A METHOD FOR CRISPR LIBRARY SCREENING
20230183884 · 2023-06-15
Inventors
- Sen WU (Beijing, CN)
- Chunlong XU (Beijing, CN)
- Xiaolan QI (Beijing, CN)
- Xuguang DU (Beijing, CN)
- Huiying ZOU (Beijing, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A01K2217/07
HUMAN NECESSITIES
A01K67/0275
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
C40B40/08
CHEMISTRY; METALLURGY
International classification
C40B40/08
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
CRISPR/Cas9 is becoming an increasingly important tool to functionally annotate genomes. However, since genome-wide CRISPR/Cas9 libraries are mostly constructed in lentiviral vectors, in vivo applications are severely limited due to difficulties in delivery. Here we examined the piggyBac (PB) transposon as an alternative vehicle to deliver a guide RNA (gRNA) library for in vivo screening. Although tumor induction has previously been achieved in mice by targeting cancer genes with the CRISPR/Cas9 system, in vivo genome-scale screening has not been reported. With our PB-CRISPR libraries, we conducted an in vivo genome-wide screen in mice and identified genes mediating liver tumorigenesis, including known and novel tumor suppressor genes (TSGs), Our results demonstrate that PB can be a simple and non-viral choice for efficient in vivo delivery of CRISPR libraries.
Claims
1. A genome wide library comprising: a plurality of PB-mediated CRISPR system polynucleotide, comprising minimal guide RNAs flanked by minimal piggyBac inverted repeat elements, and said guide sequences are capable of targeting a plurality of target sequences of interest in a plurality of genomic loci in a population of eukaryotic cells, tissues, or organisms.
2. The library of claim 1, wherein the population of eukaryotic cells is a population of mammalian cells such as mouse cells or human cells.
3. The library of claim 1, wherein the population of eukaryotic cells is a population of any kind of cells such as fibroblast.
4. The library of claim 1, wherein the population of tissues is a population of any kind of the non-reproductive tissues such as liver or lungs.
5. The library of claim 1, wherein the population of organisms is a population of mouse.
6. The library of claim 1, wherein the target sequence in the genomic locus is a coding sequence.
7. The library of claim 1, wherein gene function of said target sequence is altered by said targeting.
8. The library of claim 1, wherein said targeting results in a knockout of gene function.
9. The library of claim 1, wherein the targeting is of the entire genome.
10. The library of claim 8, wherein the knockout of gene function is achieved in a plurality of unique genes which function in mediating tumorigenesis, anti-aging, and longevity.
11. The library of claim 10, wherein said unique gene is tumor suppressor gene.
12. A method of in vivo genome-scale screening comprising: (a) introducing into a mammal containing and expressing a RNA polynucleotide having a target sequence, (b) encoding at least one gene product of a PB-mediated CRISPR system comprising one or more vectors comprising: (i) a first polynucleotide encoding a Cas9 protein, or a variant thereof or a fusion protein therewith, (ii) a second polynucleotide encoding a PB transposase, or a variant thereof or a fusion protein therewith, (iii) a third polynucleotide library of claims 1-11, wherein components (i), (ii), and (iii) are located on same or different vectors of the system, whereby PB transposase introduce guide RNA into genomes, the guide RNA targets the target sequence an Cas9 protein generates at least one site specific break is repaired through a cellular repair mechanism, (c) amplifying and sequencing the genomic DNA from said mammal.
13. The method of claim 12, wherein gene function of said gene product is altered by said system.
14. The method of claim 12, wherein said system results in a knockout of gene function.
15. The method of claim 14, wherein the knockout of gene function is achieved in a plurality of unique genes which function in mediating tumorigenesis, anti-aging, and longevity.
16. The method of claim 12, wherein said mammal in step (a) expresses at least one oncogene or knockouts at least one tumor suppresser gene to generate a sensitized background for screening without tumor formation.
17. The method of claim 16, wherein said oncogene is NRAS with dominant G12V mutation.
18. The method of claim 16, wherein said tumor suppresser gene is selected from the group consists of Cdkn2b, Trp53, Klf6, miR-99b, Clec5a, Selll2, Lgals7, Pml, Ptgdr, Tspan32, Fat4, Pik3ca, Pdlim4, Cxcl12, Lrig1, Batf2, Pmdh2, Chst10, Diras1, Ephb4, Timp3, Hrasls, Banp, and Cyb56Id2.
19. The method of claim 12, wherein said mammal is mouse.
20. The method of claim 19, wherein PB-mediated CRISPR system is introduced into mouse by hydrodynamic tail vein injection.
21. The method of claim 19, wherein PB-mediated CRISPR system is introduced by transfection in vivo such as nanoparticles and electroporation.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DETAILED DESCRIPTION
[0046] The present invention will be further illustrated below with reference to the specific examples. It should be understood that these examples are only used to describe the invention but not to limit the scope of the invention. The experimental methods with no specific conditions described in the following examples are generally performed under conventional conditions, and the materials used without specific description are purchased from common chemical reagents corporation.
[0047] Before describing the invention in detail, it is to be understood that this invention is not limited to particular biological systems or cell types. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a cell” includes combinations of two or more cells, or entire cultures of cells; reference to “a polynucleotide” includes, as a practical matter, many copies of that polynucleotide. Unless defined herein and below in the reminder of the specification, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0048] As used herein, the terms “polynucleotide”, “nucleic acid,” “oligonucleotide”, “oligomer”, “oligo” or equivalent terms, refer to molecules that comprises a polymeric arrangement of nucleotide base monomers, where the sequence of monomers defines the polynucleotide. Polynucleotides can include polymers of deoxyribonucleotides to produce deoxyribonucleic acid (DNA), and polymers of ribonucleotides to produce ribonucleic acid (RNA). A polynucleotide can be single- or double-stranded. When single stranded, the polynucleotide can correspond to the sense or antisense strand of a gene. A single-stranded polynucleotide can hybridize with a complementary portion of a target polynucleotide to form a duplex, which can be a homoduplex or a heteroduplex.
[0049] The length of a polynucleotide is not limited in any respect. Linkages between nucleotides can be internucleotide-type phosphodiester linkages, or any other type of linkage. A polynucleotide can be produced by biological means (e.g., enzymatically), either in vivo (in a cell) or in vitro (in a cell-free system). A polynucleotide can be chemically synthesized using enzyme-free systems. A polynucleotide can be enzymatically extendable or enzymatically non-extendable.
[0050] By convention, polynucleotides that are formed by 3′-5′ phosphodiester linkages (including naturally occurring polynucleotides) are said to have 5′-ends and 3′-ends because the nucleotide monomers that are incorporated into the polymer are joined in such a manner that the 5′ phosphate of one mononucleotide pentose ring is attached to the 3′ oxygen (hydroxyl) of its neighbor in one direction via the phosphodiester linkage. Thus, the 5′-end of a polynucleotide molecule generally has a free phosphate group at the 5′ position of the pentose ring of the nucleotide, while the 3′ end of the polynucleotide molecule has a free hydroxyl group at the 3′ position of the pentose ring. Within a polynucleotide molecule, a position that is oriented 5′ relative to another position is said to be located “upstream”, while a position that is 3′ to another position is said to be “downstream”. This terminology reflects the fact that polymerases proceed and extend a polynucleotide chain in a 5′ to 3′ fashion along the template strand. Unless denoted otherwise, whenever a polynucleotide sequence is represented, it will be understood that the nucleotides are in 5′ to 3′ orientation from left to right.
[0051] As used herein, it is not intended that the term “polynucleotide” be limited to naturally occurring polynucleotide structures, naturally occurring nucleotides sequences, naturally occurring backbones or naturally occurring internucleotide linkages. One familiar with the art knows well the wide variety of polynucleotide analogues, unnatural nucleotides, non-natural phosphodiester bond linkages and internucleotide analogs that find use with the invention.
[0052] As used herein, the term “gene” generally refers to a combination of polynucleotide elements, that when operatively linked in either a native or recombinant manner, provide some product or function. The term “gene” is to be interpreted broadly, and can encompass mRNA, cDNA, cRNA and genomic DNA forms of a gene. In some uses, the term “gene” encompasses the transcribed sequences, including 5′ and 3′ untranslated regions (5′-UTR and 3′-UTR), exons and introns. In some genes, the transcribed region will contain “open reading frames” that encode polypeptides. In some uses of the term, a “gene” comprises only the coding sequences (e.g., an “open reading frame” or “coding region”) necessary for encoding a polypeptide. In some aspects, genes do not encode a polypeptide, for example, ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some aspects, the term “gene” includes not only the transcribed sequences, but in addition, also includes non-transcribed regions including upstream and downstream regulatory regions, enhancers and promoters. The term “gene” encompasses mRNA, cDNA and genomic forms of a gene.
