 H) 5.57 (dd, J = 15.00, 9.85 Hz, 1 H) 6.51 (s, 1 H) 6.60-6.70 (m, 1 H) 7.15 (s, 1 H) 7.29 7.32 (m, 1 H) 65 06 LCMS (ESI, m/z), 631.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.97 (d, J = 6.65 Hz, 6 H) 1.16-1.29 (m, 2 H) 1.41-1.56 (m, 1 H) 1.81-1.84 (m, 1 H) 1.87 (br d, J = 1.25 Hz, 8 H) 1.89-1.95 (m, 1 H) 2.45-2.70 (m, 3 H) 2.72-2.84 (m, 7 H) 3.38-3.47 (m, 4 H) 3.58-3.65 (m, 2 H) 3.66-3.75 (m, 1 H) 3.77-3.91 (m, 4 H) 4.08-4.30 (m, 2 H) 4.86 (t, J = 9.85 Hz, 1 H) 5.24 (d, J = 10.79 Hz, 1 H) 5.36 (dd, J = 14.68, 9.54 Hz, 1 H) 5.58 (dd, J = 14.93,10.04 Hz, 1 H) 6.50 (s, 1 H) 6.56-6.68 (m, 1 H) 7.14-7.24 (m, 2 H) 66 07 LCMS (ESI, m/z), 629.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.96 (d, J = 2.64 Hz, 3 H) 0.98 (d, J = 2.51 Hz, 3 H) 1.16-1.32 (m, 2 H) 1.44-1.57(m, 1 H) 1.75-1.83 (m, 1 H) 1.87 (br d, J = 1.25 Hz, 3 H) 1.91-1.96 (m, 1 H) 2.48-2.57 (m, 5 H) 2.59-2.69 (m, 2 H) 2.77 (s, 3 H) 3.63-3.79 (m, 2 H) 3.82-3.90 (m, 4 H) 3.91-4.00 (m, 4 H) 4.86 (t, J = 10.04 Hz, 1 H) 5.24 (d, J = 10.54 Hz, 1 H) 5.37 (dd, J = 14.87, 9.72 Hz, 1 H) 5.58 (dd, J = 15.00, 9.98 Hz, 1 H) 6.52 (s, 1 H) 6.71-6.81 (m, 1 H) 7.18 (s, 1 H) 7.27-7.31 (m, 1 H) 67 08 LCMS (ESI, m/z), 700.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.97 (t, J = 7.09 Hz, 6 H) 1.13-1.28 (m, 2 H) 1.40- 1.54 (m, 1 H) 1.81-1.84 (m, 1 H) 1.86 (d, J = 1.13 Hz, 3 H) 1.89-1.93 (m, 1 H) 2.37 (br s, 3 H) 2.44-2.67 (m, 13 H) 3.33-3.48 (m, 3 H) 3.50-3.64 (m, 6 H) 3.66-3.74 (m, 5 H) 3.76-3.82 (m, 2 H) 4.86 (t, J = 10.04 Hz, 1 H) 5.23 (d, J = 10.54 Hz, 1 H) 5.37 (dd, J = 14.87, 9.72 Hz, 1 H) 5.57 (dd, J = 15.06, 9.91 Hz, 1 H) 6.50 (s, 1 H) 6.57-6.67 (m, 1 H) 7.19 (s, 1 H) 7.22- 7.25 (m, 1 H) 68 09 LCMS (ESI, m/z), 641.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.16-0.28 (m, 2 H) 0.48-0.57 (m, 2 H) 0.89-0.94 (m, 1 H) 0.97 (t, J = 7.03 Hz, 6 H) 1.18-1.29 (m, 2 H) 1.42-1.53 (m, 1 H) 1.73-1.83 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.90-1.94 (m, 1 H) 2.37 (s, 3 H) 2.44-2.69 (m, 7 H) 3.15 (d, J = 7.03 Hz, 2 H) 3.49-3.64 (m, 5 H) 3.66-3.74 (m, 1 H) 3.78 (d, J = 8.91 Hz, 2 H) 4.86 (t, J = 10.10 Hz, 1 H) 5.23 (d, J = 10.54 Hz, 1 H) 5.37 (dd, J = 14.87, 9.72 Hz, 1 H) 5.57 (dd, J = 15.06, 9.91 Hz, 1 H) 6.45-6.54 (m, 1 H) 6.57-6.67 (m, 1 H) 7.20- 7.26 (m, 2 H) 69 0 LCMS (ESI, m/z), 602.5 [M + H].sup.+ 70 LCMS (ESI, m/z), 602.5 [M + H].sup.+ 71 LCMS (ESI, m/z), 687.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.83 (d, J = 7.03 Hz, 3 H) 0.91-1.04 (m, 11 H) 1.17-1.28 (m, 2 H) 1.30-1.40 (m, 1 H) 1.42-1.52 (m, 1 H) 1.76-1.80 (m, 1 H) 1.83 (s, 3 H) 1.86-1.91 (m, 1 H) 2.38 (s, 3 H) 2.46-2.72 (m, 7 H) 2.76-2.86 (m, 2 H) 2.89-3.33 (m, 8 H) 3.46-3.64 (m, 5 H) 3.69 (br s, 1 H) 4.85 (t, J = 9.85 Hz, 1 H) 5.22 (d, J = 10.67 Hz, 1 H) 5.37 (dd, J = 14.87, 9.72 Hz, 1 H) 5.57 (dd, J = 15.06, 9.91 Hz, 1 H) 6.36-6.57 (m, 4 H) 72 LCMS (ESI, m/z), 701.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.89-1.03 (m, 9 H) 1.15 (d, J = 7.15 Hz, 3 H) 1.20-1.33 (m, 2 H) 1.36-1.63 (m, 3 H) 1.70-1.81 (m, 1 H) 1.84 (d, J = 1.13 Hz, 3 H) 1.86-1.91 (m, 1 H) 2.30 (s, 3 H) 2.37 (br s, 4 H) 2.48-2.57 (m, 2 H) 2.60-2.71 (m, 2 H) 3.08-3.26 (m, 4 H) 3.48 (br s, 4 H) 3.57-3.66 (m, 2 H) 3.68-3.75 (m, 2 H) 3.75-3.85 (m, 2 H) 4.12-4.29 (m, 1 H) 4.85 (t, J = 10.04 Hz, 1 H) 5.22 (d, J = 10.54 Hz, 1 H) 5.38 (dd, J = 15.06, 9.66 Hz, 1 H) 5.56 (dd, J = 14.93, 9.91 Hz, 1 H) 6.22-6.76 (m, 4 H) 73 LCMS (ESI, m/z), 764.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.97 (t, J = 6.40 Hz, 6 H) 1.15-1.28 (m, 2 H) 1.41- 1.55 (m, 1 H) 1.72-1.81 (m, 1 H) 1.84 (d, J = 1.13 Hz, 3 H) 1.87-1.95 (m, 1 H) 2.44 (s, 3 H) 2.46-2.68 (m, 11 H) 2.80-2.89 (m, 3 H) 3.11-3.18 (m, 2 H) 3.20-3.32 (m, 4 H) 3.39-3.45 (m, 4 H) 3.59 (br s, 4 H) 3.65-3.75 (m, 5 H) 4.85 (t, J = 10.10 Hz, 1 H) 5.22 (d, J = 10.67 Hz, 1 H) 5.37 (dd, J = 15.00, 9.60 Hz, 1 H) 5.57 (dd, J = 15.00, 9.85 Hz, 1 H) 6.45-6.58 (m, 4 H) 74 LCMS (ESI, m/z), 677.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.96 (t, J = 6.65 Hz, 6 H) 1.17-1.31 (m, 2 H) 1.40-1.54 (m, 1 H) 1.70-1.81 (m, 1 H) 1.84 (d, J = 1.13 Hz, 3 H) 1.88-1.95 (m, 1 H) 2.47 (s, 3 H) 2.49-2.64 (m, 3 H) 2.68 (br s, 4 H) 3.32-3.53 (m, 8 H) 3.55-3.67 (m, 4 H) 3.68-3.76 (m, 1 H) 4.76-4.91 (m, 1 H) 4.85 (t, J = 10.10 Hz, 1 H) 5.22 (d, J = 10.67 Hz, 1 H) 5.56 (dd, J = 15.00, 9.85 Hz, 1 H) 6.07 (d, J = 9.91 Hz, 1 H) 6.20- 6.31 (m, 1 H) 6.39-6.58 (m, 5 H) 75 LCMS (ESI, m/z), 602.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.99 (br t, J = 6.71 Hz, 6 H) 1.12 (br d, J = 6.40 Hz, 3 H) 1.17-1.31 (m, 2 H) 1.42-1.56 (m, 1 H) 1.74-1.83 (m, 1 H) 1.87 (s, 3 H) 1.89-1.98 (m, 1 H) 2.46 (br s, 3 H) 2.51-2.79 (m, 7 H) 3.06-3.24 (m, 2 H) 3.50-3.69 (m, 5 H) 3.70-3.78 (m, 3 H) 3.80-3.87 (m, 1 H) 3.95- 4.04 (m, 1 H) 4.88 (br t, J = 10.23 Hz, 1 H) 5.39 (dd, J = 15.00, 9.60 Hz, 1 H) 5.60 (dd, J = 15.00, 9.85 Hz, 1 H) 6.40-6.54 (m, 4 H) 76 LCMS (ESI, m/z), 618.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (d, J = 6.90 Hz, 3 H) 1.19-1.33 (m, 2 H) 1.44-1.55 (m, 1 H) 1.75-1.84 (m, 1 H) 1.86 (d, J = 1.00 Hz, 3 H) 1.88-1.98 (m, 1 H) 2.30 (s, 3 H) 2.36 (br s, 4 H) 2.50-2.59 (m, 2 H) 2.60-2.74 (m, 2 H) 2.86 (td, J = 11.92, 3.51 Hz, 1 H) 3.32-3.58 (m, 6 H) 3.64-3.88 (m, 5 H) 4.05 (br d, J = 2.01 Hz, 1 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.40 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 15.06, 9.91 Hz, 1 H) 6.39-6.57 (m, 4 H) 77 LCMS (ESI, m/z), 618.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 7.03 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.19-1.33 (m, 2 H) .44-1.55 (m, 1 H) 1.75-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.88-1.98 (m, 1 H) 2.19-2.43 (m, 7 H) 2.44-2.71 (m, 3 H) 3.12-3.28 (m, 2 H) 3.31-3.42 (m, 1 H) 3.42-3.57 (m, 2 H) 3.59-3.84 (m, 7 H) 3.90-4.04 (m, 2 H) 4.10-4.17 (m, 1 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.40 (dd, J = 14.93, 9.54 Hz, 1 H) 5.59 (dd, J = 14.93, 9.91 Hz, 1 H) 6.28-6.59 (m, 4 H) 78 LCMS (ESI, m/z), 645.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 1.00 (t, J = 6.84 Hz, 6 H) 1.21-1.27 (m, 2 H) 1.36- 1.54 (m, 1 H) 1.80-1.84 (m, 1 H) 1.86 (br d, J = 1.13 Hz, 3 H) 1.88-1.91 (m, 1 H) 2.37 (s, 3 H) 2.41-2.60 (m, 6 H) 2.62-2.70 (m, 2 H) 2.80-2.91 (m, 4 H) 3.37-3.45 (m, 1 H) 3.51-3.62 (m, 4 H) 3.68-3.76 (m, 1 H) 3.77-3.87 (m, 1 H) 3.92-4.01 (m, 1 H) 4.04-4.12 (m, 1 H) 4.89 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.39 (dd, J = 15.00, 9.47 Hz, 1 H) 5.60 (dd, J = 15.06, 9.79 Hz, 1 H) 6.44-6.64 (m, 5 H) 79 0 LCMS (ESI, m/z), 601.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CD.sub.3OD) 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.23-1.46 (m, 2 H) 1.61-1.69 (m, 2 H) 1.89 (d, J = 1.25 Hz, 3 H) 1.94- 2.00 (m, 1 H) 2.05-2.14 (m, 2 H) 2.36 (s, 3 H) 2.42-2.54 (m, 5 H) 2.55-2.70 (m, 2 H) 3.36-3.41 (m, 2 H) 3.44-3.59 (m, 4 H) 3.71 (t, J = 5.83 Hz, 2 H) 3.79-3.89 (m, 1 H) 4.90-4.96 (m, 1 H) 5.14 (d, J = 10.92 Hz, 2 H) 5.43-5.63 (m, 2 H) 6.56-6.59 (m, 1 H) 6.81-6.92 (m, 1 H) 6.93-7.03 (m, 1 H) 7.04-7.06 (m, 1 H) 80 LCMS (ESI, m/z), 655.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.19-0.30 (m, 2 H) 0.46-0.58 (m, 2 H) 0.91-1.09 (m, 7 H) 1.19-1.33 (m, 2 H) 1.44-1.53 (m, 1 H) 1.74-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.89-1.99 (m, 1 H) 2.08-2.20 (m, 2 H) 2.30 (s, 3 H) 2.36 (br s, 4 H) 2.49-2.58 (m, 2 H) 2.60- 2.70 (m, 1 H) 3.29 (d, J = 6.90 Hz, 2 H) 3.35-3.42 (m, 1 H) 3.43-3.57 (m, 6 H) 3.63-3.78 (m, 3 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.06, 9.66 Hz, 1 H) 5.59 (dd, J = 15.00, 9.85 Hz, 1 H) 6.39-6.57 (m, 1 H) 6.70-6.86 (m, 1 H) 6.92-7.01 (s, 2 H) 81 LCMS (ESI, m/z), 659.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) 0.98 (d, J = 6.78 Hz, 3 H) 1.01 (d, J = 6.78 Hz, 3 H) 1.19-1.31 (m, 2 H) 1.36 (d, J = 6.65 Hz, 3 H) 1.43-1.55 (m, 1 H) 1.73-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.89-1.99 (m, 1 H) 2.32 (s, 3 H) 2.39 (br s, 4 H) 2.48-2.68 (m, 3 H) 3.20 (t, J = 5.14 Hz, 4 H) 3.42- 3.63 (m, 6 H) 3.68-3.95 (m, 3 H) 4.50 (q, J = 6.65 Hz, 1 H) 4.88 (t, J = 10.04 Hz, 1 H) 5.25 (d, J = 10.67 Hz, 1 H) 5.40 (dd, J = 14.93, 9.66 Hz, 1 H) 5.59 (dd, J = 15.06, 9.91 Hz, 1 H) 6.38-6.67 (m, 4 H) 82 LCMS (ESI, m/z), 614.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.99 (br d, J = 4.39 Hz, 3 H) 1.00 (d, J = 4.27 Hz, 3 H) 1.18-1.35 (m, 4 H) 1.42-1.50 (m, 3 H) 1.75-1.84 (m, 1 H) 1.87 (d, J = 1.00 Hz, 3 H) 1.90-1.99 (m, 1 H) 2.48-2.70 (m, 7 H) 2.95-3.08 (m, 1 H) 3.10-3.18 (m, 4 H) 3.38 (br d, J = 10.67 Hz, 2 H) 3.67-3.78 (m, 2 H) 3.80-3.91 (m, 5 H) 4.89 (br t, J = 9.79 Hz, 1 H) 5.26 (d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.06, 9.79 Hz, 1 H) 5.60 (dd, J = 15.06, 9.66 Hz, 1 H) 6.43-6.55 (m, 4 H) 83 LCMS (ESI, m/z), 602.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (br t, J = 5.90 Hz, 6 H) 1.05 (br d, J = 6.53 Hz, 3 H) 1.10-1.28 (m, 2 H) 1.45-1.56 (m, 1 H) 1.75-1.85 (m, 1 H) 1.80 (s, 3 H) 1.83-1.93 (m, 1 H) 2.38 (s, 3 H) 2.42-2.70 (m, 7 H) 2.97-3.18 (m, 2 H) 3.40-3.70 (m, 8 H) 3.71- 3.80 (m, 1 H) 3.84-3.97 (m, 1 H) 4.88 (br t, J = 10.10 Hz, 1 H) 5.26 (br d, J = 10.54 Hz, 1 H) 5.39 (dd, J = 15.00, 9.85 Hz, 1 H) 5.60 (br dd, J = 15.12, 9.85 Hz, 1 H) 6.34-6.56 (m, 4 H) 84 LCMS (ESI, m/z), 669.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.88-0.95 (m, 2 H) 0.98 (d, J = 6.90 Hz, 3 H) 1.00 (d, J = 6.90 Hz, 3 H) 1.04-1.13 (m, 2 H) 1.21-1.31 (m, 2 H) 1.42-1.51 (m, 1 H) 1.73-1.82 (m, 1 H) 1.83-1.87 (m, 3 H) 1.89-1.96 (m, 1 H) 2.10-2.23 (m, 1 H) 2.28- 2.48 (m, 7 H) 2.49-2.63 (m, 3 H) 2.64-2.76 (m, 4 H) 3.15-3.29 (m, 4 H) 3.40 (s, 2 H) 3.63-3.69 (m, 4 H) 3.69-3.81 (m, 1 H) 4.88 (t, J = 10.10 Hz, 1 H) 5.25 (d, J = 10.79 Hz, 1 H) 5.41 (d, J = 9.79 Hz, 1 H) 5.58 (d, J = 9.91 Hz, 1 H) 6.42-6.59 (m, 4 H) 85 LCMS (ESI, m/z), 707.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.96-1.04 (m, 6 H) 1.20-1.32 (m, 2 H) 1.40-1.54 (m, 1 H) 1.75-1.84 (m, 1 H) 1.87 (s, 3 H) 1.90-1.98 (m, 1 H) 2.25- 2.50 (m, 7 H) 2.52-2.70 (m, 3 H) 2.78-2.85 (m, 4 H) 3.26-3.34 (m, 4 H) 3.49-3.75 (m, 5 H) 4.19 (s, 2 H) 4.78- 4.97 (m, 1 H) 5.26 (d, J = 10.54 Hz, 1 H) 5.36-5.45 (m, 1 H) 5.55-5.64 (m, 1 H) 6.45-6.57 (m, 4 H) 8.50-8.66 (m, 1 H) 8.79 (d, J = 2.38 Hz, 1 H) 9.25 (d, J = 1.51 Hz, 1 H) 265 LCMS (ESI, m/z), 528.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.02 (d, J = 6.78 Hz, 6 H) 1.23-1.32 (m, 2 H) 1.45-1.59 (m, 1 H) 1.76-1.86 (m, 1 H) 1.91 (d, J = 1.25 Hz, 4 H) 2.50- 2.73 (m, 9 H) 2.97 (s, 6 H) 3.44-3.50 (m, 1 H) 3.65-3.80 (m, 5 H) 4.86-4.95 (m, 1 H) 5.27-5.33 (m, 1 H) 5.36-5.45 (m, 1 H) 5.58-5.69 (m, 1 H) 6.56-6.71 (m, 4 H) 7.22 (t, J = 7.91 Hz, 1 H). 266 LCMS (ESI, m/z), 514.4 [M + H].sup.+. 267 LCMS (ESI, m/z), 506.3 [M + H].sup.+.

(61) Compounds 86-166 and 264 (Table 5) were prepared by following Procedures 11-19.

(62) Synthesis of Indazole Intermediates:

(63) Procedures 11 and 12 were used to synthesize indazole intermediates of the follwing general formulas:

(64) ##STR00130##

(65) Procedure 11.

(66) ##STR00131##

(67) To a solution of 6-bromo-4-fluoro-1H-indazole (020, 100 mg, 0.465 mmol) in THF (3.0 mL, 0.15 M) were added cesium carbonate (303 mg, 0.93 mmol) and (bromomethyl)cyclopropane (021, 126 mg, 0.93 mmol). At room temperature, the reaction mixture was stirred overnight. Then the reaction mixture was diluted by EtOAc (100 mL) and washed by brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-30% Hex:EtOAc to give both isomers, 6-bromo-1-(cyclopropylmethyl)-4-fluoro-1H-indazole (022, 62 mg, 0.233 mmol, 50% yield) and 6-bromo-2-(cyclopropylmethyl)-4-fluoro-1H-indazole (023, 20 mg, 0.078 mmol, 17% yield) were collected.

(68) (022) LCMS (ESI, m/z), 269.0 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.40-0.50 (m, 2H), 0.57-0.66 (m, 2H), 1.30-1.41 (m, 1H), 1.59 (s, 1H), 4.24 (d, J=6.90 Hz, 2H), 6.96 (dd, J=9.16, 1.25 Hz, 1H), 7.43 (t, J=1.07 Hz, 1H), 8.04 (d, J=0.75 Hz, 1H).

(69) (023) LCMS (ESI, m/z), 269.0 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.45-0.56 (m, 2H), 0.71-0.80 (m, 2H), 1.38-1.60 (m, 1H), 4.29 (d, J=7.15 Hz, 2H), 6.87 (dd, J=9.54, 1.25 Hz, 1H), 7.70 (t, J=1.13 Hz, 1H), 8.12 (s, 1H).

(70) Procedure 12.

(71) ##STR00132##

(72) Step-1: To a solution of 6-bromo-1H-indazole (024, 900 mg, 3.688 mmol) of THF (30 mL, 0.12 M) was added NaH (66%, 221 mg, 5.532 mmol). The solution was stirred for 30 mins and then (bromomethyl)cyclopropane (597 mg, 4.426 mmol) was added. The resulting solution was stirred under N.sub.2 for 12 hours at room temperature. The reaction mixture was diluted by EtOAc (200 mL) and washed with brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-20% Hex:EtOAc to give 1-(cyclopropylmethyl)-6-bromo-1H-indazole (025, 450 mg, 1.509 mmol, 40.9% yield).

(73) Step-2: To a solution of 1-(cyclopropylmethyl)-6-bromo-1H-indazole (025, 350 mg, 1.174 mmol) in ACN (1.5 ml, 0.78 M) at room temperature was added acetic acid (200 μL, 3.5 mmol) and SELECTFLUOR (832 mg, 2.348 mmol). The resulting solution was stirred under N2 for 12 hours at 50° C. Then the reaction mixture was diluted by EtOAc (100 mL) and washed by brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-30% Hex:EtOAc to give 1-(cyclopropylmethyl)-3-fluoro-6-bromo-1H-indazole (026, 41 mg, 0.130 mmol, 11.05% yield). LCMS (ESI, m/z), 269.0 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.33-0.51 (m, 1H), 0.34-0.39 (m, 2H), 0.45-0.51 (m, 1H), 1.14-1.37 (m, 2H), 1.49 (s, 1H), 4.31 (d, J=7.03 Hz, 2H), 7.16-7.17 (m, 1H), 7.16-7.20 (m, 1H), 7.30 (dd, J=8.41, 4.89 Hz, 1H), 7.89 (d, J=2.26 Hz, 1H).

(74) Procedure 13.

(75) ##STR00133##

(76) Step-1: To a solution of 6-bromo-4-fluoro-1H-indazole (020, 100 mg, 0.465 mmol) in THF (3.0 mL, 0.15 M) were added cesium carbonate (303 mg, 0.93 mmol) and methyl 2-bromoacetate (142 mg, 0.93 mmol). At room temperature, the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc (100 mL) and washed with brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-30% Hex:EtOAc to give methyl 2-(6-bromo-4-fluoro-1H-indazol-1-yl)acetate (027, 100 mg, 0.349 mmol, 75% yield).

(77) Step-2: To a solution of methyl 2-(6-bromo-4-fluoro-1H-indazol-1-yl)acetate (027, 13 mg, 0.045 mmol) in dichloromethane (0.3 mL, 0.15 M) at room temperature was added pyrrolidine (32.2 mg, 0.453 mmol). The reaction mixture was stirred at room temperature overnight. LCMS suggested full conversion of reaction. The reaction mixture was diluted with EtOAc (100 mL) and washed with brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-30% Hex:EtOAc to give 2-(6-bromo-4-fluoro-1H-indazol-1-yl)-1-(p yrrolidin-1-yl)ethanone (028, 10 mg, 0.031 mmol, 67.7% yield).

(78) Synthesis of Benzotriazole Intermediates:

(79) Procedures 14 and 15 were used to synthesize benzotriazole intermediates of the following general formulas:

(80) ##STR00134##

(81) Procedure 14.

(82) ##STR00135##

(83) To a solution of 6-bromo-4-fluoro-1H-benzo[d][1,2,3]triazole (029, 100 mg, 0.463 mmol) in THF (3.0 mL, 0.15 M) were added cesium carbonate (303 mg, 0.93 mmol) and (bromomethyl)cyclopropane (021, 187 mg, 0.93 mmol). At room temperature, the reaction mixture was stirred overnight. The reaction mixture was diluted with EtOAc (100 mL) and washed with brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-30% Hex:EtOAc to give 5-bromo-1-(cyclopropylmethyl)-7-fluoro-1H-benzo[d][1,2,3]triazole (030, 40 mg, 0.148 mmol, 32% yield), 6-bromo-2-(cyclopropylmethyl)-4-fluoro-2H-benzo[d][1,2,3]triazole (031, 20 mg, 0.074 mmol, 16% yield) and 6-bromo-1-(cyclopropylmethyl)-4-fluoro-1H-benzo[d][1,2,3]triazole (032, 16 mg, 0.059 mmol, 12% yield). (030) LCMS (ESI, m/z), 270.0 [M+H].sup.30 . .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.38-0.61 (m, 4H), 1.31-1.45 (m, 1H), 4.53 (d, J=7.28 Hz, 2H), 7.18-7.27 (m, 1H), 7.95 (d, J=1.38 Hz, 1H). (031) LCMS (ESI, m/z), 270.0 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.40-0.51 (m, 2H), 0.55-0.67 (m, 2H), 1.48 (quint, J=7.72, 7.72, 7.72, 7.72, 4.77, 4.77 Hz, 1H), 4.49 (d, J=7.40 Hz, 2H), 7.08 (dd, J=9.54, 1.38 Hz, 1H), 7.77 (d, J=1.38 Hz, 1H). (032) LCMS (ESI, m/z), 270.0 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.45-0.57 (m, 2H), 0.64-0.76 (m, 2H), 1.35-1.46 (m, 1H), 4.49 (d, J=7.15 Hz, 2H), 7.19 (dd, J=9.22, 1.32 Hz, 1H), 7.58 (d, J=1.38 Hz, 1H).

(84) Procedure 15.

(85) ##STR00136##

(86) Step-1: To a solution of 5-bromo-1,3-difluoro-2-nitrobenzene (033, 500 mg, 2.101 mmol) in THF (10 mL, 0.2 M) at rt were added tetrahydro-2H-pyran-4-amine (034, 202 mg, 1.996 mmol) and triethylamine (0.359 ml, 2.521 mmol). The reaction mixture was stirred at 80° C. for 4 hrs. The reaction mixture was concentrated and applied to ISCO on a gradient 0-20% Hex:EtOAc to give N-(5-bromo-3-fluoro-2-nitrophenyl)tetrahydro-2H-pyran-4-amine (035, 540 mg, 1.692 mmol, 81% yield).

(87) Step-2: To a solution of N-(5-bromo-3-fluoro-2-nitrophenyl)tetrahydro-2H-pyran-4-amine (035, 80 mg, 0.251 mmol) in HCl (1M) MeOH (2.5 mL) was added iron (280 mg, 5.014 mmol). Under N2, the reaction mixture was stirred at room temperature for 2 hours. LCMS suggested full conversion of the reaction. Filter through a pad of silica gel, then evaporate the solvent. Re-dissolve the reaction mixture in EtOAc (50 mL) and filter again through a pad of silica gel. The crude product 5-bromo-3-fluoro-N1-(tetrahydro-2H-pyran-4-yl)benzene-1,2-diamine (036, 60 mg, 0.208 mmol, 83% yield) was used directly for next step.

(88) Step-3: To a solution of 5-bromo-3-fluoro-N1-(tetrahydro-2H-pyran-4-yl)benzene-1,2-diamine (036, 60 mg, 0.208 mmol) in acetic acid (1 mL, 0.2 M) at room temperature was added sodium nitrite (35.8 mg, 0.519 mmol). The reaction mixture was stirred at 60° C. for 2 hrs. LC/MS suggested the completion of the reaction. The reaction mixture was vacuumed and re-suspended in EtOAc (50 mL) then washed by brine. The reaction mixture was concentrated and applied to ISCO on a gradient 0-40% Hex:EtOAc to give 6-bromo-4-fluoro-1-(tetrahydro-2H-pyran-4-yl)-1H-benzo[d][1,2,3 ]triazole (037, 42 mg, 0.140 mmol, 67.4% yield). LCMS (ESI, m/z), 300.3 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.06-2.13 (m, 2H), 2.42 (qd, J=12.09, 4.39 Hz, 2H), 3.57 (td, J=11.92, 2.01 Hz, 2H), 4.06-4.16 (m, 2H), 4.97 (tt, J=11.50, 4.19 Hz, 1H), 7.19-7.27 (m, 1H), 7.96 (d, J=1.38 Hz, 1H).

(89) Synthesis of Benzimidazole Intermediates:

(90) Procedure 16 was used to synthesize benzotriazole intermediates of the follwing general formula:

(91) ##STR00137##

(92) Procedure 16.

(93) ##STR00138##

(94) To a solution of (1r,4r)-4-((2-amino-5-bromo-3-fluorophenyl)amino)cyclohexanol (038, 100 mg, 0.33 mmol) in formic acid (3 mL, 0.11 M) at room temperature was added a few drops of concentrated HCl. The reaction mixture was stirred at 60° C. for 2 hrs. LC/MS suggested the completion of the reaction. The reaction mixture was vacuumed and re-suspended in EtOAc (50 mL) then washed by brine. The reaction mixture was concentrated and applied to ISCO on a gradient 0-10% DCM:MeOH to give (1r,4r)-4-(6-bromo-4-fluoro-1H-benzo[d]imidazol-1-yl)cyclohexanol (039, 80 mg, 0.256 mmol, 79% yield). LCMS (ESI, m/z), 313.3 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.55-1.67 (m, 2H), 1.84-1.99 (m, 2H), 2.20-2.30 (m, 4H), 3.84 (tt, J=10.89, 4.05 Hz, 1H), 4.10-4.22 (m, 1H), 7.15 (dd, J=9.66, 1.51 Hz, 1H), 7.39 (d, J=1.51 Hz, 1H).

(95) Synthesis of Phenylpiperazine Intermediates:

(96) Procedure 17 was used to synthesize phenylpiperazine intermediates of the follwing general formula:

(97) ##STR00139##

(98) Procedure 17.

(99) ##STR00140##

(100) Step-1: To a solution of 1-bromo-3,5-difluorobenzene (040, 218 mg, 1.13 mmol) in DMSO (5.0 mL, 0.23 M) added K.sub.2CO.sub.3 (187 mg, 1.356 mmol) and piperazine (041, 146 mg, 1.694 mmol). The reaction mixture was heated to 140° C. in sealed tube for 24 h. The reaction mixture was cooled and diluted by EtOAc (200 mL) then washed with brine and dried with Na.sub.2SO.sub.4. The organic layer was concentrated and applied to ISCO on a gradient 0-30% DCM:MeOH to give 1-(3-bromo-5-fluorophenyl)piperazine (042, 234 mg, 0.903 mmol, 80% yield).

(101) Step-2: To a solution of 1-(3-bromo-5-fluorophenyl)piperazine (042, 45 mg, 0.174 mmol) and 2-(1H-pyrazol-1-yl)acetic acid (043, 32.9 mg, 0.26 mmol) in DMSO (1 ml, 0.17 M) at room temperature was added HBTU (231 mg, 0.608 mmol) and TEA (0.087 ml, 0.608 mmol). The reaction was stirred overnight. The reaction mixture was diluted in EtOAc (50 ml) and washed by brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-10% DCM:MeOH to give 1-(4-(3-bromo-5-fluorophenyl)piperazin-1-yl)-2-(1H-pyrazol- 1-yl)ethanone (044, 60 mg, 0.163 mmol, 94% yield). LCMS (ESI, m/z), 367.0 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 2.80 (s, 2H), 3.08-3.21 (m, 4H), 3.64-3.80 (m, 4H), 5.05 (s, 2H), 6.27-6.40 (m, 1H), 6.43-6.540 (m, 1H), 6.69-6.82 (m, 2H), 7.45-7.63 (m, 2H).

(102) Procedure 18.

(103) ##STR00141##

(104) To a solution of 1-(3-bromo-5-fluorophenyl)piperazine (042, 40 mg, 0.154 mmol) in DCM (1.5 mL, 0.1 mmol) at room temperature was added TEA (31.2 mg, 0.309 mmol) and andoxetane-3-sulfonyl chloride (045, 25 mg, 0.15 mmol) and stir for 5 mins. Then add DMAP (0.943 mg, 7.718 μmol). The reaction mixture was stirred for 4 hrs. Dilute the reaction mixture into DCM (50 mL) and washed by brine. The combined organic layer was concentrated and applied to ISCO on a gradient 0-100% Hex:EtOAc to give 1-(3-bromo-5-fluorophenyl)-4-(oxetan-3-ylsulfonyl)piperazine (046, 40 mg, 0.11 mmol, 68.3% yield).

(105) Synthesis of Boronate Coupling Products:

(106) Procedure 19.

(107) ##STR00142##

(108) Step-1: To a solution of (2S,3S,6R,7S,10R,E)-10-hydroxy-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (008, 500 mg, 0.936 mmol) in DMSO (9.0 ml, 0.1 M) were added Pd(0) (108 mg, 0.094 mmol), 4,4,4′,4′,5,5,5′,5′-octamethyl-2,2′-bi(1,3,2-dioxaborolane) (475 mg, 1.871 mmol) and potassium acetate (184 mg, 1.871 mmol). The reaction mixture was flushed by N.sub.2, before heated up to 80° C. and stirred for 30 min. The reaction was cooled down to room temperature and H.sub.2O (50 mL) was added in. The reaction mixture was extracted by EtOAc (4×100 mL). The combined organic extracts were dried over MgSO4, filtered and concentrated under vacumm. The crude reaction mixture was applied to ISCO on a 0-10% DCM:MeOH to give (2S,3S,6R,7S,10R,E)-10-hydroxy-3,7-dimethyl-12-oxo-2-((E)-1-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)prop-1-en-2-yl)oxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (Boronate 1, 360 mg, 0.674 mmol, 72.0% yield) as a yellowish solid. LCMS (ESI, m/z), 536.4 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.87-1.08 (m, 6H), 1.19-1.35 (m, 3H), 1.28 (s, 12H), 1.42-1.55 (m, 1H), 1.73-1.85 (m, 1H), 1.88-1.96 (m, 1H), 1.98 (s, 3H), 2.31 (s, 3H), 2.35-2.49 (m, 5H), 2.50-2.65 (m, 2H), 3.39-3.58 (m, 4H), 3.66-3.77 (m, 1H), 4.87 (t, J =10.10 Hz, 1H), 5.14 (d, J=10.54 Hz, 1H), 5.33-5.47 (m, 2H), 5.56 (dd, J=15.00, 9.98 Hz, 1H).

(109) Step-2: To a solution of (2S,3S ,6R,7S,10R,E)-10-hydroxy-3,7-dimethyl-12-oxo-2-((E)-1-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)prop-1-en-2-yl)oxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate) (Boronate 1, 15 mg, 0.029 mmol) and arylbromide (047, 0.035 mmol) were added silver oxide (19 mg, 0.086 mmol) and Pd(0) (3.3 mg, 0.003 mmol). The reaction mixture was heated to 60° C. for 5 h. LCMS suggested full conversion of boronate. The mixture was cooled, filtered through a short plug of celite and concentrated. The crude reaction mixture was applied to ISCO on a 0-10% DCM:MeOH to give product 010.

