IMMUNOMODULATION BY CONTROLLING ELR+ PROINFLAMMATORY CHEMOKINE LEVELS WITH THE LONG NON-CODING RNA UMLILO
20170349898 · 2017-12-07
Assignee
Inventors
- EMILIANO DALLA (TRIESTE, IT)
- MUSA M. MHLANGA (JOHANNESBURG, ZA)
- STEPHANIE FANUCCHI (JOHANNESBURG, ZA)
- YOUTARO SHIBAYAMA (PRETORIA, ZA)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2740/15041
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C12N2310/113
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to methods for modulating the production of ELR+ proinflammatory chemokines in a subject or a cell using either UMLILO IncRNA inhibitors to decrease production of ELR+ proinflammatory cytokines or using UMLILO IncRNA's to increase the production of ELR+ proinflammatory cytokines. The invention also provides for the use of UMLILO IncRNA inhibitors or UMLILO IncRNA's to modulate the expression of ERL+ proinflammatory cytokines.
Claims
1-13. (canceled)
14. A method of decreasing the production of ELR+ proinflammatory chemokines in a subject, the method comprising administering an effective amount of an UMLILO IncRNA inhibitor to the subject.
15. The method of claim 14, wherein the ELR+ proinflammatory chemokines are IL8, CXCL1, CXCL2 and CXCL3.
16. The method of claim 14, wherein the UMLILO IncRNA inhibitor is selected from the group consisting of antisense oligonucleotides, miRNAs, siRNAs, piRNAs, snRNAs, CAS9/CRISPR, TALENS, zinc finger nucleases, BUD1 nucleases, antibody drug conjugates (ADCs) or small molecule inhibitors.
17. The method of claim 16, wherein the siRNA is an siRNA comprising a sequence selected from the group consisting of SEQ ID NOs:54 to 57.
18. The method of claim 16, wherein the small molecule inhibitor is MM-102, MM401 or OICR-9429.
19. The method of claim 14, wherein the UMLILO IncRNA inhibitor is provided by a recombinant polynucleotide comprising a promoter operably linked to a polynucleotide encoding the UMLILO IncRNA inhibitor.
20. The method of claim 19, wherein the UMLILO IncRNA inhibitor is provided by a lentiviral vector-carrying short hairpin RNA (shRNA) and wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NOs:54 to 57.
21. The method of claim 14, wherein the subject displays reduced inflammation after treatment with the UMLILO IncRNA inhibitor.
22. The method of claim 14, wherein the subject has an inflammatory condition, an autoimmune disorder or cancer.
23. The method of claim 22, wherein the inflammatory condition is selected from the group consisting of allergy, acne vulgaris, appendicitis, asthma, atherosclerosis, bursitis, cancer, celiac disease, chronic prostatitis, colitis, cystitis, dermatitis, glomerulonephritis, hay fever, viral infection, bacterial infection, fungal infection, archeal infection, inflammatory bowel disease, pelvic inflammatory disease, periodontitis, phlebitis, reperfusion injury, rhinitis, rheumatoid arthritis, sarcoidosis, sepsis, tendonitis, tonsillitis, transplant rejection, type 1 hypersensitivity and vasculitis.
24. The method of claim 22, wherein the autoimmune disorder is selected from the group consisting of acute disseminated encephalomyelitis, acute motor axonal neuropathy, Addison's disease, adiposis dolorosa, adult-onset still's disease, alopecia areata, ankylosing spondylitis, anti-glomerular basement membrane nephritis, anti-neutrophil cytoplasmic antibody-associated vasculitis, anti-N-methyl-D-aspartate receptor encephalitis, antiphospholipid syndrome, antisynthetase syndrome, aplastic anemia, autoimmune angioedema, autoimmune enteropathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune neutropenia, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune polyendocrine syndrome type 2, autoimmune polyendocrine syndrome type 3, autoimmune progesterone dermatitis, autoimmune retinopathy, autoimmune thrombocytopenic purpura, autoimmune thyroiditis, autoimmune urticarial, autoimmune uveitis, balo concentric sclerosis, Behçet's disease, Bickerstaff's encephalitis, bullous pemphigoid, celiac disease, chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, Cogan syndrome, cold agglutinin disease, crest syndrome, Crohn's disease, dermatitis herpetiformis, dermatomyositis, diabetes mellitus type 1, discoid lupus erythematosus, drug-induced lupus, endometriosis, enthesitis-related arthritis, eosinophilic fasciitis, epidermolysis bullosa acquisita, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, Felty syndrome, fibromyalgia, gestational pemphigoid, giant cell arteritis, Graves' disease, Graves ophthalmopathy, Guillain-Barré syndrome, Hashimoto's encephalopathy, Henoch-Schonlein purpura, hidradenitis suppurativa, idiopathic inflammatory demyelinating diseases, Igg4-related systemic disease, inclusion body myositis, intermediate uveitis, interstitial cystitis, juvenile arthritis, Kawasaki's disease, Lambert-Eaton myasthenic syndrome, leukocytoclastic vasculitis, lichen planus, lichen sclerosus, ligneous conjunctivitis, linear IgA disease, lupus nephritis, lupus vasculitis, Lyme disease, Ménière's disease, microscopic colitis, microscopic polyangiitis, mixed connective tissue disease, Mooren's ulcer, morphea, Mucha-Habermann disease, multiple sclerosis, myasthenia gravis, myocarditis, myositis, neuromyelitis optica, neuromyotonia, opsoclonus myoclonus syndrome, optic neuritis, Ord's thyroiditis, palindromic rheumatism, paraneoplastic cerebellar degeneration, paroxysmal nocturnal hemoglobinuria, Parry Romberg syndrome, Parsonage-Turner syndrome, pediatric autoimmune neuropsychiatric disorder associated with streptococcus, pemphigus vulgaris, pernicious anemia, pityriasis lichenoides et varioliformis acuta, polyarteritis nodosa, polymyalgia rheumatica, polymyositis, postmyocardial infarction syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, progressive inflammatory neuropathy, psoriasis, psoriatic arthritis, pure red cell aplasia, reactive arthritis, relapsing polychondritis, restless leg syndrome, retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, rheumatoid vasculitis, sarcoidosis, Schnitzler syndrome, scleritis, Sjogren's syndrome, stiff person syndrome, subacute bacterial endocarditis, Susac's syndrome, Sydenham chorea, sympathetic ophthalmia, systemic lupus erythematosus, systemic scleroderma, thrombocytopenia, Tolosa-Hunt syndrome, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, urticarial vasculitis, vasculitis and vitiligo
25. A method of increasing the production of ELR+ proinflammatory chemokines in a subject, the method comprising administering an effective amount of an UMLILO IncRNA to the subject, wherein transcription of the ELR+proinflammatory chemokines is initiated in a cell when WRDS is present with the UMLILO IncRNA.
26. The method of claim 25, wherein the ELR+ proinflammatory chemokines are IL8, CXCL1, CXCL2 and CXCL3.
27. The method of claim 25, wherein the UMLILO IncRNA is provided by a recombinant polynucleotide comprising a promoter operably linked to a polynucleotide encoding the UMLILO IncRNA.
28. The method of claim 25, wherein the subject has an immunodeficiency and wherein the immunodeficiency results in the subject having an increased risk of a pathogenic infection.
29. The method of claim 28, wherein the pathogenic infection is a viral, bacterial, fungal or parasitic infection.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0040] Non-limiting embodiments of the invention will now be described by way of example only and with reference to the following figures:
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
DETAILED DESCRIPTION OF THE INVENTION
[0070] The present invention will now be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the invention are shown.
