Co-regulatory sequences based on tetracycline and Cumate

11680267 · 2023-06-20

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure provides a nucleic acid sequence for regulating the transcription of a nucleic acid fragment of interest, wherein the nucleic acid sequence comprises at least 2 copies of TetO-operator sequences capable of binding to a transactivator rtTA regulatable by tetracycline or a derivative thereof, and 1 copy of minimal promoter sequence containing a TATA box sequence, and at least 1 copy of a CuO-operator sequence capable of binding to a transcription repressor CymR regulatable by cumate. The present disclosure also provides a vector and a host cell containing the nucleic acid sequence, and a method for inducing the expression of a nucleic acid fragment of interest in a host cell.

Claims

1. A nucleic acid sequence, comprising at least 2 copies of Tet operator (TetO) sequences capable of binding to a reverse tetracycline controlled transactivator (rtTA) regulatable by tetracycline or a derivative thereof, 1 copy of a minimal promoter sequence containing a TATA box sequence, and at least 1 copy of a Cumate operator (CuO) sequence capable of binding to a transcription repressor cysteine metabolism repressor (CymR) regulatable by cumate, wherein the CuO-sequence is downstream of the 3′ end of the TATA box sequence, and is 30 bp to 50 bp apart from the TATA box.

2. The nucleic acid sequence of claim 1, wherein the CuO-sequence is about 50 bp apart from the TATA box.

3. The nucleic acid sequence of claim 1, wherein the TetO-sequence is as set forth in SEQ ID NO: 24.

4. A vector comprising the nucleic acid sequence of claim 3.

5. The nucleic acid sequence of claim 1, wherein the nucleic acid sequence is set forth in SEQ ID NO:23, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30.

6. A vector comprising the nucleic acid sequence of claim 5.

7. The nucleic acid sequence of claim 1, further comprising a spliceable intron sequence at the 3′ end thereof.

8. A vector comprising the nucleic acid sequence of claim 1.

9. The vector of claim 8, wherein the vector is an expression vector comprising a nucleic acid fragment downstream of the 3′ end of the nucleic acid sequence, and the transcription of the nucleic acid fragment is controlled by the nucleic acid sequence.

10. A cultured host cell comprising the vector of claim 8.

11. The nucleic acid sequence of claim 1, wherein the minimal promoter sequence is set forth in SEQ ID NO: 25 or SEQ ID NO: 26.

12. A vector comprising the nucleic acid sequence of claim 11.

13. The nucleic acid sequence of claim 1, wherein the CuO-operator sequence is set forth in SEQ ID NO:27.

14. A vector comprising the nucleic acid sequence of claim 13.

15. A cultured host cell comprising the nucleic acid sequence of claim 1.

16. A method for inducing the expression of a nucleic acid fragment in a host cell, comprising the following steps: (1) introducing the vector of claim 9, a sequence comprising a coding sequence of reverse tetracycline controlled transactivator (rtTA) and a sequence comprising a coding sequence of cysteine metabolism repressor (CymR) into the host cell; (2) expressing rtTA and CymR in the host cell subjected to step (1); and (3) providing tetracycline or a derivative thereof and cumate or a functional analog thereof for the host cell subjected to step (2).

17. The method of claim 16, wherein the rtTA is rtTA of Tet-On Advanced Inducible Gene Expression Systems (rtTA.sub.adv) or rtTA of Tet-On 3G Inducible Expression Systems (rtTA.sub.3G).

18. The method of claim 16, wherein the sequence comprising the coding sequence of rtTA is set forth in SEQ ID NO: 18.

19. The method of claim 16, wherein the sequence comprising the coding sequence of CymR is set forth in SEQ ID NO: 15.

20. The method of claim 16, wherein the sequence comprising the coding sequence of rtTA and the sequence comprising the coding sequence of CymR are on a single vector or on different vectors.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A-1B show the effect of the position and quantity of the CuO operator in the complex response element in Example 2 on the induced expression level and non-induced leaky expression level of the nucleic acid fragment of interest. FIG. 1A shows respective RLU values of the Luciferase detection experiment corresponding to adding only DOX inducer and adding both DOX and Cumate inducer; FIG. 1B shows the ratio of the RLU value of adding Cumate and without adding Cumate inducer.

(2) FIGS. 2A-2B show the effects of the single regulatory response element, the complex regulatory response element, and the introns linked downstream of the response element in Example 3 on the induced expression level and the non-induced leaky expression level of the nucleic acid fragment of interest. FIG. 2A shows the RLU value of Luciferase detection experiment with/without DOX and Cumate inducers; FIG. 2B shows the ratio of RLU value with/without DOX and Cumate inducers.

(3) FIGS. 3A-3B show the effects of different introns in Example 4 on the induced expression level and non-induced leaky expression level of TRE.sub.3GCuO complex response element. FIG. 3A shows the RLU value of Luciferase detection experiment with/without DOX and Cumate inducers; FIG. 3B shows the ratio of RLU value with/without DOX and Cumate inducers.

(4) FIG. 4 shows the respective induced transcription activities of the nucleic acid fragment of interest regulated by TRE.sub.3GCuO and TRE.sub.3GCuO-BGI in Example 5 under different combinations of induction. The ordinate shows the RLU value of the Luciferase detection experiment with different inducers; the 4-color histogram shows the four combinations of inducers; the numbers on the horizontal line represent the ratio of RLU value under the induction condition and the non-induction condition (white).

DETAILED DESCRIPTION OF THE DISCLOSURE

(5) The following examples are provided to illustrate the technical solutions of the present disclosure and should not be construed as limiting the scope and spirit of the present disclosure.