(110) TABLE-US-00005 TABLE 5 Characterization of Compounds 86-166 and 264 Ex. Structure and IUPAC Chemical Name Characterization 86   [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10- dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4- en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 604.6 [M + H]. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.00 (br d, J = 6.78 Hz, 3 H) 1.09-1.21 (m, 2 H) 1.26 (hr s, 3H) 1.40-1.48 (m, 1 H) 1.76- 1.80 (m, 1H) 1.87 (s, 3 H) 2.49-2.74 (m, 3H) 2.82 (s, 3H) 2.97-3.08 (m, 4H) 3.12-3.21 (m, 4H) 3.75-3.82 (m, 1H) 3.83-3.91 (m, 8 H) 5.01-5.06 (m, 1H) 5.27-5.31(m, 1H) 5.35 (d, J = 10.29 Hz, 1H) 5.65-5.75 (m, 1H) 6.44-6.62 (m, 3H) 6.66-6.75 (m, 1H) 87   [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1- (cyclopropylmethyl)-4-fluoroindazol-6-yl]prop-1- en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 597.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.41-0.62 (m, 2H), 0.68-0.91 (m, 2H), 1.03 (d, J = 6.78 Hz, 6H), 1.19-1.39 (m, 3H), 1.39- 1.87 (m, 4H), 1.93-2.00 (m, 1H), 1.95 (s, 3H), 2.33-2.42 (m, 3H), 2.42-2.55 (m, 3H), 2.55-2.75 (m, 3H), 3.35-3.50 (m, 1H), 3.50-3.65 (m, 4H), 3.65-3.71 (m, 1H), 3.71-3.82 (m, 1H), 4.23-4.38 (m, 2H), 4.92 (t, J = 10.10 Hz, 1H), 5.30- 5.36 (m, 1H), 5.38-5.48 (m, 1H), 5.64 (dd, J = 15.00, 9.98 Hz, 1H), 6.61-6.68 (m, 2H), 7.41 (s, 1H), 8.10 (s, 1H) 88   [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1- imidazo[1,2-a]pyridin-6-ylprop-1-en-2-yl]-3,7- dimethyl-12-oxo-l-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 525.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.97-1.07 (m, 6H), 1.20-1.35 (m, 3H), 1.45-1.59 (m, 1H), 1.92 (d, J = 1.13 Hz, 5H), 2.29- 2.35 (m, 3H), 2.35-2.48 (m, 4H), 2.52- 2.72 (m, 3H), 3.41-3.61 (m, 4H), 3.69- 3.81 (m, 3H), 4.91 (t, J = 10.10 Hz, 1H), 5.23-5.38 (m, 1H), 5.43 (dd, J = 15.00, 9.73 Hz, 1H), 5.62 (dd, J = 14.93, 9.91 Hz, 1H), 6.52 (s, 1H), 7.14 (dd, J = 9.35, 1.57 Hz, 1H), 7.49-7.73 (m, 1H), 7.63- 7.68 (m, 1H), 7.63-7.67 (m, 1H), 8.07 (s, 1H) 89   [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2- [(E)-1-(7-methyl-1H-indazol-4-yl)prop-1-en-2-yl]- 12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 539.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-1.05 (m, 6H), 1.10-1.29 (m, 5H), 1.34-1.54 (m, 1H), 1.71-1.82 (m, 4H), 1.82-1.91 (m, 1H), 2.25-2.42 (m, 3H), 2.42-2.63 (m, 10H), 3.51 (hr s, 6H), 3.57-3.76 (m, 3H), 4.84 (t, J = 10.10 Hz, 1H), 5.29-5.39 (m, 3H), 5.57 (dd, J = 15.00, 9.98 Hz, 1H), 6.82 (s, 1H), 6.92 (d, J = 7.15 Hz, 1H), 7.07 (d, J = 7.15 Hz, 1H), 7.95 (s, 1H), 8.20 (hr s, 1H) 90   [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4- (cyclopropylsulfamoyl)-3-fluorophenyl]prop-1-en- 2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 622.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.57-0.66 (m, 2H), 0.66-0.73 (m, 2H), 0.97-1.07 (m, 6H), 1.20-1.38 (m, 2H), 1.47-1.58 (m, 1H), 1.76-1.87 (m, 1H), 1.87-2.02 (m, 3H), 2.25-2.32 (m, 1H), 2.39 (s, 3H), 2.42-2.93 (m, 8H), 3.45-3.66 (m, 4H), 3.66-3.79 (m, 1H), 4.90 (t, J = 10.04 Hz, 1H), 5.15 (br s, 1H), 5.29 (d, J = 10.54 Hz, 1H), 5.43 (dd, J = 15.06, 9.66 Hz, 1H), 5.61 (dd, J = 14.93, 9.91 Hz, 1H), 6.59 (s, 1H), 7.12-7.22 (m, 1H), 7.18- 7.23 (m, 1H), 7.92 (t, J = 7.84 Hz, 1H), 8.24-8.30 (m, 1H) 91   [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-fluoro-5-(4- hydroxypiperidin-l-yl)sulfonylphenyl]prop-1-en-2-yl]- 10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 666.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.87-1.00 (m, 6H), 1.13-1.27 (m, 4H), 1.31-1.49 (m, 2H), 1.54-1.66 (m, 2H), 1.66-1.80 (m, 3H), 1.81-1.93 (m, 3H), 2.23-2.32 (s, 3H), 2.32-2.44 (m, 3H), 2.44-2.55 (m, 2H), 2.55-2.65 (m, 1H), 2.81-2.92 (m, 2H), 3.16-3.28 (m, 2H), 3.46 (br s, 4H), 3.56-3.70 (m, 2H), 3.71-3.81 (m, 1H), 4.77-4.86 (m, 1H), 5.22-5.28 (m, 1H), 5.29-5.41 (m, 1H), 5.48-5.57 (m, 1H), 6.47 (s, 1H), 7.10-7.17 (m, 1H), 7.60 (m, 2H) 92   [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy- 3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- (2,2,2-trifluoroethyl)piperazine-1-carboxylate LCMS (ESI, m/z), 656.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.96-1.06 (m, 6H), 1.18-1.36 (m, 2H), 1.45-1.71 (m, 1H), 1.76-1.86 (m, 1H), 1.90 (s, 3H), 1.91-2.00 (m, 1H), 2.50-2.72 (m, 6H), 2.95-3.07 (m, 2H), 3.13-3.24 (m, 4H), 3.36-3.45 (m, 1H), 3.45-3.61 (m, 3H), 3.70-3.80 (m, 1H), 3.82-3.91 (m, 4H), 4.86-4.95 (m, 1H), 5.24-5.31 (m, 1H), 5.37-5.47 (m, 1H), 5.56-5.67 (m, 1H), 5.58-5.62 (m, 1H), 5.62-5.62 (m, 1H), 5.62-5.62 (m, 1H), 6.46-6.57 (m, 4H) 93 0 LCMS (ESI, m/z), 633.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.99 (m, 6H), 1.09-1.30 (m, 6H), 1.66-1.93 (m, 4H), 2.31 (s, 3H), 2.35-2.63 (m, 7H), 2.83-3.07 (m, 6H), 3.19-3.29 (m, 1H), 3.37-3.73 (m, 6H), 4.77-4.86 (m, 1H), 5.17-5.25 (m, 1H), 5.29-5.39 (m, 1H), 5.47-5.59 (m, 1H), 6.50-6.58 (m, 1H), 7.38-7.61 (m, 4H) 94 LCMS (ESI, m/z), 661.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.99 (m, 6H), 1.12-1.28 (m, 4H), 1.38-1.48 (m, 1H), 1.66-1.78 (m, 2H), 1.81 (d, J = 1.25 Hz, 3H),1.84-1.93 (m, 1H), 2.24-2.63 (m, 9H), 2.91-3.05 (m, 4H), 3.37-3.62 (m, 7H), 3.63-3.73 (m, 1H), 4.78-4.86 (m, 1H), 5.18-5.25 (m, 1H), 5.29-5.39 (m, 1H), 5.48-5.59 (m, 1H), 6.51-6.56 (m, 1H), 7.42-7.49 (m, 2H), 7.51-7.58 (m, 2H), 7.89-7.94 (m, 1H) 95 LCMS (ESI, m/z), 648.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl3) δ 0.98-1.07 (m, 6H), 1.22-1.35 (m, 2H), 1.46-1.57 (m, 1H), 1.60-1.73 (m, 2H), 1.75-1.86 (m, 1H), 1.86-2.01 (m, 6H), 2.41 (s, 3H), 2.47-2.73 (m, 7H), 2.84-2.99 (m, 2H), 3.27-3.47 (m, 3H), 3.50-3.86 (m, 7H), 4.86-4.95 (m, 1H), 5.27-5.34 (m, 1H), 5.38-5.47 (m, 1H), 5.57-5.67 (m, 1H), 6.61-6.66 (m, 1H), 7.47-7.55 (m, 2H), 7.63-7.69 (m, 2H) 96 LCMS (ESI, m/z), 539.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CD.sub.3OD) δ 0.98-1.08 (m, 7H), 1.30-1.49 (m, 4H), 1.62-1.70 (m, 2H), 1.82-1.89 (m, 3H), 1.91-2.01 (m, 1H), 2.29-2.35 (m, 3H), 2.38-2.53 (m, 6H), 2.53-2.58 (m, 3H), 2.58-2.75 (m, 2H), 3.42-3.57 (m, 5H), 3.76-3.88 (m, 1H), 5.22-5.30 (m, 1H), 5.44-5.66 (m, 2H), 6.91 (s, 1H), 6.94-7.02 (m, 1H), 7.10-7.17 (m, 1H), 7.97 (s, 1H) 97 LCMS (ESI, m/z), 553.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.04 (d, J = 6.78 Hz, 3H),1.06-1.13 (m, 3H), 1.25-1.33 (m, 2H), 1.50-1.61 (m, 1H), 1.73-1.89 (m, 4H), 1.90-2.02 (m, 1H), 2.33-2.38 (m, 3H), 2.38-2.50 (m, 4H), 2.56-2.71 (m, 7H), 3.44-3.65 (m, 4H), 3.73-3.81 (m, 2H), 4.02 (s, 3H), 4.88- 4.96 (m, 1H), 5.37-5.50 (m, 2H), 5.61- 5.70 (m, 1H), 6.87-6.93 (m, 1H), 7.07- 7.11 (m, 1H), 7.21-7.26 (m, 1H), 7.29- 7.36 (m, 1H) 98 LCMS (ESI, m/z), 628.5 [M + H].sup.+. .sup.1H NMR (400 MHz, CD.sub.3OD) δ 0.86-0.96 (m, 1H), 0.96-1.02 (m, 3H), 1.02-1.08 (m, 3H), 1.24-1.46 (m, 6H), 1.60-1.70 (m, 1H), 1.85-1.93 (m, 3H), 1.96-2.08 (m, 3H), 2.10-2.25 (m, 1H), 2.28-2.34 (m, 1H), 2.45-2.55 (m, 1H), 2.60-2.73 (m, 2H), 3.05 (s, 3H), 3.14-3.20 (m, 3H), 3.20-3.31 (m, 3H), 3.44-3.58 (m, 2H), 3.58-3.72 (m, 1H), 3.80-3.87 (m, 4H), 4.20-4.32 (m, 1H), 5.16 (d, J = 10.54 Hz, 1H), 5.56 (d, J = 8.78 Hz, 2H), 6.49-6.66 (m, 3H), 8.42-8.69 (m, 2H) 99 LCMS (ESI, m/z), 597.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.28-0.40 (m, 2H), 0.47-0.67 (m, 2H), 0.67-0.91 (m, 2H), 0.68-0.73 (m, 1H), 0.95 (t, J = 6.84 Hz,6H), 1.09-1.33 (m, 1H), 1.40-1.50 (m, 1H), 1.68-1.79 (m, 1H), 1.82-1.92 (m, 2H), 2.36-2.45 (m, 3H), 2.45-2.67 (m, 4H), 2.67-2.99 (m, 4H), 3.51-3.60 (m, 4H), 3.65 (m, 1H), 4.17 (d, J = 6.90 Hz, 2H), 4.82 (t, J = 10.10 Hz, 1H), 5.19-5.29 (m, 1H), 5.34 (dd, J = 15.00, 9.72 Hz, 1H), 5.55 (dd, J = 14.93, 9.91 Hz, 1H), 6.60-6.68 (m, 2H), 6.99 (s, 1H), 7.95 (d, J = 0.75 Hz, 1H), 8.16 (s, 1H) 100 LCMS (ESI, m/z), 597.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.73-0.87 (m, 1H), 0.87-0.97 (m, 6H), 1.11-1.26 (m, 1H), 1.26-1.35 (m, 1H), 1.37-1.50 (m, 1H), 1.67-1.78 (m, 2H), 1.80-1.91 (m, 4H), 2.34 (s, 3H), 2.37-2.64 (m, 6H), 3.38-3.60 (m, 4H), 3.61-3.77 (m, 1H), 4.01-4.09 (m, 2H), 4.35-4.42 (m, 2H), 4.82 (t, J = 10.10 Hz, 1H), 5.23 (d, J = 10.67 Hz, 1H), 5.34 (dd, J = 15 .00, 9.73 Hz, 1H), 5.54 (dd, J = 14.93, 9.91 Hz, 1H), 6.61 (s, 1H), 6.68 (d, J = 10.79 Hz, 1H), 7.02 (s, 2H), 7.97-8.02 (m, 1H) 101 LCMS (ESI, m/z), 557.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.85-0.99 (m, 6H), 1.09-1.30 (m, 2H), 1.44 (br dd, J = 13.30, 9.66 Hz, 2H), 1.57-1.79 (m, 2H), 1.80-1.92 (m, 4H), 2.21-2.30 (m, 3H), 2.33 (hr s, 1H), 2.42-2.61 (m, 2H), 3.16-3.57 (m, 6H), 3.60-3.72 (m, 1H), 3.99 (s, 3H), 4.82 (t, J = 10.10 Hz, 1H), 5.24 (d, J = 10.54 Hz, 1H), 5.35 (dd, J = 15.00, 9.72 Hz, 1H), 5.55 (dd, J = 15.00, 9.98 Hz, 1H), 6.60-6.69 (m, 2H), 6.96 (s, 1H), 7.93 (s, 1H) 102 LCMS (ESI, m/z), 566.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.77-0.97 (m, 6H), 1.07-1.28 (m, 3H), 1.32-1.55 (m, 1H), 1.66-1.78 (m, 1H), 1.78-1.82 (m, 3H), 1.82-1.91 (m, 1H), 2.19-2.27 (m, 3H), 2.27-2.39 (m, 4H), 2.36-2.56 (m, 2H), 3.18-3.55 (m, 5H), 3.64 (br s, 1H), 4.81 (t, J = 10.04 Hz, 1H), 5.13-5.21 (m, 1H), 5.21-5.27 (m, 2H), 5.27-5.38 (m, 1H), 5.45-5.58 (m, 1H), 6.31 (s, 1H), 6.93-7.02 (m, 2H), 7.36-7.42 (m, 1H), 7.56 (s, 1H), 8.47-8.53 (m, 2H) 103 0 LCMS (ESI, m/z), 489.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.78-0.90 (m, 3H), 0.93 (d, J = 6.90 Hz, 3H), 1.09- 1.29 (m, 2H), 1.35-1.77 (m, 2H), 1.79 (s, 3H), 1.82-1.93 (m, 3H), 2.30-2.37 (m, 1H), 2.37-2.57 (m, 7H), 3.34 (br d, J = 5.27 Hz,1H), 3.46-3.54 (m, 3H), 3.54-3.72 (m, 2H), 3.83 (s, 3H), 4.81 (t, J = 10.10 Hz, 1H), 5.14-5.23 (m, 1H), 5.31 (dd, J = 15.00, 9.73 Hz, 1H), 5.52 (dd, J = 15.00, 9.98 Hz, 1H), 6.29 (s, 1H), 7.31 (s, 1H), 7.46 (s, 1H) 104 LCMS (ESI, m/z), 645.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.92-1.01 (m, 6H), 1.11-1.17 (m, 2H), 1.22-1.42 (m, 2H), 1.60 (hr s, 2H), 1.81-1.86 (m, 3H), 1.87-1.98 (m, 1H), 2.27 (s, 3H), 2.33-2.48 (m, 4H), 2.50-2.65 (m, 2H), 3.25-3.31 (m, 3H), 3.48 (hr dd, J = 6.59, 4.08 Hz, 2H), 3.52-3.62 (m, 6H), 3.73- 3.80 (m, 1H), 3.80-3.85 (m, 2H), 4.74- 4.79 (m, 1H), 5.06-5.15 (m, 1H), 5.48 (dd, J = 15.12, 9.10 Hz, 2H), 6.45-6.58 (m, 4H) 105 LCMS (ESI, m/z), 658.3 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d6) δ 0.00 (dd, J = 9.54, 6.78 Hz, 6H), 0.25-0.45 (m, 3H), 0.65 (br s, 2H), 0.89 (d, J = 1.25 Hz, 4H), 1.31 (s, 3H), 1.36-1.52 (m, 5H), 1.58- 1.71 (m, 4H), 2.44-2.70 (m, 11H), 2.71- 2.77 (m, 2H), 2.77-2.85 (m, 1H), 2.85- 2.92 (m, 2H), 3.79-3.87 (m, 1H), 4.09- 4.19 (m, 1H), 4.45-4.61 (m, 2H), 5.47- 5.66 (m, 4H) 106 LCMS (ESI, m/z), 572.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.78-0.90 (m, 3H), 0.93 (d, J = 6.78 Hz, 3H), 1.08- 1.27 (m, 2H), 1.42 (ddd, J = 13.87, 9.85, 3.89 Hz, 1H), 1.66-1.77 (m, 1H), 1.80 (s, 3H), 1.82-1.91 (m, 2H), 1.92-2.13 (m, 6H), 2.19-2.33 (m, 8H), 2.34-2.57 (m, 4H), 2.91 (br d, J = 11.54 Hz, 2H), 3.41 (br s, 4H), 3.49-3.68 (m, 2H), 4.05 (tt, J = 11.26, 4.11 Hz, 1H), 4.81 (t, J = 10.10 Hz, 1H), 5.17 (d, J = 10.67 Hz, 1H), 5.31 (dd, J = 15.06, 9.66 Hz, 1H), 5.51 (dd, J = 14.93, 9.91 Hz, 1H), 6.30 (s, 1H), 7.38 (s, 1H), 7.48 (s, 1H) 107 LCMS (ESI, m/z), 669.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.84-0.94 (m, 6H), 1.44-1.68 (m, 3H), 1.68-2.01 (m, 6H), 2.31-2.37 (m, 3H), 2.37-2.48 (m, 4H), 2.51-2.71 (m, 3H), 2.77-2.90 (m, 4H), 3.05 (d, J = 9.54 Hz, 2H), 3.17- 3.29 (m, 4H), 3.46-3.62 (m, 5H), 3.70- 3.80 (m, 1H), 4.90 (s, 1H), 5.24-5.30 (m, 1H), 5.42 (s, 1H), 5.57-5.65 (m, 1H), 6.47-6.56 (m, 3H) 108 LCMS (ESI, m/z), 659.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.02 (dd, J = 8.53, 6.90 Hz, 6H), 1.42-1.60 (m, 1H), 1.76-1.87 (m, 1H), 1.90 (s, 3H), 1.90- 2.00 (m, 2H), 2.30-2.38 (m, 3H), 2.42 (br s, 4H), 2.48-2.68 (m, 4H), 3.12-3.28 (m, 4H), 3.42-3.47 (m, 4H), 3.47-3.59 (m, 4H), 3.59-3.71 (m, 2H), 3.71-3.84 (m, 3H), 4.15-4.19 (m, 2H), 4.90 (t, J = 10.10 Hz, 1H), 5.27 (d, J = 10.54 Hz, 1H), 5.42 (dd, J = 15.00, 9.73 Hz, 1H), 5.61 (dd, J = 15.00, 9.85 Hz, 1H), 6.48- 6.59 (m, 4H) 109 LCMS (ESI, m/z), 655.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.79-0.92 (m, 2H), 0.94-1.08 (m, 8H), 1.42-1.65 (m, 1H), 1.72-1.86 (m, 2H), 1.89 (s, 3H), 1.90-2.01 (m, 1H), 2.31-2.37 (m, 3H), 2.37-2.48 (m, 4H), 2.52-2.71 (m, 4H), 3.10-3.33 (m, 5H), 3.53 (br s, 4H), 3.70- 3.89 (m, 5H), 4.90 (t, J = 10.10 Hz, 1H), 5.27 (d, J = 10.67 Hz, 1H), 5.42 (dd, J = 14.93, 9.66 Hz, 1H), 5.61 (dd, J = 15.06, 9.91 Hz, 1H), 6.49-6.57 (m, 4H) 110 LCMS (ESI, m/z), 757.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94-1.07 (m, 6H), 1.40-1.58 (m, 1H), 1.76-1.88 (m, 4H), 1.88-2.00 (m, 1H), 2.32-2.37 (m, 3H), 2.37-2.48 (m, 5H), 2.50-2.70 (m, 4H), 3.10-3.21 (m, 4H), 3.21-3.32 (m, 4H), 3.40-3.64 (m, 4H), 3.63-3.89 (m, 2H), 3.90 (s, 3H), 4.89 (t, J = 10.04 Hz, 1H), 5.25 (d, J = 10.67 Hz, 1H), 5.37- 5.46 (m, 1H), 5.60 (dd, J = 15.06, 9.91 Hz, 1H), 6.42-6.54 (m, 4H), 7.01-7.06 (m, 2H), 7.72-7.77 (m, 2H) 111 LCMS (ESI, m/z), 757.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.88-1.00 (m, 6H), 1.41 (br d, J = 9.41 Hz, 2H), 1.78 (d, J = 1.13 Hz, 4H), 1.80-1.89 (m, 2H), 2.25-2.31 (m, 3H), 2.33-2.43 (m, 3H), 2.43-2.63 (m, 4H), 2.99-3.15 (m, 4H), 3.16-3.30 (m, 4H), 3.40-3.58 (m, 4H), 3.61-3.78 (m, 2H), 3.90 (s, 3H), 4.81 (t, J = 10.10 Hz, 1H), 5.17 (d, J = 10.54 Hz, 1H), 5.32 (dd, J = 15 .06, 9.66 Hz, 1H), 5.52 (dd, J = 15.00, 9.85 Hz, 1H), 6.34-6.49 (m, 4H), 7.64-7.68 (m, 1H), 7.68-7.73 (m, 1H) 112 LCMS (ESI, m/z), 737.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.95-1.07 (m, 6H), 1.42-1.56 (m, 1H), 1.74-1.88 (m, 5H), 1.88-1.99 (m, 2H), 2.32-2.38 (m, 3H), 2.38-2.49 (m, 4H), 2.49-2.70 (m, 4H), 3.26 (br dd, J = 17.07, 5.52 Hz, 8H), 3.46-3.63 (m, 4H), 3.70-3.86 (m, 1H), 4.90 (t, J = 10.04 Hz, 1H), 5.25 (d, J = 10.67 Hz, 1H), 5.41 (dd, J = 14.93, 9.66 Hz, 1H), 5.60 (dd, J = 14.93, 9.91 Hz, 1H), 6.43-6.57 (m, 4H), 7.54 (ddd, J = 8.00, 4.86, 0.69 Hz, 1H), 8.10 (dt, J = 8.03, 2.01 Hz, 1H), 8.88 (dd, J = 4.83, 1.44 Hz, 1H), 9.03-9.06 (m, 1H) 113 0 LCMS (ESI, m/z), 757.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.01 (dd, J = 11.54, 6.78 Hz, 6H), 1.44-1.58 (m, 1H), 1.74-1.90 (m, 4H), 1.90-2.02 (m, 3H), 2.33-2.39 (m, 3H), 2.39-2.50 (m, 4H), 2.52-2.70 (m, 4H), 3.25-3.32 (m, 4H), 3.32-3.41 (m, 4H), 3.47-3.63 (m, 4H), 3.70-3.78 (m, 1H), 3.78-3.82 (m, 3H), 4.90 (t, J = 10.10 Hz, 1H), 5.26 (d, J = 10.67 Hz, 1H), 5.41 (dd, J = 15.06, 9.66 Hz, 1H), 5.61 (dd, J = 14.93, 9.91 Hz, 1H), 6.45-6.56 (m, 4H), 7.46-7.50 (m, 1H), 7.50-7.53 (m, 1H) 114 LCMS (ESI, m/z), 697.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.02 (dd, J = 8.41, 6.90 Hz, 6H), 1.19-1.37 (m, 4H), 1.44-1.68 (m, 4H), 1.68-1.87 (m, 6H), 1.89 (d, J = 1.00 Hz, 3H), 1.91-2.00 (m, 2H), 2.32-2.41 (m, 4H), 2.41-2.68 (m, 6H), 3.19 (br s, 4H), 3.55 (br s, 4H), 3.61-3.70 (m, 2H), 3.75 (br d, J = 17.19 Hz, 4H), 4.90 (t, J = 10.10 Hz, 1H), 5.27 (d, J = 10.67 Hz, 1H), 5.42 (dd, J = 14.93, 9.66 Hz, 1H), 5.61 (dd, J = 15.06, 9.91 Hz, 1H), 6.49-6.57 (m, 4H) 115 LCMS (ESI, m/z), 780.3 [M + H].sup.+. .sup.1H NMR(400 MHz, CDCl.sub.3) δ 1.00 (dd, J = 17.82, 6.78 Hz, 6H), 1.77-1.87 (m, 4H), 1.87-2.00 (m, 2H), 2.35-2.38 (m, 3H), 2.38-2.50 (m, 5H), 2.50-2.69 (m, 4H), 3.13-3.21 (m, 4H), 3.21-3.30 (m, 4H), 3.41-3.67 (m, 5H), 3.70-3.79 (m, 1H), 3.88 (s, 3H), 4.89 (t, J = 10.10 Hz, 1H), 5.24 (d, J = 10.67 Hz, 1H), 5.36-5.48 (m, 1H), 5.60 (dd, J = 15.00, 9.85 Hz, 1H), 6.39-6.52 (m, 4H), 6.66 (dd, J = 3.20, 0.69 Hz, 1H), 7.22 (d, J = 3.14 Hz, 1H), 7.45 (d, J = 8.66 Hz, 1H), 7.64 (dd, J = 8.66, 1.76 Hz, 1H), 8.14 (d, J = 1.38 Hz, 1H) 116 LCMS (ESI, m/z), 627.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.98 (m, 6H), 1.10-1.25 (m, 2H), 1.42 (br d, J = 9.41 Hz, 1H), 1.68-1.94 (m, 7H), 2.17-2.41 (m, 9H), 2.44-2.61 (m, 3H), 3.32-3.47 (m, 4H), 3.47-3.59 (m, 3H), 3.66 (br d, J = 2.89 Hz, 1H), 4.09 (br s, 2H), 4.47-4.56 (m, 1H), 4.82 (t, J = 10.04 Hz, 1H), 5.22 (d, J = 10.54 Hz, 1H), 5.36 (br s, 1H), 5.54 (dd, J = 14.93, 9.91 Hz, 1H), 6.60-6.70 (m, 2H), 7.00 (s, 1H), 7.96 (s, 1H) 117 LCMS (ESI, m/z), 627.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (dd, J = 6.78, J = 6.78, 1.88 Hz, 6H), 1.18 (br d, J = 8.91 Hz, 2H), 1.32-1.58 (m, 2H), 1.58-1.80 (m, 2H), 1.85 (d, J = 1.13 Hz, 3H), 2.10- 2.22 (m, 4H), 2.24 (s, 3H), 2.30 (br s, 4H), 2.42-2.61 (m, 4H), 3.33-3.46 (m, 4H), 3.46-3.58 (m, 3H), 3.65 (br d, J = 2.26 Hz, 1H), 4.10 (dt, J = 11 .67, 3.07 Hz, 2H), 4.51-4.61 (m, 1H), 4.82 (t, J = 10.10 Hz, 1H), 5.23 (d, J = 10.54 Hz, 1H), 5.32 (dd, J = 15.00, 9.72 Hz, 1H), 5.53 (dd, J = 15.00, 9.98 Hz, 1H), 6.51- 6.58 (m, 2H), 7.31 (s, 1H), 7.93 (s, 1H) 118 LCMS (ESI, m/z), 699.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.01 (dd, J = 9.35, 6.84 Hz, 6H), 1.47-1.56 (m, 1H), 1.60-1.72 (m, 2H), 1.73-1.87 (m, 2H), 1.89 (s, 3H), 1.90-2.03 (m, 2H), 2.32 (s, 3H), 2.41 (br s, 4H), 2.52-2.69 (m, 3H), 2.79 (tt, J = 11.26, 3.80 Hz, 2H), 3.20 (br s, 4H), 3.39-3.60 (m, 7H), 3.63-3.85 (m, 6H), 4.01-4.10 (m, 2H), 4.90 (t, J = 10.10 Hz, 1H), 5.27 (d, J = 10.54 Hz, 1H), 5.42 (dd, J = 15.06, 9.66 Hz, 1H), 5.61 (dd, J = 14.93, 9.91 Hz, 1H), 6.49-6.57 (m, 4H) 119 LCMS (ESI, m/z), 714.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (dd, J = 8.53, 6.90 Hz, 6H), 1.48-1.77 (m, 5H), 1.75-1.88 (m, 6H), 1.83-1.90 (m, 1H), 2.21-2.29 (m, 4H), 2.33 (hr s, 4H), 2.39- 2.59 (m, 6H), 3.05-3.22 (m, 5H), 3.31- 3.51 (m, 5H), 3.51-3.72 (m, 6H), 4.81 (t, J = 10.04 Hz, 1H), 5.18 (d, J = 10.67 Hz, 1H), 5.29-5.39 (m, 1H), 5.47-5.58 (m, 1H), 6.39-6.51 (m, 4H) 120 LCMS (ESI, m/z), 695.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (dd, J = 8.78, 6.90 Hz, 6H), 1.37-1.48 (m, 2H), 1.48-1.77 (m, 3H), 1.77-1.82 (m, 3H), 1.82-1.92 (m, 1H), 2.20-2.27 (m, 4H), 2.31 (hr s, 4H), 2.42-2.62 (m, 3H), 3.09- 3.27 (m, 5H), 3.42 (br s, 5H), 3.56-3.70 (m, 5H), 4.81 (t, J = 10.10 Hz, 1H), 5.19 (d, J = 10.67 Hz, 1H), 5.33 (dd, J = 15.06, 9.66 Hz, 1H), 5.52 (dd, J = 14.93, 9.91 Hz, 1H), 6.41-6.49 (m, 4H), 7.32 (d, J = 1.25 Hz, 1H), 7.49 (d, J = 1.38 Hz, 1H) 121 LCMS (ESI, m/z), 669.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ −0.04-0.02 (m, 2H), 0.35-0.41 (m, 2H), 0.72-0.90 (m, 8H), 1.20-1.41 (m, 1H), 1.54-1.65 (m, 2H), 1.65-1.68 (m, 3H), 1.68-1.78 (m, 2H), 2.06-2.10 (m, 4H), 2.13-2.21 (m, 4H), 2.24-2.46 (m, 3H), 2.97 (br s, 4H), 3.15-3.34 (m, 4H), 3.34-3.46 (m, 3H), 3.48-3.61 (m, 3H), 4.68 (t, J = 10.10 Hz, 1H), 5.00-5.10 (m, 1H), 5.19 (dd, J = 14.93, 9.66 Hz, 1H), 5.39 (dd, J = 15.06, 9.91 Hz, 1H), 6.26-6.34 (m, 4H) 122 LCMS (ESI, m/z), 695.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.93 (m, 3H), 0.94 (br d, J = 6.90 Hz, 3H), 1.33-1.54 (m, 1H), 1.63-1.78 (m, 3H), 1.7 (s, 3H), 1.80-1.91 (m, 2H), 2.20-2.26 (m, 5H), 2.29 (br s, 3H), 2.39-2.59 (m, 3H), 3.00-3.13 (m, 5H), 3.42 (br s, 4H), 3.61-3.73 (m, 5H), 4.81 (t, J = 10.04 Hz, 1H), 4.98 (s, 2H), 5.15-5.23 (m, 1H), 5.33 (dd, J = 15.06, 9.66 Hz, 1H), 5.52 (dd, J = 15.00, 9.85 Hz, 1H), 6.26 (t, J = 2.13 Hz,1H), 6.37-6.48 (m, 4H), 7.47 (d, J = 2.26 Hz, 2H) 123 0 LCMS (ESI, m/z), 682.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (dd, J = 8.91, 6.78 Hz, 6H), 1.38-1.48 (m, 2H), 1.68-1.78 (m, 2H), 1.78-1.83 (m, 3H), 1.83-1.91 (m, 1H), 2.20-2.24 (m, 3H), 2.24-2.35 (m, 4H), 2.44-2.59 (m, 3H), 3.16-3.24 (m, 4H), 3.24-3.34 (m, 1H), 3.34-3.52 (m, 4H), 3.62-3.71 (m, 1H), 3.81-3.92 (m, 4H), 4.81 (t, J = 10.10 Hz, 1H), 5.19 (d, J = 10.54 Hz, 1H), 5.33 (dd, J = 15.00 , 9.60 Hz, 1H), 5.52 (dd, J = 14.93, 9.91 Hz, 1H), 6.41-6.50 (m, 4H), 7.58 (s, 1H), 7.90 (s, 1H) 124 LCMS(ESI, m/z), 682.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.97-1.05 (m, 6H), 1.26-1.29 (m, 1H), 1.45-1.57 (m, 1H), 1.77-1.86 (m, 1H), 1.89 (s, 3H), 1.91-2.01 (m, 1H), 2.29-2.34 (m, 3H), 2.34-2.46 (m, 4H), 2.51-2.72 (m, 3H), 3.18-3.26 (m, 2H), 3.26-3.34 (m, 4H), 3.42-3.56 (m, 8H), 3.71-3.79 (m, 1H), 4.08-4.17 (m, 3H), 4.90 (t, J = 10.04 Hz, 1H), 5.27 (d, J = 10.67 Hz, 1H), 5.42 (dd, J = 14.93, 9.66 Hz, 1H), 5.61 (dd, J = 15.00, 9.85 Hz, 1H), 6.49-6.59 (m, 4H) 125 LCMS (ESI, m/z), 707.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.98 (m, 6H), 1.12-1.25 (m, 2H), 1.37-1.48 (m, 1H), 1.69-1.77 (m, 1H), 1.79 (s, 3H), 1.81-1.91 (m, 1H), 2.20-2.25 (m, 3H), 2.28 (br s, 4H), 2.39-2.59 (m, 3H), 3.10- 3.23 (m, 4H), 3.23-3.32 (m, 1H), 3.33- 3.47 (m, 8H), 3.65 (q, J = 6.99 Hz, 1H), 4.38 (tt, J = 8.14, 6.48 Hz, 1H), 4.77-4.85 (m, 3H), 4.86-4.94 (m, 2H), 5.18 (d, J = 10.54 Hz, 1H), 5.33 (dd, J = 14.93, 9.66 Hz, 1H), 5.52 (dd, J = 14.93, 9.91 Hz, 1H), 6.39-6.50 (m, 4H) 126 LCMS (ESI, m/z), 663.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (dd, J = 6 .7 8, 2.89 Hz, 6H), 1.09-1.26 (m, 2H), 1.38-1.49 (m, 2H), 1.67-1.78 (m, 2H), 1.85 (d, J = 1.13 Hz, 5H), 2.42-2.55 (m, 5H), 2.55-2.78 (m, 4H), 3.57-3.73 (m, 6H), 4.77-4.90 (m, 4H), 5.18-5.28 (m, 1H), 5.34 (dd, J = 15.00, 9.72 Hz, 1H), 5.55 (dd, J = 15.00, 9.98 Hz, 1H), 6.59 (s, 1H), 6.69 (d, J = 10.92 Hz, 1H), 7.10 (s, 1H), 8.02-8.06 (m, 1H) 127 LCMS (ESI, m/z), 552.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.86-1.03 (m, 6H), 1.38-1.49 (m, 1H), 1.68-1.80 (m, 2H), 1.81-1.93 (m, 5H), 2.18-2.27 (m, 3H), 2.30 (hr s, 3H), 2.41-2.62 (m, 4H), 3.32-3.49 (m, 4H), 3.55-3.72 (m, 2H), 4.83 (t, J = 10.10 Hz, 1H), 5.25 (d, J = 10.67 Hz, 1H), 5.30-5.38 (m, 1H), 5.55 (dd, J = 15.00, 9.85 Hz, 1H), 6.46 (d, J = 7.15 Hz, 1H), 6.61 (s, 1H), 7.01 (br s, 1H), 7.42-7.53 (m, 2H), 8.26 (s, 1H), 9.91 (br s, 1H) 128 LCMS (ESI, m/z), 614.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (d, J = 6.78 Hz, 6H), 1.15-1.24 (m, 1H), 1.34-1.56 (m, 1H), 1.66-1.77 (m, 1H), 1.89 (s, 3H), 2.20-2.26 (m, 3H), 2.26- 2.40 (m, 3H), 2.43-2.62 (m, 2H), 2.69 (d, J = 4.77 Hz, 3H), 3.42 (hr s, 3H), 3.65 (br s, 1H), 4.81 (t, J = 10.04 Hz, 1H), 4.96 (d, J = 9.66 Hz, 3H), 5.21 (d, J = 10.54 Hz, 1H), 5.34 (dd, J = 15.06, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 5.76 (br d, J = 4.64 Hz, 2H), 6.58 (s, 1H), 6.68- 6.75 (m, 1H), 6.75-6.84 (m, 1H), 6.97 (s, 1H), 7.12 (d, J = 8.41 Hz, 1H), 7.30 (td, J = 8.06, 4.96 Hz, 1H), 8.03-8.08 (m, 1H), 8.08-8.15 (m, 1H) 129 LCMS (ESI, m/z), 654.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (d, J = 6.78 Hz, 6H), 1.08-1.24 (m, 2H), 1.42 (ddd, J = 13.71, 9.82, 3.95 Hz, 1H), 1.68- 1.82 (m, 4H), 1.82-1.85 (m, 2H), 1.89 (s, 3H), 2.19-2.28 (m, 3H), 2.32 (br s, 4H), 2.39-2.61 (m, 4H), 3.42 (br t, J = 6.90 Hz, 9H), 3.54-3.70 (m, 1H), 4.81 (t, J = 10.04 Hz, 1H), 5.05 (s, 2H), 5.20 (d, J = 10.67 Hz, 1H), 5.33 (dd, J = 15.06, 9.66 Hz, 1H), 5.52 (dd, J = 14.93, 9.91 Hz, 1H), 6.58 (s, 1H), 6.67 (d, J = 10.92 Hz, 1H), 7.03 (s, 1H), 7.97 (d, J = 0.75 Hz, 1H) 130 LCMS (ESI, m/z), 670.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (d, J = 6 .78 Hz, 6H), 1.07-1.29 (m, 2H), 1.34-1.60 (m, 1H), 1.60-1.80 (m, 2H), 1.83 (d, J = 1.13 Hz, 3H), 2.20-2.28 (m, 4H), 2.32 (hr s, 3H), 2.38-2.63 (m, 3H), 3.31-3.45 (m, 4H), 3.45-3.57 (m, 9H), 3.60-3.71 (m, 1H), 4.81 (t, J = 10.10 Hz, 1H), 5.11 (s, 2H), 5.10-5.23 (m, 2H), 5.33 (dd, J = 15.00, 9.72 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.58 (s, 1H), 6.69 (d, J = 10.79 Hz, 1H), 7.05 (s, 1H), 7.96-8.02 (m, 1H) 131 LCMS (ESI, m/z), 582.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (t, J = 6.21 Hz, 6H), 1.19 (br d, J = 8.78 Hz, 2H), 1.34-1.59 (m, 2H), 1.59-1.81 (m, 1H), 1.85 (d, J = 1.13 Hz, 4H), 2.18-2.28 (m, 3H), 2.32 (hr s, 4H), 2.44-2.61 (m, 3H), 3.31-3.54 (m, 4H), 3.66 (hr d, J = 6.27 Hz, 1H), 4.82 (t, J = 10.04 Hz, 1H), 5.20-5.25 (m, 3H), 5.31-5.39 (m, 1H), 5.53 (dd, J = 14.93, 9.91 Hz, 1H), 6.62 (s, 1H), 6.76 (d, J = 10.67 Hz, 1H), 7.04 (s, 1H), 8.03 (d, J = 0.88 Hz, 1H) 132 LCMS (ESI, m/z), 628.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (dd, J = 6.78, 0.88 Hz, 6H), 1.07-1.28 (m, 1H), 1.42 (ddd, J = 13.71, 9.76, 3.76 Hz, 1H), 1.63-1.78 (m, 1H), 1.80-1.84 (m, 4H), 1.84-1.91 (m, 1H), 2.19-2.27 (m, 2H), 2.30 (hr s, 3H), 2.43-2.62 (m, 4H), 2.80- 2.99 (m, 4H), 3.01-3.07 (m, 4H), 3.32- 3.51 (m, 3H), 3.61-3.70 (m, 1H), 4.81 (t, J = 10.10 Hz, 1H), 5.12 (s, 2H), 5.16- 5.24 (m, 1H), 5.33 (dd, J = 15.00, 9.72 Hz, 1H), 5.52 (dd, J = 15.06, 9.91 Hz, 1H), 6.58 (s, 1H), 6.65-6.74 (m, 2H), 7.00 (s, 1H), 7.96-8.02 (m, 1H) 133 0 LCMS (ESI, m/z), 597.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.32-0.48 (m, 4H), 0.93 (dd, J = 6.78, 0.88 Hz, 6H), 1.11-1.34 (m, 2H), 1.12-1.24 (m, 1H), 1.37-1.65 (m, 2H), 1.65-1.80 (m, 4H), 1.86 (td, J = 6.68, 3.58 Hz, 3H), 2.23 (s, 3H), 2.31 (br s, 4H), 2.40-2.62 (m, 2H), 3.43 (br s, 3H), 3.55-3.70 (m, 1H), 4.27- 4.37 (m, 2H), 4.82 (t, J = 10.10 Hz, 1H), 5.27-5.37 (m, 2H), 5.55 (dd, J = 14.93, 9.91 Hz, 1H), 6.58 (s, 1H), 6.87 (dd, J = 8.28, 5.77 Hz, 1H), 7.34 (d, J = 8.28 Hz, 1H), 7.88 (d, J = 2.38 Hz, 1H) 134 LCMS (ESI, m/z), 673.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.88-0.92 (d, J = 6.90, 3H), 0.93 (br d, J = 6.90 Hz, 3H), 1.18 (br d, J = 8.41 Hz, 2H), 1.33-1.57 (m, 1H), 1.64-1.75 (m, 2H), 1.78 (s, 3H), 1.80-1.92 (m, 2H), 2.17-2.27 (m, 4H), 2.30 (br s, 4H), 2.43-2.59 (m, 5H), 3.03- 3.27 (m, 5H), 3.29 (s, 3H), 3.35-3.51 (m, 4H), 3.53-3.60 (m, 2H), 3.62-3.68 (m, 3H), 3.68-3.76 (m, 2H), 4.80 (t, J = 10.10 Hz, 1H), 5.17 (d, J = 10.67 Hz, 1H), 5.32 (dd, J = 15.06, 9.66 Hz, 1H), 5.51 (dd, J = 15.06, 9.91 Hz, 1H), 6.38-6.47 (m, 4H) 135 LCMS (ESI, m/z), 645.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.87-0.92 (d, J = 6.78 Hz, 3H), 0.93 (d, J = 6.78 Hz, 3H), 1.10-1.24 (m, 2H), 1.34-1.48 (m, 1H), 1.67-1.77 (m, 1H), 1.79 (s, 3H), 1.80-1.92 (m, 1H), 2.26 (s, 3H), 2.35 (br s, 4H), 2.42-2.60 (m, 4H), 3.07-3.17 (m, 4H), 3.28-3.40 (m, 3H), 3.44 (br s, 4H), 3.55-3.69 (m, 1H), 3.69-3.78 (m, 2H), 4.13 (s, 2H), 4.80 (t, J = 10.04 Hz, 1H), 5.17 (d, J = 10.54 Hz, 1H), 5.32 (dd, J = 14.93, 9.66 Hz, 1H), 5.51 (dd, J = 15.06, 9.91 Hz, 1H), 6.39-6.50 (m, 4H) 136 LCMS (ESI, m/z), 645.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.85-0.92 (d, J = 6.78 Hz, 3H), 0.93 (d, J = 6.78 Hz, 3H), 1.11-1.37 (m, 3H), 1.37-1.47 (m, 1H), 1.64-1.75 (m, 3H), 1.79 (s, 3H), 1.81-1.90 (m, 1H), 2.20-2.24 (m, 3H), 2.24-2.34 (m, 4H), 2.40-2.56 (m, 3H), 2.57-2.67 (m, 5H), 3.03-3.20 (m, 4H), 3.41 (br s, 5H), 3.60-3.69 (m, 1H), 3.61- 3.77 (m, 3H), 4.80 (t, J = 9.98 Hz, 1H), 5.17 (d, J = 10.67 Hz, 1H), 5.32 (dd, J = 15.06, 9.66 Hz, 1H), 5.51 (dd, J = 15.00, 9.85 Hz, 1H), 6.37-6.45 (m, 4H) 137 LCMS (ESI, m/z), 598.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.37-0.45 (m, 2H), 0.54-0.63 (m, 2H), 0.90-0.94 (m, 3H), 0.95 (br d, J = 4.02 Hz, 3H), 1.12-1.24 (m, 2H), 1.24-1.47 (m, 1H), 1.38-1.51 (m, 1H), 1.67-1.78 (m, 1H), 1.78-1.93 (m, 4H), 2.22-2.26 (m, 3H), 2.26-2.39 (m, 4H), 2.38-2.61 (m, 4H), 3.32-3.52 (m, 4H), 3.66 (hr d, J = 3.39 Hz, 1H), 4.42 (dd, J = 7.09, 1.32 Hz, 2H), 4.81 (t, J = 10.10 Hz, 1H), 5.23 (d, J = 10.67 Hz, 1H), 5.34 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.62 (s, 1H), 6.90 (d, J = 10.92 Hz, 1H), 7.11 (s, 1H) 138 LCMS(ESI, m/z), 598.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.37-0.55 (m, 2H), 0.55-0.64 (m, 2H), 0.90-0.96 (m, 6H), 1.15-1.24 (m, 2H), 1.36-1.56 (m, 2H), 1.68-1.78 (m, 2H), 1.80-1.90 (m, 4H), 2.21-2.26 (m, 3H), 2.26-2.38 (m, 4H), 2.44-2.64 (m, 3H), 3.34-3.52 (m, 4H), 3.61-3.72 (m, 1H), 4.50 (d, J = 7.28 Hz, 2H), 4.82 (t, J = 10.04 Hz, 1H), 5.23 (d, J = 10.54 Hz, 1H), 5.33 (dd, J = 15.00, 9.72 Hz, 1H), 5.53 (dd, J = 14.93, 9.91 Hz, 1H), 6.57 (s, 1H), 6.88 (dd, J = 11.42, 0.88 Hz, 1H), 7.46 (s, 1H) 139 LCMS (ESI, m/z), 598.3 [M + H].sup.+. .sup.1H NMR(400 MHz, CDCl.sub.3) δ 0.40-0.49 (m, 2H), 0.51-0.61 (m, 2H), 0.94 (d, J = 6.65 Hz, 6H), 1.09-1.35 (m, 2H), 1.35-1.49 (m, 2H), 1.67-1.80 (m, 2H), 1.80-1.91 (m, 4H), 2.22-2.26 (m, 3H), 2.27-2.38 (m, 4H), 2.44-2.63 (m, 3H), 3.35-3.53 (m, 4H), 3.61-3.72 (m, 1H), 4.53 (d, J = 7.28 Hz, 2H), 4.82 (t, J = 10.04 Hz, 1H), 5.23 (d, J = 10.67 Hz, 1H), 5.30- 5.38 (m, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.58 (s, 1H), 6.98 (d, J = 11.67 Hz, 1H), 7.66 (s, 1H) 140 LCMS (ESI, m/z), 628.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.98 (m, 6H), 1.13-1.26 (m, 2H), 1.38-1.49 (m, 1H), 1.66-1.79 (m, 2H), 1.79 (s, 3H), 1.96-2.22 (m, 3H), 2.22-2.26 (m, 3H), 2.26-2.35 (m, 4H), 2.36-2.63 (m, 5H), 3.33-3.50 (m, 4H), 3.57 (br t, J = 11.67 3.33-3.50 2H), 3.63-3.71 (m, 1H), 4.14 (br d, J = 11.54 Hz, 2H), 4.77-4.85 (m, 2H), 5.22 (d, J = 10.67 Hz, 1H), 5.31-5.39 (m, 1H), 5.53 (dd, J = 14.93, 9.91 Hz, 1H), 6.62 (s, 1H), 6.90 (d, J = 10.92 Hz, 1H), 7.11 (s, 1H) 141 LCMS (ESI, m/z), 628.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (d, J = 6.78 Hz, 6H), 1.10-1.25 (m, 2H), 1.42 (ddd, J = 13.90, 9.94, 3.76 Hz, 1H), 1.67- 1.78 (m, 1H), 1.79-1.91 (m, 4H), 2.17- 2.25 (m, 5H), 2.25-2.43 (m, 5H), 2.45- 2.62 (m, 3H), 3.33-3.50 (m, 4H), 3.50- 3.61 (m, 2H), 3.61-3.72 (m, 1H), 4.05- 4.12 (m, 2H), 4.82 (t, J = 10.10 Hz, 1H), 4.87-4.98 (m, 1H), 5.23 (d, J = 10.67 Hz, 1H), 5.33 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 14.93, 9.91 Hz, 1H), 6.56 (s, 1H), 6.88 (dd, J = 11.29, 0.88 Hz, 1H), 7.46 (s, 1H) 142 LCMS (ESI, m/z), 601.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (dd, J = 6 .78, 1.51 Hz, 6H), 1.08-1.29 (m, 2H), 1.33-1.60 (m, 1H), 1.60-1.81 (m, 2H), 1.81-1.92 (m, 4H), 2.20-2.29 (m, 4H), 2.33 (br s, 4H), 2.44-2.62 (m, 3H), 3.24 (s, 3H), 3.34-3.54 (m, 3H), 3.63 (t, J = 5.08 Hz, 3H),4.22 (t, J = 5.02 Hz, 2H), 4.82 (t, J = 10.10 Hz, 1H), 5.22 (d, J = 10.67 Hz, 1H), 5.33 (dd, J = 14.93, 9.66 Hz, 1H), 5.54 (dd, J = 14.93, 9.91 Hz, 1H), 6.61 (s, 1H), 6.87 (d, J = 11.42 Hz, 1H), 6.99 (s, 1H), 7.86 (s, 1H) 143 00 LCMS (ESI, m/z), 685.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (dd, J = 9.10, 6.84 Hz, 6H), 1.14-1.24 (m, 2H), 1.37-1.45 (m, 1H), 1.66-1.74 (m, 1H), 1.79 (d, J = 1.13 Hz, 3H), 1.82-1.90 (m, 2H), 1.97-2.08 (m, 2H), 2.14-2.21 (m, 1H), 2.23-2.27 (m, 1H), 2.26-2.35 (m, 3H), 2.42-2.60 (m, 3H), 3.05-3.14 (m, 4H), 3.14-3.24 (m, 1H), 3.35-3.49 (m, 4H), 3.55-3.62 (m, 2H), 3.62-3.67 (m, 1H), 3.67-3.74 (m, 2H), 3.75-3.86 (m, 3H), 3.92-4.00 (m, 1H), 4.76-4.86 (m, 1H), 5.13-5.22 (m, 1H), 5.26-5.37 (m, 1H), 5.44-5.56 (m, 1H), 6.37-6.48 (m, 4H) 144 01 LCMS (ESI, m/z), 727.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92- 0.98 (m, 6H), 1.14-1.21 (m, 2H), 1.42 (s, 10H), 1.69-1.77 (m, 1H), 1.83 (d, J = 1.25 Hz, 4H), 2.04-2.14 (m, 2H), 2.24 (s, 9H), 2.46-2.61 (m, 3H), 2.89-3.00 (m, 2H), 3.34-3.52 (m, 4H), 3.62-3.70 (m, 1H), 4.19-4.32 (m, 2H), 4.65-4.75 (m, 1H), 4.75-4.86 (m, 1H), 5.18-5.27 (m, 1H), 5.29-5.41 (m, 1H), 5.48-5.58 (m, 1H), 6.58-6.64 (m, 1H), 6.86-6.94 (m, 1H), 7.07 (s, 1H) 145 02 LCMS (ESI, m/z), 668.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (dd, J = 10.48, 6.84 Hz, 6H), 1.11-1.22 (m, 3H), 1.36-1.45 (m, 1H), 1.72-1.73 (m, 3H), 1.81-1.87 (m, 2H), 2.27 (s, 3H), 2.30-2.41 (m, 4H), 2.43-2.61 (m, 3H), 3.33-3.53 (m, 4H), 3.60-3.71 (m, 1H), 4.80 (t, J = 10.10 Hz, 1H), 5.18 (d, J = 10.67 Hz, 1H), 5.27-5.38 (m, 1H), 5.51 (dd, J = 15.00, 9.85 Hz, 1H), 5.71 (d, J = 1.00 Hz, 2H),6.49-6.57 (m, 1H), 6.83-6.92 (m, 2H), 7.13 (d, J = 8.53 Hz, 2H), 7.24-7.28 (m, 2H) 146 03 LCMS (ESI, m/z), 668.9 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ (m, 3H), 0.95 (br d, J = 3.76 Hz, 3H), 1.19 (br d, J = 8.66 Hz, 2H), 1.37-1.51 (m, 1H), 1.67-1.79 (m, 2H), 1.80-2.01 (m, 5H), 2.08-2.12 (m, 1H), 2.08-2.27 (m, 6H), 2.20-2.22 (m, 1H), 2.22-2.27 (m, 1H), 2.32 (s, 3H), 2.40-2.60 (m, 3H), 2.68 (br t, J = 12.99 Hz, 1H), 3.08-3.31 (m, 2H), 3.31-3.54 (m, 4H), 3.62-3.71 (m, 1H), 3.98 (br d, J = 12.67 Hz, 1H), 4.27-4.35 (m, 1H), 4.78-4.88 (m, 2H), 5.22 (d, J = 10.67 Hz, 1H), 5.34 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.62 (s, 1H), 6.90 (d, J = 11.42 Hz, 1H), 6.97 (s, 1H), 7.85 (s, 1H). 147 04 LCMS (ESI, m/z), 642.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.91-0.95 (m, 3H), 0.95 (d, J = 5.52 Hz, 3H), 1.10- 1.26 (m, 2H), 1.36-1.63 (m, 3H), 1.66- 1.80 (m, 1H), 1.80-1.89 (m, 4H), 2.11- 2.27 (m, 9H), 2.30 (hr s, 4H), 2.43-2.62 (m, 4H), 3.30-3.54 (m, 4H), 3.54-3.71 (m, 1H), 3.77-3.86 (m, 1H), 4.48-4.57 (m, 1H), 4.81 (t, J = 10.04 Hz, 1H), 5.22 (d, J = 10.54 Hz, 1H), 5.31-5.40 (m, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.62 (s, 1H), 6.87-6.95 (m, 1H), 7.06-7.11 (m, 1H) 148 05 LCMS (ESI, m/z), 641.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.91-0.94 (m, 3H), 0.95 (d, J = 4.89 Hz, 3H), 1.10- 1.34 (m, 2H), 1.34-1.49 (m, 6H), 1.68- 1.79 (m, 1H), 1.82-1.91 (m, 4H), 2.21- 2.28 (m, 4H), 2.28-2.42 (m, 4H), 2.41- 2.60 (m, 3H), 3.18-3.34 (m, 3H), 3.34- 3.55 (m, 4H), 3.66 (hr s, 1H), 3.86-3.93 (m, 2H), 4.41 (d, J = 7.15 Hz, 2H), 4.81 (t, J = 10.10 Hz, 1H), 5.20-5.25 (m, 1H), 5.35 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 14.93, 9.91 Hz, 1H), 6.62 (s, 1H), 6.91 (d, J = 10.54 Hz, 1H), 7.04 (s, 1H) 149 06 LCMS (ESI, m/z), 602.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (dd, J = 6.78, 3.39 Hz, 6H), 1.13-1.25 (m, 2H), 1.37-1.51 (m, 1H), 1.59-1.65 (m, 3H), 1.67-1.77 (m, 1H), 1.79-1.91 (m, 5H), 2.20-2.28 (m, 4H), 2.28-2.42 (m, 4H), 2.45-2.62 (m, 3H), 3.35-3.55 (m, 4H), 3.62-3.72 (m, 1H), 4.04-4.12 (m, 1H), 4.18 (dd, J = 11.86, 7.47 Hz, 1H), 4.78- 4.89 (m, 2H), 5.22 (d, J = 10.54 Hz, 1H), 5.34 (dd, J = 15.00, 9.72 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.61 (s, 1H), 6.89 (d, J = 11.04 Hz, 1H), 7.13 (s, 1H) 150 07 LCMS (ESI, m/z), 602.6 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.90-0.97 (m, 6H), 1.19 (br d, J = 8.03 Hz, 2H), 1.38-1.51 (m, 1H), 1.57-1.68 (m, 3H), 1.68-1.79 (m, 1H), 1.79-1.91 (m, 5H), 2.18-2.26 (m, 4H), 2.26-2.41 (m, 4H), 2.43-2.63 (m, 3H), 3.34-3.53 (m, 4H), 3.61-3.72 (m, 1H), 4.04-4.10 (m, 1H), 4.14-4.21 (m, 1H), 4.78-4.89 (m, 2H), 5.19-5.25 (m, 1H), 5.30-5.39 (m, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.61 (s, 1H), 6.89 (d, J = 10.92 Hz, 1H), 7.13 (s, 1H) 151 08 LCMS (ESI, m/z), 685.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.88-0.92 (d, J = 6.90 Hz, 3H), 0.93 (d, J = 6.90 Hz, 3H), 1.06-1.29 (m, 2H), 1.34-1.49 (m, 1H), 1.68-1.77 (m, 1H), 1.77-1.81 (m, 4H), 1.81-1.91 (m, 2H), 1.95-2.13 (m, 1H), 2.13-2.22 (m, 1H), 2.22-2.26 (m, 3H), 2.32 (hr s, 4H), 2.37-2.62 (m, 4H), 3.05-3.23 (m, 5H), 3.37-3.52 (m, 4H), 3.67-3.87 (m, 5H), 3.68-3.75 (m, 1H), 3.90-4.00 (m, 1H), 4.80 (t, J = 10.04 Hz, 1H), 5.17 (d, J = 10.54 Hz, 1H), 5.32 (dd, J = 14.93, 9.66 Hz, 1H), 5.51 (dd, J = 14.93, 9.91 Hz, 1H), 6.39-6.48 (m, 4H) 152 09 LCMS (ESI, m/z), 685.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.86-0.97 (m, 6H), 1.10-1.24 (m, 2H), 1.34-1.49 (m, 1H), 1.68-1.89 (m, 6H), 1.94-2.12 (m, 1H), 2.12-2.29 (m, 2H), 2.33 (s, 4H), 2.38-2.61 (m, 7H), 3.05-3.23 (m, 4H), 3.47 (br s, 3H), 3.53-3.62 (m, 2H), 3.62- 3.86 (m, 6H), 3.93-3.98 (m, 1H), 4.80 (t, J = 10.10 Hz, 1H), 5.15-5.23 (m, 1H), 5.32 (dd, J = 15.06, 9.66 Hz, 1H), 5.51 (dd, J = 14.93, 9.91 Hz, 1H), 6.39-6.51 (m, 4H) 153 0 LCMS (ESI, m/z), 671.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.83-0.97 (m, 6H), 1.12-1.22 (m, 2H), 1.34-1.48 (m, 1H), 1.67-1.81 (m, 1H), 1.81-1.96 (m, 4H), 2.19-2.26 (m, 2H), 2.26-2.32 (m, 3H), 2.32-2.57 (m, 3H), 3.07 (dt, J = 18.16, 5.10 Hz, 4H), 3.18-3.33 (m, 3H), 3.41 (hr s, 5H), 3.53-3.67 (m, 2H), 3.67-3.76 (m, 2H), 3.91-4.00 (m, 1H), 4.70-4.89 (m, 2H), 4.89-5.09 (m, 1H), 5.17 (d, J = 10.67 Hz, 1H), 5.23-5.37 (m, 2H), 5.40-5.55 (m, 2H), 6.37-6.48 (m, 4H) 154 LCMS (ESI, m/z), 685.4 [M + H].sup.+. .sup.1H NMR (400 MHz,CDCl.sub.3) δ 0.90 (br d, J = 6.78 Hz, 3H), 0.92-0.95 (m, 3H), 1.06-1.28 (m, 2H), 1.33-1.60 (m, 1H), 1.62 (s, 3H), 1.67-1.77 (m, 1H), 1.77- 1.80 (m, 3H), 1.80-1.90 (m, 1H), 2.20- 2.27 (m, 4H), 2.30 (hr s, 4H), 2.36-2.61 (m, 4H), 3.08 (br s, 5H), 3.31-3.53 (m, 4H), 3.53-3.73 (m, 3H), 4.29 (d, J = 6.02 Hz, 2H), 4.80 (t, J = 10.04 Hz, 1H), 4.93 (d, J = 6.02 Hz, 2H), 5.17 (d, J = 10 .54 Hz, 1H), 5.32 (dd, J = 14.93, 9.66 Hz, 1H), 5.51 (dd, J = 15.06, 9.91 Hz, 1H), 6.38- 6.49 (m, 4H) 155 LCMS (ESI, m/z), 659.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.92 (dd, J = 9.16, 6.90 Hz, 6H), 1.06-1.28 (m, 2H), 1.33-1.49 (m, 1H), 1.66-1.76 (m, 1H), 1.76-1.80 (m, 3H), 1.80-1.91 (m, 1H), 2.18-2.27 (m, 4H), 2.31 (hr s, 4H), 2.36- 2.58 (m, 5H), 3.03-3.16 (m, 4H), 3.31- 3.47 (m, 4H), 3.47-3.58 (m, 3H), 3.60- 3.74 (m, 3H), 3.83 (t, J = 5.21 Hz, 2H), 4.80 (t, J = 10.10 Hz, 1H), 5.17 (d, J = 10 .67 Hz, 1H), 5.32 (dd, J = 14.93, 9.66 Hz, 1H), 5.51 (dd, J = 15.06, 9.91 Hz, 1H), 6.38-6.48 (m, 4H) 156 LCMS (ESI, m/z), 642.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (dd, J = 6 .7 1, 3.07 Hz, 6H), 1.10-1.26 (m, 2H), 1.36-1.64 (m, 2H), 1.64-1.77 (m, 4H), 1.84 (d, J = 1.13 Hz, 3H), 2.00-2.21 (m, 3H), 2.21-2.28 (m, 4H), 2.32 (br s, 4H), 2.39-2.62 (m, 4H), 2.66-2.91 (m, 2H), 3.32-3.51 (m, 3H), 3.51-3.70 (m, 2H), 3.74-3.83 (m, 2H), 4.81 (t, J = 10.10 Hz, 1H), 5.22 (d, J = 10.67 Hz, 1H), 5.30-5.40 (m, 1H), 5.53 (dd, J = 15.06, 9.91 Hz, 1H), 6.61 (s, 1H), 6.92 (d, J = 10.79 Hz, 1H), 7.18 (s, 1H) 157 LCMS (ESI, m/z), 705.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (t, J = 6.27 Hz, 6H), 1.08-1.29 (m, 3H), 1.34-1.58 (m, 1H), 1.58-1.80 (m, 3H), 1.84 (d, J = 1.25 Hz, 5H), 2.20-2.29 (m, 4H), 2.29-2.35 (m, 3H), 2.35-2.60 (m, 4H), 2.82 (s, 3H), 2.98-3.14 (m, 2H), 3.31-3.55 (m, 4H), 3.55-3.71 (m, 1H), 3.84-3.92 (m, 2H), 4.73-4.84 (m, 2H), 5.22 (d, J = 10.54 Hz, 1H), 5.31-5.39 (m, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.62 (s, 1H), 6.92 (d, J = 10.79 Hz, 1H), 7.08 (s, 1H) 158 LCMS (ESI, m/z), 676.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.91-0.94 (m, 3H), 0.95 (br d, J = 3.51 Hz, 3H), 1.08-1.29 (m, 2H), 1.35-1.60 (m, 1H), 1.61-1.81 (m, 1H), 1.81-1.92 (m, 4H), 2.19-2.29 (m, 4H), 2.33 (hr s, 4H), 2.45- 2.69 (m, 6H), 2.73-2.95 (m, 3H), 3.12 (td, J = 8.72, 3.26 Hz, 3H), 3.33-3.55 (m, 5H), 3.57-3.76 (m, 1H), 4.81 (t, J = 10.04 Hz, 1H), 4.86-5.00 (m, 1H), 5.22 (d, J = 10.67 Hz, 1H), 5.35 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.62 (s, 1H), 6.92-7.04 (m, 1H), 7.08 (s, 1H) 159 LCMS (ESI, m/z), 602.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (dd, J = 6.71, 3.07 Hz, 6H), 1.08-1.29 (m, 2H), 1.34-1.60 (m, 1H), 1.60-1.80 (m, 1H), 1.84 (d, J = 1.13 Hz, 4H), 2.20-2.28 (m, 3H), 2.32 (br s, 4H), 2.39-2.64 (m, 4H), 3.22 (s, 3H), 3.32-3.53 (m, 4H), 3.54- 3.73 (m, 1H), 3.80 (t, J = 5.14 Hz, 2H), 4.70 (t, J = 5.14 Hz, 2H), 4.81 (t, J = 10.10 Hz, 1H), 5.23 (d, J = 10.67 Hz, 1H), 5.34 (dd, J = 15.06, 9.66 Hz, 1H), 5.53 (dd, J = 15.06, 9.91 Hz, 1H), 6.61 (s, 1H), 6.87 (d, J = 10.92 Hz, 1H), 7.17-7.20 (m, 1H) 160 LCMS (ESI, m/z), 669.9 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.99 (m, 6H), 1.10-1.25 (m, 2H), 1.38-1.67 (m, 1H), 1.67-1.90 (m, 6H), 2.09-2.26 (m, 9H), 2.27-2.40 (m, 4H), 2.42-2.63 (m, 4H), 2.89 (br t, J = 10.92 Hz, 1H), 3.24-3.51 (m, 5H), 3.67 (br dd, J = 6.90, 3.51 Hz, 1H), 4.01 (br d, J = 13.80 Hz, 1H), 4.63-4.84 (m, 3H), 5.22 (d, J = 10.54 Hz, 1H), 5.29-5.44 (m, 1H), 5.47-5.59 (m, 1H), 6.62 (s, 1H), 6.92 (d, J = 10.92 Hz, 1H), 7.07 (s, 1H) 161 LCMS (ESI, m/z), 628.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.92-0.99 (m, 6H), 1.11-1.27 (m, 5H), 1.34-1.49 (m, 2H), 1.69-1.94 (m, 4H), 2.20-2.25 (m, 4H), 2.25-2.37 (m, 4H), 2.37-2.61 (m, 3H), 3.25-3.45 (m, 4H), 3.52 (td, J = 10.95, 3.83 Hz, 1H), 3.61-3.71 (m, 1H), 3.79-3.94 (m, 1H), 3.98 (br d, J = 11.29 Hz, 1H), 4.07-4.14 (m, 1H), 4.62-4.74 (m, 1H), 4.75-4.85 (m, 2H), 5.23 (br s, 1H), 5.30-5.40 (m, 2H), 5.48- 5.59 (m, 1H), 6.61 (s, 1H), 6.90 (d, J = 10.92 Hz, 1H), 7.12 (s, 1H) 162 LCMS (ESI, m/z), 628.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.98 (m, 6H), 1.10-1.38 (m, 2H), 1.38-1.50 (m, 1H), 1.67-1.91 (m, 8H), 2.20-2.27 (m, 4H), 2.30 (hr s, 4H), 2.35-2.61 (m, 4H), 3.39-3.45 (m, 3H), 3.52 (td, J = 10.98, 3.89 Hz, 2H), 3.67 (br dd, J = 6.53, 3.39 Hz, 1H), 3.85 (dd, J = 11.04, 10.29 Hz, 1H), 3.98 (hr d, J = 11.54 Hz, 1H), 4.07-4.13 (m, 1H), 4.66 (ddd, J = 10.63, 6.31, 4.39 Hz, 1H), 4.81 (t, J = 10.04 Hz, 1H), 5.22 (d, J = 10.67 Hz, 1H), 5.35 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.61 (s, 1H), 6.89 (d, J = 10.92 Hz, 1H), 7.12 (s, 1H) 163 0 LCMS (ESI, m/z), 644.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (dd, J = 6.65, 5.14 Hz, 6H), 1.13-1.24 (m, 2H), 1.39-1.48 (m, 1H), 1.67-1.97 (m, 4H), 2.06-2.17 (m, 2H), 2.17-2.25 (m, 4H), 2.31 (br s, 4H), 2.39-2.63 (m, 5H), 3.30- 3.60 (m, 6H), 3.61-3.74 (m, 1H), 4.05- 4.26 (m, 2H), 4.35-4.44 (m, 1H), 4.44- 4.56 (m, 1H), 4.81 (t, J = 10.04 Hz, 1H), 5.22 (d, J = 10.54 Hz, 1H), 5.35 (dd, J = 15 .00 , 9.60 Hz, 1H), 5.44-5.58 (m, 1H), 6.60 (s, 1H), 6.85 (d, J = 10.29 Hz, 1H), 7.11-7.17 (m, 1H) 164 LCMS (ESI, m/z), 626.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.94 (t, J = 6.46 Hz,6H), 1.10-1.26 (m, 2H), 1.26-1.51 (m, 3H), 1.61-1.81 (m, 2H), 1.84 (d, J = 1.13 Hz, 4H), 1.94 (br d, J = 13.80 Hz, 3H), 2.00-2.22 (m, 4H), 2.23-2.32 (m, 3H), 2.37 (br s, 3H), 2.42- 2.60 (m, 3H), 3.37-3.58 (m, 4H), 3.61- 3.71 (m, 1H), 4.48-4.57 (m, 1H), 4.81 (t, J = 10.10 Hz, 1H), 5.23 (d, J = 10.67 Hz, 1H), 5.34 (dd, J = 15.06, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.98 Hz, 1H), 6.62 (s, 1H), 6.89 (d, J = 10.92 Hz, 1H), 7.09 (s, 1H) 165 LCMS (ESI, m/z), 650.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (d, J = 6.65 Hz, 6H), 1.18 (hr d, J = 8.28 Hz, 2H), 1.38-1.46 1H), 1.57-1.91 (m, 3H), 2.18-2.29 (m, 4H), 2.34 (br s, 4H), 2.42-2.59 (m, 4H), 3.31-3.56 (m, 6H), 3.61-3.71 (m, 1H), 3.84 (s, 4H), 4.80 (s, 1H), 5.21 (d, J = 10.67 Hz, 1H), 5.35 (br d, J = 9.66 Hz, 1H), 5.50 (br d, J = 9.91 Hz, 1H), 6.60 (s, 1H), 6.95 (d, J = 10.92 Hz, 1H), 7.05 (d, J = 8.91 Hz, 2H), 7.55 (d, J = 8.91 Hz, 2H) 166 LCMS (ESI, m/z), 664.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.88-0.93 (m, 6H), 1.15-1.22 (m, 2H), 1.37-1.45 (m, 2H), 1.70-1.74 (m, 5H), 1.81-1.91 (m, 2H), 2.22-2.28 (m, 3H), 2.28-2.40 (m, 4H), 2.41-2.63 (m, 3H), 3.34-3.53 (m, 4H), 3.61-3.68 (m, 1H), 3.70 (s, 4H), 4.80 (s, 1H), 5.14-5.20 (m, 1H), 5.28- 5.38 (m, 1H), 5.46-5.55 (m, 1H), 5.68 (d, J = 2.13 Hz, 2H),6.79 (d, J = 8.78 Hz, 2H), 6.83-6.90 (m, 2H), 7.10-7.17 (m, 2H) 264 LC/MS (ESI, m/z), 631.4 [M + H].sup.+. .sup.1H NMR (400 MHz, CHCl.sub.3-d): δ ppm 0.85 -1.16 (m, 2H) 1.23-1.52 (m, 1H) 1.57- 1.77 (m, 1H) 1.87 (s, 1H) 1.92-2.13 (1H, 1 H) 2.35-2.55 (m, 1H) 2.50-2.74 (m, 1H) 3.11 (br s, 1H) 3.36-3.54 (m, 2H) 3.64 (br d, J = 10.42 Hz, 2H) 3.77- 3.90 (m, 1 H) 4.76 (hr s, 4 H) 5.07-5.19 (m, 1H) 5.38-5.68 (m, 1H) 6.40-6.76 (m, 1H) 8.02-8.66 (m, 1H).