[0071] The invention as described should not be limited to the specific embodiments disclosed and modifications and other embodiments are intended to be included within the scope of the invention. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
[0072] As used throughout this specification and in the claims which follow, the singular forms “a”, “an” and “the” include the plural form, unless the context clearly indicates otherwise.
[0073] The terminology and phraseology used herein is for the purpose of description and should not be regarded as limiting. The use of the terms “comprising”, “containing”, “having” and “including” and variations thereof used herein, are meant to encompass the items listed thereafter and equivalents thereof as well as additional items.
[0074] As used herein the term “UMLILO” refers to the Upstream Master LncRNA of the Inflammatory chemokine LOcus, a long non-coding RNA (IncRNA) encoded by the human genome sequence corresponding to the following genomic co-ordinates: chr4:74,576,019-74,580,0244. An exemplary DNA sequence encoding for UMLILO is provided in SEQ ID NO:1. Alternative transcript names for UMLILO include: TCONS_00007551; ENST00000436089; ENST00000436089.1; AC112518.3-001; OTTHUMT00000322 216.2; NONHSAT096866.
[0075] The term “immunomodulatory” or “modulating an immune response” as used herein includes immunostimulatory as well as immunosuppressive effects. Immunomodulation, for example, by UMLILO or an inhibitor of UMLILO may cause an increase or decrease in CXC production, respectively, in an individual treated in accordance with the methods of the invention as compared to the absence of treatment. The level of CXC, in turn modulates chemotaxis innate and cellular immune responses by interacting with G protein-linked transmembrane receptors or chemokine receptors, that are selectively found on the surfaces of their target cells e.g. neutrophils, macrophages, T-lymphocytes, mast cells and eosinophils.
[0076] The term “microRNA” refers to endogenous or artificial non-coding RNAs that are capable of regulating gene expression. It is believed that miRNAs function via RNA interference. Endogenous (e.g., naturally occurring) miRNAs are typically expressed from RNA polymerase II promoters and are generated from a larger transcript.
[0077] The term “siRNA” refers to single-stranded or double-stranded RNA molecules that are capable of inducing RNA interference. siRNA molecules typically have a duplex region that is between 18 and 30 base pairs in length.
[0078] The term “piRNA” refers to a class of small RNAs involved in gene silencing. piRNA molecules typically are between 26 and 31 nucleotides in length.
[0079] The term “snRNA” refers to a class of small RNAs involved in a variety of processes including RNA splicing and regulation of transcription factors. The subclass of small nucleolar RNAs (snoRNAs) is also included. The term is also intended to include artificial snRNAs, such as antisense derivatives of snRNAs comprising antisense sequences directed against the IncRNA, UMLILO.
[0080] The terms “chemokine,” “pro-inflammatory chemokine,” “CXC chemokine” and “CXC” are interchangeable and refer to cytokines characterised according to behavioural and structural characteristics to induce neutrophil chemotaxis to the site of injury or infection, in particular CXC chemokines having two N-terminal cysteines separated by one amino acid, even more particularly having a specific amino acid sequence of glutamic acid-leucine-arginine (ELR) immediately before the first cysteine of the CXC motif (ELR-positive or ELR+ CXC chemokines). ELR-positive (ELR+) CXC chemokines specifically induce the migration of neutrophils, and interact with chemokine receptors CXCR1 and CXCR2. An example of an ELR-positive CXC chemokine is interleukin-8 (IL-8), which induces neutrophils to leave the bloodstream and enter into the surrounding tissue.
[0081] The term “exon” when used in relation to a IncRNA refers to a defined section of nucleic acid that is represented in the mature form of a IncRNA molecule after portions of a pre-processed (or precursor) IncRNA have been removed by splicing.
[0082] The term “intron” when used in relation to a IncRNA refers to a nucleic acid region in the precursor IncRNA that is subsequently removed by splicing during formation of the mature IncRNA.
[0083] The terms “polynucleotide,” “oligonucleotide,” “oligo” “nucleic acid” and “nucleic acid molecule” are used herein to include a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide. There is no intended distinction in length between these terms and they are used interchangeably.
[0084] The term “pharmaceutically acceptable excipient or carrier” refers to an excipient that may optionally be included in the compositions of the invention and that causes no significant adverse toxicological effects to the patient.
[0085] The term “pharmaceutically acceptable salt” includes, but is not limited to, amino acid salts, salts prepared with inorganic acids, such as chloride, sulfate, phosphate, diphosphate, bromide, and nitrate salts, or salts prepared from the corresponding inorganic acid form of any of the preceding, e.g., hydrochloride, etc., or salts prepared with an organic acid, such as malate, maleate, fumarate, tartrate, succinate, ethylsuccinate, citrate, acetate, lactate, methanesulfonate, benzoate, ascorbate, para-toluenesulfonate, palmoate, salicylate and stearate, as well as estolate, gluceptate and lactobionate salts. Similarly salts containing pharmaceutically acceptable cations include, but are not limited to, sodium, potassium, calcium, aluminum, lithium, and ammonium (including substituted ammonium).
[0086] The term “pathogen” or “parasite” or “microbe” refers to any virus or organism that spends at least part of its life cycle or reproduces within a host. Intracellular pathogens include, but are not limited to, viruses (e.g., influenza virus, respiratory syncytial virus, hepatitis virus B, hepatitis virus C, herpes virus, papilloma virus, and human immunodeficiency virus), bacteria (e.g., Listeria, Mycobacteria (e.g., Mycobacterium tuberculosis, Mycobacterium leprae), Salmonella (e.g., S. typhi), enteropathogenic Escherichia coli (EPEC), enterohaemorrhagic Escherichia coli (EHEC), Yersinia, Shigella, Chlamydia, Chlamydophila, Staphylococcus, Legionella), protozoa (e.g., Plasmodium (e.g., P. vivax, P. falciparum, P. ovale, and P. malariae), Taxoplasma, Leishmania), and fungi (e.g., Aspergillus, Blastomyces, Candida). Eukaryotic intercellular parasites include trematodes (e.g., Schistosoma, Clonorchis), hookworms (e.g., Ancylostoma duodenale and Necator americanus), and tape worms (e.g., Taenia solium, T. saginata, Diphyllobothrium spp., Hymenolepis spp., Echinococcus spp.).
[0087] The term “cancer” refers to human cancers and carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., including but not limited to solid tumors and lymphoid cancers, kidney, breast, lung, kidney, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, esophagus, and liver cancer, lymphoma, including non-Hodgkin's and Hodgkin's lymphoma, leukemia, and multiple myeloma.
[0088] The terms “overexpress,” “overexpression” or “overexpressed” interchangeably refer to a gene that is transcribed or translated at a detectably greater level, in comparison to a normal cell. Overexpression therefore refers to both overexpression of protein and/or RNA (due to increased transcription, post transcriptional processing, translation, post translational processing, altered stability, and/or altered protein degradation), as well as local overexpression due to altered protein traffic patterns (increased nuclear localization), and augmented functional activity, e.g., as in an increased enzyme hydrolysis of substrate.
[0089] The term “inhibitor” refers to an agent that, by way of non-limiting example, inhibits expression of a IncRNA of the invention or bind to, partially or totally block stimulation or enzymatic activity, decrease, prevent or delay activation, inactivate, desensitize, or down regulate the activity of a IncRNA of the invention, e.g., antagonists.
[0090] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI website: ncbi.nlm.nih.gov/BLAST/or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0091] The term “up-regulation” refers to the process by which a cell increases the quantity of a cellular component, such as RNA or protein, in response to an internal or external variable or stimulus.