Example 1: Methods for Constructing Plasmids

(6) Molecular cloning techniques used in the following examples, such as PCR amplification of DNA fragments, restriction enzyme digestion of DNA fragments, gel recovery of DNA fragments, T4 DNA ligase ligation of two or more DNA fragments, transformation of ligation-competent cells, plasmid miniprep and identification, are all well known in the art. The following reagents are involved in the examples below: PCR enzyme (Thermo, F-530S); restriction enzyme (NEB); T4 DNA ligase (Invitrogen, 15224041); DNA fragment gel recovery kit (Omega, D2500-02); plasmid mini kit (TIANGEN, DP 105-03); competent cells (XL-10 Gold, Hu Nanfenghui Biotech Co., Ltd., JZ 011); the nucleic acid sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 22 were synthesized by GenScript and used in the construction of the plasmids of the present disclosure, and the plasmid sequencing and identification were performed by Invitrogen. Table 1 shows the primers information for plasmid construction; Table 2 shows the element composition of the sequences SEQ ID NO: 1 to SEQ ID NO: 31; Table 3 is a description of the functional elements in the plasmids; Table 4 shows the numbers and corresponding names of the plasmids constructed according to the present disclosure. The sequence information of elements adopted by each plasmid involved in the following examples is an example to carry out the present disclosure, and those skilled in the art can expect that the effect of the present disclosure can be achieved by replacing the sequence of element in the plasmid used in the examples below with other sequences of element having similar biological functions, including but not limited to backbone sequences (such as replication origin, resistance genes, etc.), restriction site sequences, transposon repeat sequences, response element sequences of inducible system, insulator sequences, promoter sequences, intron sequences, polyadenylation signal (PolyA) sequences, different codon-optimized gene sequences, mutants of the above sequences of functional elements and gene sequences, and the cloning positions, cloning sequences and cloning directions of the sequences of functional elements and gene sequences. The specific methods for constructing plasmids are as follows:

(7) 1. Construction of plasmid 18BF007: the synthetic sequence SEQ ID NO: 2 (2900 bp) was digested with NotI and AsiSI, and ligated to NotI and AsiSI restriction sites of plasmid 18BF003 (SEQ ID NO: 1), respectively, to construct plasmid 18BF007.

(8) 2. Construction of plasmid 18BF011: the 18BF007 plasmid was digested by MluI and SphI; and a fragment of 1730 bp was recovered by gel and ligated to MluI and SphI restriction sites of plasmid 18BF003, to construct a plasmid 18BF011.

(9) 3. Construction of plasmid 18BF210: the synthetic sequence SEQ ID NO: 3 (1208 bp) was digested with SpeI and AgeI, and ligated to AvrII and AgeI restriction sites of plasmid 18BF011, respectively, to construct a plasmid 18BF210.

(10) 4. Construction of plasmids 118BF211, 18BF212, 18BF213, 18BF214, 18BF215, 18BF216, 18BF217 and 18BF218: the synthetic sequences SEQ ID NO: 4 (908 bp), SEQ ID NO:5 (880 bp), SEQ ID NO:6 (890 bp) and SEQ ID NO: 7 (845 bp) were digested with MluI and ClaI, and ligated to MluI and ClaI restriction sites of plasmid 18BF210, respectively, to construct plasmids 18BF212, 18BF211, 18BF214 and 18BF213, respectively. Plasmids 18BF211, 18BF212, 18BF213 and 18BF214 were digested with BstBI, and fragments of 3932 bp (18BF211), 3960 bp (18BF212), 3897 bp (18BF213) and 3942 bp (18BF214) were recovered by gel and ligated with T4 ligase to construct plasmids 18BF215, 18BF216, 18BF217 and 18BF218, respectively.

(11) 5. Construction of plasmids 18BF229, 18BF232, 18BF233, 18BF234, 18BF235, 18BF236, 18BF237, 18BF240 and 18BF241: the Luciferase gene fragment (1728 bp) was PCR-amplified by using pGL3-Basic (Promega, E1751) as a template and using Luc-F (SEQ ID NO: 32) and Luc-R (SEQ ID NO: 33) as primers, then was digested with BamHI and XhoI, and ligated to BamHI and XhoI restriction sites of plasmids 18BF210, 18BF217, 18BF218, 18BF215, 18BF216, 18BF211, 18BF212, 18BF213 and 18BF214, respectively, to construct plasmids 18BF229, 18BF232, 18BF233, 18BF234, 18BF235, 18BF236, 18BF237, 18BF240 and 18BF241.

(12) 6. Construction of plasmids 18BF251, 18BF252, 18BF253, 18BF254, 18BF255, 18BF256 and 18BF257: the synthetic sequences SEQ ID NO:8 (414 bp), SEQ ID NO:9 (414 bp), SEQ ID NO:10 (415 bp), SEQ ID NO:11 (472 bp), SEQ ID NO:12 (588 bp), SEQ ID NO:13 (704 bp) and SEQ ID NO:22 (376 bp) were digested with MluI and ClaI, and ligated to MluI and ClaI restriction sites of plasmid 18BF235, respectively, to construct plasmids 18BF251, 18BF252, 18BF253, 18BF254, 18BF255, 18BF256 and 18BF257, respectively.

(13) 7. Construction of plasmids 18BF261, 18BF262, 18BF263 and 18BF264: a BGI (C&R) intron sequence (1036 bp) was PCR-amplified by using SEQ ID NO: 17 as a template and using BGI (C&R)-F (SEQ ID NO:34) and BGI (C&R)-R (SEQ ID NO:35) as primers; an Intron (EF-1a) intron sequence (962 bp) was PCR-amplified by using pEF1alpha-IRES-AcGFP1 (Clontech) as a template and using Intron(EF-1a)-F(SEQ ID NO:36) and Intron(EF-1a)-R(SEQ ID NO: 37) as primers; an Intron (pSI) intron sequence (152 bp) was PCR-amplified by using pSI (Promega #E1721) plasmid as a template and using Intron (pSI)-F (SEQ ID NO: 38) and Intron (pSI)-R (SEQ ID NO: 39) as primers; and the above three PCR products were respectively digested with ClaI and BamHI, and then ligated to ClaI and BamHI restriction sites of plasmid 18BF235, thereby to construct plasmids 18BF261, 18BF263 and 18BF264. The synthetic SEQ ID NO: 14 (210 bp) was digested with ClaI and BamHI, and ligated to ClaI and BamHI restriction sites of plasmid 18BF235, to construct a plasmid 18BF262.

(14) 8. Construction of plasmids 19BF075 and 19BF074: the synthetic sequences SEQ ID NO: 15 (633 bp) and SEQ ID NO: 16: (1496 bp) were digested with the ClaI and XhoI and the SpeI and AgeI, respectively, and ligated in sequence to the ClaI and XhoI restriction sites and the AvrII and AgeI restriction sites of the plasmid 18BF007 to construct a plasmid 19BF073. The synthetic sequence SEQ ID NO: 17 (1979 bp) was digested by MluI and AgeI, and ligated to MluI and AgeI restriction sites of the 18BF007 plasmid to replace a CMV-BGI-MCS-pA sequence, and thereby constructing a plasmid 18BF008. The synthetic sequences SEQ ID NO: 18 (768 bp) and SEQ ID NO: 19 (765 bp) were respectively digested by ClaI and XhoI, and then respectively ligated to the ClaI and XhoI restriction sites of plasmid 18BF008, to construct plasmids 18BF085 and 18BF084 respectively. The plasmid 19BF073 was digested with SpeI and AgeI, and a fragment of 3821 bp was recovered by gel and respectively ligated to AvrII and AgeI restriction sites of plasmids 18BF085 and 18BF084 to construct a plasmids 19BF075 and 19BF074 respectively.