[0053] In some aspects, the genomic form or genomic clone of a gene includes the sequences of the transcribed mRNA, as well as other non-transcribed sequences which lie outside of the transcript. The regulatory regions which lie outside the mRNA transcription unit are termed 5′ or 3′ flanking sequences. A functional genomic form of a gene typically contains regulatory elements necessary, and sometimes sufficient, for the regulation of transcription. The term “promoter” is generally used to describe a DNA region, typically but not exclusively 5′ of the site of transcription initiation, sufficient to confer accurate transcription initiation. In some aspects, a “promoter” also includes other cis-acting regulatory elements that are necessary for strong or elevated levels of transcription, or confer inducible transcription. In some embodiments, a promoter is constitutively active, while in alternative embodiments, the promoter is conditionally active (e.g., where transcription is initiated only under certain physiological conditions).
[0054] Generally, the term “regulatory element” refers to any cis-acting genetic element that controls some aspect of the expression of nucleic acid sequences. In some uses, the term “promoter” comprises essentially the minimal sequences required to initiate transcription. In some uses, the term “promoter” includes the sequences to start transcription, and in addition, also include sequences that can upregulate or downregulate transcription, commonly termed “enhancer elements” and “repressor elements”, respectively.
[0055] Specific DNA regulatory elements, including promoters and enhancers, generally only function within a class of organisms. For example, regulatory elements from the bacterial genome generally do not function in eukaryotic organisms. However, regulatory elements from more closely related organisms frequently show cross functionality. For example, DNA regulatory elements from a particular mammalian organism, such as human, will most often function in other mammalian species, such as mouse. Furthermore, in designing recombinant genes that will function across many species, there are consensus sequences for many types of regulatory elements that are known to function across species, e.g., in all mammalian cells, including mouse host cells and human host cells.
[0056] As used herein, the term “genome” refers to the total genetic information or hereditary material possessed by an organism (including viruses), i.e., the entire genetic complement of an organism or virus. The genome generally refers to all of the genetic material in an organism's chromosome (s), and in addition, extra-chromosomal genetic information that is stably transmitted to daughter cells (e.g., the mitochondrial genome). A genome can comprise RNA or DNA. A genome can be linear (mammals) or circular (bacterial). The genomic material typically resides on discrete units such as the chromosomes.
[0057] As used herein, the terms “vector”, “vehicle”, “construct” and “plasmid” are used in reference to any recombinant polynucleotide molecule that can be propagated and used to transfer nucleic acid segment (s) from one organism to another. Vectors generally comprise parts which mediate vector propagation and manipulation (e.g., one or more origin of replication, genes imparting drug or antibiotic resistance, a multiple cloning site, operably linked promoter/enhancer elements which enable the expression of a cloned gene, etc.). Vectors are generally recombinant nucleic acid molecules, often derived from bacteriophages, or plant or animal viruses. Plasmids and cosmids refer to two such recombinant vectors. A “cloning vector” or “shuttle vector” or “subcloning vector” contains operably linked parts that facilitate subcloning steps (e.g., a multiple cloning site containing multiple restriction endonuclease target sequences). A nucleic acid vector can be a linear molecule, or in circular form, depending on type of vector or type of application. Some circular nucleic acid vectors can be intentionally linearized prior to delivery into a cell.
[0058] As used herein, the term “expression vector” refers to a recombinant vector comprising operably linked polynucleotide elements that facilitate and optimize expression of a desired gene (e.g., a gene that encodes a protein) in a particular host organism (e.g., a bacterial expression vector or mammalian expression vector). Polynucleotide sequences that facilitate gene expression can include, for example, promoters, enhancers, transcription termination sequences, and ribosome binding sites.
[0059] As used herein, the term “host cell” refers to any cell that contains a heterologous nucleic acid. The heterologous nucleic acid can be a vector, such as a shuttle vector or an expression vector. In some aspects, the host cell is able to drive the expression of genes that are encoded on the vector. In some aspects, the host cell supports the replication and propagation of the vector. Host cells can be bacterial cells such as E. coli, or mammalian cells (e.g., human cells or mouse cells). When a suitable host cell (such as a suitable mouse cell) is used to create a stably integrated cell line, that cell line can be used to create a complete transgenic organism.
[0060] Methods (i.e., means) for delivering vectors/constructs or other nucleic acids (such as in vitro transcribed RNA) into host cells such as bacterial cells and mammalian cells are well known to one of ordinary skill in the art, and are not provided in detail herein. Any method for nucleic acid delivery into a host cell finds use with the invention.
[0061] For example, methods for delivering vectors or other nucleic acid molecules into bacterial cells (termed transformation) such as Escherichia coli are routine, and include electroporation methods and transformation of E. coli cells that have been rendered competent by previous treatment with divalent cations such as CaCl.sub.2.
[0062] Methods for delivering vectors or other nucleic acid (such as RNA) into mammalian cells in culture (termed transfection) are routine, and a number of transfection methods find use with the invention. These include but are not limited to calcium phosphate precipitation, electroporation, lipid-based methods (liposomes or lipoplexes) such as Transfectamine® (Life Technologies™) and TransFectin™ (Bio-Rad Laboratories), cationic polymer transfections, for example using DEAE-dextran, direct nucleic acid injection, biolistic particle injection, and viral transduction using engineered viral carriers (termed transduction, using e.g., engineered herpes simplex virus, adenovirus, adeno-associated virus, vaccinia virus, Sindbis virus), and sonoporation. Any of these methods find use with the invention.
[0063] The invention farther provides a host cell comprising any of the recombinant expression vectors described herein. As used herein, the term “host cell” refers to any type of cell that can contain the inventive recombinant expression vector. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5a E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5a cell. For purposes of producing a recombinant modified TCR, polypeptide, or protein, the host cell is preferably a mammalian cell. Most preferably, the host cell is a human cell. The host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage.
[0064] Also provided by the invention is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors, or a cell other than a T cell, e.g., a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cell, a muscle cell, a brain cell, etc. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector. The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector. In one embodiment of the invention, the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
[0065] As used herein, the term “recombinant” in reference to a nucleic acid or polypeptide indicates that the material (e.g., a recombinant nucleic acid, gene, polynucleotide, polypeptide, etc.) has been altered by human intervention. Generally, the arrangement of parts of a recombinant molecule is not a native configuration, or the primary sequence of the recombinant polynucleotide or polypeptide has in some way been manipulated. A naturally occurring nucleotide sequence becomes a recombinant polynucleotide if it is removed from the native location from which it originated (e.g., a chromosome), or if it is transcribed from a recombinant DNA construct. A gene open reading frame is a recombinant molecule if that nucleotide sequence has been removed from it natural context and cloned into any type of nucleic acid vector (even if that ORF has the same nucleotide sequence as the naturally occurring gene). Protocols and reagents to produce recombinant molecules, especially recombinant nucleic acids, are well known to one of ordinary skill in the art. In some embodiments, the term “recombinant cell line” refers to any cell line containing a recombinant nucleic acid, that is to say, a nucleic acid that is not native to that host cell.
[0066] As used herein, the term “marker” most generally refers to a biological feature or trait that, when present in a cell (e.g., is expressed), results in an attribute or phenotype that visualizes or identifies the cell as containing that marker. A variety of marker types are commonly used, and can be for example, visual markers such as color development, e.g., lacZ complementation (β-galactosidase) or fluorescence, e.g., such as expression of green fluorescent protein (GFP) or GFP fusion proteins, RFP, BFP, selectable markers, phenotypic markers (growth rate, cell morphology, colony color or colony morphology, temperature sensitivity), auxotrophic markers (growth requirements), antibiotic sensitivities and resistances, molecular markers such as biomolecules that are distinguishable by antigenic sensitivity (e.g., blood group antigens and histocompatibility markers), cell surface markers (for example H2KK), enzymatic markers, and nucleic acid markers, for example, restriction fragment length polymorphisms (RFLP), single nucleotide polymorphism (SNP) and various other amplifiable genetic polymorphisms.
[0067] As used herein, the expressions “selectable marker” or “screening marker” or “positive selection marker” refer to a marker that, when present in a cell, results in an attribute or phenotype that allows selection or segregated of those cells from other cells that do not express the selectable marker trait. A variety of genes are used as selectable markers, e.g., genes encoding drug resistance or auxotrophic rescue are widely known. For example, kanamycin (neomycin) resistance can be used as a trait to select bacteria that have taken up a plasmid carrying a gene encoding for bacterial kanamycin resistance (e.g., the enzyme neomycin phosphotransferase II). Non-transfected cells will eventually die off when the culture is treated with neomycin or similar antibiotic.
[0068] A similar mechanism can also be used to select for transfected mammalian cells containing a vector carrying a gene encoding for neomycin resistance (either one of two aminoglycoside phosphotransferase genes; the neo selectable marker). This selection process can be used to establish stably transfected mammalian cell lines.