[0092] An “effective amount” of UMLILO is an amount sufficient to effect beneficial or desired results, such as an amount that increases production of CXCs. An effective amount can be administered in one or more administrations, applications, or dosages.
[0093] An “effective amount” of an UMLILO inhibitor (e.g., microRNA, siRNA, piRNA, snRNA, antisense nucleic acid, ribozyme, or small molecule inhibitor) is an amount sufficient to effect beneficial or desired results, such as an amount that inhibits the activity of UMLILO, for example by interfering with transcription of UMLILO, binding of UMLILO to WDRS, or activation of CXC gene expression. An effective amount can be administered in one or more administrations, applications, or dosages.
[0094] Statistics
[0095] p values from two-tailed unpaired Student's t test and Fisher Exact tests were calculated using R (http://www.R-project.org). * p<0.05, **p<0.01, and ***p<0.001.
[0096] Bioinformatic analysis of both Hi-C and ChIA-PET data in the CXC TAD identified a ‘super-enhancer’ region, spanning ˜80kb and forming extensive chromosomal contacts with the proinflammatory genes. CAGE analysis across various primary cell types and cell lines identified UMLILO (upstream master linc of the chemokine locus), a novel IncRNA transcribed from within the super enhancer region in resting immune and non-immune cells. UMLILO is highly conserved in mammals with neutrophil-rich blood, whereas no homolog of either UMLILO or IL-8 exists in rodents and other animals with neutrophil-poor blood. “Super enhancer” drugs targeting BRD4 abrogate chemokine expression, but UMLILO expression remained unaffected. Using genome-editing technologies and siRNA knockdown approaches we show that UMLILO is necessary for chemokine expression. Further, simultaneous intronic FISH revealed that UMLILO transcription precedes the chemokine gene expression. This suggests that UMLILO may be required to establish a nuclear compartment that facilitates the rapid activation of chemokine gene expression. Accordingly, RNA immunopreciptation experiments revealed that UMLILO might coordinate chemokine gene regulation by acting as a scaffold to recruit chromatin remodelers and the WAR complex to the chemokine TAD. Preventing the WDR5/MLL1 interaction using the small molecule inhibitor, MM-102 abrogated chemokine transcription. Therefore, we present a novel approach to alter the transcriptional status of chemokine genes.
[0097] The following examples are offered by way of illustration and not by way of limitation.
EXAMPLE 1
[0098] Cell Culture
[0099] Early passage HUVECs from pooled donors (Lonza) were grown to ˜80% confluence in Endothelial Basal Medium-2 (EGM-2) with supplements (Lonza), serum-starved (18 hr) in EGM-2+0.5% FBS, and treated with TNF (10 ng/ml; Sigma) for up to 24 hr. Prior to transfection cells were grown in antibiotic free EGM-2.
[0100] Hi-C analysis
[0101] Hi-C sequencing data were preprocessed (iterative alignment and outlier removal) using the pipeline described by lmakaev and colleagues (Imakaev et al. 2012). The heatmap in the chemokine locus show the Hi-C interactions as paired-read counts between pairs of sliding windows of 50 Kbp in length.
[0102] ChIA-PET Analysis
[0103] The two Pol II (Ser2/Ser5) ChIA-PET libraries for HUVEC were obtained from NCBI (accession numbers: GSE41553) (Papantonis et al. 2012). One library is obtained 0 min after TNF treatment while another one is obtained 30 min after TNF treatment. Each library yielded about 35 millions paired-end reads. Both libraries were processed by ChIA-PET tool (Li et al. 2010). Briefly, the head and tail ChIA-PET tags are first extracted from the sequences. The ChIA-PET tags were then mapped to the human reference genome (hg19) by Batmis (Tennakoon et al. 2012) and 10.8×10.sup.6 and 8.8×10.sup.6 are successfully aligned to hg19 for 0 min and 30 min samples, respectively. From the uniquely mapped paired-end tags (PETs), we extract all intra-chromosomal PETs. Precisely, intra-chromosomal PETs were defined as the head and tail of the PETs mapped onto the same chromosome with a genomic distance at least 5 Kbp. The intra-chromosomal PETs are then clustered to form ChIA-PET interaction clusters.
[0104] Identification of Enhancers in the Chemokine TAD
[0105] We used the web tool PrESSto (Promoter Enhancer Slider Selector Tool, htp://pressto.binf.ku.dk/) to query the atlas of active, in vivo bi-directionally transcribed human enhancers identified analysing the FANTOM5 panel of tissue and primary cell samples (Andersson et al. 2014). Across the chemokine locus (chr4: 74,500,000-75,000,000) we searched for enhancers significantly expressed in the “blood vessel endothelial cell” and the “macrophage” facets (% expression≧1, P value<0.001, Benjamini-Hochberg adjusted FDR<0.05). Every identified enhancer was associated to its overall % of expression and number of tags per million (tpm) in the facets, as well as its relative tpm in every single sample belonging to the analysed facets.
[0106] Identification of Long Noncoding RNAs in the Chemokine TAD
[0107] We used the ENSEMBL mart human database (Release GRCh37.p13) to identify all the IncRNAs mapping to the chemokine locus (chr4:74,500,000-75,000,000). We then queried the FANTOM5 human expression atlas to evaluate the promoter activity associated to the Transcription Start Site (TSS) of every identified IncRNA. The ZENBU omics interactive visualization system (human hg19, February 2015 updated release) was used to derive the expression levels of each IncRNA in 1829 human samples (primary cells, cancer cell-lines and post-mortem tissues) profiled either in steady state or time-course experiments.
[0108] CRISPR Synthesis
[0109] Software developed by the Zhang laboratory (http://www.genome-engineering.org/) was used to identify CRISPR candidate guide sequences (Cong et al. 2013). CRISPRs were generated using the protocol described by Cong et al., briefly, 1 μg of pX330 was digested with Bbsl for 30 min at 37° C., gel purified using QlAquick Gel Extraction Kit and eluted in elution buffer. Oligos were then phosphorylated using T4 PNK (NEB) and annealed using the following parameters: 37° C. for 30 min; 95° C. for 5 min and then ramp down to 25° C. at 5° C/min. Annealed oligos were then ligated into the BbSI-digested pX330 vector using Quickligase (NEB). The ligation reaction was then treated with PlasmidSafe exonuclease to prevent unwanted recombination products at 37° C. for 30 min. Colony PCR was used on E. coli transformants to identify successful CRISPR clones. HUVECs were then microporated with the respective CRISPR using the Neon® Transfection System (Life Technologies) according to manufacturer's instructions. HeLas were transfected with Lipofectamine 2000 according to manufacturer's instructions. Nuclease activity was assessed by the surveyor assay.
[0110] RNA Interference
[0111] HUVECs and HeLas were transfected as per manufacturer's instructions with siRNAs targeting UMLILO (Dharmacon) using the Neon® Transfection System (Life Technologies) and Lipofectamine 2000 (Invitrogen) respectively. Total RNA was harvested 48-72 hr later using TRIzol (Invitrogen) according to manufacturer's instructions. The following siRNA's were used:
TABLE-US-00001 (SEQ ID NO: 54) UMLILO siRNA 1: 5′ AUC UUA AAU UAG AGG CGA AUU 3′ (SEQ ID NO: 55) UMLILO siRNA 2: 5′ CAU ACA AAU UCU CGC AGC AUU 3′ (SEQ ID NO: 56) UMLILO siRNA 3: 5′ AAG AGU UGG UAC ACG GUG AUU 3′ (SEQ ID NO: 57) UMLILO siRNA 4: 5′ GCA UAU UAA CCC UAC AAG UUU 3′
[0112] RT-qPCR
[0113] For all RT-qPCR analyses, whole RNA was extracted using TRIzol (Invitrogen) according to manufacturer's instructions. cDNA was generated using the SuperScript III cDNA kit (Invitrogen). All qPCR primers (Table 1) were verified to produce specific products and to perform efficiently.