(15) 9. Construction of plasmid 18BF019: the synthetic sequences SEQ ID NO: 21 (1044 bp) and SEQ ID NO: 20 (1320 bp) were respectively digested by the BamHI and XhoI and the XhoI and BglII, and ligated to BamHI and BglII restriction sites of plasmid 18BF011 to construct a plasmid 18BF019.

(16) 10. Construction of plasmids 19BF229, 19BF235 and 19BF237: plasmids 18BF229, 18BF235 and 18BF237 were digested with MluI and AgeI, and fragments of 4605 bp (18BF229), 3847 bp (18BF235) and 4341 bp (18BF237) was recovered by gel and respectively ligated to MluI and AgeI restriction sites of plasmid 18BF007, to construct plasmids 19BF229, 19BF235 and 19BF237 respectively.

(17) TABLE-US-00001 TABLE 1 Information for Primers SEQ ID NO: Primer Name Primer Sequence (5′-3′) 32 Luc-F TCAGGATCCATCTGCGATCTAAGTAAG CTTG 33 Luc-R TCAACTCGAGCTAGAATTACACGGCGA TC 34 BGI(C&R)-F GTCAATCGATGGAGTCGCTGCGCGCTG 35 BGI(C&R)-R GTCGGATCCCTGTAGGAAAAAGAAGAA GG 36 Intron(EF-1a)-F GTCAATCGATGTAAGTGCCGTGTGTG 37 Intron(EF-1a)-R GTCGGATCCCTGAAATGGAAGAAAAAA ACT 38 Intron(pSI)-F GTCAATCGATGTAAGTATCAAGGTTAC AAG 39 Intron(pSI)-R GTCGGATCCCTGTGGAGAGAAAGGC

(18) TABLE-US-00002 TABLE 2 Description of the appendix sequence elements SEQ ID NO Description of sequence elements SEQ ID NO: 1 18BF003_pma-MCS plasmid sequence (1893 bp) SEQ ID NO: 2 NotI-IR/DR-HS4I-CMV-BGI-MCS-hGHpA-HS4I-IR/DR-AsiSI (2900 bp) SEQ ID NO: 3 SpeI-SV40p-EGFP-SV40pA-AgeI (1208 bp) SEQ ID NO: 4 MluI-TRE.sub.3GCuO-BGI-ClaI (908 bp) SEQ ID NO: 5 MluI-TRE.sub.3G-BGI-ClaI (880 bp) SEQ ID NO: 6 MluI-TRE.sub.advCuO.sub.52-BGI-ClaI (890 bp) SEQ ID NO: 7 MluI-TRE.sub.adv-BGI-ClaI (845 bp) SEQ ID NO: 8 MluI-TRE.sub.3GCuO.sub.14-ClaI (414 bp) SEQ ID NO: 9 MluI-TRE.sub.3GCuO.sub.30-ClaI (414 bp) SEQ ID NO: 10 MluI-TRE.sub.3GCuO.sub.100-ClaI (415 bp) SEQ ID NO: 11 MluI-TRE.sub.3GCuO.sub.2x-ClaI (472 bp) SEQ ID NO: 12 MluI-TRE.sub.3GCuO.sub.4x-ClaI(588 bp) SEQ ID NO: 13 MluI-TRE.sub.3GCuO.sub.6x-ClaI (704 bp) SEQ ID NO: 14 CalI-Intron(mP1)-BamHI(210 bp) SEQ ID NO: 15 ClaI-optiCymR-XhoI (633 bp) SEQ ID NO: 16 SpeI-SV40p- optiHygroR-SV40pA-AgeI(1496 bp) SEQ ID NO: 17 MluI-CAGGS-BGI(C&R)-MCS-SV40pA-AgeI (1979 bp) SEQ ID NO: 18 ClaI-optirtTA.sub.3G-XhoI (768 bp) SEQ ID NO: 19 ClaI-rtTA.sub.adv-XhoI (765 bp) SEQ ID NO: 20 XhoI-ires-ECFP-BglII(1320 bp) SEQ ID NO: 21 BamHI-optiSB-XhoI (1044 bp) SEQ ID NO: 22 MluI-TRE.sub.advCuO.sub.32-BGI-ClaI (376 bp) SEQ ID NO: 23 TRE.sub.3GCuO.sub.50 response element sequence SEQ ID NO: 24 TetO operator sequence SEQ ID NO: 25 minimal promoter sequence #1 SEQ ID NO: 26 minimal promoter sequence #2 SEQ ID NO: 27 CuO operator sequence SEQ ID NO: 28 TRE.sub.3GCuO.sub.30 response element sequence SEQ ID NO: 29 TRE.sub.advCuO.sub.32 response element sequence SEQ ID NO: 30 TRE.sub.advCuO.sub.52 response element sequence SEQ ID NO: 31 sequence of human β-globulin intron (BGI)