[0069] As used herein, the term “reporter” refers generally to a moiety, chemical compound or other component that can be used to visualize, quantitate or identify desired components of a system of interest. Reporters are commonly, but not exclusively, genes that encode reporter proteins. For example, a “reporter gene” is a gene that, when expressed in a cell, allows visualization or identification of that cell, or permits quantitation of expression of a recombinant gene. For example, a reporter gene can encode a protein, for example, an enzyme whose activity can be quantitated, for example, chloramphenicol acetyltransferase (CAT) or firefly luciferase protein. Reporters also include fluorescent proteins, for example, green fluorescent protein (GFP) or any of the recombinant variants of GFP, including enhanced GFP (EGFP), blue fluorescent proteins (BFP and derivatives), cyan fluorescent protein (CFP and other derivatives), yellow fluorescent protein (YFP and other derivatives) and red fluorescent protein (RFP and other derivatives).
[0070] As used herein, the terms “bacteria” or “bacterial” refer to prokaryotic Eubacteria, and are distinguishable from Archaea, based on a number of well-defined morphological and biochemical criteria.
[0071] As used herein, the term “eukaryote” refers to organisms (typically multicellular organisms) belonging to the Kingdom Eucarya, generally distinguishable from prokaryotes by the presence of a membrane-bound nucleus and other membrane-bound organelles, linear genetic material (i.e., linear chromosomes), the absence of operons, the presence of introns, message capping and poly-A mRNA, a distinguishing ribosomal structure and other biochemical characteristics.
[0072] As used herein, the terms “mammal” or “mammalian” refer to a group of eukaryotic organisms that are endothermic amniotes distinguishable from reptiles and birds by the possession of hair, three middle ear bones, mammary glands in females, a brain neocortex, and most giving birth to live young. The largest group of mammals, the placentals (Eutheria), have a placenta which feeds the offspring during pregnancy. The placentals include the orders Rodentia (including mice and rats) and primates (including humans).
[0073] As used herein, the term “encode” refers broadly to any process whereby the information in a polymeric macro-molecule is used to direct the production of a second molecule that is different from the first. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule.
[0074] For example, in some aspects, the term “encode” describes the process of semi-conservative DNA replication, where one strand of a double-stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by a DNA-dependent DNA polymerase. In other aspects, a DNA molecule can encode an RNA molecule (e.g., by the process of transcription that uses a DNA-dependent RNA polymerase enzyme). Also, an RNA molecule can encode a polypeptide, as in the process of translation. When used to describe the process of translation, the term “encode” also extends to the triplet codon that encodes an amino acid. In some aspects, an RNA molecule can encode a DNA molecule, e.g., by the process of reverse transcription incorporating an RNA-dependent DNA polymerase. In another aspect, a DNA molecule can encode a polypeptide, where it is understood that “encode” as used in that case incorporates both the processes of transcription and translation. For example, the term “encode” refers to the capacity of a nucleic acid to provide another nucleic acid or a polypeptide. A nucleic acid sequence or construct is said to “encode” a polypeptide if it can be transcribed and/or translated to produce the polypeptide.
[0075] As used herein, the term “transcriptional element” is meant a region of DNA that can be transcribed that can be operably linked to a promoter in the vector or put into functional proximity with a promoter upon integration in the genome. In some cases, where the promoter and region of DNA to be transcribed are together in the transcriptional unit, the unit may be referred to as a “cassette”, for example the kanamycin/neomycin resistance cassette. The transcriptional unit can contain regions of DNA that are transcribed to produce mRNAs or regulatory RNAs, with or without promoter sequences.
[0076] As used herein, the term “target” or “targeting sequence” is not limited by the source of target DNA, which can be any source of DNA for which recombination is desired. For example, the target DNA can be located in a chromosome (i.e., genomic DNA) or can be in a vector, such as from a library.
[0077] In general, “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast. A sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an “editing template” or “editing polynucleotide” or “editing sequence”. In aspects of the invention, an exogenous template polynucleotide may be referred to as an editing template. In an aspect of the invention the recombination is homologous recombination.
[0078] As used herein, the term “PiggyBac” or “PB” refers to a PiggyBac transposon and/or PiggyBac transposase that provides for a similar or increased frequency of transposition relative to a wild-type PiggyBac transposon and/or transposase.
[0079] As used herein, the term “PiggyBac transposase” or “PB transposase”, refers to the transposase isolated from the Trichoplusia ni (cabbage looper moth), or the nucleic acid sequence encoding said transposase.
[0080] As used herein, the term “operably linked”, refers to the joining of nucleic acid sequences such that one sequence can provide a required function to a linked sequence. In the context of a promoter, “operably linked” means that the promoter is connected to a sequence of interest such that the transcription of that sequence of interest is controlled and regulated by that promoter. When the sequence of interest encodes a protein and when expression of that protein is desired, “operably linked” means that the promoter is linked to the sequence in such a way that the resulting transcript will be efficiently translated. Nucleic acid sequences that can be operably linked include, but are not limited to, sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5′ untranslated regions, introns, protein coding regions, 3′ untranslated regions, polyadenylation sites, and/or transcriptional terminators), sequences that provide DNA transfer and/or integration and/or excision functions (i.e., transposon sequences, transposase-encoding sequences, site specific recombinase recognition sites, integrase recognition sites), sequences that provide for selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scoreable marker functions (i.e., reporter genes), sequences that facilitate in vitro or in vivo manipulations of the sequences (i.e., polylinker sequences, site specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomous replication sequences, centromeric sequences).
[0081] As used herein, the term “gene products”, refers to either an RNA molecule or to a polypeptide resulting from the expression of a DNA sequence encoding for the RNA molecule or polypeptide.
[0082] As used herein, the term “recombinant expression vector” means a genetically-modified recombinant oligonucleotide or polynucleotide, which comprises nucleotide sequence encoding mRNA, protein, polypeptide, and peptide when the recombinant vector is contacted with the host cell under conditions sufficient to have the mRNA, protein, polypeptide or peptide expressed within the cell. The invention recombinant expression vector can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single-stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The bond between nucleotide can be naturally-occurring, and can also be non-naturally-occurring or modified.
[0083] The invention further provides any recombinant expression vector containing the inventive polynucleotide. The recombinant expression vector of the invention can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series, the pcDNA series, the pBluescript series, the pET series, the pGEX series, and the pEX series. Bacteriophage vectors, such as λGT10, λGTI11, λZapII, λEMBL4, etc. also can be used. Examples of plant expression vectors include pBI01, pBI101.2, pBI101.3, pBI121 and pBIN19. Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo. Preferably, the recombinant expression vector is pcDNA series.
[0084] The recombinant expression vectors of the invention can be prepared using standard recombinant DNA techniques. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Desirably, the recombinant expression vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA-based.
[0085] The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
[0086] The recombinant expression vector can comprise a native or normative promoter. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus. The inventive recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression.
[0087] Further, the recombinant expression vectors can be made to include a suicide gene. The term “suicide gene” refers to a gene that causes the cell expressing the suicide gene to die. The suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die. Suicide genes are known in the art (see, for example, Suicide Gene Therapy: Methods and Reviews, Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK), Humana Press, 2004) and include, for example, the Herpes Simplex Virus (HSV) thymidine kinase (TK) gene, cytosine daminase, purine nucleoside phosphorylase, and nitroreductase.
[0088] In the present, the eukaryotic cells can be any kind of cells such as a T cell, a B cell, a macrophage, a neutrophil, an erythrocyte, a hepatocyte, an endothelial cell, an epithelial cell, a muscle cell, a brain cell, etc. And the tissues or organisms can be any kind of the non-reproductive tissues such as liver, lungs, heart, brain, eye, stomach, pancreas, spleen, bladder, etc.
EXAMPLES
Example 1: Plasmids Construction
[0089] To utilize PB to deliver and express a genome-wide single guide RNA (sgRNA) library for high-throughput screening, we constructed three PB vectors, pCRISPR-sg4, pCRISPR-sg5 and pCRISPR-sg6, which all express an sgRNA under control of the human U6 promoter. pCRISPR-sg4 and pCRISPR-sg5 and pCRISPR-sg6 were constructed by PCR assembly of the U6-sgRNA expression cassette from pX330 (Cong, L. et al. Science 339, 819-823 (2013)), SV40-neo from pIRES2-EGFP (Clontech), puro from pMSCVpuro (BD biosciences), and ccdB from pStart-K (Wu, S., Ying, G, Wu, Q. & Capecchi, M. R. Nat. Protoc. 3, 1056-1076 (2008)) on a PB backbone from pZGs (Wu, S., Ying, G, Wu, Q. & Capecchi, M. R. Nat. Genet. 39, 922-930 (2007)). pCRISPR-sg4 and pCRISPR-sg5 carry puromycin and neo resistance genes respectively (
[0090] pPB-hNRAS.sup.G12V was constructed by PCR assembly of NRAS.sup.G12V amplified from cDNA, and IRES-EGFP from pIRES2-EGFP on a PB backbone from pZGs (Wu, S., Ying, G, Wu, Q. & Capecchi, M. R. Nat. Genet. 39, 922-930 (2007)).