(111) Compounds 167-196 (Tables 5, 6, 8, 10, 12, and 14) and intermediates thereof (Tables 4, 7, 9, 11, and 13) were prepared by the following general methods of Procedures 20-29.

(112) Synthesis of Boronate Intermediates:

(113) Procedure 20.

(114) ##STR00225##

(115) A solution of 3-fluoro-5-iodoaniline (250 mg, 1.055 mmol) and dihydro-2H-pyran-4(3H)-one (264 mg, 2.637 mmol) in methanol (5 mL) was charged into a 25 mL round bottom flask with a magnetic stir bar. Acetic acid (0.121 mL, 2.11 mmol) was added and the resulting solution was stirred for 30 minutes at room temperature. Sodium cyanoborohydride (133 mg, 2.11 mmol) was added, the resulting solution was stirred overnight at room temperature. The reaction was quenched with 10 mL 1M aqueous NaOH, stirred for 15 minutes. The solution was extracted with EtOAc (3×15 mL), the combined organic layers were washed with brine (15 mL), dried with MgSO.sub.4, filtered, and evaporated under vaccuum. The crude product was dry loaded onto 3 g. silica and purified by column chromatography (ISCO normal phase, 24 g. gold column, 0-60% EtOAc/hexanes gradient) to isolate N-(3-fluoro-5-iodophenyl)tetrahydro-2H-pyran-4-amine (047) (208 mg, 0.648 mmol, 61%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.41-1.55 (m, 2H) 1.95-2.09 (m, 2H) 3.38-3.48 (m, 1H) 3.53 (td, J=11.61, 2.13 Hz, 2H) 3.65-3.80 (m, 1H) 4.02 (br d, J=11.54 Hz, 2H) 6.20-6.30 (m, 1H) 6.73 (br d, J=1.76 Hz, 2H). LCMS: 322.6 [M+H].sup.+.

(116) Procedure 21.

(117) ##STR00226##

(118) A solution of N-(3-fluoro-5-iodophenyl)tetrahydro-2H-pyran-4-amine (047) (208 mg, 0.648 mmol) in acetonitrile (4 mL) was charged into a 10 mL vial with a magnetic stir bar. Cesium carbonate (422 mg, 1.295 mmol) and iodomethane (0.203 mL, 3.239 mmol) were added. The vial was sealed and heated to 80° C. with stirring overnight. The reaction was cooled to room temperature. The solids were filtered off, washed with 20 mL EtOAc, and solvents evaporated under vacuum. The crude material was dry loaded onto 3 g. silica and purified by column chromatography (ISCO normal phase, 24 g. gold column, 0-60% EtOAc/hexanes gradient) to isolate N-(3-fluoro-5-iodophenyl)-N-methyltetrahydro-2H-pyran-4-amine (048) (143 mg, 0.427 mmol, 66%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.62-1.72 (m, 2H) 1.80-1.94 (m, 2H) 2.79 (s, 3H) 3.46-3.56 (m, 2H) 3.68-3.78 (m, 1H) 4.05-4.14 (m, 2H) 6.38-6.47 (m, 1H) 6.74-6.81 (m, 1H) 6.85-6.90 (m, 1H). LCMS: 336.1 [M+H].sup.+.

(119) Procedure 22.

(120) ##STR00227##

(121) Bis(pinacolato)diboron (130 mg, 0.512 mmol), potassium acetate (126 mg, 1.28 mmol) and Pd(dppf)Cl.sub.2 (38.8 mg, 0.043 mmol) were charged into a 10 mL vial with a magnetic stir bar. A solution of N-(3-fluoro-5-iodophenyl)-N-methyltetrahydro-2H-pyran-4-amine (048) (143 mg, 0.427 mmol) in DMF (4 mL) was added. The vial was sealed and heated to 100° C. and stirred for 20 hours. The vial was cooled to room temperature, diluted with 5 mL EtOAc, filtered through a plug of celite, washed with 10 mL EtOAc, and evaporated under vacuum. The crude material was dry loaded onto a 2 g. silica column and purified by column chromatography (ISCO normal phase, 12 g. gold column, 0-50% EtOAc/hexanes gradient) to obtain N-(3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-N-methyltetrahydro-2H-pyran-4-amine (049) (82 mg, 0.245 mmol, 57%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.33-1.40 (m, 12H) 1.64-1.73 (m, 2H) 1.80-1.94 (m, 2H) 2.79-2.85 (m, 3H) 3.48-3.61 (m, 2H) 3.79-3.90 (m, 1H) 4.04-4.13 (m, 2H) 6.54-6.63 (m, 1H) 6.82-6.89 (m, 1H) 6.98-7.04 (m, 1H). LCMS: 336.3 [M+H].sup.+.

(122) The following intermediates were also synthesized according to the general methods of Procedures 20-22.

(123) TABLE-US-00006 TABLE 6 Characterization of intermediates synthesized according to Procedures 20-22 Intermediate Characterization .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 3.16-3.21 (m, 1 H) 4.49-4.54 (m, 2 H) 4.81-4.86 (m, 1 H) 5.01 (t, J = 6.53 Hz, 2 H) 6.12-6.18 (m, 1 H) 6.62- 6.66 (m, 1 H) 6.81-6.86 (m, 1 H). LCMS: 294.1 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.41-1.55 (m, 2 H) 1.98-2.09 (m, 2 H) 3.42-3.62 (m, 4 H) 3.97-4.07 (m, 2 H) 6.54- 6.60 (m, 1 H) 6.85-6.92 (m, 1 H) 6.94-6.99 (m, 1 H) 7.00-7.07 (m, 1 H). LCMS: 304.1 [M + H].sup.+. 0 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 4.10-4.24 (m, 1 H) 4.52 (s, 2 H) 4.57-4.65 (m, 1 H) 5.01 (t, J = 6.65 Hz, 2 H) 6.43- 6.51 (m, 1 H) 6.82-6.87 (m, 1 H) 6.88-6.94 (m, 1 H) 7.08-7.15 (m, 1 H). LCMS: 276.1 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 2.10-2.26 (m, 2 H) 2.36-2.55 (m, 2 H) 3.04-3.28 (m, 4 H) 3.46-3.65 (m, 1 H) 3.69- 3.89 (m, 1 H) 6.27 (d, J = 11.04 Hz, 1 H) 6.74 (s, 1 H) 6.79-6.89 (m, 1 H). LCMS: 370.1 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.31-1.40 (m, 2 H) 1.49 (s, 9 H) 1.96-2.06 (m, 2 H) 2.87- 3.02 (m, 2 H) 3.31-3.45 (m, 1 H) 3.65-3.80 (m, 1 H) 3.99-4.12 (m, 2 H) 6.25 (br d, J = 11.29 Hz, 1 H) 6.72 (s, 1 H) 6.74- 6.79 (m, 1 H). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.50-1.66 (m, 2 H) 2.16 (br dd, J = 13.24, 3.45 Hz, 2 H) 2.84 (s, 3 H) 2.87-2.97 (m, 2 H) 3.30-3.43 (m, 1 H) 3.72 (br d, J = 2.13 Hz, 1 H) 3.75-3.85 (m, 2 H) 6.25 (dt, J = 11.17, 2.13 Hz, 1 H) 6.73 (s, 1 H) 6.75-6.82 (m, 1 H). LCMS: 399.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.18 (br dd, J = 12.30, 3.14 Hz, 2 H) 1.48 (s, 9 H) 1.64-1.82 (m, 3 H) 2.72 (br t, J = 12.36 Hz, 2 H) 3.00 (d, J = 6.27 Hz, 2 H) 4.15 (q, J = 7.07 Hz, 3 H) 6.27 (br d, J = 11.17 Hz, 1 H) 6.70-6.80 (m, 2 H). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 2.97 (s, 3 H) 4.66-4.79 (m, 3 H) 4.88 (d, J = 6.40 Hz, 2H) 6.23-6.29 (m, 1 H) 6.71- 6.76 (m, 1 H) 6.82-6.90 (m, 1 H). LCMS: 308.1 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.63-1.74 (m, 2 H) 1.80-1.93 (m, 2 H) 2.79 (s, 3 H) 3.44-4.31 (m, 2 H) 3.51 (d, J = 1.88 Hz, 1 H) 3.72-3.84 (m, 1 H) 4.04-4.13 (m, 1 H) 6.74-6.81 (m, 1 H) 6.91- 6.99 (m, 1 H) 7.04-7.09 (m, 1 H) 7.10-7.16 (m, 1 H). LCMS: 318.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 2.94 (s, 3 H) 4.63-4.72 (m, 1 H) 4.72-4.78 (m, 2 H) 4.81- 4.92 (m, 2 H) 6.53-6.64 (m, 1 H) 6.90-7.02 (m, 2 H) 7.12-7.19 (m, 1 H). LCMS: 290.3 [M + H].sup.+. LCMS: 384.1 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.50 (s, 9 H) 1.60-1.78 (m, 4 H) 2.76 (s, 3 H) 2.77-2.88 (m, 2 H) 3.58-3.70 (m, 1 H) 4.18-4.37 (m, 2 H) 6.38-6.47 (m, 1 H) 6.76- 6.82 (m, 1 H) 6.85-6.90 (m, 1 H). 0 LCMS: 413.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.18 (t, J = 7.03 Hz, 3 H) 1.80-1.98 (m, 4 H) 2.73-2.83 (m, 2 H) 2.85 (s, 3 H) 3.27 (q, J = 7.07 Hz, 2 H) 3.54- 3.67 (m, 1 H) 3.93-4.03 (m, 2 H) 6.37 (dt, J = 12.89, 2.02 Hz, 1 H) 6.78 (br d, J = 7.53 Hz, 1 H) 6.81 (s, 1 H). LCMS: 427.7 [M + H].sup.+. LCMS: 441.8 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.08-1.24 (m, 2 H) 1.48 (s, 9 H) 1.66 (br d, J = 14.56 Hz, 2 H) 1.87 (ddd, J = 11.45, 7.69, 3.83 Hz, 1 H) 2.67 (br t, J = 12.61 Hz, 2 H) 2.96 (s, 3 H) 3.17 (d, J = 7.28 Hz, 2 H) 4.15 (m, 2 H) 6.31 (dt, J = 12.67, 2.26 Hz, 1 H) 6.73-6.80 (m, 2 H). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.36 (s, 12 H) 2.95-2.99 (m, 3 H) 4.72-4.82 (m, 3 H) 4.85- 4.95 (m, 2 H) 6.35-6.46 (m, 1 H) 6.84-6.89 (m, 1 H) 6.91-6.97 (m, 1 H). LCMS: 308.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.37 (s, 12 H) 1.64-1.75 (m, 2 H) 1.80-1.94 (m, 2 H) 2.83 (s, 3 H) 3.46-3.61 (m, 2 H) 3.79-3.91 (m, 1 H) 4.04-4.11 (m, 2 H) 6.92- 6.99 (m, 1 H) 7.19-7.28 (m, 2 H) 7.29-7.31 (m, 1 H). LCMS: 318.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.36 (s, 12 H) 2.93-2.96 (m, 3 H) 4.71-4.79 (m, 3 H) 4.86- 4.92 (m, 2 H) 6.73-6.79 (m, 1 H) 7.11-7.17 (m, 1 H) 7.23-7.28 (m, 1 H) 7.29-7.34 (m, 1 H). LCMS: 290.8 [M + H].sup.+.