(19) TABLE-US-00003 TABLE 3 Description of functional elements of plasmids Element name Description of functions IR/DR(L/R) inverted repeat (IR) and direct repeat (DR) of SB transposon system HS4I 4 core isolator of chicken beta-globulin highly sensitive position HygroR codon optimized sequence encoding hygromycin resistance gene Sleeping Beauty codon-optimized gene sequence encoding Sleeping Beauty (SB) transposase (optiSB) (SEQ ID NO: 21) BGI human β-globulin intron (SEQ ID NO: 31) CMV strong expression promoter of human cytomegalovirus MCS multiple cloning site of restriction enzyme CAGGS chimeric promoter of cytomegalovirus promoter enhancer part and chicken β-actin promoter BGI (C&R) chimeric intron of chicken β-actin and rabbit β-globulin Intron (mP1) Mouse Prm1 gene intron (7-202 bp in SEQ ID NO: 14, which is consistent with 942-1137 bp in Accession number of FJ411376) Intron (EF-1a) EF-1α intron of pEF1alpha-IRES-AcGFP1(Clontech) plasmid Intron (pSI) chimera intron of human beta globin and immunoglobulin heavy chain gene in pSI (Promega#E1721) plasmid TRE.sub.3GCuO/ response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate TRE.sub.3GCuO.sub.50 complex inducible expression system designed in the present disclosure, wherein the CuO sequence is spaced 50 bp behind the TATA box (SEQ ID NO: 23) TRE.sub.3GCuO.sub.14 response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, wherein the CuO sequence is spaced 14 bp behind the TATA box (10-317 bp in SEQ ID NO: 8) TRE.sub.3GCuO.sub.30 response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, wherein the CuO sequence is spaced 30 bp behind the TATA box (SEQ ID NO: 28) TRE.sub.3GCuO.sub.100 response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, wherein the CuO sequence is spaced 100 bp behind the TATA box (10-403 bp in SEQ ID NO: 10) TRE.sub.3GCuO.sub.2x response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, wherein the two repeated CuO sequence is spaced 50 bp behind the TATA box (10-411 bp in SEQ ID NO: 11) TRE.sub.3GCuO.sub.4x response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, wherein the 4 repeated CuO sequence is spaced 50 bp behind the TATA box (10-527 bp in SEQ ID NO: 12) TRE.sub.3GCuO.sub.6x response element of Tet-On (based on 7xTetO sequence in TRE.sub.3G) and Cumate complex inducible expression system designed in the present disclosure, wherein the 6 repeated CuO sequence is spaced 50 bp behind the TATA box (10-643 bp in SEQ ID NO: 13) TRE.sub.advCuO/TRE-.sub.advCuO.sub.52 response element of Tet-On (based on 7xTetO sequence in TRE.sub.adv) and Cumate complex inducible expression system designed in the present disclosure, wherein the CuO sequence is spaced 52 bp behind the TATA box (SEQ ID NO: 30) TRE.sub.advCuO.sub.32 response element of Tet-On (based on 7xTetO sequence in TRE.sub.adv) and Cumate complex inducible expression system designed in the present disclosure, wherein the CuO sequence is spaced 32 bp behind the TATA box (SEQ ID NO: 29) TRE.sub.3G/TRE.sub.adv response element of Tet-On inducible expression system: TRE.sub.3G is the third generation of response element/TRE.sub.adv is the second generation of response element (SEQ ID NO: 5/SEQ ID NO: 7) SV40p Simian vacuolar virus 40 promoter IRES ribosome entry site EGFP gene sequence encoding green fluorescent protein ECFP Gene sequence encoding cyan fluorescent protein Luciferase (Luc) Gene sequence encoding luciferase polyA polyadenylation sequence of transcription terminator (hGHpA human growth factor (hGHpA/SV40pA) terminator/SV40pA simian vacuolar virus 40 terminator) optiCymR codon-optimized coding sequence for repressor CymR protein of Cumate-induced expression system (13-621 bp in SEQ ID NO: 15) rtTA.sub.3G codon-optimized gene sequence encoding the third generation of rtTA.sub.3G transactivation element of Tet-On regulatory system (13-756 bp in SEQ ID NO: 18) rtTA.sub.adv gene sequence encoding the second generation of rtTA.sub.adv transactivation element of Tet-On regulatory system (13-756 bp in SEQ ID NO: 19)

(20) TABLE-US-00004 TABLE 4 Plasmid numbers and names Plasmid Number Plasmid Name 18BF003 pma-MCS 18BF007 pmaSBT3-2xHS4I-CMV-BGI-MCS 18BF011 pmaCMV-BGI-MCS 18BF210 pmaCMV-BGI-MCS-SV40p-EGFP 18BF211 pmaTRE.sub.3G-BGI-MCS-SV40p-EGFP 18BF212 pmaTRE.sub.3GCuO.sub.50-BGI-MCS-SV40p-EGFP 18BF213 pmaTRE.sub.adv-BGI-MCS-SV40p-EGFP 18BF214 pmaTRE.sub.advCuO.sub.52-BGI-MCS-SV40p-EGFP 18BF215 pmaTRE.sub.3G-MCS-SV40p-EGFP 18BF216 pmaTRE.sub.3GCuO.sub.50-MCS-SV40p-EGFP 18BF217 pmaTRE.sub.adv-MCS-SV40p-EGFP 18BF218 pmaTRE.sub.advCuO.sub.52-MCS-SV40p-EGFP 18BF229 pmaCMV-BGI-Luciferase-SV40p-EGFP 18BF232 pmaTRE.sub.adv-Luciferase-SV40p-EGFP 18BF233 pmaTRE.sub.advCuO.sub.52-Luciferase-SV40p-EGFP 18BF234 pmaTRE.sub.3G-Luciferase-SV40p-EGFP 18BF235 pmaTRE.sub.3GCuO.sub.50-Luciferase-SV40p-EGFP 18BF236 pmaTRE.sub.3G-BGI-Luciferase-SV40p-EGFP 18BF237 pmaTRE.sub.3GCuO.sub.50-BGI-Luciferase-SV40p-EGFP 18BF240 pmaTRE.sub.adv-BGI-Luciferase-SV40p-EGFP 18BF241 pmaTRE.sub.advCuO.sub.52-BGI-Luciferase-SV40p-EGFP 18BF251 pmaTRE.sub.3GCuO.sub.14-Luciferase-SV40p-EGFP 18BF252 pmaTRE.sub.3GCuO.sub.30-Luciferase-SV40p-EGFP 18BF253 pmaTRE.sub.3GCuO.sub.100-Luciferase-SV40p-EGFP 18BF254 pmaTRE.sub.3GCuO.sub.2x-Luciferase-SV40p-EGFP 18BF255 pmaTRE.sub.3GCuO.sub.4x-Luciferase-SV40p-EGFP 18BF256 pmaTRE.sub.3GCuO.sub.6x-Luciferase-SV40p-EGFP 18BF257 pmaTRE.sub.advCuO.sub.32-Luciferase-SV40p-EGFP 18BF261 pmaTRE.sub.3GCuO-BGI(C&R)-Luciferase-SV40p-EGFP 18BF262 pmaTRE.sub.3GCuO-Intron(mP1)-Luciferase-SV40p-EGFP 18BF263 pmaTRE.sub.3GCuO-Intron(EF-1a)-Luciferase-SV40p-EGFP 18BF264 pmaTRE.sub.3GCuO-Intron(pSI)-Luciferase- SV40p-EGFP 19BF073 pmaSBT3-2xHS4I-CMV-BGI-optiCymR-HygroR 18BF008 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-MCS 18BF085 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-optirtTA.sub.3G 18BF084 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-rtTA.sub.adv 19BF075 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-optirtTA.sub.3G-CMV-BGI-optiCymR-HygroR 19BF074 pmaSBT3-2xHS4I-CAGGS-BGI (C&R)-rtTA.sub.adv-CMV-BGI-optiCymR-HygroR 18BF019 pmaCMV-BGI-optiSB-IRES-ECFP 19BF229 pmaSBT3-2xHS4I-CMV-BGI-Luciferase-SV40p-EGFP 19BF235 pmaSBT3-2xHS4I-TRE.sub.3GCUO-Luciferase-SV40p-EGFP 19BF237 pmaSBT3-2xHS4I-TRE.sub.3GCUO-BGI-Luciferase-SV40p-EGFP