[0091] To construct the pCRISPR-W9 backbone, PB terminal repeats were amplified from pZGs (Wu, S., Ying, G, Wu, Q. & Capecchi, M. R. Nat. Genet. 39, 922-930 (2007)) and inserted into pX330 (Cong, L. et al. Science 339, 819-823 (2013)), and GFP was added to Cas9 gene with a 2A sequence.
[0092] sgRNA targeting individual genes was PCR amplified from oligonucleotide template with primers xc1732/xc1733 (Table 1). The purified PCR products were cloned into the BbsI site of pCRISPR-sg6 using the Gibson Assembly method (NEB), resulting in pCRISPR-sg6-Trp53, and pCRISPR-sg6-Cdkn2b plasmids. All plasmids were confirmed by sequencing. Qiagen EndoFree Plasmid Maxi Kit was used to prepare plasmid DNA for injection.
TABLE-US-00001 TABLE 1 Primers used in this study SEQ ID NO Primer Name Primer sequence Note 1 Non_lib Cdkn2a ATATCTTGTGGAAAGGACGAA Construction of pCRISPR-W9- ACACCGCGGTGCAGATTCGAA Cdkn2a-sgRNA CTGCGGTTTTAGAGCTAGAAAT AGCAAGTTAA 2 A_56035_Trp53 ATATCTTGTGGAAAGGACGAA Construction of pCRISPR-sg6-Trp53 ACACCGTGAGGGCTTACCATC ACCATGTTTTAGAGCTAGAAAT AGCAAGTTAA 3 B_09614_Cdkn2b ATATCTTGTGGAAAGGACGAA Construction of pCRISPR-sg6-Cdkn2b ACACCGGCAGCACGACAAGCG TGTCCGTTTTAGAGCTAGAAAT AGCAAGTTAA 4 Tet1-gRNA-F CACCGGCTGCTGTCAGGGAGC Amplification of Tet1 target site of TCA Tet1-gRNA 5 Tet1-gRNA-R AAACTGAGCTCCCTGACAGCA Amplification of Tet1 target site of GCC Tet1-gRNA 6 Tet2-gRNA-F CACCGAAAGTGCCAACAGATA Amplification of Tet2 target site of TCC Tet2-gRNA 7 Tet2-gRNA-R AAACGGATATCTGTTGGCACTT Amplification of Tet2 target site of TC Tet2-gRNA 8 Qcas9-F CCGAAGAGGTCGTGAAGAAG Quantitative RT-PCR analysis for Cas9 expression 9 Qcas9-R GCCTTATCCAGTTCGCTCAG Quantitative RT-PCR analysis for Cas9 expression 10 QhNRAS-F ACAGTGCCATGAGAGACCAA Quantitative RT-PCR analysis for hNRAS expression 11 QhNRAS-R CTCGCTTAATCTGCTCCCTGT Quantitative RT-PCR analysis for hNRAS expression 12 QmGADPH-F cttcaacagcaactcccactc Quantitative RT-PCR analysis for mGADPH expression 13 QmGADPH-R cctgttgctgtagccgtattc Quantitative RT-PCR analysis for mGADPH expression 14 xcl732 ATATCTTGTGGAAAGGACGAA Construction of sgRNA plasmids ACACCG 15 xcl733 TTAACTTGCTATTTCTAGCTCTA Construction of sgRNA plasmids AAAC 16 Tet1-gRNA-F CACCGGCTGCTGTCAGGGAGC Amplification of Tet1 target site of TCA Tet1-gRNA 17 Tet1-gRNA-R AAACTGAGCTCCCTGACAGCA Amplification of Tet1 target site of GCC Tet1-gRNA 18 Tet2-gRNA-F CACCGAAAGTGCCAACAGATA Amplification of Tet2 target site of TCC Tet2-gRNA 19 Tet2-gRNA-R AAACGGATATCTGTTGGCACTT Amplification of Tet2 target site of TC Tet2-gRNA 20 Non_lib Cdkn2a GTCAGAAGCTTTTGGACCAAC Amplification of Cdkn2a target site of target-F T Non_lib Cdkn2a 21 Non_lib Cdkn2a ACAATCCCAGTTCGGCTTAAA Amplification of Cdkn2a target site of target-R G Non_lib Cdkn2a 22 A_54001_Tle4 ATATCGAAAGTTTGGCCTCAGC Amplification of Tle4 target site of target-F GT sgRNA_A54001 23 A_54001_Tle4 ACGGGCCACTTTCGATTCCGG Amplification of Tle4 target site of target-R GTA sgRNA_A54001 24 A_36261_Olfr1311 TGTGGTCTCATGATGGTCAAGT Amplification of Olfr1311 target site of target-F AG sgRNA_A36261 25 A_36261_Olfr1311 TGGCTCATGGTATTGAATGGCT Amplification of Olfr1311 target site of target-R GA sgRNA_A36261 26 B_28812_Lgals7 TCTTGGGTTTCACCAGCACGTC Amplification of Lgals7 target site of target-F CT sgRNA_B28812 27 B_28812_Lgals7 TCCAGGGTAGCTTCAAGATCC Amplification of Lgals7 target site of target-R AA sgRNA_B28812 28 A_28412_Lamc2 AGCAACTTCATGGTGGCTCAC Amplification of Lamc2 target site of target-F AAC sgRNA_A28412 29 A_28412_Lamc2 TTCACCCCCTTCTTTCTGTGGA Amplification of Lamc2 target site of target-R GC sgRNA_A28412 30 B_27405_Kif5a ACATTGTCCCTCACTTCATCCT Amplification of Kif5a target site of target-F CCA sgRNA_B27405 31 B_27405_Kif5a AGCCTAAGTATGTGACACGCCT Amplification of Kif5a target site of target-R TT sgRNA_B27405 32 B_51283_Srms AGGAATGGAGGGGAGGAAGG Amplification of Srms target site of target-F AAGA sgRNA_B51283 33 B_51283_Srms TGAGGCCTGGTAGTTATGTTAG Amplification of Srms target site of target-R AG sgRNA_B51283 34 A_07138_Brap TTGTGTGGGTTGAGTGCCGTAC Amplification of Brap target site of target-F TG sgRNA_A07138 35 A_07138_Brap ATACACATGATCCCACCACTCA Amplification of Brap target site of target-R GG sgRNA_A07138 36 A_26940_Kcnh1 GTGAGTGCTGATGAGATTTTCA Amplification of Kcnh1 target site of target-F AG sgRNA_A26940 37 A_26940_Kcnh1 TCCAAGTGTAACTATGGAATGG Amplification of Kcnh1 target site of target-R TG sgRNA_A26940 38 B_25175_Hyal5 AAGATTGGGAAAGTCACTTCG Amplification of Hyal5 target site of target-F GCC sgRNA_B25175 39 B_25175_Hyal5 GCAAACTTCAAGTCCTAGCAA Amplification of Hyal5 target site of target-R CAG sgRNA_B25175 40 B_21517_Gm4981 TTTGCTCCCCTGTTTCCTCCAC Amplification of Gm4981 target site of target-F AT sgRNA_B21517 41 B_21517_Gm4981 ACAGCTCAAGATCAAGACTTG Amplification of Gm4981 target site of target-R CTG sgRNA_B21517 42 A_02125_AK129341 ACAGTTTCCCCTCTTGCATCTC Amplification of AK129341 target site target-F GT of sgRNA_A02125 43 A_02125_AK129341 GAGACCATGAAAGCAAATACC Amplification of AK129341 target site target-R GAG of sgRNA_A02125 44 A_63598_mmu-mir- TATGGGGTGGAGGAGAACTGT Amplification of mmu-mir-99b target 99b target-F GAG site of sgRNA_A63598 45 A_63598_mmu-mir- GCTCCTATCAAGAACTCTTGGG Amplification of mmu-mir-99b target 99b target-R CA site of sgRNA_A63598 46 A_08684_Ccdc87 TGCGCAGGCGCATTGATGCAG Amplification of Ccdc87 target site of target-F TTT sgRNA_A08684 47 A_08684_Ccdc87 GATAGACATCAGGACTGGTGA Amplification of Ccdc87 target site of target-R GGA sgRNA_A08684 48 B_34017_Ninj2 TTCATTTCTTCCTGATCGGTCTC Amplification of Ninj2 target site of target-F C sgRNA_B34017 49 B_34017_Ninj2 ATAACCTAGCATTCAAGGTGCA Amplification of Ninj2 target site of target-R GA sgRNA_B34017 50 A_30543_Mbd6 AACTCACCAGGAGAAGAGTGT Amplification of Mbd6 target site of target-F GAG sgRNA_A30543 51 A_30543_Mbd6 TGCTGTGTACTATATCAGGTATG Amplification of Mbd6 target site of target-R GC sgRNA_A30543 52 B_01105_4430402I18Rik AGGAGCGTTCTAGGACATCAT Amplification of 4430402I18Rik target target-F GTG site of sgRNA_B01105 53 B_01105_4430402I18Rik CTGACATAAGCAACCTCAGGA Amplification of 4430402I18Rik target target-R ATG site of sgRNA_B01105 54 B_53696_Thbs2 AACACTGAGACAGCTCAGTTC Amplification of Thbs2 target site of target-F CCA sgRNA_B53696 55 B_53696_Thbs2 TGAGCTCCGCAGTACAGTCTTT Amplification of Thbs2 target site of target-R GT sgRNA_B53696 56 A_28398_Lama5 TAGGTAGATGAGGACAGACAG Amplification of Lama5 target site of target-F ACA sgRNA_A28398 57 A_28398_Lama5 TGCAGCCTCCAAGAGGGATTG