(124) Synthesis of Boronate Coupling Products:

(125) Procedure 23.

(126) ##STR00247##

(127) A solution of iodide (008) (39 mg, 0.073 mmol) and (3-chloro-5-fluorophenyl)boronic acid (15.27 mg, 0.088 mmol) in 1,4-dioxane (1.0 ml) was charged into a 4 mL vial with a magnetic stir bar. The vial was de-gassed with argon for 5 minutes. Silver(I) oxide (50.7 mg, 0.219 mmol) and palladium tetrakis (8.43 mg., 0.007 mmol) were added, heated to 80° C., and stirred for 1 hour. The solution was cooled to room temperature, filtered through a plug of celite, washed with 15 mL EtOAc, and concentrated under vacuum. The crude material was dry loaded onto 1 g. silica and purified by column chromatography (ISCO normal phase, 12 g. gold column, 0-20% MeOH/DCM gradient) to provide the product Example 167 (15.2 mg, 0.028 mmol, 39% yield).

(128) Procedure 24.

(129) ##STR00248##

(130) A solution of iodide (008) (30 mg, 0.056 mmol) and N-(3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-diox aborolan-2-yl)phenyl)-N-methyltetrahydro-2H-pyran-4-amine (049) (28.2 mg, 0.084 mmol) in 1,4-dioxane (1.0 mL) was charged into a 4 mL vial with a magnetic stir bar. The solution was degassed for 5 minutes. silver(I) oxide (39.0 mg, 0.168 mmol) and palladium tetrakis (6.49 mg, 0.0056 mmol) were added. The resulting dispersion was heated to 80° C. and stirred for 3 hours. The vial was cooled to room temperature, filtered through a plug of celite, washed with 15 mL EtOAc, and concentrated under vacuum. The crude product was purified by reverse phase chromatography (MeCN/H.sub.2O w/0.1% formic acid) and lyophilized, yielding Example 168 (2.3 mg, 0.0037 mmol, 7%).

(131) Compounds 167-171 were synthesized according to the general methods of Procedures 23 and 24:

(132) TABLE-US-00007 TABLE 7 Characterization of Compounds 167-171 Ex. Structure and IUPAC Chemical Name Characterization 167 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.02 (dd, J = 10.04, 6.78 Hz, 6 H) 1.30-1.36 (m, 1 H) 1.45-1.56 (m, 2 H) 1.76-1.87 (m, 1 H) 1.89 (d, J = 1.25 Hz, 3 H) 1.95 (br dd, J = 7.34, 3.45 Hz, 1 H) 2.32 (s, 3 H) 2.38 (br s, 4 H) 2.51-2.72 (m, 3 H) 3.30-3.40 (m, 1 H) 3.51 (br s, 4 H) 3.76 (br s, 1 H) 4.91 (t, J = 10.10 Hz, 1 H) 5.27 (d, J = 10.67 Hz, 1 H) 5.43 (dd, J = 15.06, 9.66 Hz, 1 H) 5.61 (dd, J = 15.00, 9.85 Hz, 1 H) 6.51 (s, 1 H) 6.90 (d, J = 9.41 Hz, 1 H) 7.00 (dt, J = 8.41, 2.07 Hz, 1 H) 7.07 (s, 1 H). LCMS: 538.5 [M + H].sup.+ 168 0 .sup.1H NMR (400 MHz, DMSO- d.sub.6) δ ppm 0.90 (dd, J = 6.71, 2.45 Hz, 6 H) 1.19-1.34 (m, 3 H) 1.42-1.60 (m, 4 H) 1.66- 1.78 (m, 2 H) 1.84 (d, J = 1.00 Hz, 4 H) 2.17 (s, 3 H) 2.20-2.38 (m, 5 H) 2.73 (s, 3 H) 3.29 (s, 2 H) 3.34-3.40 (m, 3 H) 3.47 (br t, J = 11.11 Hz, 2 H) 3.68-3.78 (m, 1 H) 3.84- 3.97 (m, 3 H) 4.61 (d, J = 5.02 Hz, 1 H) 4.70 (t, J = 9.41 Hz, 1 H) 5.01 (d, J = 10.29 Hz, 1 H) 5.35-5.56 (m, 2 H) 6.34-6.42 (m, 1 H) 6.45-6.52 (m, 2 H) 6.52-6.58 (m, 1 H). LCMS: 616.6 [M + H].sup.+ 169 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.91 (t, J = 6.53 Hz, 6 H) 1.12-1.23 (m, 3 H) 1.37- 1.45 (m, 2 H) 1.67-1.76 (m, 3 H) 1.68-1.74 (m, 2 H) 1.78 (d, J = 1.25 Hz, 3 H) 1.81- 1.91 (m, 1 H) 2.43-2.50 (m, 4 H) 2.51-2.60 (m, 2 H) 2.85 (s, 3 H) 3.57-3.69 (m, 4 H) 4.53-4.63 (m, 1 H) 4.66 (t, J = 6.27 Hz, 2 H) 4.73-4.85 (m, 3 H) 5.17 (d, J = 10.54 Hz, 1 H) 5.25-5.36 (m, 1 H) 5.52 (dd, J = 14.93, 10.04 Hz, 1 H) 6.08-6.17 (m, 2 H) 6.36 (d, J = 9.03 Hz, 1 H) 6.40 (s, 1 H). LCMS: 588.6 [M + H].sup.+ 170 .sup.1H NMR (400 MHz, DMSO- d.sub.6) δ ppm 0.83 (d, J = 6.65 Hz, 6 H) 1.08-1.29 (m, 3 H) 1.33-1.52 (m, 5 H) 1.63-1.70 (m, 2 H) 1.76 (d, J = 1.13 Hz, 4 H) 2.09 (s, 5 H) 2.20-2.30 (m, 2 H) 2.46-2.56 (m, 2 H) 2.65 (s, 3 H) 3.32-3.43 (m, 3 H) 3.57-3.70 (m, 1 H) 3.74- 3.90 (m, 3 H) 4.53 (d, J = 5.15 Hz, 1 H) 4.62 (d, J = 9.54 Hz, 1 H) 4.58-4.71 (m, 1 H) 4.93 (d, J = 3.01 Hz, 1 H) 5.27- 5.45 (m, 3 H) 6.41 (s, 1 H) 6.55 (d, J = 8.03 Hz, 1 H) 6.62 (s, 1 H) 6.68 (dd, J = 8.53, 2.26 Hz, 1 H) 7.09 (t, J = 7.91 Hz, 1 H). LCMS: 598.7 [M + H].sup.+ 171 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.02 (t, J = 7.22 Hz, 6 H) 1.24-1.31 (m, 2 H) 1.45- 1.55 (m, 3 H) 1.77-1.86 (m, 1 H) 1.90 (d, J = 1.13 Hz, 3 H) 1.93-2.00 (m, 1 H) 2.27-2.46 (m, 6 H) 2.53-2.70 (m, 3 H) 2.92 (s, 3 H) 3.40-3.60 (m, 4 H) 3.67-3.81 (m, 1 H) 4.60- 4.70 (m, 1 H) 4.76 (t, J = 6.15 Hz, 2 H) 4.83-5.03 (m, 3 H) 5.30 (d, J = 10.67 Hz, 1 H) 5.42 (dd, J = 15.00, 9.85 Hz, 1 H) 5.63 (dd, J = 14.81, 10.16 Hz, 1 H) 6.55 (d, J = 7.03 Hz, 3 H) 6.79 (d, J = 7.65 Hz, 1 H) 7.19-7.26 (m, 1 H). LCMS: 570.6 [M + H].sup.+

(133) Procedure 25.

(134) ##STR00254##

(135) A solution of Boronate 1 (11 mg, 0.021 mmol) and 4-((3-fluoro-5-iodophenyl)(methyl)amino)tetrahydro-2H-thiopyran 1,1-dioxide (11.83 mg, 0.031 mmol)) in 1,4-dioxane (1.0 mL) was charged into a 4 mL vial with a magnetic stir bar. The solution was degassed for 5 minutes. Silver(I) oxide (14.31 mg, 0.062 mmol) and palladium tetrakis (2.38 mg, 0.0021 mmol) were added. The resulting dispersion was heated to 80° C. and stirred for 3 hours. The vial was cooled to room temperature, filtered through a plug of celite, washed with 15 mL EtOAc, and concentrated under vacuum. The crude product was purified by reverse phase chromatography (MeCN/H.sub.2O w/0.1% formic acid) and lyophilized to obtain Example 172 (5.1 mg, 0.0077 mmol, 37%).

(136) Compounds172-176 were synthesized according to the general methods of Procedure 25:

(137) TABLE-US-00008 TABLE 8 Characterization of Compounds 172-176 Ex. Structure and IUPAC Chemical Name Characterization 172 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.96-1.08 (m, 6 H) 1.19-1.34 (m, 2 H) 1.43-1.52 (m, 1 H) 1.71-1.88 (m, 2 H) 1.90 (d, J =1.00 Hz, 3 H) 1.92- 2.02 (m, 1 H) 2.06-2.18 (m, 2 H) 2.25-2.75 (m, 12 H) 2.82 (s, 3 H) 3.10-3.24 (m, 4 H) 3.28-3.45 (m, 1 H) 3.45-3.68 (m, 3 H) 3.68-3.88 (m, 2 H) 4.83- 4.96 (m, 1 H) 5.20-5.34 (m, 1 H) 5.35-5.49 (m, 1 H) 5.54-5.68 (m, 1 H) 6.31-6.59 (m, 4 H). LCMS: 664.6 [M + H].sup.+ 173 LCMS: 679.6 [M +H].sup.+ 174 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.02 (t, J = 7.40 Hz, 6 H) 1.24- 1.32 (m, 2 H) 1.46-1.53 (m, 2 H) 1.84-1.89 (m, 3 H) 1.90 (s, 4 H) 1.93- 1.96 (m, 1 H) 2.30-2.47 (m, 5 H) 2.52-2.72 (m, 5 H) 2.80 (s, 5 H) 2.85 (s, 3 H) 3.33-3.42 (m, 1 H) 3.47-3.60 (m, 3 H) 3.61-3.81 (m, 3 H) 3.98 (br d, J = 10.54 Hz, 2 H) 4.91 (t, J = 9.79 Hz, 1 H) 5.28 (d, J = 10.54 Hz, 1 H) 5.42 (dd, J = 15.18, 9.41 Hz, 1 H) 5.62 (dd, J = 14.74, 9.60 Hz, 1 H) 6.35-6.47 (m, 3 H) 6.53 (s, 1 H). LCMS: 693.7 [M + H].sup.+ 175 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.91 (dd, J = 8.85, 6.84 Hz, 6 H) 1.08 (t, J = 7.03 Hz, 3 H) 1.13-1.22 (m, 2 H) 1.35- 1.46 (m, 2 H) 1.64-1.79 (m, 5 H) 1.79-1.89 (m, 6 H) 2.32 (br dd, J = 3.58, 1.57 Hz, 3 H) 2.41-2.61 (m, 5 H) 2.69 (br d, J = 11.04 Hz, 2 H) 2.74 (s, 3 H) 3.18 (q, J = 7.07 Hz, 2 H) 3.40-3.59 (m, 5 H) 3.61-3.71 (m, 1 H) 3.82- 3.92 (m, 2 H) 4.81 (t, J = 10.04 Hz, 1 H) 5.18 (d, J = 10.54 Hz, 1 H) 5.31 (dd, J = 15.25, 9.47 Hz, 1 H) 5.52 (dd, J = 14.93, 10.04 Hz, 1 H) 6.19-6.33 (m, 3 H) 6.41 (s, 1 H). LCMS: 707.5 [M + H].sup.+ 176 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 6.46 Hz, 6 H) 1.12 (d, J = 6.65 Hz, 6 H) 1.15- 1.22 (m, 2 H) 1.35-1.44 (m, 2 H) 1.65-1.79 (m, 4 H) 1.81 (d, J = 1.13 Hz, 3 H) 1.82-1.90 (m, 2 H) 2.33-2.60 (m, 8 H) 2.68 (s, 3 H) 2.72 (s, 3 H) 3.23-3.33 (m, 2 H) 3.46- 3.71 (m, 6 H) 3.76 (br d, J = 11.29 Hz, 2 H) 4.81 (t, J = 10.10 Hz, 1 H) 5.18 (d, J = 10.79 Hz, 1 H) 5.31 (dd, J = 14.93, 9.66 Hz, 1 H) 5.52 (dd, J = 15.00, 9.98 Hz, 1 H) 6.34-6.56 (m, 4 H). LCMS: 721.7 [M + H].sup.+

(138) Synthesis of Piperidine Intermediates:

(139) Procedure 26.

(140) ##STR00260##

(141) Step 1: A solution of tert-butyl 4-((3-fluoro-5-iodophenyl)(methyl)amino)piperidine-1-carboxylate (590 mg, 1.359 mmol) in methanol (15 mL, 370.765 mmol) was charged into a 50 mL round bottom flask with a magnetic stir bar. HCl (4.0M in dioxane, 1.698 mL, 6.793 mmol) was added, the resulting solution was stirred overnight at room temperature. Solvents were evaporated under vacuum to obtain N-(3-fluoro-5-iodophenyl)-N-methylpiperidin-4-amine HCl (050) (500 mg, 1.349 mmol, 99%). LCMS: 335.1 [M+H].sup.+.

(142) Step 2: A solution of N-(3-fluoro-5-iodophenyl)-N-methylpiperidin-4-amine HCl (050) (50 mg, 0.135 mmol) in dichloromethane (2 mL) was charged into a 5 mL vial with a magnetic stir bar. N-ethyl-N-isopropylpropan-2-amine (0.059 mL, 0.337 mmol) was added then acetyl chloride (0.014 mL, 0.202 mmol). The resulting solution was stirred overnight at room temperature. The solution was partitioned between water (10 mL) and DCM (10 mL), extracted with DCM (3×10 mL), and the combined organic layers were washed with water (10 mL), dried with MgSO4, filtered and evaporated under vacuum. The crude product was dry loaded onto 2 g silica and purified by column chromatography (ISCO normal phase, 24 g. gold column, 0-100% EtOAc/hexanes gradient) to obtain 1-(4-((3-fluoro-5-iodophenyl)(methyl)amino)piperidin-1-yl)ethan-1-one (051) (24 mg, 0.064 mmol, 47%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.61-1.73 (m, 2H) 1.74-1.90 (m, 2H) 2.15 (s, 3H) 2.62 (td, J=12.77, 2.45 Hz, 1H) 2.75 (s, 3H) 3.11-3.24 (m, 1H) 3.63-3.80 (m, 1H) 3.95 (br dd, J=13.55, 2.38 Hz, 1H) 4.76-4.87 (m, 1H) 6.44 (dt, J=12.58, 2.18 Hz, 1H) 6.82 (dt, J=7.53, 1.69 Hz, 1H) 6.89 (s, 1H). LCMS: 377.2 [M+H].sup.+.

(143) The following intermediates were also synthesized according to the general methods in Procedure 26:

(144) TABLE-US-00009 TABLE 9 Characterization of intermediates synthesized according to Procedure 26 Intermediate Characterization Carried forward without further purification. LCMS: 349.0 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.19 (t, J = 7.47 Hz, 3 H) 1.59-1.72 (m, 2 H) 1.73-1.89 (m, 2 H) 2.40 (q, J = 7.40 Hz, 2 H) 2.52-2.68 (m, 1 H) 2.75 (s, 3 H) 3.13 (br t, J = 13.05 Hz, 1 H) 3.62-3.79 (m, 1 H) 3.92-4.10 (m, 1 H) 4.77-4.95 (m, 1 H) 6.44 (br d, J = 12.55 Hz, 1 H) 6.81 (d, J = 7.65 Hz, 1 H) 6.89 (s, 1 H). LCMS: 391.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.69 (qd, J = 12.42, 4.39 Hz, 2 H) 1.76-1.88 (m, 2 H) 2.67 (br t, J = 12.42 Hz, 1 H) 2.75 (s, 3 H) 3.12 (br s, 1 H) 3.47 (s, 3 H) 3.66-3.81 (m, 1 H) 4.01-4.22 (m, 3 H) 4.78 (br d, J = 13.30 Hz, 1 H) 6.43 (dt, J = 12.58, 2.24 Hz, 1 H) 6.77-6.84 (m, 1 H) 6.88 (s, 1 H). LCMS: 407.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.64-1.97 (m, 4 H) 2.79 (s, 3 H) 2.83-3.26 (m, 2 H) 3.68-3.83 (m, 1 H) 3.84-4.05 (m, 1 H) 4.78-5.05 (m, 1 H) 6.46 (br d, J = 12.55 Hz, 1 H) 6.83 (d, J = 7.53 Hz, 1 H) 6.91 (s, 1 H) 7.45 (s, 5 H). LCMS: 439.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.68-1.83 (m, 2 H) 1.85-1.96 (m, 2 H) 2.76 (s, 3 H) 2.86 (br t, J = 12.30 Hz, 1 H) 3.17-3.33 (m, 1 H) 3.73- 3.87 (m, 1 H) 4.17 (br dd, J = 13.87, 1.94 Hz, 1 H) 4.74 (ddt, J = 13.52, 4.39, 2.34, 2.34 Hz, 1 H) 6.44 (d, J = 12.42 Hz, 1 H) 6.79-6.87 (m, 1 H) 6.89 (s, 1 H). LCMS: 431.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.10 (t, J = 7.47 Hz, 3 H) 1.77-1.96 (m, 6 H) 2.78 (s, 3 H) 2.84-2.98 (m, 4 H) 3.56-3.67 (m, 1 H) 3.98 (dt, J = 12.45, 2.12 Hz, 2 H) 6.41 (dt, J = 12.61, 2.16 Hz, 1 H) 6.80 (dt, J = 7.53, 1.69 Hz, 1 H) 6.86 (s, 1 H). LCMS: 441.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.59-1.73 (m, 2 H) 1.77-1.94 (m, 6 H) 1.98-2.08 (m, 4 H) 2.78 (s, 3 H) 2.88-3.01 (m, 2 H) 3.47 (quin, J = 8.16 Hz, 1 H) 3.55-3.68 (m, 1 H) 4.00 (dt, J = 12.61, 2.16 Hz, 2 H) 6.42 (dt, J = 12.55, 2.26 Hz, 1 H) 6.78-6.83 (m, 1 H) 6.87 (s, 1 H). LCMS: 467.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.72-1.82 (m, 2 H) 1.92 (qd, J = 12.36, 4.20 Hz, 2 H) 2.69-2.82 (m, 5 H) 3.50 (tt, J = 11.75, 3.87 Hz, 1 H) 3.81 (s, 3 H) 4.03 (dt, J = 12.20, 2.12 Hz, 2 H) 6.36 (dt, J = 12.67, 2.26 Hz, 1 H) 6.75-6.79 (m, 1 H) 6.82 (s, 1 H) 7.48 (d, J = 1.38 Hz, 1 H) 7.55 (d, J = 1.13 Hz, 1 H). LCMS: 479.2 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.73-1.82 (m, 2 H) 1.91 (qd, J = 12.36, 4.33 Hz, 2 H) 2.39 (td, J = 12.14, 2.57 Hz, 2 H) 2.75 (s, 3 H) 3.42 (tt, J = 11.70, 3.86 Hz, 1 H) 3.99 (dt, J = 11.89, 2.15 Hz, 2 H) 6.34 (dt, J = 12.55, 2.26 Hz, 1 H) 6.73-6.82 (m, 2 H) 7.55-7.63 (m, 2 H) 7.64-7.71 (m, 1 H) 7.78-7.85 (m, 2 H). LCMS: 475.1 [M + H].sup.+. 0 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.09-1.25 (m, 2 H) 1.74 (br s, 2 H) 1.97 (ddd, J = 11.48, 7.72, 4.02 Hz, 1 H) 2.11 (s, 3 H) 2.52 (br t, J = 11.98 Hz, 1 H) 2.96 (s, 3 H) 2.98- 3.13 (m, 1 H) 3.18 (d, J = 7.28 Hz, 2 H) 3.86 (br d, J = 13.43 Hz, 1 H) 4.69 (br d, J = 12.42 Hz, 1 H) 6.30 (dt, J = 12.67, 2.26 Hz, 1 H) 6.73- 6.81 (m, 2 H). LCMS: 391.0 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.33-1.49 (m, 2 H) 1.73-1.92 (m, 3 H) 2.64 (td, J = 12.11, 2.38 Hz, 2 H) 2.79 (s, 3 H) 2.97 (s, 3 H) 3.21 (d, J = 7.03 Hz, 2 H) 3.80-3.94 (m, 2 H) 6.30 (dt, J =12.52, 2.21 Hz, 1 H) 6.71-6.80 (m, 2 H). LCMS: 427.0 [M + H].sup.+.

(145) Compounds 177-187 were generated from the above intermediates using the general methods of Procedures 23, 24, and 25:

(146) TABLE-US-00010 TABLE 10 Characterization of Compounds 177-187 Ex. Structure and IUPAC Chemical Name Characterization 177 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 6.59 Hz, 6 H) 1.15-1.21 (m, 2 H) 1.37-1.43 (m, 2 H) 1.51- 1.65 (m, 4 H) 1.66-1.77 (m, 4 H) 1.80 (d, J = 1.00 Hz, 3 H) 1.83- 1.91 (m, 1 H) 2.05 (s, 3 H) 2.21- 2.38 (m, 4 H) 2.42-2.60 (m, 6 H) 2.66 (s, 3 H) 3.01-3.14 (m, 1 H) 3.29 (br d, J = 10.29 Hz, 1 H) 3.59-3.74 (m, 3 H) 3.80-3.90 (m, 1 H) 4.71 (br dd, J = 14.93, 2.64 Hz, 1 H) 4.81 (t, J = 10.16 Hz, 1 H) 5.18 (d, J = 10.67 Hz, 1 H) 5.31 (dd, J = 15.06, 9.79 Hz, 1 H) 5.52 (dd, J = 15.00, 10.10 Hz, 1 H) 6.24-6.35 (m, 3 H) 6.43 (s, 1 H). LCMS: 657.5 [M + H].sup.+ 178 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.91 (t, J = 6.96 Hz, 6 H) 1.09 (t, J = 7.47 Hz, 3 H) 1.13-1.22 (m, 2 H) 1.34-1.46 (m, 2 H) 1.57-1.63 (m, 2 H) 1.64-1.76 (m, 4 H) 1.80 (d, J = 1.13 Hz, 3 H) 1.82-1.90 (m, 1 H) 2.30 (br d, J = 7.40 Hz, 7 H) 2.41-2.60 (m, 6 H) 2.66 (s, 3 H) 2.97-3.09 (m, 1 H) 3.38-3.58 (m, 3 H) 3.58-3.73 (m, 2 H) 3.85-3.95 (m, 1 H) 4.73 (br dd, J = 13.18, 2.13 Hz, 1 H) 4.80 (t, J = 10.04 Hz, 1 H) 5.18 (d, J = 10.67 Hz, 1 H) 5.31 (dd, J = 14.93, 9.66 Hz, 1 H) 5.52 (dd, J = 14.93, 10.04 Hz, 1 H) 6.25-6.34 (m, 3 H) 6.42 (s, 1 H). LCMS: 671.6 [M + H].sup.+ 179 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 6.90 Hz, 6 H) 1.17 (br s, 2 H) 1.37-1.45 (m, 2 H) 1.56- 1.65 (m, 4 H) 1.67-1.77 (m, 4 H) 1.80 (d, J = 1.00 Hz, 3 H) 1.82- 1.91 (m, 1 H) 2.29-2.35 (m, 2 H) 2.43-2.61 (m, 6 H) 2.66 (s, 3 H) 2.93-3.10 (m, 1 H) 3.37 (s, 3 H) 3.38-3.59 (m, 3 H) 3.59-3.76 (m, 3 H) 3.87-3.97 (m, 1 H) 3.98-4.13 (m, 2 H) 4.63-4.72 (m, 1 H) 4.81 (t, J = 10.10 Hz, 1 H) 5.18 (d, J = 10.67 Hz, 1 H) 5.32 (dd, J = 15.00, 9.47 Hz, 1 H) 5.52 (dd, J = 15.12, 9.98 Hz, 1 H) 6.25-6.34 (m, 3 H) 6.43 (s, 1 H). LCMS: 687.6 [M + H].sup.+ 180 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 7.47 Hz, 6 H) 1.12-1.23 (m, 2 H) 1.35-1.46 (m, 2 H) 1.55- 1.77 (m, 6 H) 1.80 (s, 3 H) 1.82- 1.92 (m, 1 H) 2.18-2.41 (m, 6 H) 2.41-2.63 (m, 4 H) 2.70 (s, 3 H) 2.94-3.11 (m, 1 H) 3.20-3.34 (m, 1 H) 3.35-3.55 (m, 3 H) 3.60-3.92 (m, 3 H) 4.81 (t, J = 10.04 Hz, 2 H) 5.18 (d, J = 10.54 Hz, 1 H) 5.31 (dd, J = 15.12, 9.60 Hz, 1 H) 5.52 (dd, J = 15.06, 10.16 Hz, 1 H) 6.25-6.35 (m, 3 H) 6.43 (s, 1 H) 7.34 (s, 5 H). LCMS: 719.8 [M + H].sup.+ 181 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 6.96 Hz, 6 H) 1.14-1.24 (m, 2 H) 1.37-1.46 (m, 1 H) 1.64- 1.75 (m, 4 H) 1.80 (d, J = 1.25 Hz, 5 H) 1.84-1.89 (m, 1 H) 2.31 (br s, 3 H) 2.36-2.62 (m, 7 H) 2.67 (s, 3 H) 2.70-2.82 (m, 1 H) 3.14 (br t, J = 12.42 Hz, 1 H) 3.50 (br dd, J = 5.83, 2.95 Hz, 4 H) 3.61-3.67 (m, 1 H) 3.68-3.79 (m, 1 H) 3.99-4.14 (m, 1 H) 4.63 (br d, J = 13.55 Hz, 1 H) 4.81 (t, J = 10.10 Hz, 1 H) 5.18 (d, J = 10.67 Hz, 1 H) 5.32 (dd, J = 14.93, 9.66 Hz, 1 H) 5.52 (dd, J = 15.00, 9.85 Hz, 1 H) 6.26- 6.37 (m, 3 H) 6.43 (s, 1 H). LCMS: 711.7 [M + H].sup.+ 182 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (dd, J = 8.34, 6.84 Hz, 6 H) 1.00 (t, J = 7.47 Hz, 3 H) 1.15-1.20 (m, 2 H) 1.37-1.47 (m, 2 H) 1.69- 1.78 (m, 7 H) 1.80 (s, 5 H) 1.82- 1.90 (m, 1 H) 2.24-2.30 (m, 1 H) 2.32-2.40 (m, 3 H) 2.44-2.61 (m, 4 H) 2.69 (s, 3 H) 2.82 (s, 5 H) 3.43-3.51 (m, 3 H) 3.54-3.60 (m, 1 H) 3.61-3.70 (m, 1 H) 3.87 (br d, J = 11.17 Hz, 2 H) 4.81 (t, J = 10.10 Hz, 1 H) 5.18 (d, J = 10.67 Hz, 1 H) 5.32 (dd, J = 15.06, 9.66 Hz, 1 H) 5.52 (dd, J = 15.00, 9.98 Hz, 1 H) 6.23-6.34 (m, 3 H) 6.42 (s, 1 H). LCMS: 721.7 [M + H].sup.+ 183 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.02 (dd, J = 6.59, 5.21 Hz, 6 H) 1.27-1.31 (m, 2 H) 1.44-1.50 (m, 2 H) 1.78-1.86 (m, 8 H) 1.90 (s, 3 H) 1.93-1.97 (m, 1 H) 2.00-2.07 (m, 4 H) 2.52-2.63 (m, 5 H) 2.64-2.75 (m, 3 H) 2.79 (s, 3 H) 2.88-3.02 (m, 2 H) 3.33-3.56 (m, 4 H) 3.73 (s, 6 H) 3.96-4.05 (m, 2 H) 4.91 (t, J = 9.98 Hz, 1 H) 5.29 (d, J = 10.67 Hz, 1 H) 5.37-5.46 (m, 1 H) 5.63 (dd, J = 15.12, 10.10 Hz, 1 H) 6.34-6.44 (m, 3 H) 6.53 (s, 1 H). LCMS: 747.7 [M + H].sup.+ 184 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.91 (dd, J = 10.98, 6.84 Hz, 6 H) 1.12-1.21 (m, 2 H) 1.35-1.45 (m, 2 H) 1.61-1.75 (m, 4 H) 1.78 (d, J = 1.00 Hz, 3 H) 1.80-1.90 (m, 2 H) 2.22-2.38 (m, 3 H) 2.44-2.65 (m, 6 H) 2.68 (s, 3 H) 3.25-3.37 (m, 1 H) 3.39-3.57 (m, 4 H) 3.39-3.53 (m, 3 H) 3.60-3.66 (m, 1 H) 3.70 (s, 3 H) 3.88-3.98 (m, 2 H) 4.81 (t, J = 10.04 Hz, 1 H) 5.16 (d, J = 10.54 Hz, 1 H) 5.31 (dd, J = 15.12, 9.47 Hz, 1 H) 5.46-5.56 (m, 1 H) 6.19-6.32 (m, 3 H) 6.39 (s, 1 H) 7.37 (d, J = 1.25 Hz, 1 H) 7.45 (s, 1 H). LCMS: 759.5 [M + H].sup.+ 185 0 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.90 (dd, J = 17.07, 6.78 Hz, 6 H) 1.17 (br d, J = 8.41 Hz, 2 H) 1.35- 1.45 (m, 2 H) 1.65-1.73 (m, 4 H) 1.77 (d, J = 1.13 Hz, 3 H) 1.78- 1.87 (m, 3 H) 2.20-2.38 (m, 7 H) 2.47 (m, 4 H) 2.66 (s, 3 H) 3.31- 3.57 (m, 5 H) 3.59-3.70 (m, 1 H) 3.88 (br d, J = 10.54 Hz, 2 H) 4.80 (t, J = 9.98 Hz, 1 H) 5.15 (d, J = 10.67 Hz, 1 H) 5.30 (dd, J = 15.18, 9.66 Hz, 1 H) 5.44-5.57 (m, 1 H) 6.14-6.31 (m, 3 H) 6.37 (s, 1 H) 7.43-7.61 (m, 3 H) 7.67-7.76 (m, 2 H). LCMS: 755.6 [M + H].sup.+ 186 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.91 (t, J = 6.27 Hz, 6 H) 1.18 (br d, J = 7.91 Hz, 2 H) 1.64-1.77 (m, 6 H) 1.80 (s, 3 H) 1.85 (br d, J = 3.01 Hz, 2 H) 2.01 (s, 3 H) 2.32- 2.61 (m, 12 H) 2.87 (s, 3 H) 2.90- 2.99 (m, 1 H) 3.10 (br d, J = 7.03 Hz, 2 H) 3.48-3.69 (m, 5 H) 3.70- 3.81 (m, 1 H) 4.54-4.63 (m, 1 H) 4.81 (t, J = 9.91 Hz, 1 H) 5.18 (d, J = 10.79 Hz, 1 H) 5.31 (dd, J = 15.12, 9.60 Hz, 1 H) 5.52 (dd, J = 14.87, 9.98 Hz, 1 H) 6.11-6.20 (m, 2 H) 6.27 (br d, J = 8.78 Hz, 1 H) 6.42 (s, 1 H). LCMS: 671.8 [M + H].sup.+ 187 LCMS: 707.7 [M + H].sup.+

(147) Synthesis of Piperidine Intermediates:

(148) Procedure 27.

(149) ##STR00283##

(150) A solution of piperidine (050) (50 mg, 0.15 mmol) and oxazole-5-carboxylic acid (25.4 mg, 0.224 mmol) in DMF (2 mL) was charged into a 4 mL vial with a magnetic stir bar. Hunig's Base (0.078 mL, 0.449 mmol), EDC (60.2 mg, 0.314 mmol) and HOBT (48.1 mg, 0.314 mmol) were added. The resulting solution was stirred overnight at room temperature and partitioned between water (10 mL) and EtOAc (10 mL). The solution was extracted with EtOAc (3×10 mL), washed with water (10 mL), dried with MgSO.sub.4, filtered, and evaporated under vacuum. The crude material was dry loaded onto 2 g. silica and purified by column chromatography (ISCO normal phase, 12 g. gold column, 0-20% MeOH/DCM gradient) to isolate (4-((3-fluoro-5-iodophenyl)(methyl)amino)piperidin-1-yl)(oxazol-5-yl)methanone (052) (24 mg, 0.056 mmol, 37%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.68-1.85 (m, 2H) 1.85-1.96 (m, 2H) 2.77 (s, 3H) 2.99-3.51 (m, 2H) 3.82 (tt, J=11.56, 4.06 Hz, 1H) 4.37-5.02 (m, 2H) 6.45 (dt, J=12.55, 2.26 Hz, 1H) 6.81-6.87 (m, 1H) 6.91 (s, 1H) 7.64 (s, 1H) 7.96-8.00 (m, 1H). LCMS: 430.3 [M+H].sup.+.

(151) The following intermediates were also synthesized according to the general methods of Procedure 27:

(152) TABLE-US-00011 TABLE 11 Characterization of intermediates synthesized according to Procedure 27. Intermediate Characterization .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.62-1.93 (m, 4 H) 2.70 (s, 3 H) 2.77-2.85 (m, 1 H) 3.04-3.20 (m, 1 H) 3.64- 3.80 (m, 1 H) 4.03-4.16 (m, 1 H) 4.85 (br dd, J = 13.24, 2.07 Hz, 1 H) 6.36 (dt, J = 12.58, 2.24 Hz, 1 H) 6.69- 6.75 (m, 1 H) 6.81 (s, 1 H) 8.49 (dd, J = 2.51, 1.51 Hz, 1 H) 8.58 (d, J = 2.64 Hz, 1 H) 8.89 (d, J = 1.51 Hz, 1 H). LCMS: 441.3 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.73-1.92 (m, 4 H) 2.76 (s, 3 H) 2.78-2.88 (m, 1 H) 3.01-3.24 (m, 1 H) 3.76 (s, 3 H) 3.77-3.84 (m, 1 H) 4.78-5.01 (m, 1 H) 5.36-5.55 (m, 1 H) 6.44 (dt, J = 12.77, 2.21 Hz, 1 H) 6.76-6.83 (m, 1 H) 6.89 (s, 1 H) 7.42-7.47 (m, 1 H) 7.55 (d, J = 1.38 Hz, 1 H). LCMS: 443.3 [M + H].sup.+.

(153) Compounds 188-190 were generated from the above intermediates using the general methods of Procedure 25.

(154) TABLE-US-00012 TABLE 12 Characterization of Compounds 188-190 Ex. Structure and IUPAC Chemical Name Characterization 188 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 6.65 Hz, 7 H) 1.15-1.21 (m, 2 H) 1.38- 1.44 (m, 2 H) 1.65-1.74 (m, 4 H) 1.74-1.83 (m, 6 H) 1.83- 1.89 (m, 1 H) 2.25-2.43 (m, 6 H) 2.44-2.65 (m, 5 H) 2.68 (s, 3 H) 3.40-3.57 (m, 4 H) 3.58- 3.70 (m, 2 H) 3.71-3.82 (m, 1 H) 4.81 (t, J = 9.91 Hz, 1 H) 5.19 (d, J = 10.79 Hz, 1 H) 5.32 (dd, J = 15.12, 9.60 Hz, 1 H) 5.44-5.59 (m, 1 H) 6.27- 6.36 (m, 3 H) 6.43 (s, 1 H) 7.53 (s, 1 H) 7.88 (s, 1 H). LCMS: 710.6 [M + H].sup.+ 189 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (dd, J = 6.65, 4.89 Hz, 6 H) 1.14-1.21 (m, 2 H) 1.37-1.49 (m, 2 H) 1.69-1.77 (m, 4 H) 1.80 (d, J = 1.13 Hz, 5 H) 2.34-2.49 (m, 6 H) 2.52- 2.63 (m, 4 H) 2.71 (s, 3 H) 2.74-2.86 (m, 1 H) 3.05-3.19 (m, 1 H) 3.50-3.69 (m, 5 H) 3.76 (s, 1 H) 4.05 (br d, J = 13.18 Hz, 1 H) 4.68-4.90 (m, 2 H) 5.18 (d, J = 10.67 Hz, 1 H) 5.31 (dd, J = 14.87, 9.60 Hz, 1 H) 5.52 (dd, J = 15.12, 10.10 Hz, 1 H) 6.33 (s, 3 H) 6.43 (s, 1 H) 8.48 (dd, J = 2.51, 1.51 Hz, 1 H) 8.57 (d, J = 2.51 Hz, 1 H) 8.88 (d, J = 1.51 Hz, 1 H). LCMS: 721.7 [M + H].sup.+ 190 LCMS: 723.6 [M + H].sup.+

(155) Synthesis of Piperidine Intermediates:

(156) Procedure 28.

(157) ##STR00289##

(158) A solution of N-(3-fluoro-5-iodophenyl)-N-methylpiperidin-4-amine HCl (050) (50 mg, 0.135 mmol) in dichloromethane (2 mL) was charged into a 5 mL vial with a magnetic stir bar. N-ethyl-N-isopropylpropan-2-amine (0.035 mL, 0.202 mmol) then 2-isocyanatopropane (17.22 mg, 0.202 mmol) were added. The resulting solution was stirred overnight at room temperature and evaporated under vacuum. The crude product was dry loaded onto 2 g silica and purified by column chromatography (ISCO normal phase, 24 g. gold column, 0-100% EtOAc/hexanes gradient) to obtain 4-((3-fluoro-5-iodophenyl)(methyl)amino)-N-isopropylpiperidine-1-carboxamide (053) (45 mg, 0.107 mmol, 80%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.19 (d, J=6.53 Hz, 6H) 1.66-1.80 (m, 4H) 2.75 (s, 3H) 2.81-2.92 (m, 2H) 3.57-3.73 (m, 1H) 4.00 (dd, J=13.49, 6.59 Hz, 1H) 4.08 (dt, J=13.40, 2.09 Hz, 2H) 4.27 (br d, J=7.03 Hz, 1H) 6.41 (dt, J=12.67, 2.26 Hz, 1H) 6.75-6.82 (m, 1H) 6.86 (s, 1H). LCMS: 420.7 [M+H].sup.+.

(159) The following intermediates were also synthesized according to the general methods of Procedure 28:

(160) TABLE-US-00013 TABLE 13 Characterization of intermediates synthesized according to Procedure 28 Intermediate Characterization 0 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.96 (t, J = 7.40 Hz, 3 H) 1.53-1.60 (m, 2 H) 1.66-1.83 (m, 4 H) 2.75 (s, 3 H) 2.82- 2.94 (m, 2 H) 3.19-3.30 (m, 2 H) 3.54-3.75 (m, 1 H) 4.02- 4.19 (m, 2 H) 4.50 (br s, 1 H) 6.43 (dt, J = 12.64, 2.21 Hz, 1 H) 6.76-6.82 (m, 1 H) 6.87 (s, 1 H). LCMS: 420.7 [M + H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.70-1.91 (m, 4 H) 2.77 (s, 3 H) 2.95-3.07 (m, 2 H) 3.65-3.79 (m, 1 H) 4.21-4.30 (m, 2 H) 6.42-6.49 (m, 1 H) 6.79-6.85 (m, 1 H) 6.90 (s, 1 H) 7.05-7.10 (m, 1 H) 7.30-7.41 (m, 5 H). LCMS: 454.2 [M + H].sup.+.