[0114] qPCR reactions were performed with technical triplicates on a CFX Real Time PCR detection system (Biorad) with SsoFast qPCR Supermix (Biorad). Relative quantification was performed using the delta delta Ct method with HPRT as a reference gene.
TABLE-US-00002 TABLE 1 QPCR primers Direc- SEQ ID Target tion Primer sequence NO. UMLILO FW 5′ GGAAGGAGGGGAACATGGAA 3′ SEQ ID intron NO: 2 1 RW 5′ CTACCTGACTCCCTCCCTCT 3′ SEQ ID NO: 3 UMLILO FW 5′ GGTACACGGTGAACATTTGCT 3′ SEQ ID exon 3 NO: 4 RW 5′ CAGCATCTCTCTGTCCACTGA 3′ SEQ ID NO: 5 IL8 FW 5′ AGGGCCAAGAGAATATCCGA 3′ SEQ ID gene NO: 6 RW 5′ GGACTTGTGGATCCTGGCTA 3′ SEQ ID NO: 7 CXCL1 FW 5′ AGCTTGCCTCAATCCTGCAT 3′ SEQ ID gene NO: 8 RW 5′ CCTCCTCCCTTCTGGTCAGT 3′ SEQ ID NO: 9 CXCL2 FW 5′ CACAGTGTGTGGTCAACATTTCTC 3′ SEQ ID gene NO: 10 RW 5′ ACACAGAGGGAAACACTGCATAA 3′ SEQ ID NO: 11
[0115] RNA FISH Probes
[0116] RNA FISH was performed according to the protocol by Raj et al. 2008 using 48 20-mer probes (Biosearch) targeting the following genes: IL-8 intron 1 (SEQ ID NOs:58-101), CXCL1 intron 1 (SEQ ID NOs:187-227), CXCL2 intron 1 (SEQ ID NOs:149-186), UMLILO intron 1 and intron 2 (SEQ ID NOs:260-294) and 28 20-mer probes targeting eGFP (SEQ ID NOs:228-259). Each 20-mer bares a 3′-amino-modifier C6-dT. The amino group was subsequently conjugated to the following NHS-ester dyes: ATTO-488, ATTO-565, ATTO-647N (ATTO-TEC) or Alexa Fluor 647 (Invitrogen). Briefly, oligonucleotide probes were ethanol precipitated and resuspended in 0.1 M sodium tetraborate (Sigma). Approximately 0.3 mg of the NHS-ester dye (ATTO-TEC) was dissolved in dimethyl sulphoxide (Sigma). The dye solution was added to the probe solution and incubated overnight in the dark at 37° C. Following conjugation reaction, the probes were ethanol precipitated overnight, and resuspended in 0.1 M Triethyl ammonium (TEA, Sigma). Conjugated probes were separated and purified to enrich for dye-conjugated probes by reverse phase HPLC on a C18 column.
[0117] Immuno-RNA FISH
[0118] For each experiment, early passage HUVECs on coverslips were grown to ˜80% confluence, treated with TNF, fixed in 3.7% formaldehyde for 10 mins at room temperature, then washed three times in PBS. Cells were permeabilized in ice-cold 90% methanol for ten minutes, then washed twice with PBS and incubated in blocking buffer (1% BSA/PBS) for 30 minutes at room temperature on an orbital shaker. Cells were then incubated in primary antibody solution (diluted in 1% BSA/PBS) for 1 hr. Double strand breaks were detected with rabbit polyclonal anti-phospho-histone H2A.X (Ser139) (Sigma). Goat polyclonal anti-WDR5 (SantaCruz) was used to detect WDR5 protein. Coverslips were then washed 5 times with wash buffer (0.05% Tween-20/PBS), following incubation with secondary antibodies conjugated to either Atto-488 or Atto-565 for 1 hr. Coverslips were then washed 5 times with wash buffer (0.05% Tween-20/PBS), and post-fixed with 3.7% formaldehyde/PBS for 10 minutes at room temperature, followed by further permeabilization in 70% ethanol overnight. For RNA FISH detection, coverslips were washed twice in PBS and incubated in wash buffer (10% formamide, 2×SCC-1×SCC is 0.15 M NaCl plus 0.015 M sodium citrate) for 5 min. Cells were then hybridized overnight in a humidified chamber at 37° C. in 50 μl of Hyb buffer (10% dextran sulfate, 1 μg/μl E. Coli tRNA, 2 mM Vanadyl ribonucleoside complex, 0.02% RNAse-free BSA, 10% formamide) combined with 50 ng of single molecule FISH probes. Coverslips were then washed 3× (30 min each on the orbital shaker) in wash buffer (10% formamide, 2×SCC). Cells were then incubated in equilibration buffer (0.4% glucose, 2×SCC) for 5 min and counter stained with 1 μg/ml DAPI (4′,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in glox buffer (3.7 μg/μl glucose oxidase, 1U catalase) and imaged.
[0119] Image Acquisition and Processing
[0120] Cells were imaged on a custom built Nikon Ti Eclipse widefield TIRF microscope using a 100× N.A. 1.49 Nikon Apochromat TIRF oil immersion objective. Imaging was done using mercury lamp illumination through the appropriate filter sets at low camera gain in each of the fluorescent channels using an Andor iXion897 EMCCD camera cooled to −80° C. The microscope was controlled using pmanager open source microscope management software (NIH and UCSF, USA). A 20 ms exposure time was used for DAPI. Exposure times ranged from 200 to 500 ms for other dyes. Each field of view was captured as a series of images acquired on multiple focal planes through the samples, across a range of 2-10 μm in the axial plane. A 0.2 μm piezo step-size was used for these z-stacks. Chromatic aberration was verified before image capture by alignment of Focal Check Fluorescent Microspheres (Molecular Probes). Signal intensities were measured using Fiji (Schindelin et al., 2012). The contrast of pictures shown was adjusted to fit a 16 bit grey scale. To facilitate the comparison between different fields of view on the same coverslip, IDV values were normalized relative to the intensity of fluorescent beads.
[0121] Repair Construct
[0122] To generate double stranded PCR product harboring the 20 and 18 bp homologous arms, the following primers were used: [0123] (100 nmole and HPLC purification)
TABLE-US-00003 (SEQ ID NO: 12) FW: 5′ TTGAACCGGGTTTTCCAGTCACATATGGTGAGCAAGGGCGA 3′ (SEQ ID NO: 13) RW: 5′ ACTATGAAGACTCTTGGGTCACTTGTACAGCTCGTCCA 3′
[0124] The PCR product was purified by QlAquick PCR Purification Kit (Qiagen) prior to transfection.