Example 2: The Effect of the Position and Number of CuO Operator on the Induced Expression Level and Non-Induced Leaky Expression Level

(21) The experiment described in the present Example is to study and verify the effect of the position and copy number of the CuO operator in the Tet-On and Cumate complex response element on the induced expression level and non-induced leaky expression level of the complex response element, and to optimize and confirm the optimal position and copy number of the CuO operator. In the present Example, based on the 7×TetO sequence in the TRE.sub.3G response element and the minimal promoter sequence #1 (SEQ ID NO: 25), the response elements TRE.sub.3GCuO.sub.14 (10-317 bp in SEQ ID NO: 8), TRE.sub.3GCuO.sub.30 (SEQ ID NO: 28), TRE.sub.3GCuO.sub.50 (SEQ ID NO: 23) and TRE.sub.3GCuO.sub.100 (10-403 bp in SEQ ID NO: 10) were designed by linking a CuO operator sequence at 10 bp to 100 bp downstream of the TATA box (at 14 bp, 30 bp, 50 bp and 100 bp downstream of the TATA box, respectively), and a Luciferase reporter gene sequence was linked downstream of the 3′ end of the above response elements, to construct plasmids 18BF251, 18BF252, 18BF235 and 18BF253. Further, in order to study the effect of multiple copies of CuO operators, 2, 4 and 6 copies of CuO operator sequences were respectively inserted at 50 bp downstream of the TATA box, to design the response elements TRE.sub.3GCuO.sub.2x (10-411 bp in SEQ ID NO: 11), TRE.sub.3GCuO.sub.4x (10-527 bp in SEQ ID NO: 12) and TRE.sub.3GCuO.sub.6x (10-643 bp in SEQ ID NO: 13), and then a Luciferase reporter gene sequence was linked downstream of 3′ end of the above response elements to construct plasmids 18BF254, 18BF255 and 18BF256. In 293T-rtTA.sub.3G-CymR cells stably expressing rtTA.sub.3G and CymR genes, the above plasmids were transiently transfected, and the optimal position and number of CuO operator were validated by measuring the luciferase fluorescence value of samples added with both DOX and Cumate inducers and that of the control added with the DOX inducer only. The specific experimental methods were as follows:

(22) 1. Construction of 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR Cells with SB Transposon System

(23) 293T cells were seeded at 1.5E+06 cells per 60 mm culture dish, and cultured in DMEM (Sigam, D6429) complete medium supplemented with 10% FBS (ExCell, 11H116) at 37° C. and 5% CO 2. After 24 hours of culture, transfection was carried out according to the PEI method. During transfection, 500 μL of transfection reagent which contained 5.5 ug of total plasmid was added to each 60 mm culture dish, and the mass ratio of total plasmid to PEI MAX (Polysciences, 24765-1) was 1:4. The transfection was carried out according to the PEI method, wherein the amount of total plasmid was 5.5 μg. The transfection was performed with plasmids 19BF074:18BF019 at a molar ratio of 10:1 to obtain 293T-rtTA.sub.adv-CymR cells; and the transfection was performed with plasmids 19BF075:18BF019 at a molar ratio of 10:1 to obtain 293T-rtTA.sub.3G-CymR cells. The plasmid and PEI MAX were mixed uniformly, and then put into a culture dish after standing for 15 minutes. 3 hours after transfection, the medium was changed to a complete DMEM medium, and the transfection operation was completed. After 24 hours of transfection, the cells were digested with trypsin and all seeded in a 100 mm culture dish (Corning, 430167), and 200 μg/ml of hygromycin (Sangon Biotech A600230-0001) drug screening was performed for at least three passages. After the growth of cells under the pressure of drug screening was consistent with that of the original 293T cells, the following experiments were performed.

(24) 2. Detection of the Performance of Each Response Element Under Both DOX and Cumate Induction or Under DOX Induction Alone by Luciferase Fluorescence Intensity Assay

(25) The 293T-rtTA.sub.3G-CymR cells were seeded in a 96-well plate (Corning 3916) at 2.5E+04 cells per well, and the medium was 100 microliters of DMEM complete medium. After 24 hours of culture, the following plasmids were transfected according to the PEI method: 18BF234 (TRE.sub.3G), 18BF251 (TRE.sub.3GCuO.sub.14), 18BF252 (TRE.sub.3GCuO.sub.30), 18BF235 (TRE.sub.3GCuO.sub.50), 18BF253 (TRE.sub.3GCuO.sub.100), 18BF254 (TRE.sub.3GCuO.sub.2x), 18BF255 (TRE.sub.3GCuO.sub.4x) and 18BF256 (TRE.sub.3GCuO.sub.6x); 10 μL of transfection reagent was added into each well during transfection, which contains 0.3 ug of total plasmids including 0.01 ug of the above 8 kinds of plasmids to be tested and 0.29 ug of 18BF003 empty plasmid. The mass ratio of total plasmid to PEI MAX (Polysciences, 24765-1) was 1:4, and each plasmid was transfected into 6 wells. After 3 hours of transfection, the complete DMEM medium was changed; and the inducer 1 ug/ml DOX (doxycycline hydrochloride, Sangon Biotech (Shanghai), A600889)) and 200 ug/ml Cumate (Aladdin, I107765) were added into 3 wells; and 1 ug/ml DOX alone was added into the remaining 3 wells. After 24 hours of transfection, relative light unit RLU of each well was detected using a Steady-Gb® Luciferase Assay System (Promega, E2610) kit according to the instruction (Promega, FB037), wherein the detection instrument was a fluorescence microplate reader (Perkin Elmer Victor V).