(161) Compounds 191-193 were generated from the above intermediates using the general methods of Procedure 25.

(162) TABLE-US-00014 TABLE 14 Characterization of Compounds 191-193 Ex. Structure and IUPAC Chemical Name Characterization 191 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (t, J = 7.03 Hz, 6 H) 1.09 (d, J = 6.53 Hz, 6 H) 1.14-1.21 (m, 2 H) 1.33-1.45 (m, 2 H) 1.57-1.76 (m, 6 H) 1.80 (d, J = 1.13 Hz, 3 H) 1.81-1.89 (m, 1 H) 2.19-2.38 (m, 4 H) 2.44-2.60 (m, 4 H) 2.67 (s, 3 H) 2.71-2.82 (m, 2 H) 3.24-3.33 (m, 1 H) 3.37- 3.53 (m, 3 H) 3.54-3.73 (m, 3 H) 3.90 (dd, J = 13.68, 6.53 Hz, 1 H) 3.98 (br d, J = 13.43 Hz, 2 H) 4.15 (br d, J = 7.40 Hz, 1 H) 4.81 (t, J = 10.10 Hz, 1 H) 5.18 (d, J = 10.54 Hz, 1 H) 5.31 (dd, J = 15.00, 9.72 Hz, 1 H) 5.52 (dd, J = 15.00. 9.98 Hz, 1 H) 6.25- 6.34 (m, 3 H) 6.43 (s, 1 H). LCMS: 700.7 [M + H].sup.+ 192 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.86 (t, J = 7.40 Hz, 3 H) 0.92 (t, J = 6.90 Hz, 6 H) 1.18 (br d, J = 8.66 Hz, 2 H) 1.46 (br d, J = 7.28 Hz, 6 H) 1.61-1.71 (m, 4 H) 1.80 (d, J = 1.25 Hz, 3 H) 1.82-1.90 (m, 1 H) 2.18-2.41 (m, 4 H) 2.45-2.60 (m, 4 H) 2.67 (s, 3 H) 2.73-2.84 (m, 2 H) 3.09- 3.18 (m, 2 H) 3.30 (br d, J = 10.92 Hz, 1 H) 3.36-3.54 (m, 3 H) 3.54-3.70 (m, 3 H) 3.99 (br d, J = 13.05 Hz, 2 H) 4.38 (br t, J = 5.46 Hz, 1 H) 4.81 (t, J = 10.10 Hz, 1 H) 5.18 (d, J = 10.54 Hz, 1 H) 5.31 (dd, J = 15.00, 9.60 Hz, 1 H) 5.52 (dd, J = 15.00, 9.98 Hz, 1 H) 6.25-6.33 (m, 3 H) 6.43 (s, 1 H). LCMS: 700.7 [M + H].sup.+ 193 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.92 (dd, J = 6.71, 1.44 Hz, 6 H) 1.15-1.23 (m, 2 H) 1.34-1.42 (m, 2 H) 1.64-1.77 (m, 6 H) 1.81 (d, J = 1.13 Hz, 3 H) 1.83-1.91 (m, 1 H) 2.32- 2.66 (m, 8 H) 2.69 (s, 3 H) 2.87-2.98 (m, 2 H) 3.27-3.33 (m, 1 H) 3.62 (s, 5 H) 4.10- 4.20 (m, 2 H) 4.81 (t, J = 9.85 Hz, 1 H) 5.19 (d, J = 10.42 Hz, 1 H) 5.31 (dd, J = 15.12, 9.72 Hz, 1 H) 5.53 (dd, J = 14.93, 9.66 Hz, 1 H) 6.25- 6.36 (m, 4 H) 6.44 (s, 1 H) 6.94-7.01 (m, 1 H) 7.20-7.32 (m, 5 H). LCMS: 734.7 [M + H].sup.+

(163) Synthesis of Piperidine Intermediates:

(164) Procedure 29.

(165) ##STR00295##

(166) Step 1: A solution of piperidin-4-ol (200 mg, 1.977 mmol) in DCM (5 mL) was charged into a 25 mL round bottom flask with a magnetic stir bar. Hunig's Base (1.036 mL, 5.932 mmol) then methanesulfonyl chloride (0.339 mL, 4.35 mmol) were added. The resulting solution was stirred overnight at room temperature, and the reaction was quenched with water (10 mL). The resulting solution was extracted with DCM (3×10 mL), washed with brine (10 mL), dried with MgSO.sub.4, filtered and evaporated under vacuum to yield 1-(methylsulfonyl)piperidin-4-yl methanesulfonate (054) (404 mg, 1.571 mmol).

(167) Step 2: A solution of 3-bromo-5-fluorophenol (200 mg, 1.047 mmol) and 1-(methylsulfonyl)piperidin-4-yl methanesulfonate (054) (404 mg, 1.571 mmol) in DMF (5 mL) was charged into a 10 mL vial with a magnetic stir bar. Cesium carbonate (682 mg, 2.094 mmol) was added. The resulting dispersion was heated to 70° C. and stirred overnight. The reaction was cooled to room temperature and partitioned between EtOAc (10 mL) and water (10 mL). The solution was extract with EtOAc (3×10 mL), washed with brine (10 mL), dried with MgSO.sub.4, filtered, and evaporated under vaccuum. The crude product was dry loaded onto 2 g. silica and purified by column chromatography (ISCO normal phase, 24 g. gold column, 0-60% EtOAc/hexanes gradient) to isolate 4-(3-bromo-5-fluorophenoxy)-1-(methylsulfonyl)piperidine (055) (108 mg, 0.307 mmol, 29%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.97-2.08 (m, 4H) 2.84 (s, 3H) 3.36-3.43 (m, 4H) 4.48-4.58 (m, 1H) 6.59 (dt, J=10.45, 2.24 Hz, 1H) 6.87-6.93 (m, 2H). LCMS: 353.1 [M+H].sup.+.

(168) The following intermediate was also synthesized according to the general methods of Procedure 29:

(169) TABLE-US-00015 TABLE 15 Characterization of intermediate synthesized according to Procedure 29 Intermediate Characterization .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 1.91-2.08 (m, 2 H) 2.08- 2.18 (m, 2 H) 2.26-2.52 (m, 4 H) 4.49 (dt, J = 10.16, 5.08 Hz, 1 H) 6.99 (dd, J = 9.10, 1.19 Hz, 1 H) 7.43 (t, J = 1.00 Hz, 1 H) 8.05 (s, 1 H). LCMS: 334.1 [M + H].sup.+.

(170) Compounds 194-196 were generated from the above intermediates using the general methods of Procedure 25.

(171) TABLE-US-00016 TABLE 16 Characterization of Compounds 194-196 Ex. Structure and IUPAC Chemical Name Characterization 194 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.91 (dd, J = 6.84, 1.44 Hz, 6 H) 1.15-1.22 (m, 2 H) 1.31-1.40 (m, 2 H) 1.65-1.77 (m, 2 H) 1.79 (d, J = 1.13 Hz, 3 H) 1.83-2.02 (m, 5 H) 2.32- 2.72 (m, 8 H) 2.74 (s, 3 H) 3.10-3.38 (m, 7 H) 3.53-3.79 (m, 3 H) 4.42 (br dd, J = 5.71, 2.70 Hz, 1 H) 4.80 (t, J = 10.04 Hz, 1 H) 5.17 (d, J = 10.42 Hz, 1 H) 5.30 (dd, J = 15.25, 9.85 Hz, 1 H) 5.47- 5.58 (m, 1 H) 6.38-6.46 (m, 2 H) 6.49 (s, 1 H) 6.54 (br d, J = 8.91 Hz, 1 H). LCMS: 680.6 [M + H].sup.+ 195 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.94 (dd, J = 9.22, 6.84 Hz, 6 H) 1.15-1.21 (m, 2 H) 1.36-1.45 (m, 2 H) 1.51-1.61 (m, 2 H) 1.66-1.77 (m, 2 H) 1.84 (d, J = 1.13 Hz, 3 H) 1.88-2.12 (m, 4 H) 2.17-2.42 (m, 6 H) 2.43-2.66 (m, 6 H) 3.20-3.39 (m, 1 H) 3.41-3.79 (m, 4 H) 4.43 (br d, J = 4.39 Hz, 1 H) 4.82 (t, J = 10.16 Hz, 1 H) 5.23 (d, J = 10.79 Hz, 1 H) 5.33 (dd, J = 15.12, 9.60 Hz, 1 H) 5.55 (dd, J = 15.00, 9.98 Hz, 1 H) 6.61 (s, 1 H) 6.68 (d, J = 10.67 Hz, 1 H) 6.96 (s, 1 H) 7.95 (s, 1 H). LCMS: 661.0 [M + H].sup.+ 196 .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.94 (t, J = 7.03 Hz, 6 H) 1.15-1.26 (m, 2 H) 1.33- 1.42 (m, 2 H) 1.48-1.58 (m, 2 H) 1.65 (br d, J = 5.27 Hz, 1 H) 1.84 (d, J = 1.13 Hz, 3 H) 1.86-1.91 (m, 1 H) 2.01- 2.16 (m, 2 H) 2.22-2.40 (m, 5 H) 2.42-2.66 (m, 5 H) 2.80 (s, 3 H) 2.99 (br t, J = 11.73 Hz, 2 H) 3.22-3.30 (m, 1 H) 3.38-3.57 (m, 2 H) 3.60-3.77 (m, 2 H) 3.82-3.95 (m, 2 H) 4.35-4.52 (m, 1 H) 4.81 (t, J = 10.16 Hz, 1 H) 5.16-5.25 (m, 1 H) 5.34 (dd, J = 15.06, 9.66 Hz, 1 H) 5.54 (dd, J = 15.00, 9.98 Hz, 1 H) 6.56- 6.76 (m, 2 H) 6.96 (s, 1 H) 7.95 (s, 1 H). LCMS: 704.6 [M + H].sup.+

(172) Compounds 197-207 were prepared according to the general methods of Procedures 30 and 31.

(173) Synthesis of Sulfonylpyrrolidine Intermediate:

(174) Procedure 30.

(175) ##STR00300##

(176) To a stirred solution of 3-bromo-5-fluorobenzene-1-sulfonyl chloride (40 mg, 0.146 mmol) in dichloromethane (471 μl) was added pyrrolidine (30.2 μl, 0.366 mmol). The reaction solution was stirred at room temperature overnight. The reaction solution was purified by column chromatography, eluting with a 0-100% EtOAc/hexanes gradient. This afforded 1-((3-bromo-5-fluorophenyl)sulfonyl)pyrrolidine (53.2 mg, 118%) as a white solid. LCMS (ESI, m/z), 308.0, 310.0 [M+H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.81-1.89 (m, 4H), 3.27-3.34 (m, 4H), 7.50 (tdd, J=7.53, 7.53, 2.38, 1.51 Hz, 2H), 7.76-7.83 (m, 1H).

(177) Synthesis of Boronate Coupling Products:

(178) Procedure 31.

(179) ##STR00301##

(180) To a stirred solution of Boronate 1 (15 mg, 0.028 mmol) and 1-((3-bromo-5-fluorophenyl)sulfonyl)pyrrolidine (056) (12.11 mg, 0.039 mmol) in 480 μl of 1,4-dioxane and 10.11 μl water were added potassium carbonate (23.27 mg, 0.168 mmol) and tetrakis palladium triphenylphosphine (16.21 mg, 0.014 mmol). The mixture was degassed and heated to 95° C. for 2 hrs. Upon completion by UPLC, the mixture was cooled to room temperature, filtered, and purified by column chromatography eluting with a 0-100% EtOAc/hexanes gradient then a 0-20% MeOH/DCM gradient. This afforded Example 197 (8.1 mg, 45%) as a colorless oil.

(181) TABLE-US-00017 TABLE 17 Characterization of Compounds 197-207 Ex. Structure and IUPAC Chemical Name Characterization 197 02 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4- en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 636.3 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3): δ 0.84-0.93 (m, 3H), 1.03 (d, J = 6.65 Hz, 6H), 1.21-1.32 (m, 11H), 1.47-1.52 (m, 2H), 1.79-1.85 (m, 5H), 1.91 (d, J = 1.25 Hz, 3H), 1.94-2.00 (m, 1H), 2.07 (s, 1H), 2.52-2.74 (m, 7H), 3.27-3.34 (m, 4H), 3.62-3.82 (m, 4H), 4.15 (q, J = 7.15 Hz, 1H), 4.91 (t, J = 10.10 Hz, 1H), 5.30 (d, J = 10.67 Hz, 1H), 5.43 (dd, J = 15.00, 9.60 Hz, 1H), 5.62 (dd, J = 15.00, 9.98 Hz, 1H), 6.60 (s, 1H), 7.18-7.23 (m, 1H), 7.44 (dt, J = 7.47, 2.04 Hz, 1H), 7.54 (s, 1H). 198 03 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(azetidin-1- ylsulfonyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 604.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.87-0.97 (m, 6H), 1.10-1.25 (m, 3H), 1.29-1.46 (m, 1H), 1.33-1.45 (m, 3H), 1.68-1.78 (m, 1H), 1.78-1.90 (m, 4H), 1.95-2.08 (m, 2H), 2.43-2.60 (m, 6H), 2.43-2.63 (m, 6H), 3.22-3.31 (m, 1H), 3.60-3.78 (m, 7H), 4.76-4.85 (m, 1H), 5.17-5.26 (m, 1H), 5.28-5.38 (m, 1H), 5.47-5.58 (m, 1H), 6.52-6.59 (m, 1H), 7.40-7.52 (m, 2H), 7.60-7.69 (m, 2H), 7.70-7.70 (m, 1H) 199 04 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3- [(3R)-3-hydroxypyrrolidin-1- yl]sulfonylphenyl]prop-1-en-2-yl]-3,7-dimethyl-12- oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 634.5 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (br d, J = 6.78 Hz, 6H), 1.13-1.23 (m, 2H), 1.38-1.47 (m, 1H), 1.67-1.77 (m, 2H), 1.80 (s, 4H), 1.84-1.91 (m, 2H), 2.36- 2.44 (m, 3H), 2.44-2.62 (m, 7H), 3.18 (br d, J = 11.17 Hz, 1H), 3.28-3.40 (m, 3H), 3.52-3.70 (m, 5H), 4.29-4.36 (m, 1H), 4.76-4.85 (m, 1H), 5.21 (br d, J = 10.67 Hz, 1H), 5.33 (br dd, J = 15.00, 9.72 Hz, 1H), 5.53 (br dd, J = 14.87, 9.73 Hz, 1H), 6.54 (s, 1H), 7.36-7.46 (m, 2H), 7.62-7.69 (m, 2H) 200 05 [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2- [(E)-1-[3-[(2S)-2-methylpyrrolidin-1- yl]sulfonylphenyl]prop-1-en-2-yl]-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 632.6 [M + H]+. 1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (d, J = 5.77 Hz, 7H), 1.07-1.21 (m, 3H), 1.24 (d, J = 6.40 Hz, 3H), 1.39-1.52 (m, 3H), 1.58-1.77 (m, 4H), 1.80 (s, 4H), 1.83-1.91 (m, 2H), 2.40-2.68 (m, 10H), 2.40-2.67 (m, 9H), 2.53-2.54 (m, 1H), 3.03-3.13 (m, 1H), 3.33-3.43 (m, 1H), 3.55-3.72 (m, 6H), 4.76-4.86 (m, 1H), 5.16-5.26 (m, 1H), 5.26-5.37 (m, 1H), 5.47-5.58 (m, 1H), 6.50-6.57 (m, 1H), 7.33-7.46 (m, 2H), 7.60-7.70 (m, 2H) 201 06 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(1- hydroxy-2-methylpropan-2- yl)sulfamoyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl- 12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 636.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.88-0.96 (m, 6H), 1.04-1.10 (m, 6H), 1.15-1.23 (m, 2H), 1.36-1.45 (m, 2H), 1.68-1.77 (m, 2H), 1.77-1.83 (m, 3H), 1.84-1.91 (m, 1H), 2.44-2.62 (m, 6H), 2.67-2.86 (m, 2H), 3.36-3.43 (m, 2H), 3.62-3.78 (m, 4H), 4.77-4.86 (m, 2H), 5.18-5.23 (m, 1H), 5.27-5.36 (m, 1H), 5.48-5.57 (m, 1H), 6.49-6.57 (m, 1H), 7.32-7.45 (m, 2H), 7.67-7.75 (m, 2H) 202 07 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4,4- difluoropiperidin-1-yl)sulfonylphenyl]prop-1-en-2- yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 668.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.00-1.06 (m, 6H), 1.20-1.34 (m, 3H), 1.43-1.56 (m, 6H), 1.77-1.86 (m, 1H), 1.86-1.92 (m, 3H), 1.92-2.03 (m, 1H), 2.03-2.17 (m, 4H), 2.53-2.72 (m, 4H), 2.72-2.83 (m, 3H), 3.20-3.29 (m, 4H), 3.32-3.40 (m, 1H), 3.70-3.81 (m, 2H), 4.87-4.95 (m, 1H), 5.29-5.35 (m, 1H), 5.37-5.47 (m, 1H), 5.59-5.69 (m, 1H), 6.60-6.67 (m, 1H), 7.49-7.59 (m, 2H), 7.63-7.69 (m, 2H) 203 08 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2- [(E)-1-(4-methyl-3-pyrrolidin-1- ylsulfonylphenyl)prop-1-en-2-yl]-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 632.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.92 (dd, J = 6.78, 1.88 Hz, 6H), 1.12-1.24 (m, 3H), 1.37-1.46 (m, 3H), 1.67-1.75 (m, 2H), 1.78-1.89 (m, 8H), 2.44-2.61 (m, 10H), 3.16-3.27 (m, 5H), 3.27-3.36 (m, 1H), 3.58-3.72 (m, 5H), 4.76-4.85 (m, 1H), 5.17-5.23 (m, 1H), 5.28-5.36 (m, 1H), 5.48-5.58 (m, 1H), 6.44-6.51 (m, 1H), 7.20-7.27 (m, 2H), 7.77 (d, J = 1.51 Hz, 1H) 204 09 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(3,3- difluoropyrrolidin-1-yl)sulfonylphenyl]prop-1-en-2- yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 354.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.88-0.96 (m, 6H), 1.11-1.29 (m, 5H), 1.64-1.76 (m, 2H), 1.77-1.82 (m, 3H), 1.84-1.94 (m, 1H), 2.14-2.29 (m, 2H), 2.42-2.62 (m, 3H), 2.65-2.78 (m, 4H), 3.33-3.42 (m, 4H), 3.45-3.57 (m, 2H), 3.59-3.73 (m, 2H), 4.07-4.20 (m, 1H), 4.74-4.87 (m, 1H), 5.17-5.27 (m, 1H), 5.27-5.39 (m, 1H), 5.49-5.61 (m, 1H), 6.51-6.59 (m, 1H), 7.40-7.51 (m, 2H), 7.58-7.67 (m, 2H), 7.85-7.95 (m, 1H) 205 0 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl- 12-oxo-2-[(E)-1-(5-pyrrolidin-1-ylsulfonylpyridin- 3-yl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 619.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.82-0.93 (m, 1H), 1.01-1.07 (m, 6H), 1.17-1.38 (m, 5H), 1.46-1.52 (m, 1H), 1.75-1.88 (m, 6H), 1.91-2.03 (m, 4H), 2.53-2.87 (m, 9H), 3.28-3.37 (m, 5H), 3.41-3.51 (m, 2H), 3.68-3.83 (m, 3H), 4.15-4.32 (m, 2H), 4.86-4.95 (m, 1H), 5.27-5.35 (m, 1H), 5.37-5.49 (m, 1H), 5.57-5.70 (m, 1H), 6.61 (s, 1H), 8.02 (s, 1H), 8.73 (d, J = 2.01 Hz, 1H), 8.89-8.98 (m, 1H) 206 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(3,3- difluoroazetidin-1-yl)sulfonylphenyl]prop-1-en-2- yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 640.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93 (dd, J = 9.22, 6.84 Hz, 7H), 0.94-0.95 (m, 1H), 1.03-1.28 (m, 6H), 1.25-1.39 (m, 4H), 1.51-1.56 (m, 2H), 1.68-1.89 (m, 4H), 2.44-2.62 (m, 3H), 2.62-2.72 (m, 2H), 2.72-2.76 (m, 3H), 3.34-3.42 (m, 2H), 3.57-3.72 (m, 3H), 4.04-4.21 (m, 7H), 4.76-4.85 (m, 1H), 5.18-5.26 (m, 1H), 5.26-5.37 (m, 1H), 5.49-5.59 (m, 1H), 6.53-6.58 (m, 1H), 7.45-7.53 (m, 2H), 7.63-7.70 (m, 2H) 207 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2- [(E)-1-[4-methyl-3-(2-oxopyrrolidin-1- yl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec- 4-en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 582.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.86-0.95 (m, 6H), 1.10-1.26 (m, 2H), 1.35-1.42 (m, 2H), 1.64-1.76 (m, 1H), 1.76-1.80 (m, 3H), 1.81-1.89 (m, 1H), 2.10-2.20 (m, 5H), 2.41-2.60 (m, 6H), 2.62-2.72 (m, 3H), 3.32 (br d, J = 10.92 Hz, 1H), 3.59-3.69 (m, 4H), 4.81 (t, J = 10.04 Hz, 1H), 5.18 (d, J = 10.54 Hz, 1H), 5.29 (dd, J = 14.93, 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.98 Hz, 1H), 6.41-6.48 (m, 1H), 6.94-6.99 (m, 1H), 7.03-7.09 (m, 1H), 7.13-7.17 (m, 1H)

(182) Compounds 208-218 were prepared according to the general methods of Procedure 32.

(183) Synthesis of Boronate Coupling Products:

(184) Procedure 32.

(185) ##STR00313##

(186) To a stirred solution of iodide (008) (15 mg, 0.028 mmol) and N-(tert-butyl)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzenesulfonamide (11.43 mg, 0.034 mmol) in 426 μl of p-dioxane was added silver oxide (19.51 mg, 0.084 mmol) and tetrakis(triphenylphosphine)palladium(0) (3.24 mg, 2.807 μmol). The mixture was degassed and heated to 80° C. for 90 minutes. Upon completion by UPLC, the reaction mixture was cooled to room temperature, filtered, and concentrated. Purification by column chromatography eluting with a 0-20% MeOH/DCM gradient afforded Example 208 (23.3 mg, ˜100%) as a colorless oil.

(187) TABLE-US-00018 TABLE 18 Characterization of Compounds 208-218 and 268 Ex. Structure and IUPAC Chemical Name Characterization 208 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(tert- butylsulfamoyl)phenyl]prop-1-en-2-yl]-10-hydroxy- 3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 620.8 [M + H]+. 1H NMR (400 MHz, CDCl.sub.3) δ 0.84-0.93 (m, 1H), 0.99-1.05 (m, 6H), 1.22-1.29 (m, 13H), 1.48-1.56 (m, 1H), 1.79-1.87 (m, 1H), 1.88-1.92 (m, 3H), 1.93-1.99 (m, 1H), 2.39 (s, 3H), 2.48 (br s, 2H), 2.60 (br d, J = 3.14 Hz, 3H), 3.31-3.41 (m, 1H), 3.55-3.59 (m, 2H), 3.71-3.81 (m, 1H), 4.53 (s, 1H), 4.85-4.95 (m, 1H), 5.32 (s, 2H), 5.38-5.47 (m, 1H), 5.58-5.67 (m, 1H), 6.63 (s, 1H), 7.39- 7.52 (m, 2H), 7.74-7.85 (m, 2H). 209 [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl- 12-oxo-2-[(E)-1-[3-(propan-2- ylsulfamoyl)phenyl]prop-1-en-2-yl]-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 606.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.89-0.96 (m, 6H), 0.99-1.05 (m, 6H), 1.12-1.23 (m, 2H), 1.37-1.44 (m, 3H), 1.67-1.76 (m, 1H), 1.77-1.83 (m, 3H), 1.83-1.91 (m, 1H), 2.39-2.50 (m, 1H), 2.43-2.46 (m, 1H), 2.53-2.66 (m, 4H), 3.23-3.30 (m, 1H), 3.27-3.28 (m, 1H), 3.36-3.48 (m, 1H), 3.60-3.70 (m, 2H), 4.17-4.24 (m, 1H), 4.76-4.85 (m, 1H), 5.17-5.24 (m, 1H), 5.28-5.39 (m, 1H), 5.54 (dd, J = 15.00, 9.98 Hz, 1H), 6.50-6.56 (m, 1H), 7.32-7.45 (m, 2H), 7.64-7.72 (m, 2H) 210 [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3- (ethylsulfamoyl)phenyl]prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4- en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 592.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.00-1.06 (m, 6H), 1.13-1.18 (m, 3H), 1.29-1.32 (m, 2H), 1.47-1.56 (m, 2H), 1.74-1.88 (m, 2H), 1.88-1.92 (m, 3H), 1.92-2.00 (m, 1H), 2.46 (br s, 3H), 2.56-2.70 (m, 5H), 2.99-3.11 (m, 2H), 3.32-3.40 (m, 1H), 3.54-3.81 (m, 5H), 4.32-4.41 (m, 1H), 4.86-4.96 (m, 1H), 5.27-5.35 (m, 1H), 5.37-5.48 (m, 1H), 5.56-5.68 (m, 1H), 6.60-6.66 (m, 1H), 7.44-7.55 (m, 2H), 7.73-7.82 (m, 2H) 211 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2- [(E)-1-[3-(4-methylpiperazin-1- yl)sulfonylphenyl]prop-1-en-2-yl]-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 647.7 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.72- 0.86 (m, 3H), 0.89-0.97 (m, 7H), 1.08- 1.26 (m, 12H), 1.66-1.77 (m, 1H), 1.67-1.78 (m, 1H), 1.78-1.84 (m, 3H), 1.84-1.92 (m, 1H), 1.85-1.95 (m, 1H), 2.44-2.73 (m, 8H), 3.08-3.16 (m, 1H), 3.21-3.30 (m, 2H), 3.59-3.71 (m, 2H), 4.76 (s, 1H), 5.16-5.25 (m, 1H), 5.27- 5.36 (m, 1H), 5.49-5.60 (m, 1H), 6.49- 6.57 (m, 1H), 7.40-7.50 (m, 2H), 7.52- 7.58 (m, 2H) 212 [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2- [(E)-1-[3-(methylsulfamoyl)phenyl]prop-1-en-2-yl]- 12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 578.5 [M + H]+. .sup.1H NMR (400 MHz, CDC1.sub.3) δ 0.93 (dd, J = 6.71, 2.07 Hz, 5H), 0.93-0.95 (m, 1H), 1.13-1.24 (m, 3H), 1.68-1.76 (m, 1H), 1.79-1.84 (m, 4H), 1.84-1.91 (m, 1H), 2.41-2.64 (m, 12H), 3.06 (s, 1H), 3.22-3.29 (m, 1H), 3.52-3.75 (m, 5H), 4.24-4.33 (m, 1H), 4.81 (t, J = 10.04 Hz, 1H), 5.21 (d, J = 10.54 Hz, 1H), 5.34 (d, J = 9.66 Hz, 1H), 5.53 (dd, J = 15.00, 9.85 Hz, 1H), 6.51-6.55 (m, 1H), 7.36- 7.46 (m, 2H), 7.49-7.53 (m, 1H), 7.64- 7.70 (m, 2H) 213 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl- 12-oxo-2-[(E)-1-(3-piperidin-1- ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec- 4-en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 632.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 1.03 (dd, J = 6.65, 2.89 Hz, 6H), 1.20-1.35 (m, 2H), 1.39-1.72 (m, 10H), 1.75-1.86 (m, 1H), 1.91 (d, J = 1.00 Hz, 3H), 1.93- 2.00 (m, 1H), 2.51-2.82 (m, 7H), 3.02 (br d, J = 5.40 Hz, 4H), 3.31-3.42 (m, 1H), 3.59-3.94 (m, 4H), 4.88-4.98 (m, 1H), 5.26-5.35 (m, 1H), 5.37-5.48 (m, 1H), 5.62 (br d, J = 9.91 Hz, 1H), 6.59- 6.67 (m, 1H), 7.51 (br d, J = 11.67 Hz, 2H), 7.68 (s, 2H) 214 0 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl- 12-oxo-2-[(E)-1-(3-pyrrolidin-1- ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec- 4-en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 618.5 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.98-1.08 (m, 6H), 1.21-1.37 (m, 2H), 1.46-1.67 (m, 4H), 1.75-1.86 (m, 5H), 1.89-1.94 (m, 3H), 1.94-2.02 (m, 1H), 2.52-2.82 (m, 7H), 3.25-3.32 (m, 4H), 3.33-3.42 (m, 1H), 3.66-3.84 (m, 3H), 4.85-4.96 (m, 1H), 5.28-5.35 (m, 1H), 5.37-5.47 (m, 1H), 5.58-5.70 (m, 1H), 6.60-6.68 (m, 1H), 7.44-7.57 (m, 2H), 7.68-7.81 (m, 2H) 215 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3- cyclopropylsulfonylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4- en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 589.5 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.97-1.10 (m, 9H), 1.21-1.33 (m, 2H), 1.35-1.43 (m, 2H), 1.47-1.57 (m, 2H), 1.77-1.87 (m, 1H), 1.91 (d, J = 1.25 Hz, 3H), 1.93-2.02 (m, 1H), 2.42-2.54 (m, 2H), 2.54-2.85 (m, 7H), 3.32-3.41 (m, 1H), 3.63-3.92 (m, 4H), 4.86-4.96 (m, 1H), 5.25-5.35 (m, 1H), 5.38-5.49 (m, 1H), 5.58-5.68 (m, 1H), 6.61-6.68 (m, 1H), 7.54 (br d, J = 0.75 Hz, 2H), 7.76-7.87 (m, 2H) 216 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3- (cyclopropylsulfonylamino)phenyl]prop-1-en-2-yl]- 10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 604.6 [M + H]+. .sup.1H NMR (400 MHz, CDCl.sub.3) δ 0.93-1.07 (m, 8H), 0.98-0.98 (m, 1H), 1.15-1.22 (m, 2H), 1.23-1.36 (m, 2H), 1.46-1.57 (m, 2H), 1.76-1.87 (m, 1H), 1.88-1.92 (m, 3H), 1.96 (td, J = 6.74, 3.70 Hz, 1H), 2.44-2.73 (m, 8H), 3.41 (d, J = 10.79 Hz, 1H), 3.59-4.00 (m, 3H), 3.67-3.68 (m, 1H), 4.91 (t, J = 10.10 Hz, 1H), 5.25-5.34 (m, 1H), 5.35-5.48 (m, 1H), 5.63 (dd, J = 15.06, 9.91 Hz, 1H), 6.52-6.62 (m, 2H), 7.08-7.20 (m, 2H), 7.21-7.26 (m, 1H), 7.30-7.36 (m, 1H) 217 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3S)- 3-(methanesulfonamido)pyrrolidin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl- 12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 665.5 [M + H] 1H NMR (400 MHz, CDCl.sub.3) d ppm 0.97- 1.05 (m, 6 H) 1.22-1.31 (m, 2 H) 1.45- 1.53 (m, 2 H) 1.75-1.85 (m, 1 H) 1.92-1.99 (m, 1H) 2.04-2.12 (m, 1 H) 2.31 (br s, 8 H) 2.50-2.69 (m, 3 H) 3.04 (s, 3 H) 3.21-3.29 (m, 1 H) 3.31- 3.49 (m, 4 H) 3.58-3.65 (m, 1 H) 3.69-3.77 (m, 1 H) 4.17-4.27 (m, 1 H) 4.36-4.47 (m, 1 H) 4.88-4.94 (m, 1 H) 5.23-5.29 (m, 1 H) 5.37-5.45 (m, 1 H) 5.56-5.65 (m, 1 H) 6.12- 6.20 (m, 2 H) 6.34-6.41 (m, 1 H) 6.48- 6.53 (m, 1 H) 218 [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)- 3-[(2-methoxyacetyl)amino]pyrrolidin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl- 12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 659.7 [M + H]. 268 (2S,3S,6R,7S,10R,E)-10-hydroxy-3,7-dimethyl-12- oxo-2-((E)-1-(3-(pyrrolidin-1- ylsulfonyl)phenyl)prop-1-en-2-yl)oxacyclododec-4- en-6-yl piperazine-1-carboxylate LCMS (ESI, m/z), 604.5 [M + H].

(188) Compounds 219 and 220 (Tables 17 and 18) were synthesized according to the general methods of Procedures 33 and 34.

(189) Procedure 33.

(190) ##STR00326##

(191) Step 1. A vial was charged with DMAP (0.117 g, 0.957 mmol), DCM (4.78 ml, 0.957 mmol) (4R,7S,8R,11S,12S,E)-4-((tert-butyldimethylsilyl)oxy)-8-hydroxy-12-((E)-1-iodoprop-1-en-2-yl)-7,11-dimethyloxacyclododec-9-en-2-one (005) (0.5 g, 0.957 mmol), 4-nitrophenyl chloroformate (0.193 g, 0.957 mmol) were combined and stirred overnight. 1-Methyl piperazine (0.191 ml, 1.722 mmol) was added and and then the reaction stirred for 1 hr. The reaction mixture was directly loaded into a silica gel column and chromatographed to afford to afford (2S,3S,6R,7S,10R,E)-10-((tert-butyldimethylsilyl)oxy)-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (007) (0.567 g, 0.874 mmol, 91% yield). LCMS (ESI, m/z), 649.4 [M+H]+.

(192) Step 2. Silver oxide (0.098 g, 0.421 mmol), tert-butyl 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-5,6-dihydropyridine-1(2H)-carboxylate (0.052 g, 0.168 mmol), (2S,3S,6R,7S,10R,E)-10-hydroxy-2-((E)-1-iodoprop-1-en-2-yl)-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (007) (0.045 g, 0.084 mmol), 1,4-dioxane (0.842 ml, 0.084 mmol), were combined and sparged with nitrogen for 10 minutes after which tetrakis(triphenylphosphine)palladium(0) (0.019 g, 0.017 mmol) was added and spargd with nitrogen for 10 minutes and stirred at 90° C. for 1.5 hr. The reaction mix was filtered, concentrated and chromatographed to afford Example 219 (2S,3S,6R,7S,10R,E)-2-((E)-1-(1-(tert-butoxycarbonyl)-1,2,5,6-tetrahydropyridin-3-yl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-methylpiperazine-1-carboxylate (12 mg, 0.020 mmol, 24.16% yield).

(193) TABLE-US-00019 TABLE 19 Characterization of Compound 219 Ex. Structure and IUPAC Chemical Name Characterization 219 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl- 2-[(E)-1-[1-[(2-methylpropan-2-yl)oxycarbonyl]- 3,6-dihydro-2H-pyridin-5-yl]prop-1-en-2-yl]-12- oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 591.7 [M + H]+. 1H NMR (400 MHz, CDCl.sub.3) □ ppm 0.87- 0.97 (m, 3 H) 1.02 (d, J = 6.78 Hz, 3 H) 1.19-1.31 (m, 2 H) 1.42-1.59 (m, 9 H) 1.82 (s, 4H) 1.86-1.98 (m, 1 H) 2.18- 2.27 (m, 2 H) 2.31 (s, 3 H) 2.37 (br s, 4 H) 2.45-2.69 (m, 3 H) 3.50 (br d, J = 5.52 Hz, 6 H) 3.66-3.80 (m, 1 H) 3.81-4.06 (m, 2 H) 4.82-4.92 (m, 1 H) 5.11-5.19 (m, 1 H) 5.33-5.43 (m, 1 H) 5.52-5.62 (m, 1 H) 5.73-5.93 (m, 2 H).

(194) Procedure 34.

(195) ##STR00328##

(196) Step 1. To a solution of alcohol (057) (265 mg, 0.423 mmol, 89% yield) in DCM (2.388 ml, 0.478 mmol) was added DMAP (0.058 g, 0.478 mmol), Hunig'sBase (0.417 ml, 2.388 mmol), 4-Nitrophenyl chloroformate (0.173 g, 0.86 mmol). The resulting yellowish suspension was stirred for 12 h till SM was gone, Reaction mixture was concentrated and chromatograhed to afford the carbonate. The product was then taken up in methanol (4.78 ml, 0.478 mmol), aded tosic acid (0.182 g, 0.955 mmol) and stirred for 1 hour. TEA (1 mL) was added and stirred for 10 minutes. The reaction mix was then concentrated to dryness and added DCM (6 mL) and sat'd NaHCO3 (2 mL) and stirred and extracted. The aqeous layer was then back extracted with DCM (3×). The organic layers were combined, dried over anhydrous Na2SO4 and concentrated to dryness to afford (058) (265 mg, 0.423 mmol, 89% yield). LCMS (ESI, m/z), 627.3 [M+H] 1H NMR (400 MHz, CDCl.sub.3) δ ppm 0.06-0.12 (m, 6H) 0.41-0.42 (m, 1H) 0.85-0.89 (m, 4H) 0.91 (s, 10H) 0.97-1.05 (m, 6H) 1.09-1.14 (m, 3H) 1.59-1.66 (m, 2H) 1.68-1.77 (m, 1H) 1.84-1.89 (m, 3H) 1.95-2.02 (m, 1H) 2.04 (s, 2H) 2.36-2.44 (m, 1H) 2.51-2.65 (m, 2H) 3.10-3.18 (m, 4H) 3.79-3.88 (m, 4H) 3.88-3.95 (m, 1H) 4.79-4.88 (m, 1H) 5.07-5.14 (m, 1H) 5.45-5.57 (m, 1H) 5.63-5.74 (m, 1H) 6.42-6.55 (m, 4H) 7.38 (d, J=9.29 Hz, 2H) 8.24-8.30 (m, 2H).

(197) Step 2. To a solution of carbonate (058) (50 mg, 0.087 mmol) in DCM (0.434 ml, 0.087 mmol) was added DMAP (10.61 mg, 0.087 mmol), Hunig'sBase (0.076 ml, 0.434 mmol), 4-Nitrophenyl chloroformate (0.032 g, 0.156 mmol). The resulting yellowish suspension was stirred for 5 h and, d3-N-Methylpiperizine (0.027 g, 0.26 mmol) was added and stirred till the completion of the reaction (1 hr). Reaction mixture was concentrated and chromatograhed to afford (059) (58 mg, 0.082 mmol, 95% yield). LCMS (ESI, m/z), 705.7 [M+H .sub.1H NMR (400 MHz, CDCl.sub.3) d ppm 1.01 (s, 6H) 1.23-1.32 (m, 2H) 1.55 (s, 11H) 1.75-1.84 (m, 1H) 1.88 (d, J=1.25 Hz, 3H) 1.91-2.02 (m, 1H) 2.02-2.14 (m, 1H) 2.20-2.46 (m, 8H) 2.48-2.70 (m, 3H) 3.19-3.56 (m, 11H) 3.57-3.66 (m, 1H) 3.68-3.80 (m, 1H) 4.16-4.27 (m, 1H) 4.39-4.49 (m, 1H) 4.82-4.94 (m, 1H) 5.24-5.29 (m, 1H) 5.36-5.46 (m, 1H) 5.55-5.66 (m, 1H) 6.10-6.21 (m, 2H) 6.34-6.42 (m, 1H) 6.47-6.55 (m, 1H).

(198) Step 3. Carbamate (059) (58 mg, 0.082 mmol), methanol (823 μl, 0.082 mmol), Tosic acid (46.9 mg, 0.247 mmol) was combined and stirred overnight. The reaction mix was then stirred with TEA (1 mL), concentrated to dryness and extracted with sat'd NaHCO3. The organic layer was separated, dried over an. Na2SO4 and concentrated to dryness and chromatographed (0-10% MeOH in DCM) to afford Example 220 (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-fluoro-5-morpholinophenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl 4-(methyl-d3)piperazine-1-carboxylate (17 mg, 0.029 mmol, 35.0% yield).