[0125] Chromatin Immunoprecipitation
[0126] For each ChIP experiment, 1×10.sup.7 cells were grown to ˜80% confluence, fixed in 3.7% formaldehyde for 10 mins at room temperature, then washed three times in PBS. Then, glycine was added to a final concentration of 125 mM to the media and incubated with shaking for 5 min at RT. Cells were rinsed 2× with 10 ml cold PBS, scraped into 5 ml cold PBS and centrifuged for 5 min at 1,000 g. The resultant pellet was resuspended in FA Lysis Buffer (50 mM HEPES-KOH pH 7.5; 140 mM NaCl; 1 mM EDTA pH 8; 1% Triton X-100; 0.1% Sodium Deoxycholate; 0.1% SDS; Protease Inhibitors (add fresh each time). The nuclear pellet was then sonicated with the Covaris S220 Sonicator to an average fragment size of 500 to 1000 bp and centrifuged for 30 seconds at 4° C., 8,000 g. The supernatant was transferred to a new tube. 50 μl of each sonicated sample was removed as the INPUT to obtain the DNA concentration. 25 μg of protein was used per IP. Protein concentration was calculated using the Bradford assay. Each sample was diluted 1:10 with RIPA buffer (50 mM Tris-HCl pH 8.0; 2 mM EDTA pH 8.0; 1% NP-40; 0.5% Sodium Deoxycholate; 0.1% SDS; Protease Inhibitors (add fresh each time). 2 μg of antibody was added per 25 μg of protein. The following ChIP grade antibodies were used: anti-H3K4me3 (Abcam), MED12 (Bethyl laboratories), anti-RNA Pol II Ser5 (Abcam), anti-WDR5 (H-35 SantaCruz). 20 μl of magnetic protein A/G beads (Resyn Biosciences) (pre-absorbed with sonicated single stranded salmon sperm DNA at 1.5 μg/20 μl beads) to all samples and incubated at 4° C. overnight with rotation. Beads were washed 3× with 1 ml wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA pH 8; 150 mM NaCl; 20 mM Tris-HCl pH 8) and then 1× with final wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA pH 8; 500 mM NaCl; 20 mM Tris-HCl pH 8). DNA was eluted with 120 μl of Elution Buffer (1% SDS; 100 mM NaHCO.sub.3) to the protein A/G beads and incubated at 37° C. for 15 min with rotation. DNA from ChIP and INPUT samples was purified using phenol:chloroform extraction and ethanol precipitated in presence of 10 μl glycogen (5 mg/ml) and taken up in 100 μl H.sub.2O.
TABLE-US-00004 TABLE 2 ChIP primers Direc- SEQ ID Target tion Primer sequence NO. IL8 FW 5′ TGGGCCATCAGTTGCAAATC 3′ SEQ ID NO: 14 RW 5′ AGTGAGATGGTTCCTTCCGG 3′ SEQ ID NO: 15 CXCL1 FW 5′ ACGTGGGTCTAAGGGATCTG 3′ SEQ ID NO: 16 RW 5′ GGGTCTGACTGTCTTGCGTA 3′ SEQ ID NO: 17 CXCL2 FW 5′ CTGTGGTGGTTCTCAGGGAT 3′ SEQ ID NO: 18 RW 5′ TGGACTCTGAGACTCTGGGA 3′ SEQ ID NO: 19 CXCL3 FW 5′ TCTGGAATCCGAGACGATGG 3′ SEQ ID NO: 20 RW 5′ GACAGGAAAGGCACGACTTC 3′ SEQ ID NO: 21 SAMD4A FW 5′ GAGCTTTGGGTGGAGAGAGT 3′ SEQ ID NO: 22 RW 5′ TTACTCCTCCTCCTCCTCCC 3′ SEQ ID NO: 23 UMLILO FW 5′ TGTCCAAATCCACATTGACAGT 3′ SEQ ID NO: 24 RW 5′ GGAGTGTTGCTGCGAGAATT 3′ SEQ ID NO: 25
[0127] RNA Immunoprecipitation with Targeted Mass Spectrophotometry
[0128] For each experiment, 1×10.sup.7 cells were grown to ˜80% confluence, then washed three times in PBS. Briefly, cells were resuspended in Buffer A (10 mM HEPES pH 7.5, 1.5 mM MgCl.sub.2, 10 mM KCl, 0.5 mM DTT, 1.0 mM PMSF), lysed in 0.25% NP40, and fractionated by low speed centrifugation. The nuclear fraction was resuspended and lysed in Buffer C (20 mM HEPES pH 7.5, 10% glycerol, 0.42 M KCl, 4 mM MgCl.sub.2, 0.5 mM DTT, 1.0 mM PMSF). Either the nuclear or cytoplasmic fraction was incubated with biotinylated oligonucleotide probes (SEQ ID NOs:295-314) tiling exonic UMLILO in hyb buffer (100 mM Tris-HCl pH 7.0; 500 mM NaCl; 10 mM EDTA pH 8.0; 15% formamide; 1 mM DTT; 1% SDS; 0.1 U/μl Superase) at 37° C. for 4 hr. 20 μl of magnetic protein A/G beads (Resyn Biosciences) (pre-absorbed with sonicated single stranded salmon sperm DNA at 1.5 μg/20 μl beads) was added to all samples and incubated at 37° C. for 1 hr with rotation. Beads were washed 3× with wash buffer (2×SCC; 0.5% SD; 1 mM DTT). Proteins were eluted with SDS loading buffer and subject to SDS-PAGE analysis. Gels were stained using Colloidal Coomasie and protein bands of interest were in-gel trypsin digested as per the protocol described in Shevchenko et al., 2007. In short, gel bands were destained using 50 mM NH.sub.4HCO.sub.3/50% MeOH followed by in-gel protein reduction (50 mM DTT in 25 mM NH.sub.4HCO.sub.3) and alkylation (55 mM iodoacetamide in 25 mM NH.sub.4HCO.sub.3). Proteins were digested overnight at 37° C. using 5-50 μl, 10 ng/μl tryspin depending on the gel piece size. Digests were resuspended in 40 μl, 2% acetonitrile/0.2% formic acid and analysed using a Dionex Ultimate 3000 RSLC system coupled to an AB Sciex 6600 TripleTOF mass spectrometer. Peptides were first de-salted on an Acclaim PepMap C18 trap column (75 μm×2 cm) for 8 min at 5 μl/min using 2% acetonitrile/0.2% formic acid, then separated on Acclain PepMap C18 RSLC column (75 μm×15 cm, 2 μm particle size). Peptide elution was achieved using a flow-rate of 500 nl/min with a gradient of 4-60% B in 30 min (A: 0.1% formic acid; B: 80% acetonitrile/0.1% formic acid). Nano-spray was achieved using a NanoSpray III source assembled with a New Objective, PicoTip emitter. An electrospray voltage of 2.3 kV was applied to the emitter. Precursor spectra were acquired in the range 400-1500 m/z (0.25 s accumulation time). Product ion spectra were acquired for 18 precursors reporting on 5 targeted proteins. Product scans were recorded in the mass range 100-1500 m/z, high sensitivity mode, with an accumulation time of 0.1 s for a total cycle time of 2.1 s. Data processing was performed in Skyline (Shevchenko et al. 2007). MS1 filtering was performed at 30,000 whilst MS2 at 15,000 resolution with a match tolerance of 0.025 m/z.