Amplification of Lama5 target site of target-R TTT sgRNA_A28398 58 B_19120_Fxyd4 CTTACCATAGTAGAAGGGACTG Amplification of Fxyd4 target site of target-F TC sgRNA_B19120 59 B_19120_Fxyd4 ATCTGGTAGGCCTAGGATCAGG Amplification of Fxyd4 target site of target-R GT sgRNA_B19120 60 A_36051_Olfr1239 AAGAGTGACTCCCTTTCTTAGT Amplification of Olfr1239 target site of target-F GC sgRNA_A36051 61 A_36051_Olfr1239 TATAACCTTCCTTTCTGTGGTC Amplification of Olfr1239 target site of target-R CT sgRNA_A36051 62 A_45045_Reep5 TGCATGGAGATTAACCTGGGTC Amplification of Reep5 target site of target-F AA sgRNA_A45045 63 A_45045_Reep5 AACCAGCAGCAACAAGAAAC Amplification of Reep5 target site of target-R ACCC sgRNA_A45045 64 B_10774_Clec5a ATCAGCTATCTCAGGTATCTCA Amplification of Clec5a target site of target-F GG sgRNA_B10774 65 B_10774_Clec5a TTCCTGATTCGCAGAACCAGA Amplification of Clec5a target site of target-R CCA sgRNA_B10774 66 A_63693_mmu-mir- AGGGGATAGAACTTATGTGGA Amplification of mmu-mir-6970 target 6970 target-F GGT site of sgRNA_A63693 67 A_63693_mmu-mir- TGAATTGGTGGGATCAGAAGT Amplification of mmu-mir-6970 target 6970 target-R GGA site of sgRNA_A63693 68 B_21757_Gm5941 ATGGTAGGCACCTGGAAGTTC Amplification of Gm5941 target site of target-F AAC sgRNA_B21757 69 B_21757_Gm5941 ATCTCCCTCAACCAGAGTGATC Amplification of Gm5941 target site of target-R TC sgRNA_B21757 70 A_36065_Olfr1243 TCCAGCTACCAGCAACAGAAG Amplification of Olfr1243 target site of target-F AAT sgRNA_A36065 71 A_36065_Olfr1243 CCAAGGAAGAGTAGACATCAA Amplification of Olfr1243 target site of target-R CCT sgRNA_A36065 72 B_17813_Fastkd5 ACGAGTGCCCTTCAGAGAGCA Amplification of Fastkd5 target site of target-F GAG sgRNA_B17813 73 B_17813_Fastkd5 TGACTTAGAGGTTCAGCTTGAT Amplification of Fastkd5 target site of target-R GC sgRNA_B17813 74 B_09614_Cdkn2b TACTAAATCTCCTTGGTGATCC Amplification of Cdkn2b target site of target-F CC sgRNA_B09614 75 B_09614_Cdkn2b TTTCTTATTGCTTCACCTGTGG Amplification of Cdkn2b target site of target-R AG sgRNA_B09614 76 B_41633_Pml AGGACCTTGGTGTCTCTTTAGG Amplification of Pml target site of target-F AC sgRNA_B41633 77 B_41633_Pml CCGGATCTTTCCTTGTTCTGCT Amplification of Pml target site of target-R AA sgRNA_B41633 78 A_53331_Tecr AGAGGCAACAAGCCGATGAGG Amplification of Tecr target site of target-F GAA sgRNA_A53331 79 A_53331_Tecr TAGCTTGTTCCTGACCTGCCTG Amplification of Tecr target site of target-R TA sgRNA_A53331 80 A_35899_Olfr1181 AGGTTGAAAGAGCTTTGCGTC Amplification of Olfr1181 target site of target-F TCC sgRNA_A35899 81 A_35899_Olfr1181 GATGCAGTTCTCTGTTCAACCA Amplification of Olfr1181 target site of target-R AC sgRNA_A35899 82 A_55795_Trim36 AGTAACCTATATGTAGTCCCAT Amplification of Trim36 target site of target-F CC sgRNA_A55795 83 A_55795_Trim36 TGACCCTGTGTTGGTTTTCATC Amplification of Trim36 target site of target-R CT sgRNA_A55795 84 B_22324_Golga7 AACAGTCCAGAGACCCAGACA Amplification of Golga7 target site of target-F1 ATG sgRNA_B22324 85 B_22324_Golga7 TGTACAGCTGATAACTGTGTCC Amplification of Golga7 target site of target-R1 TG sgRNA_B22324 86 B_22324_Golga7 ATTGGGAGACAAAGTGGATGC Amplification of Golga7 target site of target-F2 TGA sgRNA_B22324 87 B_22324_Golga7 TGTTCATTAAGACTACAGCAGT Amplification of Golga7 target site of target-R2 GG sgRNA_B22324 88 B_55404_Tpd52 AAGAAGTCAGGCAAGCACTTC Amplification of Tpd52 target site of target-F AGG sgRNA_B55404 89 B_55404_Tpd52 AACACTTGAGTTTTGCCAGCC Amplification of Tpd52 target site of target-R CCA sgRNA_B55404 90 B_41976_Pon2 TGGAGAAACCCAGAGACCTTT Amplification of Pon2 target site of Target-F ATC sgRNA_B41976 91 B_41976_Pon2 ACCCACAATTCAAGAGTACAG Amplification of Pon2 target site of Target-R TGG sgRNA_B41976 92 A_53332_Tecr AGAGGCAACAAGCCGATGAGG Amplification of Tecr target site of target-F GAA sgRNA_A53332 93 A_53332_Tecr TAGCTTGTTCCTGACCTGCCTG Amplification of Tecr target site of target-R TA sgRNA_A53332 94 A_47925_Serpinb9c TGAGGGACTTAAAAGTCTTTC Amplification of Serpinb9c target target-R ACC site of sgRNA_A47925 95 B_44752_Rbm15 CGAATGGTGCCAAATCGGTCA Amplification of Rbm15 target site of target-F AA sgRNA_B44752 96 B_44752_Rbm15 TGCTGCTCTGGGATACAGAGA Amplification of Rbm15 target site of target-R CTA sgRNA_B44752 97 A_12850_Cyp2g1 TTTCCAAACCAGGTTGCAGTTT Amplification of Gyp2g1 target site of target-F GG sgRNA_A12850 98 A_12850_Cyp2g1 AAGGCCAGCCTGAGCTACACA Amplification of Gyp2g1 target site of target-R AAG sgRNA_A12850 99 A_39356_Paip2b ATAAGCCTCTGGCTGCTAAGGC Amplification of Paip2b target site of target-F CT sgRNA_A39356 100 A_39356_Paip2b TGGGGAACAAGGTTTACATAG Amplification of Paip2b target site of target-R CAT sgRNA_A39356 101 B_23557_H2-Q2 ACAGATCACTTCAAGTGTCCTG Amplification of H2-Q2 target site of target-F CT sgRNA_B23557 102 B_23557_H2-Q2 CATGTTCCACATGGCATGTGTA Amplification of H2-Q2 target site of target-R TC sgRNA_B23557 103 B_16359_Epm2aip1 AAATCTCCAGCCAATAGGAAC Amplification of Epm2aip1 target target-F GGA site of sgRNA_B16359 104 B_16359_Epm2aip1 TGCACTGGTGTACGAAGTCAC Amplification of Epm2aip1 target target-R CCT site of sgRNA_B16359 105 B_19898_Gif ATTACCTCTGAGCTGTACCACT Amplification of Gif target site of target-F CA sgRNA_B19898 106 B_19898_Gif TGAAGTGTCATCAGAGGTAGC Amplification of Gif target site of target-R TCT sgRNA_B19898 107 B_31702_Morn1 AACTCACTTTGTAGACCAGGC Amplification of Morn1 target site of target-F TGG sgRNA_B31702 108 A_09612_Cdkn2b AGTGTTGGCTTCTTTCTATGAC Amplification of Cdkn2b target site of target-F TG sgRNA_A09612 109 A_09612_Cdkn2b TGCAGAACGCTGCAGCTCAGT Amplification of Cdkn2b target site of target-R GCC sgRNA_A09612 110 A_19126_Fxyd4 AGCCAAAGATCCGTACCACTT Amplification of Fxyd4 target site of target-F GGC sgRNA_A19126 ill A_19126_Fxyd4 TTCTGAATGAATGTGTGAGGGT Amplification of Fxyd4 target site of target-R AC sgRNA_A19126 112 B_31702_Morn1 ACAGACAGACAAACATACATA Amplification of Morn1 target site of target-R CAG sgRNA_B31702 113 B_44494_Rap1gap2 ACCTGAGGTCTCCACTAGCCT Amplification of Rap1gap2 target target-F GAT site of sgRNA_B44494 114 B_44494_Rap1gap2 TGTTCCAGGTCACCAGTCTAG Amplification of Rap1gap2 target target-R GAAG site of sgRNA_B44494 115 B_57494_Usp14 ATGCCACTCATCCAAAAGTCA Amplification of Usp14 target site of target-F ACC sgRNA_B57494 116 B_57494_Usp14 TTTTGGCCAGGTGAATTGATAG Amplification of Usp14 target site of target-R GC sgRNA_B57494 117 A_33521_Ndufa11 AATAAGACCTCGGTACAAACC Amplification of Ndufa11 target site of target-F TGC sgRNA_A33521 118 A_33521_Ndufa11 TTCAAAAACTCCGATGACCCG Amplification of Ndufa11 target site of target-R