(199) TABLE-US-00020 TABLE 20 Characterization of Compound 220 Ex. Structure and IUPAC Chemical Name Characterization 220 [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy- 3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(trideuteriomethyl)piperazine-1-carboxylate LCMS (ESI, m/z), 591.4 [M + H] .sup.1H NMR (400 MHz, CDCl.sub.3) d ppm 0.95- 1.05 (m, 6 H) 1.17-1.33 (m, 2 H) 1.88 (d, J = 1.13 Hz, 4 H) 1.91-2.00 (m, 1 H) 2.30-2.43 (m, 4 H) 2.50-2.68 (m, 3 H) 3.11-3.19 (m, 4 H) 3.31-3.42 (m, 1 H) 3.43-3.58 (m, 4 H) 3.67-3.79 (m, 1 H) 3.81-3.90 (m, 4 H) 4.84-4.94 (m, 1 H) 5.21-5.29 (m, 1 H) 5.35-5.46 (m, 1 H) 5.55-5.66 (m, 1 H) 6.43-6.56 (m, 4 H).

(200) Compounds 221-253 were synthesized according to the general methods of Procedure 35.

(201) Procedure 35.

(202) ##STR00330##

(203) Step 1. Iodide (005) (0.2 g, 0.393 mmol), 1-(4-(3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)piperazin-1-yl)-2-(1H-pyrazol-1-yl)ethanone (0.179 g, 0.433 mmol), silver oxide (0.456 g, 1.967 mmol), 1,4-dioxane (3.93 ml, 0.393 mmol) were combined and sparged with nitrogen for ˜5 min. Pd(PPh.sub.3).sub.4 (0.068 g, 0.059 mmol) was added and the reaction mix sparged with nitrogen for ˜5 min. The reaction was then placed in an oil bath at 80 C and stirred for 3 hours. The reaction mix was filtered and ceoncentrated and chromatographed (0-100% EtOAc in Hexane) to afford (060) (179 mg, 0.268 mmol, 68.0% yield). LCMS (ESI, m/z), 683.55 [M+H].

(204) Step 2. To a solution of alcohol (060) (0.575 g, 0.842 mmol) and DCM (4.21 ml, 0.842 mmol) were added DMAP (0.103 g, 0.842 mmol), Hunig'sBase (0.735 ml, 4.21 mmol), 4-nitrophenyl chloroformate (0.305 g, 1.516 mmol). The resulting yellowish suspension was stirred for 12 h until the starting material was gone. The reaction mixture was concentrated and chromatographed to afford (061) (0.58 g, 0.684 mmol, 81% yield). LCMS (ESI, m/z), 848.5 [M+].

(205) Step 3. Carbonate (061) (580 mg, 0.684 mmol), methanol (6839 μl, 0.684 mmol), tosic acid (390 mg, 2.052 mmol) were combined and stirred for 1 hour. Triethylamine (1 mL) was added and the reaction stired for 15 minutes. The reaction mix was then concentrated to drynesss and dissolved in DCM. The crude reaction mix was stirred with saturated NaHCO.sub.3 for 10 minutes and extracted. The organic phases were combined, dried over anhydrous Na.sub.2SO.sub.4 and concentrated to dryness to afford (062) (410 mg, 0.559 mmol, 82% yield). LCMS (ESI, m/z), 734.4 [M+H].

(206) Step 4. Carbonate (062) (0.015 g, 0.020 mmol), DCM (0.204 ml, 0.020 mmol), Hunig'sBase (7.14 μL, 0.041 mmol) were mixed, and amine (0.007 g, 0.061 mmol) was added and the reactions stirred overnight. The reaction mixture was then concentrated to dryness and chromatographed (reverse-phase HPLC) to afford product Example 221 (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-(4-(2-(1H-pyrazol-1-yl)acetyl)piperazin-1-yl)-5-fluorophenyl)prop-1-en-2-yl)-10-hydroxy-3,7 -dimethyl-12-oxooxacyclododec-4-en-6-yl(pyridin-4-ylmethyl)carbamate (9.4 mg, 0.013 mmol, 65.4% yield).

(207) TABLE-US-00021 TABLE 21 Characterization of Compounds 221-253 Ex. Structure and IUPAC Chemical Name Characterization 221 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(pyridin-4-ylmethyl)carbamate LCMS (ESI, m/z), 703.4 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.92- 1.00 (m, 3 H) 1.01-1.11 (m, 3 H) 1.24- 1.46 (m, 2 H) 1.55-1.70 (m, 2 H) 1.87 (s, 3 H) 1.91-1.99 (m, 1 H) 2.42-2.53 (m, 1 H) 2.57-2.65 (m, 2 H) 3.18-3.29 (m, 4 H) 3.74 (br s, 4 H) 3.77-3.85 (m, 1 H) 4.26-4.37 (m, 2 H) 5.09-5.17 (m, 1 H) 5.20 (s, 2 H) 5.50-5.57 (m, 2 H) 6.33- 6.35 (m, 1 H) 6.50-6.54 (m, 1 H) 6.54- 6.56 (m, 1 H) 6.60-6.65 (m, 1 H) 6.65- 6.67 (m, 1 H) 6.86-6.93 (m, 1 H) 6.89 (d, J = 9.29 Hz, 1 H) 7.29-7.38 (m, 2 H) 7.49- 7.55 (m, 1 H) 7.62-7.66 (m, 1 H) 8.09- 8.16 (m, 2 H) 8.09-8.15 (m, 1 H) 8.42- 8.50 (m, 2 H) 222 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(pyrimidin-4-ylmethyl)carbamate LCMS (ESI, m/z), 704.5 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.98 (d, J = 6.78 Hz, 3 H) 1.06 (br d, J = 6.65 Hz, 3 H) 1.24-1.47 (m, 3 H) 1.55-1.69 (m, 2 H) 1.87 (s, 3 H) 1.91-2.01 (m, 1 H) 2.40- 2.52 (m, 1 H) 2.55-2.70 (m, 2 H) 3.16- 3.28 (m, 4 H) 3.67-3.76 (m, 4 H) 3.79 (s, 2 H) 4.39 (s, 2 H) 5.09-5.16 (m, 1 H) 5.20 (s, 2 H) 5.49-5.58 (m, 2 H) 6.30- 6.38 (m, 1 H) 6.55 (s, 2 H) 6.59-6.70 (m, 2 H) 7.52 (d, J = 1.63 Hz, 1 H) 7.64 (d, J = 2.13 Hz, 1 H) 8.71 (d, J = 5.27 Hz, 1 H) 9.00-9.11 (m, 1 H) 223 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] morpholine-4-carboxylate LCMS (ESI, m/z), 682.4 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (dd, J = 12.05, 6.78 Hz, 6 H) 1.26-1.45 (m, 2 H) 1.57-1.71 (m, 2 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.91-2.02 (m, 1 H) 2.43-2.52 (m, 1 H) 2.57-2.69 (m, 2 H) 3.18-3.28 (m, 4 H) 3.38-3.50 (m, 4 H) 3.60-3.67 (m, 4 H) 3.71-3.76 (m, 4 H) 3.78-3.84 (m, 1 H) 5.11-5.17 (m, 1 H) 5.18-5.22 (m, 2 H) 5.45-5.60 (m, 3 H) 5.49-5.59 (m, 1 H) 6.29-6.36 (m, 1 H) 6.48-6.58 (m, 2 H) 6.59-6.69 (m, 2 H) 7.51-7.53 (m, 1 H) 7.63-7.66 (m, 1 H) 224 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(dimethylamino)ethyl]carbamate LCMS (ESI, m/z), 683.6 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.93-1.10 (m, 6 H) 1.26-1.47 (m, 2 H) 1.55-1.74 (m, 2 H) 1.82-1.93 (m, 4 H) 2.43-2.54 (m, 6 H) 2.57-2.66 (m, 2 H) 2.68-2.77 (m, 1 H) 3.18-3.29 (m, 5 H) 3.68-3.75 (m, 3 H) 3.77-3.84 (m, 1 H) 5.10-5.17 (m, 1 H) 5.19-5.22 (m, 2 H) 5.41-5.58 (m, 3 H) 6.30-6.38 (m, 1 H) 6.47-6.56 (m, 2 H) 6.59-6.70 (m, 2 H) 7.49-7.56 (m, 1 H) 7.60-7.68 (m, 1 H) 225 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- methyl-1,4-diazepane-1-carboxylate LCMS (ESI, m/z), 709.5 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.95-1.01 (m, 3 H) 1.01-1.08 (m, 3 H) 1.26-1.49 (m, 3 H) 1.56-1.73 (m, 2 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.91-2.02 (m, 3 H) 2.42-2.55 (m, 4 H) 2.56-2.70 (m, 2 H) 2.81 (br d, J = 4.27 Hz, 4 H) 3.17- 3.29 (m, 5 H) 3.44-3.66 (m, 4 H) 3.67- 3.76 (m, 4 H) 3.77-3.86 (m, 1 H) 5.09- 5.17 (m, 1 H) 5.20 (s, 2 H) 5.49 (s, 2 H) 6.31-6.37 (m, 1 H) 6.46-6.58 (m, 2 H) 6.59-6.69 (m, 2 H) 7.48-7.55 (m, 1 H) 7.61-7.68 (m, 1 H) 226 [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[(4-methoxyphenyl)methyl]carbamate LCMS (ESI, m/z), 732.5 [M + H] .sup.1H NMR (400 MHz, CDC1.sub.3) δ ppm 0.82- 1.09 (m, 6 H) 1.17-1.34 (m, 2 H) 1.40- 1.58 (m, 1 H) 1.87 (d, J = 1.13 Hz, 5 H) 2.47-2.75 (m, 3 H) 3.08-3.22 (m, 4 H) 3.67-3.76 (m, 3 H) 3.80 (s, 5 H) 4.30 (br d, J = 5.40 Hz, 2 H) 4.78-4.86 (m, 1 H) 4.87-4.96 (m, 1 H) 5.07 (s, 2 H) 5.23- 5.29 (m, 1 H) 5.35-5.45 (m, 1 H) 5.61 (dd, J = 14.93, 9.91 Hz, 1 H) 6.35 (t, J = 2.07 Hz, 1 H) 6.47-6.63 (m, 4 H) 6.82- 6.89 (m, 2 H) 7.20 (brd, J = 8.41 Hz, 2 H) 7.52-7.59 (m, 2 H) 227 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1- carboxylate LCMS (ESI, m/z), 710.7 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.98 (d, J = 6.78 Hz, 3 H) 1.00-1.06 (m, 3 H) 1.26-1.45 (m, 2 H) 1.64 (br s, 2 H) 1.76-1.84 (m, 1 H), 1.87 (d, J = 1.25 Hz, 3 H) 1.90-2.02 (m, 1 H) 2.13-2.24 (m, 1 H) 2.36 (d, J = 4.64 Hz, 6 H) 2.42- 2.51 (m, 1 H) 2.56-2.67 (m, 2 H) 2.88- 2.98 (m, 1 H) 3.11-3.19 (m, 1 H) 3.19- 3.28 (m, 4 H) 3.52-3.62 (m, 1 H) 3.64- 3.70 (m, 1 H) 3.71-3.76 (m, 4 H) 3.77- 3.85 (m, 1 H) 5.09-5.18 (m, 1 H) 5.20 (s, 2 H) 5.48 (s, 2 H) 6.34 (s, 1 H) 6.48-6.57 (m, 2 H) 6.59-6.68 (m, 2 H) 7.47-7.55 (m, 1 H) 7.60-7.66 (m, 1 H) 228 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1- carboxylate LCMS (ESI, m/z), 710.6 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.98 (d, J = 6.65 Hz, 3 H) 1.00-1.08 (m, 3 H) 1.26-1.47 (m, 2 H) 1.55-1.71 (m, 2 H) 1.74-1.84 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.91-2.03 (m, 1 H) 2.09- 2.24 (m, 1 H) 2.35 (d, J = 3.64 Hz, 6 H) 2.42-2.50 (m, 1 H) 2.56-2.69 (m, 2 H) 2.82-3.02 (m, 1 H) 3.11-3.29 (m, 5 H) 3.52-3.70 (m, 2 H) 3.70-3.76 (m, 4 H) 3.78-3.86 (m, 1 H) 5.10-5.17 (m, 1 H) 5.18-5.23 (m, 2 H) 5.44-5.60 (m, 2 H) 6.31-6.37 (m, 1 H) 6.47-6.58 (m, 2 H) 6.59-6.69 (m, 2 H) 7.49-7.55 (m, 1 H) 7.61-7.67 (m, 1 H) 229 [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[(2S)-1-hydroxypropan-2-yl]carbamate LCMS (ESI, m/z), 670.4 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (br dd, J = 16.00, 6.71 Hz, 6 H) 1.12 (d, J = 6.65 Hz, 4 H) 1.34-1.45 (m, 2 H) 1.56-1.71 (m, 3 H) 1.87 (d, J = 1.13 Hz, 4 H) 2.41-2.53 (m, 1 H) 2.56-2.65 (m, 2 H) 3.16-3.26 (m, 3 H) 3.38-3.50 (m, 2 H) 3.60-3.69 (m, 1 H) 3.69-3.77 (m, 3 H) 3.77-3.86 (m, 1 H) 5.10-5.17 (m, 1 H) 5.20 (s, 2 H) 6.35 (t, J = 2.13 Hz, 1 H) 6.48-6.69 (m, 3 H) 7.52 (d, J = 1.76 Hz, 1 H) 7.64 (d, J = 2.26 Hz, 1H) 230 0 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3- oxopiperazine-1-carboxylate LCMS (ESI, m/z), 695.4 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.98 (d, J = 6.65 Hz, 3 H) 1.03 (d, J = 6.90 Hz, 3 H) 1.26-1.46 (m, 2 H) 1.58-1.72 (m, 2 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.94-2.05 (m, 1 H) 2.43-2.53 (m, 1 H) 2.58-2.70 (m, 2 H) 3.18-3.29 (m, 4 H) 3.32-3.36 (m, 2 H) 3.58-3.69 (m, 2 H) 3.69-3.77 (m, 4 H) 3.78-3.86 (m, 2 H) 3.99-4.14 (m, 2 H) 5.09-5.18 (m, 1 H) 5.20 (s, 2 H) 5.45-5.63 (m, 2 H) 6.29-6.39 (m, 1 H) 6.45-6.58 (m, 2H) 6.60-6.70 (m, 2 H) 7.49-7.54 (m, 1 H) 7.60-7.68 (m, 1 H) 231 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3R)-3-fluoropyrrolidine-1-carboxylate LCMS (ESI, m/z), 684.4 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.95- 1.07 (m, 6 H) 1.21-1.31 (m, 2 H) 1.33 (br d, J = 8.41 Hz, 2 H) 1.60-1.72 (m, 2 H) 1.87 (d, J = 0.75 Hz, 3 H) 1.91-2.07 (m, 2 H) 2.14-2.28 (m, 1 H) 2.42-2.52 (m, 1 H) 2.57-2.69 (m, 2 H) 3.18-3.28 (m, 4 H) 3.36-3.51 (m, 2 H) 3.52-3.68 (m, 2 H) 3.70-3.78 (m, 4 H) 3.79-3.86 (m, 1 H) 4.56 (s, 2 H) 5.11-5.17 (m, 2 H) 5.20 (s, 2 H) 5.51-5.63 (m, 2 H) 6.32- 6.37 (m, 1 H) 6.49-6.69 (m, 4 H) 7.49- 7.55 (m, 1 H) 7.61-7.66 (m, 1 H) 232 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,3,4-trimethylpiperazine-1-carboxylate LCMS (ESI, m/z), 723.6 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.95-1.04 (m, 6 H) 1.06 (s, 6 H) 1.27-1.46 (m, 3 H) 1.54-1.74 (m, 2 H) 1.82-1.90 (m, 3 H) 1.90-2.02 (m, 1 H) 2.24-2.35 (m, 3 H) 2.41-2.53 (m, 1 H) 2.53-2.69 (m, 4 H) 3.16-3.29 (m, 7 H) 3.49-3.59 (m, 2 H) 3.68-3.76 (m, 4 H) 3.78-3.86 (m, 1 H) 4.52-4.60 (m, 1 H) 5.10-5.18 (m, 1 H) 5.18-5.23 (m, 2 H) 5.49 (s, 5 H) 6.30-6.38 (m, 1 H) 6.47- 6.58 (m, 2 H) 6.60-6.70 (m, 2 H) 7.49- 7.55 (m, 1 H) 7.62-7.69 (m, 1 H) 233 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate LCMS (ESI, m/z), 723.5 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (dd, J = 14.18, 6.78 Hz, 6 H) 1.25-1.46 (m, 3 H) 1.60-1.69 (m, 2 H) 1.71-1.78 (m, 2 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.89-2.04 (m, 3 H) 2.43-2.68 (m, 8 H) 2.82 (s, 3 H) 3.18-3.28 (m, 7 H) 3.73 (br d, J = 5.27 Hz, 4 H) 3.78-3.86 (m, 1 H) 3.95-4.07 (m, 1 H) 4.53-4.60 (m, 2 H) 5.11-5.17 (m, 1 H) 5.20 (s, 2 H) 5.50- 5.58 (m, 2 H) 6.31-6.39 (m, 1 H) 6.49- 6.68 (m, 4 H) 7.51-7.56 (m, 1H) 7.63- 7.67 (m, 1 H) 234 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- (2-hydroxyethyl)piperazine-1-carboxylate LCMS (ESI, m/z), 725.5 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (dd, J = 10.35, 6.71 Hz, 6 H) 1.22-1.31 (m, 2 H) 1.32-1.45 (m, 2 H) 1.60-1.69 (m, 2 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.92- 2.00 (m, 1 H) 2.46-2.51 (m, 4 H) 2.52- 2.57 (m, 2 H) 2.58-2.67 (m, 2 H) 3.19- 3.28 (m, 5 H) 3.44-3.53 (m, 4 H) 3.66- 3.70 (m, 2 H) 3.72-3.77 (m, 4 H) 3.78- 3.86 (m, 1 H) 4.56 (s, 4 H) 5.10-5.17 (m, 1 H) 5.20 (s, 2 H) 5.46-5.61 (m, 2 H) 6.31-6.37 (m, 1 H) 6.49-6.57 (m, 2 H) 6.60-6.68 (m, 2 H) 7.49-7.54 (m, 1 H) 7.62-7.66 (m, 1 H) 235 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] piperazine-1-carboxylate LCMS (ESI, m/z), 681.4 [M + H] .sup.1H NMR (400 MHz, CDC1.sub.3) δ ppm 0.93- 1.04 (m, 6 H) 1.26 (br s, 3 H) 1.42-1.56 (m, 1 H) 1.75-1.84 (m, 1 H) 1.87 (s, 3 H) 1.89-2.01 (m, 1 H) 2.42-2.70 (m, 5 H) 3.11 (br s, 5 H) 3.42-3.59 (m, 3 H) 3.74 (s, 8 H) 4.83-4.99 (m, 1 H) 5.06 (s, 2 H) 5.20-5.31 (m, 1 H) 5.33-5.46 (m, 1 H) 5.54-5.66 (m, 1 H) 6.29-6.37 (m, 1 H) 6.42-6.57 (m, 4 H) 7.55 (d, J = 2.01 Hz, 2 H) 236 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- cycloheptylpiperazine-1-carboxylate LCMS (ESI, m/z), 778.0 [M + H] .sup.1H NMR (400 MHz, CDC1.sub.3) δ ppm 0.99 (br d, J = 6.53 Hz, 6 H) 1.16-1.33 (m, 3 H) 1.42- 1.70 (m, 19 H) 1.74-1.84 (m, 3 H) 1.87 (s, 3 H) 1.88-2.02 (m, 1 H) 2.18-2.33 (m, 2 H) 2.45-2.74 (m, 3 H) 2.81-3.02 (m, 3 H) 3.09-3.20 (m, 3 H) 3.25-3.50 (m, 4 H) 3.62-3.86 (m, 7 H) 4.04-4.32 (m, 2 H) 4.81-4.96 237 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- pyridin-4-ylpiperazine-1-carboxylate LCMS (ESI, m/z), 758.7 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.94-1.06 (m, 6 H) 1.28-1.46 (m, 2 H) 1.56-1.72 (m, 2 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.93-2.05 (m, 1 H) 2.37 (s, 1 H) 2.43-2.52 (m, 1 H) 2.57-2.71 (m, 2 H) 3.18-3.29 (m, 4 H) 3.53-3.61 (m, 4 H) 3.62-3.69 (m, 4 H) 3.71-3.77 (m, 4 H) 3.77-3.86 (m, 1 H) 4.86-4.91 (m, 1 H) 5.12-5.17 (m, 1 H) 5.20 (s, 2 H) 5.46-5.62 (m, 2 H) 6.32- 6.36 (m, 1 H) 6.48-6.57 (m, 2 H) 6.59- 6.69 (m, 2 H) 7.20-7.25 (m, 1 H) 7.50- 7.55 (m, 1 H) 7.63-7.67 (m, 1 H) 7.68- 7.74 (m, 1 H) 238 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- cyclohexylpiperazine-1-carboxylate LCMS (ESI, m/z), 763.7 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.94-1.07 (m, 6 H) 1.26-1.46 (m, 2 H) 1.56-1.72 (m, 2 H) 1.87 (d, J = 1.25 Hz, 5 H) 1.92-2.02 (m, 1 H) 2.40-2.52 (m, 1 H) 2.58-2.70 (m, 2 H) 2.84-2.98 (m, 3 H) 3.19-3.29 (m, 4 H) 3.45-3.64 (m, 4 H) 3.70-3.77 (m, 4 H) 3.78-3.86 (m, 1 H) 5.11-5.18 (m, 1 H) 5.20 (s, 2 H) 5.44-5.61 (m, 2 H) 6.34 (s, 1 H) 6.49-6.57 (m, 2 H) 6.60-6.68 (m, 2 H) 7.52 (d, J = 1.51 Hz, 1 H) 7.64 (d, J = 2.01 Hz, 1 H) 239 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(4-hydroxyphenyl)ethyl]-N- methylcarbamate LCMS (ESI, m/z), 746.8 [M + H] 240 0 (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-fluoro-5- morpholinophenyl)prop-1-en-2-yl)-10-hydroxy- 3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl 7-methyl-1,7-diazaspiro[3.5]nonane-1- carboxylate LCMS (ESI, m/z), 628.7 [M + H] 241 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] N-(3-morpholin-4- ylpropyl)carbamate LCMS (ESI, m/z), 632.4 [M + H] .sup.1H NMR (400 MHz, METHANOL-d4) δ ppm 0.95-1.07 (m, 6 H) 1.27-1.49 (m, 4 H) 1.58-1.74 (m, 2 H) 1.78-1.87 (m, 2 H) 1.88-1.91 (m, 3 H) 1.92-2.02 (m, 1 H) 2.42-2.54 (m, 1 H) 2.58-2.67 (m, 2 H) 2.68 (s, 3 H) 3.04- 3.14 (m, 2 H) 3.15-3.21 (m, 4 H) 3.76- 3.79 (m, 1 H) 3.81 (s, 2H) 3.81-3.94 (m, 7 H) 4.76-4.83 (m, 1 H) 5.09-5.21 (m, 1 H) 5.45-5.62 (m, 2 H) 6.47-6.66 (m, 4 H) 242 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] N-[2- (dimethylamino)ethyl]carbamate LCMS (ESI, m/z), 576.6 [M + H] 243 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1- carboxylate LCMS (ESI, m/z), 602.6 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 0.94-1.06 (m, 6 H) 1.24-1.47 (m, 2 H) 1.55-1.70 (m, 2 H) 1.72-1.82 (m, 1 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.91-2.02 (m, 1 H) 2.09-2.21 (m, 1 H) 2.29 (s, 6 H) 2.39-2.52 (m, 1 H) 2.56-2.68 (m, 2 H) 2.75-2.88 (m, 1 H) 3.10-3.19 (m, 5 H) 3.52-3.71 (m, 2 H) 3.76-3.88 (m, 5 H) 4.72-4.82 (m, 1 H) 5.09-5.18 (m, 1 H) 5.42-5.60 (m, 2 H) 6.46-6.65 (m, 4 H) 244 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1- carboxylate LCMS (ESI, m/z), 602.6 [M + H 1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (dd, J = 18.89, 6.71 Hz, 6 H) 1.36 (br d, J = 19.58 Hz, 2 H) 1.64 (br t, J = 3.01 Hz, 2 H) 1.74-1.85 (m, 1 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.90- 2.02 (m, 1 H) 2.10-2.21 (m, 1 H) 2.31 (s, 6 H) 2.40-2.51 (m, 1 H) 2.66 (s, 2 H) 2.76-2.94 (m, 1 H) 3.09-3.19 (m, 5 H) 3.47-3.73 (m, 2 H) 3.75-3.86 (m, 5 H) 5.08-5.18 (m, 1 H) 5.40-5.60 (m, 2 H) 6.43-6.68 (m, 4 H) 245 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] N-(2-cyanoethyl)-N-methylcarbamate LCMS (ESI, m/z), 572.5 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 0.98 (d, J = 6.78 Hz, 6 H) 1.24-1.48 (m, 2 H) 1.56-1.73 (m, 2 H) 1.87 (d, J = 1.13 Hz, 3 H) 1.93-2.05 (m, 1 H) 2.42-2.52 (m, 1 H) 2.57-2.68 (m, 2 H) 2.68-2.76 (m, 2 H) 2.94-3.03 (m, 3 H) 3.10-3.18 (m, 4 H) 3.47-3.65 (m, 2 H) 3.75-3.86 (m, 5 H) 5.10-5.18 (m, 1 H) 5.45-5.60 (m, 2 H) 6.45-6.66 (m, 4 H) 246 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] 3,3,4-trimethylpiperazine-1- carboxylate LCMS (ESI, m/z), 616.6 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 0.89- 1.09 (m, 11 H) 1.25-1.48 (m, 2 H) 1.56- 1.72 (m, 2 H) 1.87 (d, J = 1.25 Hz, 3 H) 1.91-2.05 (m, 1 H) 2.27 (s, 3 H) 2.42-2.53 (m, 1 H) 2.66 (s, 4 H) 3.10-3.18 (m, 4 H) 3.20- 3.28 (m, 2 H) 3.41-3.63 (m, 2 H) 3.81 (dd, J = 10.54, 5.65 Hz, 5 H) 5.09-5.20 (m, 1 H) 5.40-5.62 (m, 2 H) 6.44-6.66 (m, 4 H) 247 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] (3R)-3-fluoropyrrolidine-1- carboxylate LCMS (ESI, m/z), 577.5 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 0.93-1.06 (m, 6 H) 1.25-1.49 (m, 2 H) 1.56-1.74 (m, 2 H) 1.87 (d, J = 1.00 Hz, 3 H) 1.96 (brs, 3 H) 2.40-2.51 (m, 1 H) 2.43-2.51 (m, 1 H) 2.57-2.65 (m, 2 H) 2.66 (s, 4 H) 3.10- 3.19 (m, 4 H) 3.37-3.51 (m, 1 H) 3.53- 3.73 (m, 2 H) 3.76-3.87 (m, 5 H) 5.09- 5.34 (m, 1 H) 5.09-5.16 (m, 1 H) 5.15- 5.21 (m, 1 H) 5.28-5.34 (m, 1 H) 5.41- 5.62 (m, 2 H) 6.43-6.65 (m, 4 H) 248 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3- (dimethylsulfamoylamino)-5-fluorophenyl]prop- 1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine- 1-carboxylate LCMS (ESI, m/z), 625.5 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (dd, J = 14.31, 6.78 Hz, 6 H) 1.25-1.47 (m, 2 H) 1.56-1.72 (m, 2 H) 1.88 (d, J = 1.13 Hz, 3 H) 1.93-2.04 (m, 1 H) 2.39 (s, 3 H) 2.44-2.56 (m, 4 H) 2.57- 2.64 (m, 2 H) 2.80 (s, 7 H) 3.42-3.59 (m, 4 H) 3.76-3.88 (m, 1 H) 5.09-5.19 (m, 1 H) 5.49 (s, 3 H) 6.53 (s, 1 H) 6.68- 6.76 (m, 1 H) 6.82-6.90 (m, 1 H) 6.90- 6.98 (m, 1 H) 249 [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5- [(2-methoxyacetyl)amino]phenyl]prop-1-en-2- yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine- 1-carboxylate LCMS (ESI, m/z), 590.6 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 1.00 (dd, J = 10.67, 6.78 Hz, 6 H) 1.25-1.45 (m, 2 H) 1.57-1.70 (m, 2 H) 1.89 (d, J = 1.25 Hz, 3 H) 1.92-2.00 (m, 1 H) 2.30 (s, 3 H) 2.35-2.43 (m, 4 H) 2.44- 2.51 (m, 1 H) 2.58-2.68 (m, 2 H) 3.48 (s, 6 H) 3.79 (s, 1 H) 4.03 (s, 2 H) 5.14 (d, J = 10.54 Hz, 1 H) 5.49 (s, 2 H) 6.55 (s, 1 H) 6.76-6.81 (m, 1 H) 7.33-7.37 (m, 1 H) 7.41-7.47 (m, 1 H) 250 0 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(2- cyclopropylacetyl)amino]-5-fluorophenyl]prop- 1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine- 1-carboxylate LCMS (ESI, m/z), 600.6 [M + H] 1H NMR (400 MHz, METHANOL-d4) δ ppm 0.21- 0.27 (m, 2 H) 0.54-0.61 (m, 2 H) 1.00 (dd, J = 10.79, 6.78 Hz, 6 H) 1.12 (s, 1 H) 1.34 (br s, 2 H) 1.57-1.73 (m, 2 H) 1.89 (d, J = 1.25 Hz, 3 H) 1.92-2.01 (m, 1 H) 2.24-2.29 (m, 2 H) 2.30 (s, 3 H) 2.34- 2.43 (m, 4 H) 2.43-2.53 (m, 1 H) 2.57- 2.69 (m, 2 H) 3.39-3.58 (m, 4 H) 3.79 (s, 1 H) 5.14 (d, J = 10.67 Hz, 1 H) 5.44-5.61 (m, 3 H) 6.54 (s, 1 H) 6.71-6.80 (m, 1 H) 7.26 (s, 1 H) 7.36-7.45 (m, 1 H) 251 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- [(3-hydroxyphenyl)methyl]piperazine-1- carboxylate LCMS (ESI, m/z), 787.7 [M + H] 252 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4- (2-pyrazol-1-ylacetyl)piperazin-1- yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- (pyridin-3-ylmethyl)piperazine-1-carboxylate LCMS (ESI, m/z), 772.7 [M + H] 253 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1- acetylpiperidin-4-yl)-7-fluorobenzotriazol-5- yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12- oxo-1-oxacyclododec-4-en-6-yl] piperazine-1- carboxylate LCMS (ESI, m/z), 655.8 [M + H] .sup.1H NMR (400 MHz, CDCl.sub.3) d ppm 1.03 (br dd, J = 6.78, 4.14 Hz, 12 H) 1.22-1.36 (m, 2 H) 1.45-1.67 (m, 3 H) 1.74-1.87 (m, 1 H) 1.88-1.94 (m, 3 H) 1.94-2.00 (m, 1 H) 2.20 (s, 3 H) 2.22-2.32 (m, 3 H), 2.35-2.54 (m, 2 H) 2.54-2.72 (m, 3 H) 2.72-2.90 (m, 4 H) 2.91-3.12 (m, 2 H) 3.31-3.48 (m, 5 H) 3.68-,3.81 (m, 1 H) 4.04-4.15 (m, 1 H) 4.68-4.80 (m, 1 H) 4.80-4.93 (m, 2 H) 5.26-5.34 (m, 1 H) 5.39-5.49 (m, v1 H) 5.56-5.68 (m, 1 H) 6.65-6.75 (m, 1 H) 6.92-7.04 (m, 1 H) 7.11-7.18 (m, 1 H)

(208) Compounds 254-261 were synthesized according to the general methods of Procedure 36.

(209) Procedure 36.

(210) ##STR00364##

(211) Step 1: To a stirred solution of iodide (008) (120 mg, 0.225 mmol) and boronate (063) (63 mg, 0.269 mmol) in 3.4 ml of p-dioxane were added silver oxide (156 mg, 0.674 mmol) and tetrakis(triphenylphosphine)palladium(0) (25.9 mg, 0.022 mmol). The mixture was degassed and heated to 80° C. for 60 minutes. Upon completion by UPLC, the reaction mixture was cooled to room temperature, filtered, and concentrated. Purification by column chromatography eluting with a 0-20% MeOH/DCM gradient afforded (064) (59 mg, 51% yield) as a colorless oil. LCMS (ESI, m/z), 515.5 [M+H].sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) d ppm 1.00 (m, 6H) 1.14-1.36 (m, 2H) 1.50 (m, 1H) 1.64-1.84 (m, 1H) 1.84-1.94 (m, 4H) 2.29 (s, 3H) 2.35 (br s, 4H) 2.45-2.66 (m, 3H) 3.48 (br s, 4H) 3.59-3.76 (m, 1H) 4.69 (s, 2H) 4.88 (t, J=10.04 Hz, 1H) 5.28 (d, J=10.54 Hz, 1H) 5.40 (dd, J=14.93, 9.66 Hz, 1H) 5.60 (dd, J=14.93, 9.91 Hz, 1H) 6.59 (s, 1H) 7.18-7.35 (m, 4H).

(212) Step 2: To a stirred solution of (064) (59 mg, 0.115 mmol) in 2 ml of 1,2-dichloroethane at 0° C. was added 4-nitrophenyl carbonochloridate (27.7 mg, 0.138 mmol), triethylamine (0.083 ml, 0.573 mmol), then N,N-dimethylpyridine-4-amine (2.8 mg, 0.023 mmol). The mixture stirred at 0° C. for 21 h. Completion was determined by UPLC.

(213) Step 3: To the mixture from the previous step containing (065) (approximately 7.8 mg, 0.011 mmol) in 200 uL of 1,2-dichloroethane was added (R)-pyrrolidin-3-ol (066) (4 mg, 0.046 mmol). The resulting mixture was stirred at room temperature. Upon completion by UPLC, the reaction mixture was concentrated. Purification by HPLC afforded the title compound Example 254 (3.4 mg, 49% yield).

(214) TABLE-US-00022 TABLE 22 Characterization of Compounds 254-261 Ex. Structure and IUPAC Chemical Name Characterization 254 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3- [[(3R)-3-hydroxypyrrolidine-1- carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 628.5 [M + H].sup.+. .sup.1H NMR (400 MHz, DMSO-d6) d ppm 0.89- 0.90 (m, J = 6.78 Hz, 6 H) 1.15-1.35 (m, 3 H) 1.40-1.52 (m, 2 H) 1.72-1.90 (m, 6 H) 2.11-2.32 (m, 6 H) 2.54-2.59 (m, 4 H) 3.27-3.36 (m, 1 H) 3.40-3.49 (m, 7 H) 3.62-3.79 (m, 1 H) 4.30-4.35 (m, 1 H) 4.61-4.72 (m, 2 H) 4.94-5.09 (m, 3 H) 5.37-5.50 (m, 2 H) 6.5 (s, 1 H) 7.23- 7.30 (m, 3 H) 7.36 (m, 1 H). 255 [3-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7- dimethyl-6-(4-methylpiperazine-1-carbonyl)oxy- 12-oxo-1-oxacyclododec-4-en-2-yl]prop-1- enyl]phenyl]methyl 2-oxa-7-azaspiro[3.4]octane- 7-carboxylate LCMS (ESI, m/z), 254.6 [M + H]+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.65 Hz, 6 H) 1.14-1.36 (m, 3 H) 1.40-1.57 (m, 2 H) 1.76-1.87 (m, 4 H) 2.07-2.19 (m, 2 H) 2.19-2.46 (m, 5H) 2.52-2.59 (m, 4 H) 3.31-3.57 (m, 8 H) 3.71 (m, 1 H) 4.43 (m, 2 H) 4.48-4.55 (m, 2 H) 4.61-4.73 (m, 2 H) 4.98-5.09 (m, 3 H) 5.37-5.50 (m, 2 H) 6.54 (br s, 1 H) 7.22-7.29 (m, 3 H) 7.31-7.43 (m, 1 H) 256 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[2- [(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]pyridin- 4-yl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 630.6 [M + H].sup.+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.65 Hz, 6 H) 1.14-1.36 (m, 2 H) 1.47 (br d, J = 8.78 Hz, 2 H) 1.81 (br s, 4 H) 1.98-2.19 (m, 2 H) 2.19-2.37 (m, 5 H) 2.52-2.59 (m, 4 H) 3.29-3.59 (m, 9 H) 3.65-3.92 (m, 1 H) 4.60-4.75 (m, 2 H) 5.0 (m, 1H) 5.08 (s, 2 H) 5.23 (s, 1 H) 5.37-5.49 (m, 2H) 6.55 (s, 1 H) 7.23- 7.30 (m, 3 H) 7.32-7.47 (m, 1 H) 257 [3-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7- dimethyl-6-(4-methylpiperazine-1-carbonyl)oxy- 12-oxo-1-oxacyclododec-4-en-2-yl]prop-1- enyl]phenyl]methyl morpholine-4-carboxylate LCMS (ESI, m/z), 628.6 [M + H]+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.78 Hz, 6H) 1.11-1.36 (m, 3 H) 1.37-1.63 (m, 2 H) 1.73-1.89 (m, 4 H) 2.12-2.31 (m, 5 H) 2.52-2.62 (m, 4 H) 3.28-3.47 (m, 8 H) 3.53-3.56 (m, 4 H), 3.65-3.81 (m, 1 H) 4.58-4.76 (m, 2 H) 4.97-5.06 (m, 1 H) 5.09 (s, 2 H) 5.33- 5.53 (m, 2 H) 6.47-6.58 (m, 1 H) 7.20- 7.31 (m, 3 H) 7.33-7.46 (m, 1 H). 258 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3- (dimethylcarbamoyloxymethyl)phenyl]prop-1-en- 2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-methylpiperazine-1- carboxylate LCMS (ESI, m/z), 586.5 [M + H]+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.78 Hz, 6 H) 1.11-1.37 (m, 3 H) 1.40-1.57 (m, 2 H) 1.82 (s, 4 H) 2.23 (m, 5 H) 2.54-2.58 (m, 4 H) 2.85 (m, 6 H) 3.38-3.49 (m, 4 H) 3.64-3.77 (m, 1 H) 4.59-4.75 (m, 2 H) 5.05 (s, 3 H) 5.34- 5.53 (m, 2 H) 6.49-6.59 (m, 1 H) 7.20- 7.30 (m, 3 H) 7.30-7.44 (m, 1 H). 259 0 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3- [[(2R)-2-(hydroxymethyl)pyrrolidine-1- carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 642.6 [M + H]+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.78 Hz, 6 H) 1.14-1.36 (m, 3 H) 1.37-1.52 (m, 2 H) 1.73-1.87 (m, 9 H) 2.20-2.46 (m, 5 H) 2.52-2.61 (m, 4 H) 3.25-3.53 (m, 4 H) 3.52 (m, 2H) 3.63- 3.82 (m, 3 H) 4.61-4.73 (m, 2 H) 4.73- 4.83 (m, 1 H) 5.05 (s, 3 H) 5.30-5.58 (m, 2 H) 6.42-6.59 (m, 1 H) 7.25 (s, 3 H) 7.31-7.44 (m, 1 H) 260 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[[(3R)-3- fluoropyrrolidine-1- carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4- en-6-yl] 4-methylpiperazine-1-carboxylate LCMS (ESI, m/z), 630.6 [M + H].sup.+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.65 Hz, 6 H) 1.14-1.36 (m, 2 H) 1.47 (br d, J = 8.78 Hz, 2 H) 1.81 (br s, 4 H) 1.98-2.19 (m, 2 H) 2.19-2.37 (m, 5 H) 2.52-2.59 (m, 4 H) 3.29-3.59 (m, 9 H) 3.65-3.92 (m, 1 H) 4.60-4.75 (m, 2 H) 5.0 (m, 1H) 5.08 (s, 2 H) 5.23 (s, 1 H) 5.37-5.49 (m, 2H) 6.55 (s, 1 H) 7.23- 7.30 (m, 3 H) 7.32-7.47 (m, 1 H). 261 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3- [(4-hydroxypiperidine-1- carbonyl)oxymethyl]phenyl]prop-1-en-2-yl]-3,7- dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4- methylpiperazine-1-carboxylate LCMS (ESI, m/z), 642.6 [M + H]+. 1H NMR (400 MHz, DMSO-d6) d ppm 0.89 (d, J = 6.65 Hz, 6 H) 1.13-1.38 (m, 2 H) 1.40-1.57 (m, 1 H) 1.62-1.75 (m, 2 H) 1.78-1.88 (m, 4 H) 2.23-2.46 (m, 5 H) 2.52-2.60 (m, 4 H) 2.91-3.17 (m, 4 H) 3.24-3.45 (m, 4 H) 3.56-3.83 (m, 3 H) 4.56-4.73 (m, 3 H) 4.78 (d, J = 4.02 Hz, 2 H) 4.92-5.15 (m, 3 H) 5.43 (m, 3 H) 6.53 (s, 1 H) 7.18-7.27 (m, 3 H) 7.30-7.42 (m, 1 H).