[0129] 3C Assay
[0130] 3C experiments were performed as described previously by Hagege et al. with some minor modifications (Hagege et al. 2007). Briefly, a single-cell suspension of 8×10.sup.6 HeLa cells was crosslinked with 1% formaldehyde in 10% (v/v) FBS/PBS for 10 min at room temperature and quenched by adding 0.125 M glycine and incubating for 5 min on ice. Cells were then pelleted by centrifugation at 225 g for 8 min at 4° C. and lysed on ice in 3C lysis buffer (10 mM Tris-HCl, pH 7.5; 10 mM NaCl; 0.2% NP-40; 1× complete protease inhibitor (Roche) for 30 min and subsequently dounce homogenized. Nuclei were collected by centrifugation at 400 g for 5 min at 4° C. The pellets were resuspended in 1.2× Buffer R (Thermo Scientific) with 0.3% SDS and incubated at 37° C. for 1 hr while being shaken at 250 rpm. The SDS was sequestered by adding 2% Triton X-100 and incubating this for 1 hr at 37° C. with shaking. 550 U of HindIII (10 U/ul) (Thermo Scientific) was then added and incubated overnight at 37° C. with shaking. The digestion was terminated with 1.3% SDS at 65° C. for 20 min. 6.125 ml of 1.15× T4 Ligation Buffer (Thermo Scientific) with 1% Triton X-100 was added and incubated at 37° C. for 1 hr with mild shaking (150 rpm). Samples were allowed to cool to room temperature before 100 U T4 DNA ligase (Thermo Scientific) was added and incubated at 16° C. for 4 hr, with gentle shaking (90 rpm), followed by an additional 30 min at room temperature. Crosslinks were reversed with 300 μg of proteinase K and overnight incubation at 65° C. The following day, 300 μg of RNase A was added to the sample and incubated at 37° C. for 30 min. Finally, genomic DNA was purified by phenol chloroform extraction followed by isopropanol precipitation. Ligation events were detected using unidirectional, fragment specific primers (Table 3). qPCR reactions were performed with technical triplicates on a CFX Real Time PCR detection system (Biorad) with SsoFast qPCR Supermix (Biorad). A putative genomic interaction was used to correct for variations between 3C library preparations. Interaction frequencies were calculated relative to the random interaction frequencies as determined with a BAC template (RPCI-11 447E20) spanning the genomic region of interest.
TABLE-US-00005 TABLE 3 30 primers Fragment Primer location Sequence SEQ ID NO Anchor chr4:74604292- 5′ TCCTCTGACATAATGAAAAGATGAGGGTGC 3′ SEQ ID NO: 26 74606315 1 chr4:74499669- 5′ AAAATAGAAACCCTGAATGTACCGGTAACA 3′ SEQ ID NO: 27 74501601 2 chr4:74511769- 5′ TCAAATCCGTGATCAGCATTACCAAGCCAT 3′ SEQ ID NO: 28 74524359 3 chr4:74527725- 5′ ATTGGAAGGCTAAATATACTTACATGGC 3′ SEQ ID NO: 29 74529421 4 chr4:74530103- 5′ TTTTAAAAGCAGCACTAGTGTATCCGG 3′ SEQ ID NO: 30 74534800 5 chr4:74546061- 5′ AAAGAGCTCAATGTGTGTTACTAAAGAATG 3′ SEQ ID NO: 31 74548099 6 chr4:74549704- 5′ AAAGGTAAGCAATAATTGGCCCATATCTC 3′ SEQ ID NO: 32 74551014 7 chr4:74553813- 5′ AAAAGTGATACATGTTCATTGCATTTAAAC 3′ SEQ ID NO: 33 74555419 8 chr4:74578660- 5′ CGTAAGGCTGGTCAAGGTATGCTGAG 3′ SEQ ID NO: 34 74585594 9 chr4:74585594- 5′ TTCTTCATTATGCTAGTGTTGTGTATTGTG 3′ SEQ ID NO: 35 74587345 10 chr4:74587345- 5′ TGAAATTAGAGAAAAACATGTACTTAGGGA 3′ SEQ ID NO: 36 74591147 11 chr4:74591147- 5′ CACCCCGCCCATTTGATGAACTGTTT 3′ SEQ ID NO: 37 74596339 12 chr4:74596459- 5′ ACTTCAAACTCCAAACTCCACCGATTTG 3′ SEQ ID NO: 38 74601876 13 chr4:74601963- 5′ CCAACATCACTGAAGCAAAGAAACTTGGAG 3′ SEQ ID NO: 39 74604292 14 chr4:74607958- 5′ TCTGCTTGTACGTAGGTATGTAGATT 3′ SEQ ID NO: 40 74612686 15 chr4:74722664- 5′ GCTAGCAACCAACTCTTTAAGAATACAGCC 3′ SEQ ID NO: 41 74725426 16 chr4:74736063- 5′ AGAAACACAACGATACAATGTGAAA 3′ SEQ ID NO: 42 74750395 17 chr4:74751595- 5′ AGTGTGACTCCAAATAACCTAGTTTGCTA 3′ SEQ ID NO: 43 74756828 18 chr4:74756828- 5′ ACACAGTCATAATCACAACCCCAGTC 3′ SEQ ID NO: 44 74759327 19 chr4:74899318- 5′ TCAGACTCATGGGCTCAGTTGATTC 3′ SEQ ID NO: 45 74900128 20 chr4:74901502- 5′ GGCTGACACATTATGGTCTCCCACTAAATA 3′ SEQ ID NO: 46 74902795 21 chr4:74903866- 5′ GAAACATGTCAAGAGGCCGTGGACATTT 3′ SEQ ID NO: 47 74908292 22 74917831- 5′ AGTGTGAAACAAAACGAGAAGGGAAG 3′ SEQ ID NO: 48 74918715 23 74964374- 5′ AAATTATTTGCTTTAGGAAGGGAAGTAGAA 3′ SEQ ID NO: 49 74967509 24 74972881- 5′ CATAGGAGAGACTGCGACAGAAATTCCATT 3′ SEQ ID NO: 50 74981053 25 74981053- 5′ TTACAACTCCTACAACCGTGCTTGGTACAT 3′ SEQ ID NO: 51 74983881 GAPDH chr12:6639882- 5′ TGCCAATCTCCTTGTTTTCTAATG 3′ SEQ ID NO: 52 control 6641136 F1 GAPDH chr12:6641136- 5′ TATTCCCCCAGGTTTACATGTTC 3′ SEQ ID NO: 53 control 6645917 F2
EXAMPLE 2
[0131] The ELR+ CXC Chemokines Engage in Pre-Formed Chromosomal Contact
[0132] Recent Hi-C and 5C studies show that several classes of innate immune genes are organized into TADs (Jin et al. 2013). Tumor necrosis factor (TNF) has been shown to strongly induce the expression of the ELR+ CXC chemokines (IL8, CXCL1, CXCL2 and CXCL3; hereafter referred to as chemokines) in fibroblasts and endothelial cells (Paulsen et al. 2013; Jin et al. 2013). Therefore, we utilized previously published Hi-C data to examine the higher order chromatin organization of the chemokine TAD in diploid fibroblasts (IMR90), primary endothelial cells (HUVECs) and other cell types. Analysis of Hi-C data across the proinflammatory chemokine locus revealed that the chemokine TAD spans a region of ˜500 Kbp, and is well defined in unstimulated IMR90s, HUVECs and other immune and non-immune cells (
[0133] Although Hi-C reveals TAD structure, it does not reveal the status of interacting chromatin at actively transcribing genes. The ChIA-PET technique incorporates a ChIP step, and therefore, enables the detection of chromosomal contacts that are mediated by specific proteins. We analysed ChIA-PET data from a library constructed with an antibody that enriches for actively transcribing RNA Pot II (dual phosphorylated at Ser2/Ser5) (Papantonis et al. 2012). To minimise amplification effects, two or more reads that were either identical, or overlapped by +/−2bp were classified as a single PET. ChIA-PET analysis confirmed that upon gene activation with TNF for 30 min there were numerous PETs/contacts that occurred between the super-enhancer region and the chemokine genes, forming a putative ‘inverted rosette’ structure (
[0134] A previous report demonstrated that the 5′ insulator element of the chemokine TAD engages in chromosomal contact prior to chemokine activation by TNF. Therefore, in order to investigate whether chromosomal contact between UMLILO and the chemokine was influenced by TNF treatment, we performed 3C analysis across the entire chemokine TAD. Corresponding to other innate immune genes examined in the study by Jin et al. we observed that the chemokine TAD structure is formed prior to gene activation by TNF. The transcriptional regulation of chemokines is tightly controlled, permitting chemokine expression only upon receipt of the correct signals. For this reason, in resting cells, the promoters of chemokine genes are primed to allow their swift activation and the immediate mobilization of the neutrophil response. Taken together, this suggested a relationship between pre-formed chromosomal contact and the poised nature of the chemokine genes.