(26) The results were shown in FIG. 1: the induced expression level of response element in the Tet-On inducible expression system was affected by the CuO operator sequence; the closer the distance between the CuO operator and the TATA box of TRE response element was, the lower the expression level after induction was. However, as the distance between the CuO operator and the TATA box increases, the leaky expression level of non-Cumate induction became higher. Based on the results of the expression level after induction, the leaky expression level of non-Cumate induction and the ratio of Cumate induced/leaky expression level, it was determined that the optimal distance between the CuO and the TATA box was 30 bp to 50 bp, and the induced expression level was 3.06E+06 RLU and 4.53E+06 RLU, which was respectively 44.5% and 66.0% of the induced expression level of TRE.sub.3G response element; and the ratio of induced/leaky expression level based on Cumate inducible expression system was 4.21 times and 2.81 times that of TRE.sub.3G response element, respectively. The expression level after induction was further decreased by increasing the copy number of CuO operator to 2, 4 or 6, and the ratio of Cumate induced/leaky expression level was not increased. Based on the above results, it is the optimal condition to insert the CuO operator and insert only one copy at a distance of 30 bp to 50 bp from the TATA box of the TRE response element.

(27) Based on the 7×TetO sequence in the TRE.sub.adv response element and the minimal promoter sequence #2 (SEQ ID NO: 26), the response elements TRE.sub.advCuO.sub.32 (SEQ ID NO:29) and TRE.sub.adv CuO.sub.52 (SEQ ID NO:30) were designed by linking a CuO operator at 32 bp and 52 bp downstream of the TATA box, and a Luciferase reporter gene sequence was linked downstream of the 3′ end of the above response elements, to construct plasmids 18BF257 and 18BF233. By the same method as above, the detected induced expression levels were 3.26+06 RLU and 4.88E+06 RLU, respectively, which were 37.8% and 53.4% of the induced expression level for TRE.sub.adv response element; the ratio of induced/leaky expression level based on Cuamte inducible expression system was 4.97 times and 3.23 times that for the TRE.sub.adv response element, respectively. In the subsequent examples, experiments were performed with response elements TRE.sub.advCuO.sub.52 and TRE.sub.3GCuO.sub.50, and they were marked as TRE.sub.advCuO and TRE.sub.3GCuO response elements, respectively.

Example 3: The Effect of Single Regulation/Complex Regulation and Introns on the Induced Expression Level and Non-Induced Leaky Expression Level

(28) In Tet-On inducible expression system, the induced transcription activity and the leaky transcription activity were comprehensively affected by the TetO operator linking sequence of the TRE response element and the minimal promoter sequence, as well as different mutants of the transactivator rtTA. In addition, the transport and stability of messenger ribonucleic acid may be enhanced by linking a spliceable intron sequence downstream of the 3′ end of the response element and upstream of the 5′ end of the regulated nucleic acid fragment of interest, but the induced transcription activity and leaky transcription activity of response element of the inducible expression system may also be affected. Based on this, the optimal design scheme of complex response element was determined in this Example based on the induced expression level and the ratio of induced/leaky expression level of Luciferase gene under the combination of the following conditions: (1) Tet-On and Cumate complex response elements TRE.sub.advCuO and TRE.sub.3GCuO designed based on the TRE.sub.adv and TRE.sub.3G response element sequences; (2) whether an intron was linked; (3) being regulated by the transactivator rtTA.sub.adv or rtTA.sub.3G. A total of 8 design schemes were compared in this Example: TRE.sub.adv (18BF232), TRE.sub.advCuO (18BF233), TRE.sub.3G (18BF234), TRE.sub.3GCuO (18BF235), TRE.sub.adv-BGI (18BF240, wherein the response element was TRE.sub.adv, and a human β-globulin intron was linked between the 3′ end of the response element and the 5′ end of the Luciferase gene), TRE.sub.advCuO-BGI (18BF241, wherein the response element was TRE.sub.advCuO, and a human β-globulin intron was linked between the 3′ end of the response element and the 5′ end of the Luciferase gene), TRE.sub.3G-BGI (18BF236, wherein the response element was TRE.sub.3G, and a human β-globulin intron was linked between the 3′ end of the response element and the 5′ end of the Luciferase gene) and TRE.sub.3GCuO-BGI (18BF237, wherein the response element was TRE.sub.3GCuO, and a human β-globulin intron was linked between the 3′ end of the response element and the 5′ end of the Luciferase gene). The promoter CMV-BGI (18BF229, wherein the promoter was CMV, and a human β-globulin intron was linked between the 3′ end of the CMV promoter and the 5′ end of the Luciferase gene) was used as a positive control. In 293T-rtTA.sub.adv-CymR cells stably expressing rtTA.sub.adv and CymR genes and 293T-rtTA.sub.3G-CymR cells stably expressing rtTA.sub.3G and CymR genes, the above plasmids were transiently transfected, and the optimal combination of complex response elements was verified by measuring the luciferase fluorescence value of samples added with both DOX and Cumate inducers and that of the control added with no inducer. The specific experimental methods were as follows:

(29) The 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells constructed in Example 2 were seeded into a 96-well plate (Corning 3916) at 2.5E+04 cells per well, and the medium was 100 microliters of DMEM complete medium. After 24 hours of culture, the above 9 plasmids were transfected according to the PEI method. 10 μL of transfection reagent, which contains 0.3 ug of total plasmids including 0.01 ug of the above 9 plasmids to be tested and 0.29 μg of 18BF003 empty plasmid, was added into each well during transfection. The mass ratio of total plasmid to PEI MAX (Polysciences, 24765-1) was 1:4, and each plasmid was transfected into 6 wells for 293T-rtTA.sub.adv-CymR and 293T-rtTA.sub.3G-CymR cells respectively. After 3 hours of transfection, the DMEM complete medium was replaced; the inducer 1 ug/ml DOX and 200 ug/ml Cumate were added into 3 wells for each cell; and the same amount of medium was added into the remaining 3 wells as a control. After 24 hours of transfection, relative light unit RLU of each well was detected using a Steady-Gb® Luciferase Assay System (Promega, E2610) kit according to the instructions (Promega, FB037), wherein the detection instrument was a fluorescence microplate reader (Perkin Elmer Victor V).