(215) Compounds 262 and 263 were synthesized according to the general methods of Procedures 37 and 38.

(216) Procedure 37.

(217) ##STR00373##

(218) Step 1: A solution of DMAP (140 mg, 1.148 mmol), N1,N1,N8,N8-tetramethylnaphthalene-1,8-diamine (246 mg, 1.148 mmol) and triethylamine (0.667 ml, 4.878 mmol) in 9 ml diethyl ether was stirred for 60 mins at room temperature. To this mixture was added iodide (005) (500 mg, 0.957 mmol) as a solution in 3 mL diethyl ether (dropwise over 2 min) and stirred at room temperature for 7 h. At this point, 1,4′-bipiperidine (066) (725 mg, 4.306 mmol) was added and the mixtured stirred for 19 h. The mixture was diluted with 10:1 heptane/MTBE and the organics washed multiple times with 1:1 saturated sodium bicarbonate solution/1M NaOH. The organics were then washed with brine and concentrated. The crude product was purified by flash chromatography through silica gel with MeOH/EtOAc gradient to isolate (067) (600 mg, 87%). 1H NMR (400 MHz, CDCl.sub.3) d ppm 0.88 (d, J=3.76 Hz, 6H) 1.68-1.74 (m, 12H) 1.78 (d, J=6.78 Hz, 3H) 2.03 (m, 1H) 2.18 -2.42 (m, 12H) 2.61 (s, 6H) 3.13-3.35 (m, 8H) 3.47-3.62 (m, 2H) 4.64-4.71 (m, 1H) 5.01(m, 1H) 5.60 (t, J=9.72 Hz, 1H) 5.90 (d, J=10.67 Hz, 1H) 6.15-6.33 (m, 2H) 8.08 (s, 1H).

(219) Step 2: A solution of bipiperidine (067) (600 mg, 0.837 mmol) in 6 ml methanol was added 4-methylbenzenesulfonic acid hydrate (478 mg, 2.51 mmol) and stired for 2 h. At this time, excess triethylamine was added and concentrated. Diluted in ethyl acetate, washed with saturated sodium bicarbonate solution, then brine. The organics were dried with sodium sulfate, filtered, and concentrated. The crude mixture was purified by flash chromatography through silica gel to deliver (068) (456 mg, 90%). LCMS (ESI, m/z), 603.4 [M+H]+. 1H NMR (400 MHz, CDCl.sub.3) d ppm 0.90 (d, J=6.65 Hz, 3H) 0.98 (d, J=6.90 Hz, 3H) 1.12-1.30 (m, 2H) 1.34-1.50 (m, 4H) 1.57 (m, 4H) 1.74-1.85 (m, 6H) 1.90 (m, 1H) 1.99 (s, 1H) 2.35-2.54 (m, 6H) 2.57-2.76 (m, 3H) 3.48 (s, 1H) 3.71 (br dd, J=6.53, 3.26 Hz, 1H) 4.16 (br d, J=11.04 Hz, 2H) 4.83 (t, J=10.04 Hz, 1H) 5.25-5.40 (m, 2H) 5.47-5.55 (m, 1H) 6.47 (d, J=1.00 Hz, 1H) 7.26 (s, 1H).

(220) Step 3: Example 262 was synthesized following the procedure described in Procedure 5, by substituting dipiperidine (068) and 4-(3-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)morpholine to deliver the title compound Example 262. LCMS (ESI, m/z), 656.6 [M+H]+. 1H NMR (400 MHz, CDCl.sub.3) d ppm 0.99 (m, 6H) 1.18-1.31 (m, 3H) 1.36-1.56 (m, 4H) 1.59 (br s, 4H) 1.82 (m, 4H) 1.86 (s, 3H) 1.91 (m, 1H) 2.41 (m, 1H) 2.47-2.65 (m, 6H) 2.72 (m, 2H) 3.12-3.17 (m, 4H) 3.37 (br s, 1H) 3.72 (br s, 1H) 3.82-3.87 (m, 4H) 4.09-4.26 (m, 2H) 4.86 (t, J=10.04 Hz, 1H) 5.23-5.26 (m, 1H) 5.39 (dd, J=15.06, 9.66 Hz, 1H) 5.58 (dd, J=14.93, 9.91 Hz, 1H) 6.45-6.53 (m, 4H).

(221) Procedure 38.

(222) ##STR00374##

(223) Step 1: The compound was synthesized following the procedure described in Procedure 5 by substituting dipiperidine (068) and boronate (069) (38.7 mg, 0.10 mmol) to dipiperidine (070). LCMS (ESI, m/z), 738.5 [M+H]+. 1H NMR (400 MHz, CDCl.sub.3) d ppm 0.99 (t, J=6.27 Hz, 6H) 1.15-1.36 (m, 2H) 1.39-1.56 (m, 13H) 1.64 (br s, 4H) 1.74-1.95 (m, 7H) 2.17 (s, 1H) 2.46-2.66 (m, 8H) 2.73 (br t, J=12.11 Hz, 2H) 3.04-3.20 (m, 4H) 3.53-3.61 (m, 4H) 3.72 (br s, 1H) 4.12-4.32 (m, 2H) 4.87 (t, J=10.04 Hz, 1H) 5.27 (d, J=10.54 Hz, 1H) 5.39 (dd, J=14.93, 9.66 Hz, 1H) 5.59 (dd, J=15.00, 9.98 Hz, 1H) 6.55 (s, 1H) 6.78-6.83 (m, 3H) 7.21-7.27 (m, 2H).

(224) Step 2. To a stirred solution of dipiperidine (070) (19 mg, 0.026 mmol) (Example 8, Step b) in 7.7 ml DCM at 0° C. was added TFA (40 ul, 0.516 mmol). The mixture was warmed to room temperature and stirred for 2 days. At that point, the reaction was diluted in DCM, washed with saturated sodium bicarbonate solution, dried with sodium sulfate, filtered and concentrated. The crude was purified through flash chromatography through C-18 column with acetonitrile/water gradient to deliver (071) (11 mg, 67%). LCMS (ESI, m/z), 328.9 [(M+Na+H)/2]+.

(225) Step 3. To a stirred solution of dipiperidine (071) (11 mg, 0.017 mmol) in 0.2 ml DCM was added 2-bromoethanol (072) (2.45 ul, 0.035 mmol) and triethylamine (9.6 ul, 0.069 mmol). The mixture was stirred until completion of the reaction based on LC/MS. At that point, the reaction was diluted in DCM, washed with saturated sodium bicarbonate solution, dried with sodium sulfate, filtered and concentrated. The crude material was purified by flash chromatography through silica gel to deliver the title compound Example 263 (8.4 mg, 71%).

(226) TABLE-US-00023 TABLE 23 Characterization of Compounds 262-263 Ex. Structure and IUPAC Chemical Name Characterization 262 [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5- morpholin-4-ylphenyl)prop-1-en-2-yl]-10- hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec- 4-en-6-yl] 4-piperidin-1-ylpiperidine-1- carboxylate LCMS (ESI, m/z), 656.6 [M + H]+. 1H NMR (400 MHz, CDCl.sub.3) d ppm 0.99 (m, 6 H) 1.18-1.31 (m, 3 H) 1.36-1.56 (m, 4 H) 1.59 (br s, 4 H) 1.82 (m, 4H) 1.86 (s, 3H) 1.91 (m, 1 H) 2.41 (m, 1 H) 2.47-2.65 (m, 6 H) 2.72 (m, 2H) 3.12- 3.17 (m, 4 H) 3.37 (br s, 1 H) 3.72 (br s, 1 H) 3.82-3.87 (m, 4 H) 4.09-4.26 (m, 2 H) 4.86 (t, J = 10.04 Hz, 1 H) 5.23-5.26 (m, 1 H) 5.39 (dd, J = 15.06, 9.66 Hz, 1 H) 5.58 (dd, J = 14.93, 9.91 Hz, 1 H) 6.45- 6.53 (m, 4 H) 263 [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3- [4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop- 1-en-2-yl]-3,7-dimethyl-12-oxo-1- oxacyclododec-4-en-6-yl] 4-piperidin-1- ylpiperidine-1-carboxylate LCMS (ESI, m/z), 681.6 [M + H]+. 1H NMR (400 MHz, METHANOL-d4) d ppm 1.00 (m, 6 H) 1.23-1.51 (m, 3 H) 1.52-1.61 (m, 2 H) 1.65 (br s, 4 H) 1.70 (br s, 1H) 1.80-2.02 (m, 9 H) 2.06-2.16 (m, 3 H) 2.47 (dd, J = 13.99, 5.33 Hz, 1 H) 2.54-2.72 (m, 2 H) 2.76-2.90 (m, 4 H) 2.90-3.00 (m, 4 H) 3.06-3.23 (m, 4 H) 3.23-3.28 (m, 4 H) 3.79 (br t, J = 5.52 Hz, 3 H) 4.29 (m, 2 H) 5.15 (d, J = 10.54 Hz, 1 H) 5.44-5.60 (m, 2 H) 6.57 (s, 1 H) 6.80- 6.93 (m, 3 H) 7.24 (t, J = 7.91 Hz, 1 H)

BIOLOGICAL METHODS AND MATERIALS

(227) Scintillation Proximity Assay (SPA) with [.sup.3-H]-Labelled Pladienolide Probe

(228) Batch immobilization of anti-SF3B1 antibody (MBL) to anti-mouse PVT SPA scintillation beads (PerkinElmer) was prepared as follows: for every 2.5 mg of nuclear extracts, 5 μg anti-SF3B1 antibody and 1.5 mg of beads were mixed in 150 μl PBS. The antibody-bead mixture was incubated for 30 min at RT and centrifuged at 18,000 g for 5 min. 150 μl PBS was used to resuspend every 1.5 mg antibody-bead mixture. The beads were suspended and added to the prepared nuclear extracts. The slurry was incubated for 2 h at 4° C. with gentle mixing. The beads were then collected by centrifuging at 18,000 g for 5 min, and washed twice with PBS+0.1% Triton X-100. After a final centrifugation step, every 1.5 mg of beads was suspended with 150 μl of PBS. The SF3b complexes were tested for [.sup.3H]-labelled pladienolide probe binding ([.sup.3H]—PB), synthesized as previously described (Kotake et al., 2007). 100 μl binding reactions were prepared with 50 μl bead slurry and by adding varying concentrations of PB or PB—OH, and after 30 min pre-incubation, 2.5 nM [.sup.3H]—PB was added. The mixture was incubated for 30 min, and luminescence signals were read using a MicroBeta2 Plate Counter (PerkinElmer). Prism 6 (Graphpad) was used for non-linear regression curve fitting of the data. a. b. HeLa nuclear extract preparation (for in vitro splicing modulation assay below) c. HeLa S3 cell pellets were resuspended in hypotonic buffer (10 mM HEPES pH 7.9, 1.5 mM MgCl.sub.2, 10 mM KCl, 0.2 mM PMSF, and 0.5 mM DTT) and the suspension was brought up to a total of 5 packed cell volume (PCV). After centrifugation, the supernatant was discarded, and the cells were brought up to 3 PCV with hypotonic buffer and incubated on ice for 10 minutes. Cells were lysed using a dounce homogenizer and then centrifuged. The supernatant was discarded, and the pellet was resuspended with ½ packed nuclear volume (PNV) of low salt buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl.sub.2, 20 mM KCl, 0.2 mM EDTA, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT), followed by ½ PNV of high salt buffer (same as low salt buffer except 1.4 M KCl was used). The nuclei were gently mixed for 30 minutes before centrifuging. The supernatant (nuclear extract) was then dialyzed into storage buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 0.2 mM PMSF, 0.5 mM DTT). Protein concentration was determined using NanoDrop 8000 UV-Vis spectrophotometer (ThermoFisher Scientific). d. In vitro splicing assay (IVS)

(229) All Ad2-derived (Pellizzoni et al., 1998) sequences were cloned into pcDNA3.1(+) vector (Promega) using 5′ EcoRI and 3′ XbaI restriction sites. The plasmids were linearized using XbaI and used as DNA templates in the in vitro transcription reactions. The FtzΔi intron-less plasmid (Luo and Reed, 1999) was linearized using EcoRI. All RNAs were in vitro transcribed and then purified using MEGAScript T7 (Invitrogen) and MegaClear (Invitrogen) kits, respectively. For splicing reactions using Ad2 variant pre-mRNAs, 1 μL reactions were prepared using 8 μg nuclear extracts prepared from HeLa S3, 2 ng pre-mRNA, 0.2 ng FTZΔi, and varying concentrations of exemplary payloads or DMSO. After a 15 minute pre-incubation at 30° C., 1 μL splicing activation buffer (0.5 mM ATP, 20 mM creatine phosphate, 1.6 mM MgCl.sub.2) was added, and the reactions were incubated for 90 minutes at 30° C. The reactions were then quenched with 13 μL it DMSO, and 25 nL was used for RT-qPCR. RT-qPCR reactions were prepared using TaqMan RNA-to-C.sub.T 1-step kit (Life Technologies), RNA from splicing reactions, Ad2 (forward: ACTCTCTTCCGCATCGCTGT; reverse: CCGACGGGTTTCCGATCCAA; probe: CTGTTGGGCTCGCGGTTG) and Ftz (forward: TGGCATCAGATTGCAAAGAC; reverse: ACGCCGGGTGATGTATCTAT; probe: CGAAACGCACCCGTCAGACG) mRNA primer-probe sets. Prism 6 (Graphpad) was used for non-linear regression curve fitting of the formed spliced product and normalized to the control (DMSO) sample.

(230) Cell Lines

(231) Panc 10.05 (CRL-2547), Panc 05.04 (CRL-2557), NCI-H1568 (CRL-5876) and NCI-H1650 (CRL-5883) were purchased from ATCC. Cell lines were maintained in RPMI-1640 (ATCC 30-2001) supplemented with 10% fetal bovine serum (FBS). The Panc lines were supplemented in addition with insulin and FBS up to 15% total. Panc 10.05 are WT for SF3b whereas Panc 05.04 are SF3b K700E mutant and have differential sensitivity to SF3b modulators.

(232) NCI-H1568 cells express high MCL1 and undergo apoptosis upon SF3b modulator treatment, whereas NCI-H1650 are not dependent on MCL1 and therefore insensitive to SF3b modulator treatment, showing only cytostasis but no lethality (Aird et al., (2015). Abstract C8: Targeting MCL1-dependent cancers with SF3B splicing modulators. Molecular Cancer Therapeutics. 14. C8-C8. 10.1158/1535-7163.TARG-15-C8.).

(233) Compound Preparation and Presentation to Cells

(234) Compounds for assay were prepared as stocks in 90% dimethyl sulfoxide (DMSO), assessed for purity by LC/MS, and serially diluted in DMSO using a low-volume liquid handler (VIAFLO ASSIST and VIAFLO II electronic 16-channel pipette, 0.5-12.5 μL) in an 11-point half-log serial dilution to create a master dose response (MDR) source used for all tests.

(235) Transfer of compounds from the MDR source plate to cell assay-ready plates were accomplished directly by low-energy acoustic transfer (ATS100, EDC Biosystems). After transfer of compounds to the assay plate, the dose-response range experienced by cells was typically 10 μM-100 pM (5 logs), and final DMSO concentration in the assay was 0.1%, uniformly. Each assay plate was self-anchored containing vehicle/DMSO negative controls, medium-only/positive controls, and cidal control dose-responses of bortezomib and staurosporine. Assay-ready plates were heat-sealed and stored at −20° C. until used, no longer than one month.

(236) On the day of assay, cells were harvested, diluted from 37,500 to 25,000 cells per mL, and then 50 μL (750-500 cells) were dispensed onto assay-ready plates using a bulk liquids reagent dispenser (Using a Multidrop™ Combi Reagent Dispenser, Thermo Scientific). A DMSO-matched time zero (T0) plate was read and then all other plates were incubated at 37° C. with 5% CO.sub.2 and 95% relative humidity until the end of assay. Cell proliferation and viability assays were performed 72 hours post-treatment depending on cell growth where at least one doubling would have occurred.

(237) Measurement of Anti-proliferative Activity of Treated Cells

(238) Assessment of viability and proliferation was by measurement of cell ATP content using CellTiter-Glo® Luminescent Cell Viability Assay reagent (Promega) according to the manufacturer's instructions (CellTiter-Glo® Luminescent Cell Viability Assay Technical Bulletin Instructions for Use of Product(s) G7570, G7571, G7572, G7573 Literature #TB288, Revised March 2015), using a microtiter plate reader (Envision, PE).

(239) Cell proliferation was evaluated using the time zero (T0) signal as the positive control and the within-plate vehicle wells (DMSO) as the negative control. Data was converted to percent inhibition and falls into the range from −100% to 100% of growth where −100% equals a cidal response and 100% equals uninhibited or maximal growth. Cell growth at or near 0% is considered a static response.

(240) 1. Results

(241) TABLE-US-00024 TABLE 24 Biological Assay Results CTGlo- CTGlo- CTGlo- CTGlo- SPA- qPCR- ATS ATS ATS ATS ATS IVS- GMean Mean GMean Mean GMean qPCR- ATS GI50 MinRe- GI50 MinRe- IC50 IVS-ATS GMean (nM) sponse % (nM) sponse % (nM) GMean IC50 72 h 72 h 72 h 72 h SF3B1 IC50 (nM) (nM) Ratio PANC0 PANC0 NCIH1 NCIH1 Ex. (WT) Ad2.1 Ad2.2 Ad2.1/2.2 504.1 504.1 568.1 568.1 1 19.803 28.938 18.709 1.547 54.801 −79.550 61.245 −71.582 2 14.700 29.282 24.750 1.183 30.291 −76.626 40.606 −70.665 3 1.744 18.620 10.306 1.807 2.955 −87.809 2.423 −78.460 4 3.796 >25000.000 58.659 426.192 26.904 −27.423 15.481 −46.416 5 6.607 1499.846 94.734 15.832 47.221 −17.631 59.671 −38.293 6 8.853 >25000.000 75.297 332.020 15.693 −88.664 29.143 −17.149 7 2.885 1247.783 25.138 49.637 8.957 −89.436 15.136 −56.359 8 14172.621 42.184 335.973 19.268 −94.207 9 14.917 106.832 26.999 3.957 63.852 −87.085 116.290 −83.308 10 18.088 811.844 39.511 20.547 73.839 −87.077 123.385 −69.020 11 9.490 >25000.000 93.381 267.720 54.219 −91.789 84.398 −43.979 12 4.879 14.745 13.542 1.089 7.551 −73.954 3.638 −92.161 13 7.427 19.311 15.877 1.216 32.728 −94.040 20.826 −95.312 14 2.717 584.420 54.679 10.688 19.581 −91.489 14.050 −65.049 15 6.330 21.602 12.286 1.758 6.231 −80.816 7.581 −74.931 16 57.019 100.255 39.239 2.555 41.517 −85.810 59.115 −88.977 17 10.673 46.759 34.009 1.375 57.794 −72.749 53.407 −87.647 18 16.748 77.450 34.312 2.257 19.945 −83.683 26.089 −60.339 19 60.256 353.840 82.303 4.299 40.549 −82.122 67.494 −65.760 20 7.757 61.280 40.259 1.522 14.578 −78.467 17.600 −68.668 21 10.335 1612.616 52.275 30.849 23.638 −90.919 31.212 −50.841 22 5.764 876.293 38.831 22.567 11.553 −84.195 12.792 −69.453 23 4.231 369.160 28.305 13.042 10.429 −90.781 10.847 −64.974 24 5.186 192.475 30.664 6.277 8.286 −89.895 10.866 −67.459 25 4.943 430.092 46.405 9.268 20.469 −88.378 20.618 −49.158 26 11.379 107.167 43.532 2.462 18.968 −88.278 26.479 −68.566 27 10.473 39.853 42.297 0.942 11.911 −84.822 12.297 −71.773 28 10.051 8.549 61.513 0.139 42.924 −41.132 89.619 −39.539 29 5.601 >25000.000 90.701 275.631 34.668 −90.429 53.788 −19.404 30 19.063 10.990 1.734 7.020 −75.997 5.890 −78.664 31 43.243 50.141 14.624 3.429 53.037 −90.716 89.383 −98.108 32 3.243 19.498 16.198 1.204 6.528 −69.289 10.016 −74.701 33 5.583 28.419 27.607 1.029 10.030 −77.334 11.999 −73.122 34 3.180 56.541 26.903 2.102 14.046 −85.656 9.461 −55.438 35 4.783 913.307 27.076 33.732 53.186 −87.702 106.908 −46.227 36 3.488 236.343 32.930 7.177 19.014 −84.494 25.362 −54.389 37 2.267 85.797 20.173 4.253 4.612 −86.134 4.748 −82.247 38 3.095 1022.501 25.191 40.589 14.409 −88.672 19.555 −54.093 39 25.961 63.120 31.983 1.974 50.069 −89.747 45.607 −97.412 40 3.984 55.865 28.124 1.986 7.751 −82.881 13.254 −72.259 41 8.256 221.329 39.233 5.641 15.842 −82.009 21.437 −77.375 42 2.924 330.409 12.646 26.129 4.757 −86.319 6.130 −63.030 43 11.951 >25000.000 139.415 179.321 57.498 −88.777 89.062 −36.254 44 8.263 12765.261 86.608 147.392 41.465 −92.314 67.162 −14.871 45 15.877 36.326 18.285 1.987 35.719 −92.006 18.874 −98.435 46 12.199 >25000.000 114.487 218.366 40.026 0.031 78.415 −10.684 47 16947.874 79.628 212.839 78.160 −87.783 66.450 −44.494 48 11.279 >25000.000 187.531 133.311 95.203 −89.415 121.439 −38.837 49 3.039 16254.945 28.331 573.757 9.015 −93.022 11.720 −35.275 50 1.463 17856.646 60.163 296.807 28.290 −82.642 43.578 −65.255 51 19.740 >25000.000 88.061 283.894 80.862 −78.388 111.651 −31.962 52 8.296 39.595 45.397 0.872 13.573 −76.609 23.254 −63.079 53 14.104 1905.683 30.477 62.529 81.130 −92.947 81.762 −59.250 54 4.286 12.450 15.804 0.788 8.658 −94.487 7.806 −96.584 55 2.370 19926.430 45.284 440.028 17.209 −85.478 21.239 −57.557 56 1.937 16.055 15.295 1.050 1.849 −90.320 4.423 −67.625 57 9.161 >25000.000 228.152 109.576 49.719 −71.380 41.349 −47.783 58 6.544 30.122 22.020 1.368 6.969 −91.132 6.998 −70.067 59 2.750 13563.090 46.122 294.071 17.527 −95.512 14.534 −44.526 60 2.987 >25000.000 55.461 450.767 26.744 −87.159 29.909 −42.456 61 13.472 >25000.000 114.387 218.556 41.974 −93.599 46.822 −38.996 62 7.865 586.891 52.933 11.088 40.541 −94.536 54.936 −57.446 63 12.307 18789.671 52.047 361.016 41.172 −96.440 39.304 −50.769 64 3.081 116.017 24.425 4.750 7.959 −92.050 6.499 −66.274 65 2.835 26.222 17.310 1.515 5.742 −88.951 5.878 −68.297 66 2.233 206.385 33.895 6.089 8.224 −89.623 11.718 −64.699 67 1.955 22.653 20.232 1.120 7.272 −87.661 8.603 −75.182 68 3.393 1866.932 35.703 52.291 11.676 −93.925 12.401 −67.270 69 3.830 36.743 20.881 1.760 7.480 −86.274 4.035 −76.018 70 1.550 17.647 16.459 1.072 5.944 −83.969 3.371 −77.042 71 3.713 29.685 18.942 1.567 11.503 −68.599 6.391 −92.527 72 4.659 35.841 13.972 2.565 5.683 −75.581 4.189 −80.730 73 2.423 13.107 13.586 0.965 6.908 −79.201 5.850 −76.720 74 4.880 34.483 20.848 1.654 13.134 −64.747 4.694 −99.528 75 2.154 18.981 15.420 1.231 3.693 −81.995 3.579 −85.064 76 4.197 21.475 17.666 1.216 5.166 −90.504 3.021 −77.948 77 1.784 16.111 13.305 1.211 3.903 −86.524 1.786 −82.189 78 1.760 24.338 13.783 1.766 7.332 −93.916 2.498 −74.454 79 2.139 17.991 12.323 1.460 4.013 −72.802 80 1.590 6.641 8.572 0.775 2.681 −69.196 81 2.591 9.069 4.952 1.831 2.176 −83.963 82 3.795 68.613 28.180 2.435 8.738 −88.044 12.243 −60.656 83 4.567 159.090 49.023 3.245 15.634 −94.723 17.288 −68.447 84 2.749 29.576 22.131 1.336 5.608 −89.010 4.299 −80.428 85 4.735 21.984 27.018 0.814 8.418 −90.914 14.112 −80.438 86 12.173 929.495 89.619 10.372 34.772 −93.814 32.453 −39.164 87 4.984 62.738 26.981 2.325 4.193 −79.550 3.679 −85.463 88 1.021 >25000.000 154.434 161.881 86.265 −5.029 156.578 −20.194 89 3.246 24720.040 95.397 259.128 109.364 −16.694 218.842 −22.815 90 >25000.000 168.183 148.647 141.083 −12.315 106.927 −8.495 91 6.036 14.666 18.860 0.778 4.639 −90.776 6.857 −64.491 92 80.020 >25000.000 664.298 37.634 433.353 −37.359 401.466 −3.918 93 24.701 219.281 41.634 5.267 108.516 −97.726 73.797 −57.108 94 7.481 5565.342 37.521 148.326 30.367 −94.671 35.506 −40.948 95 2.317 10.347 10.014 1.033 2.586 −93.120 2.513 −73.174 96 2.405 >25000.000 108.152 231.155 167.999 −14.554 304.650 −29.687 97 240.267 >25000.000 2894.085 8.638 9144.823 46.987 4369.614 11.801 98 3.447 159.084 35.908 4.430 10.333 −87.759 11.545 −75.954 99 4.138 >25000.000 156.062 160.193 77.983 −69.788 93.243 −73.818 100 1.131 32.113 10.860 2.957 2.888 −91.579 3.696 −68.437 101 1.097 1809.361 4.130 438.113 9.778 −94.474 7.680 −64.073 102 29.757 >25000.000 506.758 49.333 3023.428 24.371 4903.112 31.099 103 258.210 >25000.000 4256.594 5.873 >10000.000 80.958 >10000.000 78.168 104 2.104 31.908 13.892 2.297 4.579 −86.795 5.100 −69.040 105 2.867 68.782 21.791 3.156 5.852 −90.949 6.952 −68.464 106 145.787 21316.281 555.636 38.364 1946.074 25.144 9024.448 49.516 107 8.762 189.979 25.441 7.467 8.464 −83.679 7.274 −87.564 108 2.031 16.802 14.335 1.172 3.313 −82.618 2.470 −79.118 109 2.847 26.481 13.998 1.892 3.546 −84.673 2.001 −84.780 110 42.069 141.880 63.236 2.244 41.768 −74.667 40.946 −93.755 111 27.997 69.785 27.292 2.557 13.896 −71.803 12.823 −81.303 112 12.794 36.638 24.108 1.520 8.289 −80.066 6.234 −86.973 113 8.195 29.264 18.814 1.555 48.965 −80.966 41.765 −73.107 114 18.232 103.149 39.101 2.638 12.323 −82.856 9.346 −87.102 115 144.378 335.063 233.242 1.437 85.228 −97.417 88.916 −93.625 116 4.448 24.986 19.171 1.303 2.203 −76.511 1.547 −90.483 117 9.759 >25000.000 69.572 359.342 50.241 −95.049 79.845 −55.709 118 3.756 21.956 19.869 1.105 4.547 −79.169 3.004 −82.113 119 11.656 31.021 21.652 1.433 8.431 −75.344 8.838 −81.451 120 3.971 25.336 26.526 0.955 9.424 −78.098 11.196 −75.164 121 2.994 25.480 21.964 1.160 3.729 −88.956 2.656 −80.331 122 5.505 18.838 14.314 1.316 2.097 −70.057 1.995 −85.128 123 1.697 16.462 13.079 1.259 2.753 −71.328 2.263 −86.056 124 3.444 12.855 9.437 1.362 5.982 −86.148 3.264 −78.963 125 5.058 17.638 14.945 1.180 6.759 −83.226 4.508 −83.586 126 127 19.133 >25000.000 452.324 55.270 1071.042 11.995 835.105 −18.734 128 8.763 3350.427 18.070 185.417 44.222 −96.227 25.733 −62.651 129 4.376 31.998 15.613 2.049 11.278 −94.183 4.734 −70.909 130 37.142 43.909 30.032 1.462 18.296 −93.452 11.962 −72.458 131 4.040 356.631 45.767 7.792 27.067 −94.995 19.218 −65.430 132 4.913 34.109 12.752 2.675 13.574 −94.673 11.510 −68.423 133 6.986 1671.083 92.470 18.072 25.554 −94.957 17.704 −69.167 134 2.055 26.469 13.270 1.995 4.113 −92.570 3.920 −79.743 135 3.672 14.929 14.858 1.005 2.463 −90.575 2.411 −84.225 136 8.107 8.637 14.479 0.597 7.168 −90.722 137 1.209 27.636 12.146 2.275 1.615 −86.584 1.174 −81.149 138 8.696 >25000.000 57.468 435.028 120.328 −85.916 70.303 −80.330 139 4.318 >25000.000 93.194 268.259 240.142 −21.195 142.072 −61.022 140 1.728 11.563 11.755 0.984 1.631 −80.398 1.251 −82.434 141 12.956 >25000.000 61.283 407.944 72.446 −94.865 48.767 −63.745 142 1.348 12.904 6.986 1.847 2.189 −69.213 143 3.200 19.245 17.177 1.120 3.675 −87.719 1.751 −84.803 144 12.945 22.998 17.838 1.289 4.117 −95.432 145 69.448 688.137 38.070 18.076 24.952 −66.236 146 22.736 11.142 12.673 0.879 2.795 −88.975 147 7.302 9.573 7.431 1.288 1.560 −91.884 148 2.243 12.371 3.566 3.469 1.420 −85.010 149 1.863 9.132 8.715 1.048 1.663 −73.106 150 1.316 8.579 10.968 0.782 2.187 −68.000 151 3.409 17.913 11.423 1.568 2.239 −83.213 152 3.835 16.214 8.392 1.932 1.511 −80.509 153 4.830 14.527 14.848 0.978 2.338 −81.206 154 3.752 20.021 8.724 2.295 1.852 −85.459 155 2.214 8.445 5.877 1.437 1.905 −83.475 156 3.949 8.369 7.912 1.058 1.267 −87.369 157 2.266 8.466 7.491 1.130 1.288 −90.424 158 13.917 18.895 18.193 1.039 6.574 −87.167 159 1.839 88.302 10.196 8.660 3.446 −65.047 160 1.648 4.681 4.688 0.999 1.147 −82.399 0.896 −86.403 161 2.507 8.501 6.311 1.347 0.772 −85.783 162 1.077 9.290 7.400 1.255 1.471 −75.943 163 164 3.594 20.692 27.869 0.742 1.539 −87.159 165 18.724 29.539 15.222 1.941 10.028 −78.159 166 23.795 1509.545 48.288 31.261 17.605 −66.370 167 3.189 >25000.000 46.455 538.154 34.052 −85.316 52.392 −70.414 168 3.049 27.565 16.451 1.676 10.386 −86.930 5.963 −75.760 169 1.429 96.624 19.836 4.871 8.899 −90.232 8.264 −66.086 170 4.926 10988.155 30.980 354.686 23.187 −96.570 25.872 −56.895 171 1.509 18827.426 42.614 441.815 23.552 −92.998 19.645 −50.083 172 5.584 22.596 15.368 1.470 17.920 −88.455 8.722 −74.177 173 20.954 88.062 28.433 3.097 15.154 −79.437 174 3.144 13.142 10.739 1.224 6.035 −80.529 3.858 −92.525 175 5.827 9.503 8.125 1.170 9.488 −99.134 176 38.494 49.735 31.244 1.592 19.031 −88.183 177 2.380 18.243 10.348 1.763 3.618 −80.643 178 2.159 20.409 4.309 4.736 6.847 −77.714 179 6.147 31.411 14.211 2.210 8.698 −82.684 180 42.275 29.896 24.606 1.215 14.432 −86.471 181 8.204 19.659 19.152 1.026 9.736 −85.226 182 86.414 207.933 40.096 5.186 23.384 −69.521 183 66.316 713.164 20.288 35.151 53.565 −66.270 184 14.417 18.135 11.589 1.565 59.779 −85.535 185 186.395 542.957 46.594 11.653 114.397 −99.538 186 12.625 41.845 17.450 2.398 14.473 −70.969 187 43.164 157.172 59.645 2.635 65.000 −54.197 188 2.610 7.414 5.626 1.318 2.767 −79.922 189 6.800 16.928 10.256 1.651 9.532 −76.052 190 6.547 33.521 15.729 2.131 19.847 −69.142 191 3.472 11.620 7.474 1.555 6.329 −83.895 192 3.846 14.134 10.277 1.375 7.490 −75.900 193 126.764 47.796 19.577 2.441 17.220 −89.438 194 10.679 30.128 25.852 1.165 6.729 −75.631 195 69.302 91.936 58.257 1.578 6.595 −95.559 196 13.226 29.980 19.611 1.529 1.829 −90.418 197 2.665 98.532 22.818 4.318 3.526 −91.100 4.693 −69.290 198 7.815 2386.120 43.208 55.224 21.688 −96.773 15.506 −56.095 199 8.992 1822.689 47.173 38.638 33.778 −95.445 22.936 −52.026 200 8.028 8049.493 27.048 297.600 17.434 −94.085 24.228 −51.281 201 5.641 619.579 17.460 35.485 40.947 −91.697 27.494 −48.055 202 14.089 4467.112 25.183 177.387 24.666 −93.824 29.369 −59.083 203 10.093 14444.856 69.732 207.149 44.957 −94.627 47.257 −36.664 204 23.530 >25000.000 113.702 219.873 81.984 −94.081 81.900 −24.924 205 16.221 >25000.000 107.697 232.132 70.845 −91.576 85.857 −28.455 206 1.813 >25000.000 112.801 221.630 62.322 −83.659 72.151 −57.585 207 3.456 22.522 15.523 1.451 15.083 −92.266 16.872 −63.380 208 1.770 1378.136 25.142 54.813 9.265 −94.342 11.644 −47.371 209 4.781 3132.451 30.034 104.297 16.373 −93.368 12.134 −51.998 210 4.353 10999.791 32.727 336.112 27.842 −96.896 17.045 −51.154 211 11.856 651.389 83.449 7.806 47.630 −91.820 60.600 −52.358 212 8.790 >25000.000 93.796 266.536 60.172 −59.089 128.747 −49.302 213 3.227 9.836 7.955 1.236 3.196 −85.603 6.031 −64.116 214 2.297 3924.472 19.217 204.217 3.290 −91.986 6.370 −48.793 215 6.829 20476.683 50.708 403.817 20.031 −81.853 25.032 −42.412 216 3.325 11066.674 35.740 309.648 29.022 −85.005 47.209 −32.014 217 3.180 18.360 16.585 1.107 14.978 −91.288 13.777 −71.339 218 2.795 30.466 5.616 5.425 6.197 −75.420 219 7.958 >25000.000 71.481 349.744 24.575 −91.460 42.396 −42.617 220 3.174 19.337 14.390 1.344 4.362 −90.506 2.012 −76.936 221 9.334 9.597 4.864 1.973 11.415 −66.213 222 23.560 115.933 53.192 2.179 69.418 −58.410 223 15.882 93.895 6.961 13.488 33.076 −62.835 224 3.139 41.136 5.884 6.991 16.428 −61.875 225 18.247 7.559 22.404 0.337 10.999 −73.768 226 1.171 8.742 101.817 0.086 34.694 −64.963 227 3.250 5.848 10.285 0.569 2.367 −81.522 228 3.965 6.310 5.330 1.184 3.287 −77.633 229 17.110 329.387 12.200 27.000 13.389 −65.653 230 12.876 11.748 10.902 1.078 15.854 −69.108 231 26.032 512.816 5.284 97.051 22.694 −59.209 232 5.015 15.326 9.504 1.613 4.674 −78.974 233 2.458 5.872 6.047 0.971 1.984 −87.288 234 3.163 13.069 16.472 0.793 5.202 −81.384 235 5.564 16.010 15.144 1.057 1.937 −84.459 2.347 −84.925 236 84.028 49.935 56.184 0.889 9.924 −90.096 237 8.375 18.550 9.327 1.989 12.024 −78.619 238 18.054 32.210 68.149 0.473 5.789 −88.447 239 149.765 103.261 47.999 2.151 63.497 −77.758 240 241 20.455 >25000.000 130.264 191.917 120.417 −88.873 225.056 −59.521 242 15.329 7146.158 62.113 115.051 68.920 −92.786 180.037 −65.744 243 3.592 98.426 38.548 2.553 10.379 −92.290 10.582 −71.678 244 3.376 3581.722 38.506 93.018 27.607 −95.630 20.195 −65.165 245 17.436 8875.216 64.831 136.897 112.774 −95.548 62.255 −46.475 246 5.802 279.340 36.136 7.730 16.490 −95.467 12.136 −68.331 247 14.431 50.833 34.641 1.467 40.535 −77.509 31.375 −67.545 248 6.624 >25000.000 76.389 327.274 75.840 −92.622 97.040 −46.753 249 5.164 6351.906 33.622 188.921 13.815 −93.297 14.524 −49.016 250 3.626 2185.864 44.144 49.517 23.101 −94.381 15.593 −58.677 251 52.399 49.653 28.136 1.765 13.373 −87.236 252 21.819 22.624 27.410 0.825 10.275 −76.109 253 1.924 10.022 8.586 1.167 12.915 −80.763 2.424 −84.782 254 5.123 22048.355 52.240 422.058 29.045 −77.065 23.704 −41.424 255 7.321 >25000.000 89.728 278.618 65.836 −61.401 67.624 −24.942 256 15.609 >25000.000 112.177 222.862 43.369 −88.839 60.856 −5.090 257 5.745 >25000.000 116.875 213.903 71.477 −75.412 265.710 −4.151 258 11.739 >25000.000 73.832 338.606 28.684 −65.918 29.773 −12.669 259 >25000.000 83.063 300.977 31.491 −86.489 133.009 −43.329 260 0.196 >25000.000 99.444 251.398 39.499 −47.734 42.267 −44.621 261 23290.387 76.557 304.222 32.328 −89.906 57.557 −36.811 262 5.655 4102.465 51.625 79.467 29.341 −91.709 41.697 −65.862 263 37.684 93.581 25.451 3.677 64.532 −88.783 102.396 −67.601 264 35.694 33.402 72.404 0.461 143.328 −21.716 265 5.3 >25000.000 71.6 349.0 36.7 25.1 47.5 −9.0

(242) Administration of at Least One Compound Chosen from Compounds of Formula I (Including Formulas IIa-e, IIIa, IVa, and Va) and/or Pharmaceutically Acceptable Salts Thereof

(243) CT26 colon cancer cells (0.25×10.sup.6; ATCC Cat. #CRL-2638) are implanted subcutaneously into the right flank of eight-week old female Balb/c mice (Envigo) in 100 μL of PVS lacking Matrigel. CT26 tumors are allowed to grow to an average of ˜100 mm.sup.3 before animals are enrolled into the efficacy study. Each treatment group contains 12 mice. Mice are treated with at least one compound chosen from compounds of Formula I (including Formulas IIa-e, IIIa, IVa, and Va) and/or pharmaceutically acceptable salts thereof, an anti-CTLA4 antibody, or a combination thereof, at various doses and via various routes of administration. The at least one compound chosen from compounds of Formula I (including Formulas IIa-e, IIIa, IVa, and Va) and/or pharmaceutically acceptable salts thereof is formulated in a composition containing 5% ethanol and 95% methylcellulose solution (0.5% methylcellulose). The anti-CTLA4 antibody is formulated in PBS at pH 7. Tumors are measured 3 times per week for up to 19 days. Tumor volumes are calculated using the ellipsoid formula: Tumor Volume=(length×width.sup.2)/2.