ATC sgRNA_A33521 119 A_46638_Rspry1 GTCCACTTTAGGACTATGAACA Amplification of Rspry1 target site of target-F GC sgRNA_A46638 120 A_46638_Rspry1 TTTACCCCCTCCGTGTTATGTG Amplification of Rspry1 target site of target-R TC sgRNA_A46638 121 A_57601_Usp38 ATGTCTGACACTGAAGCAGAA Amplification of Usp38 target site of target-F CTG sgRNA_A57601 122 A_57601_Usp38 AGCTTGCCAATTGAACAGTGTA Amplification of Usp38 target site of target-R TG sgRNA_A57601 123 B_06455_Baat TACTCTCCTTCCTTGCCAGATA Amplification of Baat target site of target-F AG sgRNA_B06455 124 B_06455_Baat TCTACCCACCTGTACCCAGTAA Amplification of Baat target site of target-R TG sgRNA_B06455 125 A_18990_Fsd11 CATGAGAACTATTGGGTTGTGT Amplification of Fsd11 target site of target-F GG sgRNA_A18990 126 A_18990_Fsd11 AACTGCATCCCAGCAGGGTAC Amplification of Fsd11 target site of target-R AT sgRNA_A18990 127 B_54358_Tmem151a TCCACTTAAGCTTCGGAAGAC Amplification of Tmem151a target site target-F CCC of sgRNA_B54358 128 B_54358_Tmem151a AAGTGCTTCAGCTTTGGGAGT Amplification of Tmem151a target site target-R GCT of sgRNA_B54358 129 A_58447_Vmn1r63 ATGTACTGAGGACACAGGTGG Amplification of Vmn1r63 target site target-F AG of sgRNA_A58447 130 A_58447_Vmn1r63 GTTGATATTCTGGATCAATGTC Amplification of Vmn1r63 target site target-R C of sgRNA_A58447 131 A_29995_Mael AGAGTTTTGGGCTGCAAGTCC Amplification of Mael target site of target-F AGC sgRNA_A29995 132 A_29995_Mael TAGCTATAGAAGTTGTTTGCCA Amplification of Mael target site of target-R TG sgRNA_A29995 133 B_49633_Slc6a14 TGTACTCTGCAGACACCTGCTT Amplification of Slc6a14 target site of target-F TC sgRNA_B49633 134 B_49633_Slc6a14 GTACTTCTCATTGTGGCCTTGA Amplification of Slc6a14 target site of target-R TC sgRNA_B49633 135 B_47599_Sel1l2 GATGAACAAGATCAGCATCTAT Amplification of Sel1l2 target site of target-F AC sgRNA_B47599 136 B_47599_Sel1l2 CACAGTGTCACCACAATGTTTC Amplification of Sel1l2 target site of target-R C sgRNA_B47599 137 A_44928_Rcbtb2 ACGAGGCAGTTTGCTTTAGGA Amplification of Rcbtb2 target site of target-F AGG sgRNA_A44928 138 A_44928_Rcbtb2 TGTCACGCAATGATTCCACTCT Amplification of Rcbtb2 target site of target-R GA sgRNA_A44928 139 B_15909_Elane TGACCTCTGGTCCATCTCTTTC Amplification of Elane target site of target-F AT sgRNA_B15909 140 B_15909_Elane AGCACTACCTGCACTGACCGG Amplification of Elane target site of target-R AAA sgRNA_B15909 141 B_01812_9130204L05Rik AGACTTCAGAAGCATGGAGAG Amplification of 9130204L05Rik target target-F CAC site of sgRNA_B01812 142 B_01812_9130204L05Rik CTGCAAAACAGAGTCCTAGCT Amplification of 9130204L05Rik target target-R CTG site of sgRNA_B01812 143 A_60072_Zbtb37 TGGCCCAAGCCACTCTTCTAGA Amplification of Zbtb37 target site of target-F TT sgRNA_A60072 144 A_60072_Zbtb37 TATTTCCGGGATCACATGTCCT Amplification of Zbtb37 target site of target-R TG sgRNA_A60072 145 A_28484_Larp6 TGTCCCCTTGGTTTCTATACCTA Amplification of Larp6 target site of target-F C sgRNA_A28484 146 A_28484_Larp6 AATTTGCTAGGCAGGCAGCCTA Amplification of Larp6 target site of target-R TG sgRNA_A28484 147 xcl801- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F gagcgaggcgTGAAAGTATTTCGAT sequencing TTCTTGG 148 xcl802- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R gagcgaggcgGTTGATAACGGACTA sequencing GCCTTATT 149 xcl803- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F ctatggtggcTGAAAGTATTTCGATT sequencing TCTTGG 150 xcl804- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R ctatggtggcGTTGATAACGGACTA sequencing GCCTTATT 151 xcl805- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F atgccagtttTGAAAGTATTTCGATT sequencing TCTTGG 152 xcl806- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R atgccagtttGTTGATAACGGACTAG sequencing CCTTATT 153 xcl807- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F gcgcccgacaTGAAAGTATTTCGAT sequencing TTCTTGG 154 xcl808- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R gcgcccgacaGTTGATAACGGACTA sequencing GCCTTATT 155 xcl817- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F tgatccgtagTGAAAGTATTTCGATT sequencing TCTTGG 156 xcl818- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R tgatccgtagGTTGATAACGGACTA sequencing GCCTTATT 157 xcl819- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F aaggtgccctTGAAAGTATTTCGATT sequencing TCTTGG 158 xcl820- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R aaggtgccctGTTGATAACGGACTA sequencing GCCTTATT 159 xcl827- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F ggggttgcatTGAAAGTATTTCGATT sequencing TCTTGG 160 xcl828- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R ggggttgcatGTTGATAACGGACTA sequencing GCCTTATT 161 xcl829- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F tttgaccgcgTGAAAGTATTTCGATT sequencing TCTTGG 162 xcl830- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R tttgaccgcgGTTGATAACGGACTA sequencing GCCTTATT 163 xcl831- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F cgtgagtctaTGAAAGTATTTCGATT sequencing TCTTGG 164 xcl832- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R cgtgagtctaGTTGATAACGGACTA sequencing GCCTTATT 165 xcl833- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-F gggtgaaagcTGAAAGTATTTCGAT sequencing TTCTTGG 166 xcl834- gtttctatca Amplification of sgRNA regions for CRScloneDeSeq-R gggtgaaagcGTTGATAACGGACTA sequencing GCCTTATT 167 A_56035_Trp53 ATTCTGCCAGCTGGCGAAGAC Amplification of Trp53 target site of target F GTG sgRNA_A56035 168 A_56035_Trp53 ACTCGGGATACAAATTTCCTTC Amplification of Trp53 target site of target R CA sgRNA_A56035 169 A_24528_Hmox2 TGAGTCTTCTTAGTTTAGGGAT Amplification of Hmox2 target site of target F GG sgRNA_A24528 170 A_24528_Hmox2 CAGTTGCTGCCTCCTAGTGTAC Amplification of Hmox2 target site of target R CT sgRNA_A24528 171 B_30072_Magel2 AGCTGACACCGGGAGTCCTGA Amplification of Magel2 target site of target F TGG sgRNA_B30072 172 B_30072_Magel2 TTGTAGGATCAAAGGCTGACC Amplification of Magel2 target site of target R CTG sgRNA_B30072 173 A_38994_Osbpl11 AAGGAAAGTAGTGCTAGCCTT Amplification of Osbpl11 target site of target F TGC sgRNA_A38994 174 A_38994_Osbpl11 AATCACTCTACCTCCCTGGCTC Amplification of Osbpl11 target site of target R TA sgRNA_A38994 175 A_22974_Grik3 ACCAATGCTGTCCAGTCCATTT Amplification of Grik3 target site of target F GC sgRNA_A22974 176 A_22974_Grik3 TAGGCAAGCAGACAACACTAA Amplification of Grik3 target site of target R TGT sgRNA_A22974 177 A_47925_Serpinb9c TCTTCTCAGGCTGAGAGTCAAT Amplification of Serpinb9c target target-F CC site of sgRNA_A47925
Example 2: Test of PB-CRISPR Vectors in Mouse iPS Cells