(30) The experimental results were shown in FIG. 2: (1) Compared with the TRE single regulatory response element, the TRECuO complex response element significantly increases the ratio of induced/leaky expression level by one to two orders of magnitude. Compared with the TRE.sub.advCuO complex response element, the TRE.sub.3GCuO complex response element can better control the leaky expression. In 293T-rtTA.sub.adv-CymR cells, the induced/leaky expression ratios of TRE.sub.3GCuO and TRE.sub.advCuO were 1565 and 1345 times, respectively, which showed an increase of 16.4%; in 293T-rtTA.sub.3G-CymR cells, the induced/leaky expression ratios of TRE.sub.3GCuO and TRE.sub.advCuO were respectively 2635 and 1915 times, which showed an increase of 37.6%. However, compared with the TRE single regulatory response element, the TRECuO complex response element significantly decreased the induced expression level. In 293T-rtTA.sub.adv-CymR cells, the induced expression levels of TRE.sub.3GCuO and TRE.sub.advCuO were 50.4% and 36.3% of those of the corresponding TRE.sub.3G and TRE.sub.adv single regulatory response elements, respectively; in 293T-rtTA.sub.3G-CymR cells, the induced expression levels of TRE.sub.3GCuO and TRE.sub.advCuO were 61.8% and 40.3% of those of the single regulatory response element, respectively. (2) In terms of induced expression level, the TRE.sub.3GCuO complex response element was more sensitive to the downstream intron than the TRE.sub.advCuO complex response element, and the induced expression level in the presence of the intron BGI was significantly increased. In 293T-rtTA.sub.adv-CymR cells, the induced expression levels of TRE.sub.3GCuO and TRE.sub.3GCuO-BGI were 3.4E+06 RLU and 10.6E+06 RLU, respectively, which were 50.4% and 157.9% of the induced expression level of TRE.sub.3G, and linking an intron can increase the induced expression level of TRE.sub.3GCuO complex response element by 2.13 times; in 293T-rtTA.sub.3G-CymR cells, the induced expression levels of TRE.sub.3GCuO and TRE.sub.3GCuO-BGI were 4.24E+06 and 11.3E+06, which were 61.8% and 165.0% of the induced expression level of TRE.sub.3G, respectively, and linking an intron can increase the induced expression level of TRE.sub.3GCuO complex response element by 1.67 times. (3) Regarding the induced expression level, there was no significant difference between the transactivator rtTA.sub.3G and rtTA.sub.adv in the 8 design schemes, but rtTA.sub.3G had a significant advantage regarding the ratio of induced/leaky expression levels. The average ratio of induced/leaky expression level of rtTA.sub.3G in 8 design schemes was 1110 times, which was 1.68 times that of rtTA.sub.adv (the average ratio of induced/leaky expression level of rtTA.sub.adv was 661 times).

(31) Based on the above results, the TRE.sub.3GCuO complex response element has a better ability to control the leaky expression as compared to TRE.sub.adv and TRE.sub.3G and TRE.sub.advCuO complex response elements; with linking the intron BGI downstream, the TRE.sub.3GCuO complex response element can maintain the control of the leaky expression while greatly improving the induced expression level. Under the regulation of rtTA.sub.3G, the induced expression level of TRE.sub.3GCuO-BGI was 80.6% of that of TRE.sub.adv, 80.5% of that of TRE.sub.adv-BGI, 199.9% of that of TRE.sub.advCuO, 147.0% of that of TRE.sub.advCuO-BGI, 165.0% of that of TRE.sub.3G, 81.5% of that of TRE.sub.3G-BGI and 267.2% of that of TRE.sub.3GCuO, reaching 84.7% of that of the constitutive promoter CMV-BGI; the ratio of induced/non-induced expression level of TRE.sub.3GCuO-BGI was 24.5 times that of TRE.sub.adv, 43.4 times that of TRE.sub.adv-BGI, 1.2 times that of TRE.sub.advCuO, 1.6 times that of TRE.sub.advCuO-BGI, 5.9 times that of TRE.sub.3G, 8.9 times that of TRE.sub.3G-BGI and 0.8 times that of TRE.sub.3GCuO.

Example 4: The Effect of Different Introns on the Induced Expression Level and Non-Induced Leaky Expression Level of TRE.SUB.3G.CuO Complex Response Element

(32) In Example 3, the linkage of the intron BGI significantly increased the induced transcription activity of the TRE.sub.3GCuO complex induction response element and the expression level of the target gene of Luciferase. It was verified in this Example whether other introns had similar effects. In this example, the introns in the four commonly used plasmid vectors were cloned between the 3′downstream of the TRE.sub.3GCuO complex response element and the 5′upstream of the luciferase reporter gene, to construct plasmids 18BF261, 18BF262, 18BF263 and 18BF264 respectively containing BGI (C&R), Intron (mP1), Intron (EF-1a) and Intron (pSI) introns, and the specific methods for constructing a plasmid was described in Example 1. In 293T-rtTA.sub.3G-CymR cells stably expressing rtTA.sub.3G and CymR genes, the above plasmids and TRE.sub.3GCuO (18BF235), TRE.sub.3GCuO-BGI (18BF237) and CMV-BGI (18BF229) plasmids were transiently transfected, respectively, and the effect of each intron on the induced expression and non-induced leaky expression of the TRE.sub.3GCuO complex response element was verified by measuring the luciferase fluorescence values of samples added with both DOX and Cumate inducers and that of the control added with no inducer. The specific experimental methods were as follows:

(33) The 293T-rtTA.sub.3G-CymR cells were seeded in a 96-well plate (Corning 3916) at 2.5E+04 cells per well, and the medium was 100 microliters of DMEM complete medium. After 24 hours of culture, the above 7 plasmids were respectively transfected according to the PEI method. 10 μL of transfection reagent, which contains 0.3 ug of total plasmids including 0.01 ug of the above 7 plasmids to be tested and 0.29 μg of 18BF003 empty plasmid, was added into each well during transfection. The mass ratio of total plasmid to PEI MAX (Polysciences, 24765-1) was 1:4, and each plasmid was transfected into 6 wells. After 3 hours of transfection, the DMEM complete medium was replaced; the inducer 1 ug/ml DOX and 200 ug/ml Cumate were added into 3 wells; and the same amount of medium was added into the remaining 3 wells. After 24 hours of transfection, relative light unit RLU of each well was detected using a Steady-Gb® Luciferase Assay System (Promega, E2610) kit according to the instructions (Promega, FB037), wherein the detection instrument was a fluorescence microplate reader (Perkin Elmer Victor V).