OTHER EMBODIMENTS

Embodiment 1

(244) A compound chosen from compounds of Formula I:

(245) ##STR00377## and pharmaceutically acceptable salts thereof, wherein: R.sup.1 is chosen from:

(246) ##STR00378##
each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, C.sub.3-C.sub.8 cycloalkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, dimethylamino groups, and methoxy C.sub.1-C.sub.6 alkyl groups; R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, and R.sup.7 are each independently chosen from hydrogen, hydroxyl groups, —O—R.sup.10 groups, and C.sub.1-C.sub.6 alkyl groups; R.sup.8, R.sup.9, and R.sup.13 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; R.sup.10 is chosen from hydrogen, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 aminoalkyl groups, C.sub.1-C.sub.6 alkylamino groups, C.sub.1-C.sub.6 alkylcarboxylic acid groups, C.sub.3-C.sub.8 cycloalkyl groups, benzyl groups, C.sub.3-C.sub.8 heterocyclyl groups, —CH.sub.2—C.sub.3-C.sub.8 heterocyclyl groups, —C(O)—C.sub.3-C.sub.8 heterocyclyl groups, acyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, methoxy C.sub.1-C.sub.6 alkyl groups, —CD.sub.3, and —C(O)—NR.sup.11R.sup.12 groups; R.sup.11 and R.sup.12 are independently chosen from hydrogen, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 aminoalkyl groups, C.sub.1-C.sub.6 alkylamino groups, C.sub.3-C.sub.8 cycloalkyl groups, and C.sub.3-C.sub.8 heterocyclyl groups; V is chosen from —CH.sub.2— and —N(R.sup.9)—; W is chosen from 3 to 8 membered carbocycles and 3 to 8 membered heterocycles, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups; X and Y are each independently chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—; and each n is independently chosen from 0 to 4.

Embodiment 2

(247) The compound of embodiment 1, wherein R.sup.1 is chosen from

(248) ##STR00379##
each of which may be substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

Embodiment 3

(249) The compound of embodiment 1 or embodiment 2, wherein R.sup.1 is chosen from

(250) ##STR00380##
which may be substituted with 1 to 3 groups chosen from C.sub.1-C.sub.6 alkyl groups.

Embodiment 4

(251) The compound of any one of embodiments 1-3, wherein R.sup.1 is chosen from unsubstituted

(252) ##STR00381##

Embodiment 5

(253) The compound of any one of embodiments 1-4, wherein R.sup.2 is methyl and R.sup.3 is hydrogen.

Embodiment 6

(254) The compound of any one of embodiments 1-5, wherein R.sup.4 is hydrogen, and and R.sup.5 is hydroxyl.

Embodiment 7

(255) The compound of any one of embodiments 1-6, wherein R.sup.6 is hydrogen and and R.sup.7 is methyl.

Embodiment 8

(256) The compound of any one of embodiments 1-7, wherein R.sup.8 is methyl.

Embodiment 9

(257) The compound of any one of embodiments 1-8, wherein V is —CH.sub.2—.

Embodiment 10

(258) The compound of any one of embodiments 1-9, wherein W is chosen from a benzene ring, pyridine ring, benzimidazole ring, benzotriazole ring, indazole ring, 1,2,3,6-tetrahydropyridine ring, and imidazopyridine ring, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups.

Embodiment 11

(259) The compound of any one of embodiments 1-10, wherein W is a benzene ring, which may be optionally substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

Embodiment 12

(260) The compound of any one of embodiments 1-11, wherein X and Y are each independently chosen from a bond,

(261) ##STR00382##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 13

(262) The compound of any embodiments 1-11, wherein Y is hydrogen, and X is chosen from:

(263) ##STR00383##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 14

(264) A compound chosen from compounds of Formula IIa:

(265) ##STR00384## and pharmaceutically acceptable salts thereof, wherein: R.sup.10 is chosen from hydrogen and methyl; W is chosen from 3 to 8 membered carbocycles and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups; X and Y are each independently chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 15

(266) The compound of embodiment 14, wherein W is chosen from a benzene ring, pyridine ring, benzimidazole ring, benzotriazole ring, indazole ring, 1,2,3,6-tetrahydropyridine ring, and imidazopyridine ring, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups

Embodiment 16

(267) The compound of embodiment 14 or embodiment 15, wherein W is a benzene ring, which may be optionally substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

Embodiment 17

(268) The compound of any one of embodiments 14-16, wherein X and Y are each independently chosen from a bond,

(269) ##STR00385##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 18

(270) The compound of any embodiments 14-17, wherein Y is hydrogen, and X is chosen from:

(271) ##STR00386##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 19

(272) The compound of any one of embodiments 14-17, wherein Y is hydrogen and X is a bond.

Embodiment 20

(273) A compound chosen from compounds of Formula IIb:

(274) ##STR00387## and pharmaceutically acceptable salts thereof, wherein: R.sup.16 is chosen from hydrogen and fluoro; X and Y are each independently chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 21

(275) The compound of embodiment 20, wherein X and Y are each independently chosen from a bond,

(276) ##STR00388##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 22

(277) The compound of embodiment 20 or embodiment 21, wherein Y is hydrogen, and X is chosen from:

(278) ##STR00389##
which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 23

(279) The compound of any one of embodiments 20-22, wherein Y is hydrogen and X is a bond.

Embodiment 24

(280) The compound of any one of embodiments 20-23, wherein R.sup.16 is fluoro.

Embodiment 25

(281) A compound chosen from compounds of Formula IIc:

(282) ##STR00390## and pharmaceutically acceptable salts thereof, wherein: R.sup.16 is chosen from hydrogen and fluoro; Y is chosen from hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.2 is chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; n.sup.3 is 0; and n.sup.4 is chosen from 0 to 4.

Embodiment 26

(283) The compound of embodiment 25, wherein Y is chosen from hydrogen,

(284) ##STR00391##
which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 27

(285) The compound of embodiment 25 or embodiment 26, wherein L.sup.2 is a bond.

Embodiment 28

(286) The compound of any one of embodiments 25-27, wherein R.sup.16 is fluoro.

Embodiment 29

(287) A compound chosen from compounds of Formula IId:

(288) ##STR00392## and pharmaceutically acceptable salts thereof, wherein: R.sup.16 is chosen from hydrogen and fluoro; X is chosen from hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 30

(289) The compound of embodiment 29, wherein X is chosen from a bond,

(290) ##STR00393##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 31

(291) The compound of embodiment 29 or embodiment 30, wherein X, L.sup.1, and L.sup.2 are each a bond.

Embodiment 32

(292) The compound of any one of embodiments 25-27, wherein R.sup.16 is fluoro.

Embodiment 33

(293) A compound chosen from compounds of Formula IIe:

(294) ##STR00394## and pharmaceutically acceptable salts thereof, wherein: R.sup.16 is chosen from hydrogen and fluoro; X is independently chosen from hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 34

(295) The compound of embodiment 33, wherein X is chosen from a bond,

(296) ##STR00395##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 35

(297) The compound of embodiment 33 or embodiment 34, wherein X, L.sup.1, and L.sup.2 are each a bond.

Embodiment 36

(298) The compound of any one of embodiments 33-35, wherein R.sup.16 is fluoro.

Embodiment 37

(299) A compound chosen from compounds of Formula IIIa:

(300) ##STR00396## and pharmaceutically acceptable salts thereof, wherein: R.sup.10 is chosen from hydrogen and methyl; W is chosen from 3 to 8 membered carbocycles and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups; X and Y are each independently chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 38

(301) A compound chosen from compounds of Formula IVa:

(302) ##STR00397## or a pharmaceutically acceptable salt thereof, wherein: R.sup.10 is chosen from hydrogen and methyl; W is chosen from 3 to 8 membered carbocycles and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups; X and Y are each independently chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 39

(303) The compound of embodiment 38, wherein W is chosen from a benzene ring, pyridine ring, benzimidazole ring, benzotriazole ring, indazole ring, 1,2,3,6-tetrahydropyridine ring, and imidazopyridine ring, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups

Embodiment 40

(304) The compound of embodiment 38 or embodiment 39, wherein W is a benzene ring, which may be optionally substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

Embodiment 41

(305) The compound of any one of embodiments 38-40, wherein X and Y are each independently chosen from a bond,

(306) ##STR00398##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 42

(307) The compound of any embodiments 38-41, wherein Y is hydrogen, and X is chosen from:

(308) ##STR00399##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 43

(309) The compound of any one of embodiments 38-42, wherein Y is hydrogen and X is a bond.

Embodiment 44

(310) A compound chosen from compounds of Formula Va:

(311) ##STR00400## or a pharmaceutically acceptable salt thereof, wherein: R.sup.9 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; R.sup.10 is chosen from hydrogen and methyl; W is chosen from 3 to 8 membered carbocycles and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups; X and Y are each independently chosen from a bond, hydrogen, 3 to 8 membered carbocycles, and 3 to 8 membered heterocycles, each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; L.sup.1 and L.sup.2 are each independently chosen from a bond, —O—, —C(O)—, —C(O)O—, —N(R.sup.13)—C(O)—, —C(O)—N(R.sup.13)—, —N(R.sup.13)—S(O.sub.2)—, —S(O.sub.2)—N(R.sup.13)—, —S(O.sub.2)—, and —N(R.sup.13)—, wherein R.sup.13 is chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups; and each n is independently chosen from 0 to 4.

Embodiment 45

(312) The compound of embodiment 44, wherein W is chosen from a benzene ring, pyridine ring, benzimidazole ring, benzotriazole ring, indazole ring, 1,2,3,6-tetrahydropyridine ring, and imidazopyridine ring, each of which may be optionally substituted with 1 to 3 groups independently chosen from halogens, —NR.sup.8R.sup.9 groups, C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, and C.sub.3-C.sub.5 cycloalkyl groups

Embodiment 46

(313) The compound of embodiment 44 or embodiment 45, wherein W is a benzene ring, which may be substituted with 1 to 3 groups chosen from halogens and C.sub.1-C.sub.6 alkyl groups.

Embodiment 47

(314) The compound of any one of embodiments 44-46, wherein X and Y are each independently chosen from a bond,

(315) ##STR00401##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 48

(316) The compound of any embodiments 44-47, wherein Y is hydrogen, and X is chosen from:

(317) ##STR00402##
each of which may be substituted with 1 to 3 groups independently chosen from halogens, hydroxyl groups, C.sub.1-C.sub.6 alkyl groups, hydroxy C.sub.1-C.sub.6 alkyl groups, C.sub.1-C.sub.6 alkoxy groups, methoxy C.sub.1-C.sub.6 alkyl groups, —SO.sub.2—C.sub.1-C.sub.6 alkyl groups, and —NR.sup.14R.sup.15 groups, wherein R.sup.14 and R.sup.15 are each independently chosen from hydrogen and C.sub.1-C.sub.6 alkyl groups.

Embodiment 49

(318) The compound of any one of embodiments 44-48, wherein Y is hydrogen and X is a bond.

Embodiment 50

(319) A compound chosen from: [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-piperazin-1-ylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-(4-methylpiperazin-1-yl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-(1H-indazol-6-yl)prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-(1H-indazol-4-yl)prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(2-morpholin-4-ylpyridin-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(2-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(4-fluoro-3-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(2-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3R)-3-fluoropyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-[(2R,6S)-2,6-dimethylmorpholin-4-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(3S)-3-(dimethylamino)pyrrolidin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(3-methyl-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-morpholin-4-yl-5-(trifluoromethyl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-chloro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(2-hydroxyethyl)piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate; [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3,4-dimethylpiperazine-1-carboxylate; [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-propan-2-ylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-tert-butylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cyclobutylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cyclopentylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3,5-difluorophenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(dimethylamino)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(4-hydroxypiperidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-(1-methylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(1R,5S)-8-oxa-3-azabicyclo[3.2.1]octan-3-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxa-7-azaspiro[3.4]octan-7-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3R)-3-hydroxypyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(3-oxopyrrolidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(oxan-4-yl)piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-3-yl)carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(3-fluoroazetidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3-(dimethylamino)piperidine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2S)-2-methylpyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxopyrrolidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2S)-2-methylpyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(methylamino)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(5-chloropyridin-3-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(pyridin-4-ylmethyl)carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3,5-dichlorophenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxo-1,2-thiazolidin-2yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(1,3-dimethylindazol-6-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxo-1,4-thiazinan-4-yl)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N,N-dimethylcarbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxo-1,4-thiazinan-4-yl)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] morpholine-4-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(1-methylindazol-6-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(3-oxomorpholin-4-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-(cyclopentylsulfamoyl)-2-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(4-methylsulfonylpiperazin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(4-fluoro-1H-indazol-6-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-imidazol-1-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl]4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxoimidazolidin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[3-(2-hydroxyethyl)-2-oxoimidazolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[3-(2-fluoroethynyl)-2-oxoimidazolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[3-(2-morpholin-4-ylethyl)-2-oxoimidazolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[3-(cyclopropylmethyl)-2-oxoimidazolidin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2S)-2-methylmorpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-(2-methylmorpholin-4-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-[(2S,3R)-3-hydroxy-2-methylpentyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-[(2R,3R)-3-hydroxy-2-methylpentanoyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-morpholin-4-ylethylsulfonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4-ethenylsulfonylpiperazin-1-yl)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-methylmorpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(hydroxymethyl)morpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(hydroxymethyl)morpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2R)-2-(methylcarbamoyl)morpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(2-oxo-1,3-diazinan-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[3-(cyclopropylmethyl)-2-oxo-1,3-diazinan-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-[(2R)-2-hydroxypropanoyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,4,6,7,8,8a-hexahydro-1H-pyrrolo[1,2-a]pyrazine-2-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-methylmorpholin-4-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(2-cyclopropyl-2-oxoethyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-oxo-2-pyrazin-2-ylethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-7,10-dihydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyclopropylmethyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-imidazo[1,2-a]pyridin-6-ylprop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(7-methyl-1H-indazol-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-(cyclopropylsulfamoyl)-3-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-fluoro-5-(4-hydroxypiperidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(2,2,2-trifluoroethyl)piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-piperazin-1-ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4-formylpiperazin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-(4-hydroxypiperidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(6-methyl-1H-indazol-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(1,3-dimethylindazol-4-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(1-azabicyclo[2.2.2]octan-3-yl)-N-methylcarbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-(cyclopropylmethyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(2-hydroxyethyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(4-fluoro-1-methylindazol-6-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-[1-(pyridin-4-ylmethyl)pyrazol-4-yl]prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(1-methylpyrazol-4-yl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethyl)-3-oxopiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-methoxyethyl)-3-oxopiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[1-(1-methylpiperidin-4-yl)pyrazol-4-yl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2,2,2-trifluoroethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-methoxyacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(cyclopropanecarbonyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(4-methoxyphenyl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylpyrazol-4-yl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(4-pyridin-3-ylsulfonylpiperazin-1-yl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylimidazol-4-yl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(cyclohexanecarbonyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylindol-6-yl)sulfonylpiperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(oxan-4-yl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-2-(oxan-4-yl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxane-4-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-morpholin-4-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1-methylimidazole-4-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[4-(2-cyclopropylacetyl)piperazin-1-yl]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(1,3-oxazole-5-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyethylsulfonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxetan-3-ylsulfonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(oxetan-3-ylsulfonyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-(1-hydroxyisoquinolin-7-yl)prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[4-fluoro-1-[2-(methylamino)-2-oxoethyl]indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(2-oxo-2-pyrrolidin-1-ylethyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(2-morpholin-4-yl-2-oxoethyl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyanomethyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-[2-(dimethylamino)-2-oxoethyl]-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyclopropylmethyl)-3-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[4-(3-methoxypropanoyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-hydroxyacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(3-hydroxypropyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(cyclopropylmethyl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[2-(cyclopropylmethyl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(cyclopropylmethyl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(oxan-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-2-(oxan-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-(2-methoxyethyl)benzimidazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxolane-3-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[1-[(2-methylpropan-2-yl)oxycarbonyl]piperidin-4-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(4-chlorophenyl)methyl]-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1-acetylpiperidin-4-yl)-7-fluorobenzimidazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(4-hydroxycyclohexyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(oxan-4-ylmethyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-[(2S)-1-hydroxypropan-2-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-[(2S)-1-hydroxypropan-2-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-[(3S)-oxolane-3-carbonyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-[(3S)-oxolane-3-carbonyl]piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(oxetane-3-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(3-methyloxetane-3-carbonyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(3-hydroxypropanoyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(4-methyloxan-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-(1-methylsulfonylpiperidin-4-yl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1,1-dioxothian-4-yl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-(2-methoxyethyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1-acetylpiperidin-4-yl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[(3S)-oxan-3-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[(3S)-oxan-3-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[7-fluoro-3-[(3R,4S)-3-hydroxyoxan-4-yl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-cyclohexyl-7-fluorobenzotriazol-5-yl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-(4-methoxyphenyl)benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[7-fluoro-3-[(4-methoxyphenyl)methyl]benzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-chloro-5-fluorophenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl(oxan-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl(oxetan-3-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[methyl(oxan-4-yl)amino]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[methyl(oxetan-3-yl)amino]phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1,1-dioxothian-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(1-methylsulfonylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-(1-methylsulfonylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-[ethyl-(1-methylsulfonylpiperidin-4-yl)amino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(1-methylsulfonylpiperidin-4-yl)-propan-2-ylamino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-acetylpiperidin-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-(1-propanoylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[[1-(2-methoxyacetyl)piperidin-4-yl]-methylamino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-benzoylpiperidin-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(2,2,2-trifluoroacetyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-(1-propylsulfonylpiperidin-4-yl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-cyclopentylsulfonylpiperidin-4-yl)-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(1-methylimidazol-4-yl)sulfonylpiperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[[1-(benzenesulfonyl)piperidin-4-yl]-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(1-acetylpiperidin-4-yl)methyl-methylamino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[(1-methylsulfonylpiperidin-4-yl)methyl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(1,3-oxazole-5-carbonyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(pyrazine-2-carbonyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[methyl- [1-(1-methylimidazole-4-carbonyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(propan-2-ylcarbamoyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(propylcarbamoyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S ,10R)-2-[(E)-1-[3-fluoro-5-[methyl-[1-(phenylcarbamoyl)piperidin-4-yl]amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-(1-methylsulfonylpiperidin-4-yl)oxyphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[1-(4,4-difluorocyclohexyl)-4-fluoroindazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[4-fluoro-1-(1-methylsulfonylpiperidin-4-yl)indazol-6-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(azetidin-1-ylsulfonyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(3R)-3-hydroxypyrrolidin-1-yl]sulfonylphenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-[(2S)-2-methylpyrrolidin-1-yl]sulfonylphenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(1-hydroxy-2-methylpropan-2-yl)sulfamoyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(4,4-difluoropiperidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-(4-methyl-3-pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(3,3-difluoropyrrolidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(5-pyrrolidin-1-ylsulfonylpyridin-3-yl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(3,3-difluoroazetidin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[4-methyl-3-(2-oxopyrrolidin-1-yl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(tert-butylsulfamoyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-[3-(propan-2-ylsulfamoyl)phenyl]prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-(ethylsulfamoyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-(4-methylpiperazin-1-yl)sulfonylphenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[3-(methylsulfamoyl)phenyl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-piperidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-2-[(E)-1-(3-pyrrolidin-1-ylsulfonylphenyl)prop-1-en-2-yl]-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-cyclopropylsulfonylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(cyclopropylsulfonylamino)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[(3S)-3-(methanesulfonamido)pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(3S)-3-[(2-methoxyacetyl)amino]pyrrolidin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-2-[(E)-1-[1-[(2-methylpropan-2-yl)oxycarbonyl]-3,6-dihydro-2H-pyridin-5-yl]prop-1-en-2-yl]-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(trideuteriomethyl)piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(pyridin-4-ylmethyl)carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(pyrimidin-4-ylmethyl)carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] morpholine-4-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(dimethylamino)ethyl]carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methyl-1,4-diazepane-1-carboxylate; [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[(4-methoxyphenyl)methyl]carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; [(2R,3R,4E,6R,7S,10S)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[(2S)-1-hydroxypropan-2-yl]carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3-oxopiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3R)-3-fluoropyrrolidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,3,4-trimethylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-methyl-N-(1-methylpiperidin-4-yl)carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(2-hydroxyethyl)piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cycloheptylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-pyridin-4-ylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-cyclohexylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(4-hydroxyphenyl)ethyl]-N-methylcarbamate; (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-fluoro -5-morpholinophenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl 7-methyl-1,7-diazaspiro[3.5]nonane-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(3-morpholin-4-ylpropyl)carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-[2-(dimethylamino)ethyl]carbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3S)-3-(dimethylamino)pyrrolidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] N-(2-cyanoethyl)-N-methylcarbamate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 3,3,4-trimethylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] (3R)-3-fluoropyrrolidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(dimethylsulfamoylamino)-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7R,10S)-2-[(E)-1-[3-fluoro-5-[(2-methoxyacetyl)amino]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[(2-cyclopropylacetyl)amino]-5-fluorophenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-[(3-hydroxyphenyl)methyl]piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-fluoro-5-[4-(2-pyrazol-1-ylacetyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-(pyridin-3-ylmethyl)piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(1-acetylpiperidin-4-yl)-7-fluorobenzotriazol-5-yl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] piperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[[(3R)-3-hydroxypyrrolidine-1-carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [3-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-6-(4-methylpiperazine-1-carbonyl)oxy-12-oxo-1-oxacyclododec-4-en-2-yl]prop-1-enyl]phenyl]methyl 2-oxa-7-azaspiro[3.4]octane-7-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[2-[(2R)-2-(hydroxymethyl)pyrrolidin-1-yl]pyridin-4-yl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [3-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-6-(4-methylpiperazine-1-carbonyl)oxy-12-oxo-1-oxacyclododec-4-en-2-yl]prop-1-enyl]phenyl]methyl morpholine-4-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-(dimethylcarbamoyloxymethyl)phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[[(2R)-2-(hydroxymethyl)pyrrolidine-1-carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-[3-[[(3R)-3-fluoropyrrolidine-1-carbonyl]oxymethyl]phenyl]prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[(4-hydroxypiperidine-1-carbonyl)oxymethyl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-methylpiperazine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-2-[(E)-1-(3-fluoro-5-morpholin-4-ylphenyl)prop-1-en-2-yl]-10-hydroxy-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; [(2S,3S,4E,6R,7S,10R)-10-hydroxy-2-[(E)-1-[3-[4-(2-hydroxyethyl)piperazin-1-yl]phenyl]prop-1-en-2-yl]-3,7-dimethyl-12-oxo-1-oxacyclododec-4-en-6-yl] 4-piperidin-1-ylpiperidine-1-carboxylate; 2-[4-[3-fluoro-5-[(E)-2-[(2S,3S,4E,6R,7S,10R)-10-hydroxy-3,7-dimethyl-12-oxo-6-(piperazine-1-carbonyloxy)-1-oxacyclododec-4-en-2-yl]prop-1-enyl]phenyl]piperazin-1-yl]acetic acid; (2S,3S,6R,7S,10R,E)-2-((E)-1-(3-(dimethylamino)phenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl4-methylpiperazine-1-carboxylate; (2S,3S 6R,7S,10R,E)-2-((E)-1-(3-(dimethylamino)phenyl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-yl piperazine-1-carboxylate; (2S,3S,6R,7S,10R,E)-2-((E)-1-(5-chloropyridin-3-yl)prop-1-en-2-yl)-10-hydroxy-3,7-dimethyl-12-oxooxacyclododec-4-en-6-ylpiperazine-1-carboxylate; (2S,3S,6R,7S,10R,E)-10-hydroxy-3,7-dimethyl-12-oxo-2-((E)-1-(3-(pyrrolidin-1-ylsulfonyl)phenyl)prop-1-en-2-yl)oxacyclododec-4-en-6-yl piperazine-1-carboxylate; and pharmaceutically acceptable salts thereof.

Embodiment 51

(320) The compound of any one of embodiments 1-50, wherein said compound omprises greater than about 80% by weight of one stereoisomer of the compound.

Embodiment 52

(321) The compound of embodiment any one of embodiments 1-50, wherein said compound comprises greater than about 90% by weight of one stereoisomer of the compound.

Embodiment 53

(322) The compound of any one of embodiments 1-50, wherein said compound comprises greater than about 95% by weight of one stereoisomer of the compound.

Embodiment 54

(323) The compound of any one of embodiments 1-50, wherein said compound comprises greater than about 97% by weight of one stereoisomer of the compound.

Embodiment 55

(324) A pharmaceutical composition comprising at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of claims 1-54.

Embodiment 56

(325) The pharmaceutical composition of embodiment 55, wherein said composition is formulated for intravenous, oral, subcutaneous, or intramuscular administration.

Embodiment 57

(326) The pharmaceutical composition of embodiment 56, wherein said composition is formulated for oral administration.

Embodiment 58

(327) A method of treating cancer in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, wherein the cancer is chosen from myelodysplastic syndrome, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer, ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma, and lung cancer.

Embodiment 59

(328) The method of embodiment 58, wherein said cancer is chosen from myelodysplastic syndrome, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, and acute myeloid leukemia.

Embodiment 60

(329) The method of embodiment 58, wherein said cancer is myelodysplastic syndrome.

Embodiment 61

(330) The method of embodiment 58, wherein said cancer is chronic myelomonocytic leukemia.

Embodiment 62

(331) The method of embodiment 58, wherein said cancer is acute myeloid leukemia.

Embodiment 63

(332) The method of embodiment 58, wherein said cancer is chronic lymphocytic leukemia.

Embodiment 64

(333) The method of embodiment 58, wherein said cancer is acute lymphoblastic leukemia.

Embodiment 65

(334) The method of embodiment 58, wherein said cancer is endometrial cancer.

Embodiment 66

(335) The method of embodiment 58, wherein said cancer is ovarian cancer.

Embodiment 67

(336) The method of embodiment 58, wherein said cancer is breast cancer.

Embodiment 68

(337) The method of embodiment 58, wherein said cancer is uveal melanoma.

Embodiment 69

(338) The method of embodiment 58, wherein said cancer is gastric cancer.

Embodiment 70

(339) The method of embodiment 58, wherein said cancer is cholangiocarcinoma.

Embodiment 71

(340) The method of embodiment 58, wherein said cancer is lung cancer

Embodiment 72

(341) The method of embodiment 58, wherein said cancer is colon cancer.

Embodiment 73

(342) The method of embodiment 58, wherein said cancer is pancreatic cancer.

Embodiment 74

(343) The method of any one of embodiments 58-73, wherein said cancer is positive for one or more mutations in a spliceosome gene or protein.

Embodiment 75

(344) The method of embodiment 74, wherein said spliceosome gene or protein is chosen from splicing factor 3B subunit 1 (SF3B1), U2 small nuclear RNA auxiliary factor 1 (U2AF1), serine/arginine-rich splicing factor 2 (SRSF2), zinc finger (CCCH type) RNA-binding motif and serine/arginine rich 2 (ZRSR2), pre-mRNA-processing-splicing factor 8 (PRPF8), U2 small nuclear RNA auxiliary factor 2 (U2AF2), splicing factor 1 (SF1), splicing factor 3a subunit 1 (SF3A1), PRP40 pre-mRNA processing factor 40 homolog B (PRPF40B), RNA binding motif protein 10 (RBM10), poly(rC) binding protein 1 (PCBP1), crooked neck pre-mRNA splicing factor 1 (CRNKL1), DEAH (Asp-Glu-Ala-His) box helicase 9 (DHX9), peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2), RNA binding motif protein 22 (RBM22), small nuclear ribonucleoprotein Sm D3 (SNRPD3), probable ATP-dependent RNA helicase DDX5 (DDX5), pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15 (DHX15), and polyadenylate-binding protein 1 (PABPC1).

Embodiment 76

(345) The method of embodiment 75, wherein the spliceosome gene or protein is splicing factor 3B subunit 1.

Embodiment 77

(346) A method of treating cancer in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, and at least one additional therapy.

Embodiment 78

(347) The method of embodiment 77, wherein the at least one additional therapy comprises at least one, at least two, at least three, at least four, or at least five additional therapies.

Embodiment 79

(348) The method of embodiment 77, wherein the therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, and/or the at least one additional therapy is reduced by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 90%, relative to a standard dosage of a compound of Formula I, or pharmaceutically acceptable salt thereof, and/or the at least one additional therapy.

Embodiment 80

(349) The method of any one of embodiments 77 to 79, wherein the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, and/or the at least one additional therapy is administered at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 90% less frequently, relative to a standard dosing regimen of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, and/or the at least one additional therapy.

Embodiment 81

(350) The method of any one of embodiments 77 to 80, wherein the administered amount and/or dosage of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, and/or the at least one additional therapy results in lower systemic toxicity and/or improved tolerance.

Embodiment 82

(351) The method of embodiment 77, wherein administration of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, is initiated before administration of the at least one additional therapy.

Embodiment 83

(352) The method of embodiment 77, wherein administration of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, is initiated after administration of the at least one additional therapy.

Embodiment 84

(353) The method of embodiment 77, wherein administration of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, is initiated concurrently with administration of the at least one additional therapy.

Embodiment 85

(354) The method of any one of embodiments 77 to 84, wherein administration of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, is repeated at least once after initial administration.

Embodiment 86

(355) The method of embodiment 85, wherein the amount of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, used for repeated administration is reduced relative to the amount used for initial administration.

Embodiment 87

(356) The method of embodiment 85, wherein the amount of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, used for repeated administration is reduced relative to a standard dosage of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57.

Embodiment 88

(357) The method of embodiment 85, wherein the amount of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, used for repeated administration is reduced by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 90%, relative to a standard dosage of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57.

Embodiment 89

(358) The method of any one of embodiments 77 to 88, wherein administration of the at least one additional therapy is repeated at least once after initial administration.

Embodiment 90

(359) The method of embodiment 89, wherein the amount of the at least one additional therapy used for repeated administration is reduced relative to the amount used for initial administration.

Embodiment 91

(360) The method of embodiment 89, wherein the amount of the at least one additional therapy used for repeated administration is reduced relative to a standard dosage of the at least one additional therapy.

Embodiment 92

(361) The method of embodiment 89, wherein the amount of the at least one additional therapy used for repeated administration is reduced by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 90%, relative to a standard dosage of the at least one additional therapy.

Embodiment 93

(362) The method of any one of embodiments 77 to 92, wherein repeated administration of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, is concurrent with repeated administration of the at least one additional therapy.

Embodiment 94

(363) The method of any one of embodiments 77 to 92, wherein repeated administration of the at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, is sequential or staggered with repeated administration of the at least one additional therapy.

Embodiment 95

(364) The method of any one of embodiments 77 to 94, wherein the at least one additional therapy comprises administering a checkpoint inhibitor.

Embodiment 96

(365) The method of embodiment 95, wherein the subject is intolerant, non-responsive, or poorly responsive to the checkpoint inhibitor when administered alone.

Embodiment 97

(366) The method of embodiment 95, wherein the checkpoint inhibitor targets CTLA4, PD1, PDL1, OX40, CD40, GITR, LAG3, TIM3, and/or KIR.

Embodiment 98

(367) The method of embodiment 95, wherein the checkpoint inhibitor targets CTLA4, OX40, CD40, and/or GITR.

Embodiment 99

(368) The method of embodiment 97 or embodiment 98, wherein the checkpoint inhibitor comprises a cytotoxic T-lymphocyte-associated antigen 4 pathway (CTLA4) inhibitor.

Embodiment 100

(369) The method of embodiment 99, wherein the CTLA4 inhibitor is an anti-CTLA4 antibody.

Embodiment 101

(370) The method of embodiment 100, wherein the anti-CTLA4 antibody is ipilimumab.

Embodiment 102

(371) The method of embodiment 97 or embodiment 98, wherein the checkpoint inhibitor comprises a programmed death-1 pathway (PD1) inhibitor.

Embodiment 103

(372) The method of embodiment 102, wherein the PD1 inhibitor is an anti-PD1 antibody.

Embodiment 104

(373) The method of embodiment 103, wherein the anti-PD1 antibody is nivolumab.

Embodiment 105

(374) The method of embodiment 102, wherein the PD1 inhibitor is an anti-PDL1 antibody.

Embodiment 106

(375) The method of embodiment 105, wherein the anti-PDL1 antibody is atezolizumab.

Embodiment 107

(376) The method of embodiment 97 or embodiment 98, wherein the checkpoint inhibitor comprises a CTLA4 inhibitor and a PD1 inhibitor.

Embodiment 108

(377) The method of embodiment 107, wherein the CTLA4 inhibitor is an anti-CTLA4 antibody.

Embodiment 109

(378) The method of embodiment 108, wherein the anti-CTLA4 antibody is ipilimumab.

Embodiment 110

(379) The method of embodiment 107 or embodiment 108, wherein the PD1 inhibitor is an anti-PD1 antibody.

Embodiment 111

(380) The method of embodiment 110, wherein the anti-PD1 antibody is nivolumab.

Embodiment 112

(381) The method of embodiment 107 or embodiment 108, wherein the PD1 inhibitor is an anti-PDL1 antibody.

Embodiment 113

(382) The method of embodiment 112, wherein the anti-PDL1 antibody is atezolizumab.

Embodiment 114

(383) The method of any one of embodiments 77 to 94, wherein the at least one additional therapy comprises administering a cytokine or cytokine analog.

Embodiment 115

(384) The method of embodiment 114, wherein the subject is intolerant, non-responsive, or poorly responsive to the cytokine or cytokine analog when administered alone.

Embodiment 116

(385) The method of embodiment 114, wherein the cytokine or cytokine analog comprises a T-cell enhancer.

Embodiment 117

(386) The method of embodiment 114, wherein the cytokine or cytokine analog comprises IL-2, IL-10, IL-12, IL-15, IFNγ, and/or TNFα.

Embodiment 118

(387) The method of any one of embodiments 77 to 94, wherein the at least one additional therapy comprises engineered tumor-targeting T-cells.

Embodiment 119

(388) The method of any one of embodiments 77 to 118, wherein the subject has a non-synonymous mutational burden of about 150 mutations or less.

Embodiment 120

(389) The method of any one of embodiments 77 to 119, wherein the subject has a non-synonymous mutational burden of about 100 mutations or less.

Embodiment 121

(390) The method of any one of embodiments 77 to 120, wherein the subject has a non-synonymous mutational burden of about 50 mutations or less.

Embodiment 122

(391) The method of any one of embodiments 77 to 121, wherein the cancer is a hematological malignancy or a solid tumor. The method of embodiment 122, wherein the hematological malignancy is chosen from a B-cell malignancy, a leukemia, a lymphoma, and a myeloma.

Embodiment 123

(392) The method of embodiment 122 or embodiment 123, wherein the hematological malignancy is chosen from acute myeloid leukemia and multiple myeloma.

Embodiment 124

(393) The method of embodiment 122, wherein the solid tumor is chosen from breast cancer, gastric cancer, prostate cancer, ovarian cancer, lung cancer, uterine cancer, salivary duct carcinoma, melanoma, colon cancer, and esophageal cancer.

Embodiment 125

(394) The method of any one of embodiments 77 to 121, wherein the cancer is chosen from myelodysplastic syndrome, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer, ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma, and lung cancer.

Embodiment 126

(395) A method of inducing at least one neoantigen, comprising contacting a neoplastic cell with a therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, thereby inducing production of at least one neoantigen.

Embodiment 127

(396) The method of embodiment 126, wherein the neoplastic cell is present in an in vitro cell culture.

Embodiment 128

(397) The method of embodiment 126 or embodiment 127, wherein the neoplastic cell is obtained from a subject.

Embodiment 129

(398) The method of embodiment 126, wherein the neoplastic cell is present in a subject.

Embodiment 130

(399) The method of any one of embodiments 126 to 129, wherein the neoplastic cell is derived from a hematological malignancy or a solid tumor.

Embodiment 131

(400) The method of embodiment 130, wherein the hematological malignancy is selected from a B-cell malignancy, a leukemia, a lymphoma, and a myeloma.

Embodiment 132

(401) The method of embodiment 130 or embodiment 131, wherein the hematological malignancy is selected from acute myeloid leukemia and multiple myeloma.

Embodiment 133

(402) The method of embodiment 130, wherein the solid tumor is selected from breast cancer, gastric cancer, prostate cancer, ovarian cancer, lung cancer, uterine cancer, salivary duct carcinoma, melanoma, colon cancer, and esophageal cancer.

Embodiment 134

(403) A method of inducing at least one neoantigen and/or a T-cell response in a subject having or suspected of having a neoplastic disorder, comprising administering to the subject a therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57.

Embodiment 135

(404) A method of treating a subject having or suspected of having a neoplastic disorder, comprising administering to the subject a therapeutically effective amount of at least one compound chosen from compounds and/or pharmaceutically acceptable salts thereof of any one of embodiments 1-54, or the pharmaceutical composition of any one of embodiments 55-57, wherein administration of the at least one compound or the pharmaceutical composition induces at least one neoantigen and/or a T-cell response.

Embodiment 136

(405) The method of embodiment 135, wherein the amount of the at least one compound or the pharmaceutical composition administered is reduced due to induction of at least one neoantigen and/or a T-cell response, relative to a standard dosage of the at least one compound or the pharmaceutical composition.

Embodiment 137

(406) The method of embodiment 136, wherein the administered amount of the at least one compound or the pharmaceutical composition is reduced by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 90%, relative to a standard dosage of the at least one compound or the pharmaceutical composition.

Embodiment 138

(407) The method of any one of embodiments 135 to 137, wherein the at least one compound or the pharmaceutical composition is administered at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, or 90% less frequently, relative to a standard dosing regimen of the at least one compound or the pharmaceutical composition.

Embodiment 139

(408) The method of any one of embodiments 135 to 137, wherein the administered amount and/or dosage of the at least one compound or the pharmaceutical composition results in lower systemic toxicity and/or improved tolerance.

Embodiment 140

(409) The method of any one of embodiments 134 to 119, further comprising administering at least one additional therapy.