[0093] Mouse iPS cell line (iPS-ZX11-18-2) used was described previously (Wu, S., Wu, Y, Zhang, X. & Capecchi, M. R. Proc. Natl. Acad. Sci. 111, 10678-10683 (2014)). iPS cells were cultured in embryonic stem cell medium composed of DMEM (Gibco), 15% FBS (Gibco), 1×Penicillin and Streptomycin (Gibco) and 1000 U/mL LIF (Millipore). One million cells were electroporated with 1.5 μg pCRISPR-S10 that expresses Cas9 nuclease, 1.5 μg pCRISPR-sg6-Tet1/Tet2 and 1 μg pCAG-PBase. After electroporation, 1,000 cells were placed in a 10 cm dish. After 10 days, individual clones were picked for further culture and analysis. For PCR-RFLP assay, ˜500 bp DNA fragments around gRNA target sites were amplified using primers as previously published (Wang, H. Y. et al. Cell 153, 910-918 (2013)) from genomic DNA of iPS cells (Table 1), subjected to restriction endonuclease digestion and resolved on a 2% agarose gel. The result validated PB vector-mediated CRISPR mutagenesis by successfully targeting mouse Tet1 and Tet2 in cultured cells (
Example 3: Library Construction
[0094] To construct the PB-CRISPR-M1 library, we synthesized oligos according to the genome-wide gRNA list (Shalem, O. et al. Science 343, 84-87 (2014)), amplified sgRNA with primer pair xc1732/xc1733, and cloned them into pCRISPR-sg6 at the BbsI site with the Gibson Assembly method (NEB). We amplified the sgRNA expression cassettes in the GeCKOv2 genome-scale mouse CRISPR/Cas9 knockout library (Sanjana, N. E., Shalem, O. & Zhang, F. Nat. Methods 11, 783-784 (2014)) including 130,209 synthesized sgRNA oligonucleotides targeting all mouse protein coding genes and miRNAs, and cloned into pCRISPR-sg6 to obtain the PB-CRISPR-M2 library (
[0095] To construct the PB-CRISPR-M2 library, we PCR amplified the U6-sgRNA cassettes from the GeCKOv2 mouse library (Sanjana, N. E., Shalem, O. & Zhang, F. Nat. Methods 11, 783-784 (2014)) and cloned them into pCRISPR-sg6.
[0096] For both PB-CRISPR-M1 library and PB-CRISPR-M2 library, 10 individual electroporations of 100 μL DH10B competent cells with 20 μL of ligation products were carried out. Bacterial cells were placed on one hundred 15 cm dishes to obtain about 10.sup.7 recombinants about 80-fold coverage of genome-wide gRNAs was obtained for PB-CRISPR M1 library, and about 10-fold coverage of genome-wide gRNAs was obtained for PB-CRISPR M2 library. Bacteria were harvested for maxi-preparation of PB-CRISPR libraries with the Endo-free Plasmid Maxi kit (Qiagen).
[0097] The integrity of this PB-CRISPR library was confirmed by deep sequencing, with 95% sgRNAs from the GeCKOv2 mouse library having representation in the PB-CRISPR-M2 library (
[0098] We also constructed a PB sgRNA library by cloning 130,209 synthesized sgRNA oligonucleotides into pCRISPR-sg6, resulting in the PB-CRISPR-M1 library. Due to simplicity of cloning, genome-wide PB-CRISPR libraries can be constructed rapidly, from synthesis of oligonucleotides to ready-for-use libraries in a week.
Example 4: Deep Sequencing and Bioinformatics Analysis
[0099] Deep sequencing was used to profile the PB-CRISPR-M2 and GeCKOv2 libraries. After sequencing, we compared normalized read counts of gRNA between the two libraries and calculated Spearman correlation efficiency to measure their similarity (r.sup.2=0.83, P<0.001).
[0100] To identify sgRNA contents in tumors, —100 bp DNA fragments spanning the 20 nt gRNA region of PB library were PCR amplified from tumor genomic DNA or the library control. Sequencing libraries were constructed with these PCR products following standard protocols for the Illumina HiSeq2500. Individual libraries from different samples were barcoded and pooled. Sequences of ˜100 bp were demultiplexed from raw data and trimmed into 28 nt gRNA sequences containing sgRNA sequences, which were mapped against index libraries made from the GeCKOv2 library. Fully mapped reads were used to generate gRNA reads list.
[0101] To detect mutations in sgRNA target sites, we amplified ˜300 bp DNA including gRNA sequence in the center and performed NGS by Hiseq2500 following standard protocol. BWA aligner was used to map deep sequence data to the mouse genome (mm9) (Li, H. & Durbin, R. Bioinformatics 25, 1754-1760 (2009)). The bam files generated from BWA aligner were sorted and indexed by samtools (Li, H. et al. Bioinformatics 25, 2078-2079 (2009)). Mutation variants were called by VarScan.v2.3.9 (Koboldt, D. C. et al. Genome Res. 22, 568-576 (2012)).
Example 5: Generation of Animal Model
[0102] All mouse experiments in this study were approved by the institutional animal care and use committees at China Agricultural University. CD-1 mice of 4 weeks old from Charles River were selected for hydrodynamic tail vein injection of PB-CRISPR library. It was shown that rapid injection of a large volume of DNA solution (˜10% of body weight) via mouse tail vein can achieve efficient gene transfer and expression in vivo, preferentially in the liver (Liu F, Song Y, & Liu D. Gene Ther 6(7), 1258-1266 (1999)). We followed a previously described injection protocol (Sanchez-Rivera, F. J. et al. Nature 516, 428-431 (2014)). The number of animals for screening and validation is derived from experience and confirmed with power analysis using data from prior, similar type studies (Chen, S. D. et al. Cell 160, 1246-1260 (2015); Sanchez-Rivera, F. J. et al. Nature 516, 428-431 (2014)). Mice were randomly allocated into different experimental groups. All mice injected were included for analysis. The investigators who assessing mice for tumorigenesis were blinded without knowing whether the animal was from control or experiment.
[0103] To evaluate the efficiency of delivery into mouse liver, we performed high pressure tail vein injection of the PB-CRISPR-M2 library, and pPB-IRES-EGFP, with or without PB transposase (PBase) overexpression plasmid pCAG-PBase, and analyzed liver samples at day 14 post injection (
[0104] To examine the in vivo library size after PB mediated delivery, 3 mice were injected with PB-CRISPR-M1 library, pPB-IRES-EGFP, pCAG-PBase at 8 μg each, and 3 Control mice (no pCAG-PBase) were injected with PB-CRISPR-M2 library and pPB-IRES-EGFP at 8 μg each. DNA was mixed in saline at a volume of 10% body weight. Each injection was finished within 10 seconds. Liver tissues (˜300 mg) were collected for genomic DNA extraction at day 14 post injection. sgRNAs were PCR amplified with primers listed in Table 1. The purified PCR products were used for NGS.