[0135] UMLILO is a Super-Enhancer Resident IncRNA Transcribed within the Chemokine TAD
[0136] TADs containing enhancer-dense regions or super-enhancers (SE) may include co-regulated genes that are exceptionally sensitive to external stimuli, permitting fine-tuned and rapid control of gene regulation. ChlPseq analysis across the chemokine TAD revealed a previously identified SE that is atypically large (˜80 Kbp) and highly enriched for the eRNA chromatin marks, H3K4me1 and H3K27Ac (
EXAMPLE 3
[0137] UMLILO Transcription Precedes Chemokine Gene Activation
[0138] The regulation of chemokine expression occurs predominantly at the transcriptional level. Historically, chemokine transcription is assayed at a population level, which lacks the resolution to reveal the exact site of active chemokine transcriptional activation. Importantly, this can only be achieved through single cell studies able to achieve single molecule resolution. Thus in order to directly observe the site of transcription at a single cell level, we designed single molecule RNA FISH (smFISH) probes to target the introns of the chemokine genes (Raj et al. 2008). As introns are typically spliced and degraded cotranscriptionally, these probes label the transcriptional start site (TSS). Of the four chemokine genes within the TAD, CXCL3 does not possess an intron and was therefore excluded from our single cell analysis experiments. Using intronic smFISH, we were able to show that the chemokines are only induced in HUVECs following TNF induction (
[0139] To investigate the transcriptional activation of UMLILO in HUVECs at a single cell level, we designed RNA FISH probes targeting intron 1 and intron 2 of UMLILO. RNA FISH revealed that the signal from both introns consistently colocalized (
[0140] The expression of UMLILO in resting endothelial cells coincides with UMLILO being brought in close proximity to the chemokine gene promoters by pre-formed chromosomal loops (
[0141] UMLILO is Conserved in Higher Vertebrates, but Lacks a Homolog in Rodents
[0142] The rules governing the transcriptional regulation of IncRNAs are poorly understood, especially with respect to IncRNAs that are expressed in unstimulated cells. UMLILO was identified by CAGE to be a low abundant transcript, which is expressed in a wide variety of challenged and unchallenged immune and nonimmune cells, including primary endothelial cells. Due to the fact that most of these cell types are able to induce neutrophil chemotaxis, UMLILO may be an important regulator of the innate immune response. The chemokines comprise a critical component of the innate immune system, which in mammals is highly evolutionarily conserved. Therefore, we investigated the sequence conservation of UMLILO across metazoans. We observed that UMLILO is highly conserved in higher vertebrates, but no homolog of UMLILO exists in mice, a model used for a multitude of inflammatory disorders (
EXAMPLE 4
[0143] UMLILO Transcription is Impervious to Perturbation of Super-Enhancer Transcriptional Regulators and is Necessary for Chemokine Transcription
[0144] Super-enhancers (SE) are densely occupied by chromatin regulators, including the mediator subunit, MED12, and BRD4 (
[0145] Many critical proinflammatory genes, such as the chemokines, are poised prior to activation, allowing their rapid transcription upon the arrival of signal-dependent transcription factors. The promoters of the chemokine genes are enriched for histone H3 K4 mono-, di- and trimethylation (H3K4me3), which are active chromatin marks catalyzed by the MLL family of methyltransferases. These chromatin modifications permit RNA Pol II to access the promoter, where it awaits further signals to initiate active transcription. The release of “paused” Pol II is facilitated by the recruitment of the transcriptional elongation factor P-TEFb by the chromatin reader, BRD4. In the case of proinflammatory genes, various signals such as TNF or lipopolysaccharide (LPS) induce the nuclear translocation of NF-KB. The p65 subunit of NF-KB then associates directly with BRD4, prompting the release of the “paused” inflammatory genes (Kaikkonen et al. 2013). In endothelial cells, TNF induction has been demonstrated to redistribute the BRD4 payload away from resting SE, to establish new SE domains. Critically, these newly activated SEs are adjacent to canonical inflammatory genes. Therefore, we used the bromodomain inhibitor, JQ1, to investigate how the loading of the super-enhancer with BRD4/NF-KB influenced UMLILO and chemokine expression. Corresponding to a previous report, (+) JQ1 but not its enantiomer (−) JQ1 abrogated chemokine transcriptional activation (
[0146] Through their interaction with MED12, eRNAs have been proposed to be the architects of chromatin organization and therefore putatively TADs. We found that depleting MED12 abrogates the expression of the CXC chemokines (
[0147] It remains unknown whether IncRNAs arising from within super-enhancers are an artifact produced due to the elevated levels of transcriptional regulators occupying super-enhancers, or if they are functionally necessary for target gene expression. 3C-based approaches had thus far shown that the chemokine TAD assembles into an ‘inverted rosette’, with pre-formed contact occurring between the chemokines and UMLILO (
EXAMPLE 5
[0148] UMLILO Acts in Cis to Regulate Chemokine Expression
[0149] The activity of cis-acting IncRNAs appears to be dependent on these IncRNAs being transcribed at an exact genomic location. Indeed, ectopic expression of HOTTIP was insufficient to rescue the effects of HOTTIP depletion (Wang et al. 2011). siRNA approaches fail to address whether a IncRNA is acting in cis or in trans. Therefore, we devised a single cell microscopy-based approach, using the CRISPR-Cas9 system to erase the genomic sequence encoding UMLILO and replace it with an eGFP reporter sequence in primary HUVEC cells (
[0150] To investigate whether UMLILO exerts its effects in cis or trans, we compared cells displaying a single eGFP focus but still expressing UMLILO from the intact allele, to cells displaying dual eGFP foci. Interestingly, in cells displaying no eGFP foci, expression of IL8 and CXCL2 is comparable to the mock transfected cells (
EXAMPLE 6
[0151] UMLILO Interacts with the WAR Complex to Maintain H3K4me3 Epigenetic Regulation of Chemokine Genes
[0152] The data thus far had shown UMLILO to be an enhancer-like cis-acting IncRNA (
[0153] UMLILO was recovered from the nuclear fraction of cell lysates using biotinylated single stranded DNA probes tiling the exonic portion of the IncRNA. In order to verify the components of the WAR complex we used a targeted Multiple Reaction Monitoring with High Resolution Mass Spectrometry (MRM.sup.HR) method (
[0154] To investigate whether UMLILO was targeting the WDR5-MLL1 methylase complex to the chemokine promoters, and to interrogate the specificity of the UMLILO-WDR5 interaction, we performed siRNA knockdown of UMLILO followed by WDR5, H3K4me3, Pol II Ser5 and MED12 CHIP analysis of the chemokine promoters. Consistent with the lack of eRNA chromatin marks on UMLILO, siUMLILO did not alter MED12 occupancy on the chemokine promoters (
[0155] Activity of MLL1 is particularly reliant on its association with WDR5, a multifunctional adapter protein that identifies H3K4 methylation marks on the promoters of genes as well as binds to MLL1. As a consequence, small molecule inhibitors that prevent the WDR5/MLL1 interaction lead to a significant reduction in MLL1 methyltransferase activity (Cao et al. 2014). We introduced such a small molecule inhibitor, MM102, into HUVECs to prevent the WDR5/MLL1 interaction, and observed a significant reduction in chemokine gene transcription (
EXAMPLE 7
[0156] Depleting UMLILO does not Abrogate Chromosomal Contact Across the Chemokine TAD
[0157] The mechanism underpinning the pause release of Pol II on the promoters of the primed inflammatory genes is well studied. However, the upstream molecular events that coordinate the poised state of inflammatory genes, such as the chemokines, are poorly understood. Important outstanding questions include; what directs the preinitiation complex to the chemokine promoters to facilitate the methylation of the chemokine genes?