(34) The results were shown in FIG. 3: there is no significant difference in the induced expression level and the ratio of induced/leaky expression level between plasmids 18BF261, 18BF262, 18BF263 and 18BF264 containing four other introns and the TRE.sub.3GCuO-BGI (18BF237), all of which can achieve the effect of TRE.sub.3GCuO-BGI as described in Example 3. In the intron, a 5′splice site, a 3′splice site, and a splice branch point are required for splicing. This Example demonstrates that spliceable introns which meet the above conditions can achieve the experimental effects as described in the present disclosure. Therefore, the effects as described in the present disclosure should not be limited by specific intron sequences, and any sequence capable of RNA splicing in mammalian cells can achieve the above functions. Intron sequences that may be selected include, but are not limited to, introns in common cloning vectors, such as a rabbit β-globulin intron, a hybrid intron derived from human β-globulin and immunoglobulin heavy chain intron, EF-1α intron A, SV40 intron, a hybrid intron derived from adenovirus and immunoglobulin heavy chain intron, a modified human cytomegalovirus intron, a hybrid intron derived from chicken β-actin (CBA) and mouse microvirus (MMV) intron, a chimera derived from chicken β-actin and rabbit β-globulin intron, and a mP1 intron; or any intron of any gene of any eukaryote; or an artificial intron sequence designed based on the intron splicing rules.

Example 5: Study of Induced Transcription Activity of the TRE.SUB.3G.CuO Complex Response Element Under Different Induction Combinations

(35) In this Example, stable cell lines, under complex regulation of Tet-ON and Cumate, TRE.sub.3GCuO or TRE.sub.3GCuO-intron, and with Luciferase as the reporter gene, were constructed. Then, based on these cell lines, induced transcription activities of the reporter gene under the following 4 induction conditions were detected: without inducer, Cumate only, DOX only or both DOX and Cumate inducers. In this Example, the Luciferase reporter gene was taken as an example, and in principle, the method of the present disclosure was not affected by the nucleic acid fragment of interest. The specific experimental methods were as follows:

(36) 1. Construction of a Luciferase Stable Cell Line Regulated by DOX and Cumate by Using SB Transposon System:

(37) 293T cells were seeded at 1.5E+06 cells per 60 mm culture dish, and cultured in DMEM (Sigam, D6429) complete medium supplemented with 10% FBS (ExCell, 11H116) at 37° C. and 5% CO 2. After 24 hours of culture, transfection was carried out according to the PEI method. During transfection, 500 μL of transfection reagent which contained 5.5 ug of total plasmid was added to each 60 mm culture dish, and the mass ratio of total plasmid to PEI MAX (Polysciences, 24765-1) was 1:4; and thereby 3 Luciferase stable cell lines were constructed. The transfection plasmids were transfected at the 19BF075:19BF229:18BF019 molar ratio of 5:5:1 to obtain 293T(T&C)-CMV-BGI-Luc cells; the transfection plasmids were transfected at the 19BF075:19BF235:18BF019 molar ratio of 5:5:1 to obtain 293T(T&C)-TRE.sub.3GCuO-Luc cells; the transfection plasmids were transfected at the 19BF075:19BF237:18BF019 molar ratio of 5:5:1 to obtain 293T(T&C)-TRE.sub.3GCuO-BGI-Luc cells. The plasmid and PEI MAX were mixed uniformly, and then put into a culture dish after standing for 15 minutes. 3 hours after transfection, the medium was changed to a complete DMEM medium, and the transfection operation was completed. After 24 hours of transfection, the cells were digested with trypsin and all seeded in a 100 mm culture dish (Corning, 430167), and 200 μg/ml of hygromycin (Sangon Biotech A600230-0001) drug screening was performed for at least three passages. After the growth of cells under the pressure of drug screening was consistent with that of the original 293T cells, the above 3 cells were diluted to 1 cell per well by a limiting dilution method and seeded in a 96-well plate; when the cells grew to about 50% of the bottom area of the well, the wells with strong EGFP green fluorescence intensity and uniform luminescence were selected under the fluorescence microscope, and 3 independent clones of each cell were selected for the following experiments.

(38) 2. Induction of Luciferase Expression by Using Different Combinations of DOX and Cumate:

(39) For the above 3 cells, 3 independent clones for each cell were seeded into a 96-well plate (Corning 3916) at 2.5E+04 cells per well, with 8 wells per clone, and the medium was 100 microliters of DMEM complete medium. After 24 hours of culture, the medium was replaced and the following reagents were added into the duplicate wells of the 8 wells for each cell: (1) the same amount of medium, (2) Cumate at a final concentration of 200 ug/ml, (3) DOX at a final concentration of 1 ug/ml, or (4) DOX at a final concentration of 1 ug/ml and Cumate at a final concentration of 200 ug/ml. After 24 hours of further culture, relative light unit RLU of each well was detected using a Steady-Glo® Luciferase Assay System (Promega, E2610) kit according to the instruction (Promega, FB037), wherein the detection instrument was a fluorescence microplate reader (Perkin Elmer Victor V).

(40) The experimental results were shown in FIG. 4: under the condition of only adding Cumate, the induced transcription activities of TRE.sub.3GCuO and TRE.sub.3GCuO-BGI were 1.36E+04 RLU and 4.16E+04 RLU, which were respectively 4.31 times and 3.27 times higher than those obtained by no induction. Under the condition of only adding DOX, the induced transcription activities of TRE.sub.3GCuO and TRE.sub.3GCuO-BGI were 2.14E+05 RLU and 5.34E+05 RLU, which were respectively 67.66 times and 42.07 times higher than those obtained by no induction, and were 15.71 times and 12.86 times higher than those obtained under the induction condition of only adding Cumate. Under the condition of adding both DOX and Cumate, the induced transcription activities of TRE.sub.3GCuO and TRE.sub.3GCuO-BGI were 7.54E+06 RLU and 1.29E+07 RLU, which were respectively 2381.05 times and 1011.81 times higher than those obtained by no induction; were 552.99 times and 309.27 times higher than those obtained under the induction condition of only adding Cumate; were 35.19 times and 24.05 times higher than those obtained under the induction condition of only adding DOX. Based on the above results, TRE.sub.3GCuO and TRE.sub.3GCuO-BGI complex response elements can regulate the induced transcription activity of the nucleic acid fragment of interest at various levels according to different combinations of inducers, with ranges of 4.31 times to 2381.05 times and 3.27 times to 1011.81 times, respectively; when both DOX and Cumate inducers were added, the maximum induced transcription activities can reach 47.84% and 81.54% of that of CMV promoter, respectively. With further optimization of the concentration of DOX and/or Cumate inducer, the transcription activity of the nucleic acid fragment of interest can be further finely regulated at different transcription activity levels.