[0158] And, how does 3D chromatin topology influence this regulation? In a resting state, the chemokine TAD is comprised of pre-formed chromosomal loops. Moreover, through the activity of UMLILO, the promoters of the chemokine genes are marked with active epigenetic marks prior to chemokine gene activation (
[0159] 5C analysis revealed that although HOTTIP is brought in close proximity to the HoxA genes by chromosomal looping, the higher order chromatin structure of the HoxA locus remained unaltered in HOTTIP-depleted cells (Wang et al. 2011). However, this approach lacked the resolution to determine whether intra-TAD contacts were formed prior to HoxA gene activation. Therefore, we sought to investigate whether the pre-formed chromosomal contacts occurred upstream of the epigenetic activation of the chemokines. Across three biological replicates, siUMLILO followed by 3C analysis revealed that chromosomal contact across the chemokine TAD remained unaffected in the absence of UMLILO (
EXAMPLE 8
[0160] The Activity of UMLILO can be Substituted with a Different WDR5-Interacting IncRNA
[0161] Both HOTTIP and UMLILO use ‘pre-configured’ chromatin compaction to direct the WDR5-MLL1 complex in close vicinity of their target genes (
[0162] We generated a repair template that included the sequence of the HOTTIP IncRNA, with homologous arms that flanked UMLILO (
[0163] Discussion
[0164] Here we report UMLILO, a new super-enhancer (SE) resident enhancer-like IncRNA that interacts with WDR5 to coordinate the H3K4me3 epigenetic activation of the highly therapeutically relevant chemokine locus. Many characterized IncRNAs are identified based on their strong upregulation by external stimuli, such as LPS or DNA damage. Subsequently, low copy number IncRNAs that are expressed in resting cells and prior to stimulation receive less attention. Uniquely, UMLILO was identified using a ‘guilt-by association’ approach, by analyzing all IncRNAs transcribed across the chemokine TAD in unchallenged immune and nonimmune cells. The ubiquitous expression of UMLILO across various cell types reveals that it may be an important regulator of the innate immune response.
[0165] The functional relationship between 3D chromatin structure and rapidly responding genes remains opaque. Therefore, we used the chemokine TAD as a model to dissect the temporal events that are required to achieve chemokine gene expression. Chromosomal contacts across the TAD were not influenced by TNF induction of the chemokines, indicating that pre-formed chromosomal contact within the chemokine TAD forms upstream of chemokine transcription. In support of this notion, siRNA depletion of UMLILO did not alter the pre-formed chromosomal contacts demonstrating that the formation of the TAD precedes UMLILO-mediated activity (
[0166] Owing to the delays that occur due to the assembly of the preinitiation complex and eviction of inhibitory nucleosomes at the promoter, genes that lack poised Pol II may exhibit more stochastic patterns of gene expression. However, stochasticity in innate immune gene expression may be detrimental to mounting a successful immune response. Therefore, by maintaining the promoters of the innate immune genes in an active state, eukaryotic organisms may have evolved to reduce gene-intrinsic noise. Indeed, the “poised” innate immune genes in humans, such as the CXC chemokines, need to respond immediately to external stimuli, and therefore, exhibit a robust transcriptional response upon activation across nearly all cells (
[0167] TNF is an established mediator of sepsis-associated inflammatory processes. Therefore, a detailed understanding of TNF-induced transcriptional responses is vital to develop new therapies that curb the excessive cytokine release that occurs during sepsis. Despite being used as a model for various inflammatory disorders, mice have been reported to be highly resistant to inflammatory stimuli when compared with humans. Indeed, early in vivo studies revealed that the lethal dose of LPS in half of the population of mice was 1,000-10,000 times the dose that is associated with septic shock and severe disease in humans. One explanation may be that mice lack several components involved in innate immune signaling: notably IL8 (
[0168] Historically, upstream steps that regulate chemokine signal transduction are targeted for therapeutic intervention. Unfortunately, due to broad off-target effects, these approaches have been largely unsuccessful. More recently, agonists targeting the CXC chemokine receptors, CXCR1 and CXCR2, are thought to be a viable option to attenuate chemokine signalling. However, there is concern that these global approaches may lead to immunosuppression upon extended treatment. Therefore, there is a great need to develop highly specific small molecule inhibitors that are able to more discretely influence chemokine transcriptional regulation. As UMLILO is essential to the epigenetic activation of the chemokines, it represents a novel approach to drug the chemokine transcriptional response. Indeed, a small molecule inhibitor that inhibits the WDR5/MLL1 interaction led to a significant reduction in chemokine expression (
REFERENCES
[0169] Andersson, R, et al. (2014). An atlas of active enhancers across human cell types and tissues. Nature 507, 455-461.
[0170] Cao, F, et al. (2014). Targeting MLL1 H3K4 methyltransferase activity in mixed-lineage leukemia. Mol Cell. 53, 247-261.
[0171] Cong, L, et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-23.
[0172] Grebien, F, et al. (2015). Pharmacological targeting of the Wdr5-MLL interaction in C/EBPα N-terminal leukemia. Nat Chem Biol. 11, 571-8.
[0173] Hagege, H, et al. (2007). Quantitative analysis of chromosome conformation capture assays (3C-qPCR). Nat. Protoc. 2, 1722-1733.
[0174] Gomez, J A, et al. (2013). The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-g locus. Cell 152, 743-754.
[0175] Jin, F. (2013). A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature 503, 290-294.
[0176] Li, G, et al. (2010). ChIA-PET tool for comprehensive chromatin interaction analysis with paired-end tag sequencing. Genome Biol. 11, R22.
[0177] Papantonis, A, et al. (2012). TNFα signals through specialized factories where responsive coding and miRNA genes are transcribed. EMBO J. 31, 4404-4414.
[0178] Paulsen, M T, et al. (2013). Coordinated regulation of synthesis and stability of RNA during the acute TNF-induced proinflammatory response. Proc Natl Acad Sci U S A. 110, 2240-5.
[0179] Raj, A, et al. (2008). Imaging individual mRNA molecules using multiple singly labeled probes. Nat. Methods 5, 877-879.
[0180] Shevchenko, A, et al. (2007). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols. 1, 2856-2860.
[0181] Tennakoon, C, et al. (2012). BatMis: a fast algorithm for k-mismatch mapping. Bioinformatics 28, 2122-8.
[0182] Wang, K C, et al. (2011). A long non-coding RNA maintains active chromatin to coordinate homeotic gene expression. Nature 472, 120-124.
[0183] Wang, X, et al. (2012). MLL1, a H3K4 methyltransferase, regulates the TNFα-stimulated activation of genes downstream of NF-KB. J Cell Sci. 125, 4058-4066.