[0105] Since liver tumor screens typically require more than a year to obtain tumors (Bard-Chapeau, E. A. et al. Nat. Genet. 46, 24-32 (2014); Keng, V. W. et al. Nat. Biotechnol. 27, 264-274 (2009)), we aimed to find a faster scheme to demonstrate the feasibility of PB-CRISPR library screening in wild type mice. A recent CRISPR validation study showed that Cdkn2a sgRNA and Ras oncogene overexpression, with sgRNAs targeting 9 other TSGs delivered by SB transposon generated tumors, but only at 20-30 weeks after injection (Weber, J. et al. Proc. Natl. Acad. Sci. 112, 13982-13987 (2015)). We performed tail vein injections to test whether Cdkn2a-sgRNA/NRAS.sup.G12V overexpression delivered by PB could be used as a sensitized genetic background. Total RNA was isolated from mouse liver using RNeasy Fibrous Tissue Mini Kit (Qiagen) following the manufacturer's protocol. RNA (2 μg) was reverse transcribed into cDNA using M-MLV reverse transcriptase (Promega). Quantitative RT-PCR was performed on LightCycler 480 (Roche) using LightCycler 480 SYBR Green I Master (Roche) following the program: pre-incubation (95° C., 10 sec), amplification (95° C., 10 sec; 60° C., 10 sec; 72° C., 10 sec) 30 cycles, melting curve (95° C., 5 sec; 65° C., 1 min), cooling (40° C., 10 sec). The primers used to detect the expression of Cas9 and hNRAS.sup.G12V are displayed in Table 1. Gene expression was normalized to the GAPDH. We examined the 21 mice injected at day 61, and no tumors were detected (Table 2), while Cas9 and NRAS.sup.G12V expression could be detected by quantitative real-time RT-PCR (qRT-PCR) in liver samples (
[0106] We next conducted a genome-wide screen for liver tumorigenesis through injection with pCRISPR-W9-Cdkn2a-sgRNA, pPB-hNRAS.sup.G12V, and the PB-CRISPR-M2 library, along with pCAG-PBase (
TABLE-US-00002 TABLE 2 PB-CRISPR library screening for tumorigenesis in mouse livers. pCRISPR-W9- pPB- PB-CRISPR- pCAG- Tumorigenesis Cdkn2a-sgRNA hNRAS.sup.G12V M2 library PBase efficiency (%) Control 12 μg 12 μg — 8 μg 0/21 (♂, 0%) Screen 8 μg 8 μg 8 μg 8 μg 9/27 (♂, 33.3%) Note: In addition to the 27 male mice in the screening group, we also performed screening with 20 female mice that were not included in the table. No tumor induction was observed in the 20 female mice at day 61. It is known that male mice are many fold more likely to develop liver tumors than female mice (Naugler, W.E. et al. Science 317, 121-124 (2007)).
Example 6: Hydrodynamic Tail Vein Injection of PB-CRISPR Library and Detection of Tumors
[0107] To examine the in vivo library size after PB mediated delivery, 3 mice were injected with PB-CRISPR-M1 library, pPB-IRES-EGFP, pCAG-PBase at 8 μg each, and 3 Control mice (no pCAG-PBase) were injected with PB-CRISPR-M2 library and pPB-IRES-EGFP at 8 μg each. DNA was mixed in saline at a volume of 10% body weight. Each injection was finished within 10 seconds. Liver tissues (˜300 mg) were collected for genomic DNA extraction at day 14 post injection. sgRNAs were PCR amplified with primers listed in Table 1. The purified PCR products were used for NGS. Deep sequencing was used to profile the PB-CRISPR-M2 and GeCKOv2 libraries. After sequencing, we compared normalized read counts of gRNA between the two libraries and calculated Spearman correlation efficiency to measure their similarity (r.sup.2=0.83, P<0.001).
[0108] For in vivo screening, each mouse was injected with pCRISPR-W9-Cdkn2a-sgRNA, pPB-hNRAS.sup.G12V, PB-CRISPR-M2 library and pCAG-PBase at 8 μg each in saline at a volume of 10% body weight. Control groups were injected with plasmids according to Table 2.
[0109] For validation experiments, each mouse was injected with corresponding PB-sgRNA, pCRISPR-W9-Cdkn2a-sgRNA (or pCRISPR-W9), pPB-hNRAS.sup.G12V, and pCAG-PBase at 8 μg each in saline at a volume of 10% body weight. On the day the first mouse in a group died, all mice in the same group were examined. If no mice died in a validation group, all mice were examined at day 45 post injection. For the control group, mice were examined at day 61 post injection.
[0110] Tumors were fixed in 4% formalin in PBS at 4° C. overnight, paraffin embedded, sectioned at 5 μm and stained with hematoxylin and eosin (H&E) for pathology. The following antibodies were used for immunostaining: Anti-Actin, a-Smooth Muscle antibody, Mouse monoclonal clone 1A4 (Sigma, A5228); Monoclonal anti-vimentin clone LN-6 (Sigma, V2258); Anti-Collagen Type IV Antibody (EMD Millipore Corporation, AB8201); Anti-alpha 1 Fetoprotein antibody (Abcam, ab46799); Purified Mouse Anti-Ki-67 (BD, 550609); Anti-Cytokeratin AE1/AE3 antibody (Abcam, ab115963). The pathologists reading the slides were blinded.
[0111] Histological analysis by hematoxylin and eosin (H&E) staining and immunohistochemistry showed that most tumors analyzed were intrahepaticcholangiocarcinoma (ICC) (
Example 7: Sequencing and Identification of sgRNA Contents in Tumor
[0112] To identify sgRNA contents in tumors, —100 bp DNA fragments spanning the 20 nt gRNA region of PB library were PCR amplified from tumor genomic DNA or the library control. Sequencing libraries were constructed with these PCR products following standard protocols for the Illumina HiSeq2500. Individual libraries from different samples were barcoded and pooled. Sequences of ˜100 bp were demultiplexed from raw data and trimmed into 28 nt gRNA sequences containing sgRNA sequences, which were mapped against index libraries made from the GeCKOv2 library. Fully mapped reads were used to generate gRNA reads list.
[0113] To detect mutations in sgRNA target sites, we amplified ˜300 bp DNA including gRNA sequence in the center and performed NGS by Hiseq2500 following standard protocol. BWA aligner was used to map deep sequence data to the mouse genome (mm9) (Li H & Durbin R. Bioinformatics 25(14):1754-1760.(2009)). The bam files generated from BWA aligner were sorted and indexed by samtools (Li H, et al. Bioinformatics 25(16):2078-2079 (2009)). Mutation variants were called by VarScan.v2.3.9 (Koboldt D C, et al. Genome research 22(3):568-576 (2012)).
[0114] To identify sgRNAs that had inserted into the tumor genome, we selected 18 tumors for further analysis. We used PCR to amplify sgRNAs from each tumor for next generation sequencing (NGS). We generated a list of 1149 TSG orthologs in mouse genome using human TSG as comparative information (http://bioinfo.mc.vanderbilt.edu/TSGene) (Zhao M, Sun J, & Zhao Z Nucleic Acids Res 41 (Database issue):D970-976. (2013)). In the PB-CRISPR libraries, there were 6650 sgRNAs targeting all these mouse TSG orthologs. Out of 271 sgRNAs identified in 18 tumors, 26 sgRNAs targeting 21 mouse TSG orthologs were found to be significantly enriched (P<0.01) by two-sided Fisher's Exact test.
[0115] A total of 271 library sgRNAs was identified, with each tumor containing 15.06±7.64 sgRNAs (Table 3). The differences in counts for sgRNAs within a tumor suggest that some tumors may have a multiclonal origin. Also, the differences in sgRNA content for tumors isolated from one mouse (i.e., Tumor 5-1 to Tumor 5-8) showed they were clonally unrelated. Among the 271 sgRNAs, the prominent TSG Trp53 was targeted twice, and Cdkn2b, a TSG not previously implicated in mouse liver cancers (Krimpenfort P, et al. Nature 448(7156):943-946 (2007)), was targeted in 4 tumors by 3 distinct sgRNAs (Table 4). In total, 26 of the 271 sgRNAs were targeting 21 mouse TSG orthologs. Analysis by Fisher's exact test found these sgRNAs for TSGs were significantly enriched (P<0.01,
TABLE-US-00003 TABLE 3 Sequencing read counts of sgRNA contents in tumors and CRISPR libraries. Tumor 1 reads Tumor 2 reads Non_Lib Cdkn2a sgRNA 178117 Non_Lib Cdkn2a sgRNA 683716 LibA_54001_Tle4 79496 LibA_24528_Hmox2 195420 LibA_36261_Olfrl311 75666 LibB_30072_Magel2 166531 LibB_28812_Lgals7 74390 LibA_38994_Osbpl11 159980 LibA_28412_Lamc2 73428 LibA_56035_Trp53 30905 LibA_56035_Trp53 72553 LibA_22974_Grik3 11746 LibB_27405_Kif5a 41358 LibB_51283_Srms 39028 LibA_07138_Brap 38781 LibA_26940_Kcnh1 37981 LibB_25175_Hyal5 35944 LibB_21517_Gm4981 22964 LibA_02125_AK129341 17831 LibA_63598_mmu-mir-99b 15705 Tumor 3 reads Tumor 4-2 reads Non_Lib Cdkn2a sgRNA 349083 Non_Lib Cdkn2a sgRNA 346022 LibA_08684_Ccdc87 119186 LibA_29995_Mael 203340 LibB_34017_Ninj2 113996 LibB_49633_Slc6a14 187983 LibA_30543_Mbd6 109867 LibB_47599_Sel1l2 173556 LibB_01105_4430402I18Rik 99285 LibA_44928_Rcbtb2 166965 LibB_53696_Thbs2 98008 LibB_15909_Elane 115690 LibA_28398_Lama5 97720 LibB_01812_9130204L05Rik 57159 LibB_19120_Fxyd4 95392 LibA_60072_Zbtb37 56058 LibA_36051_Olfr1239 94355 LibA_28484_Larp6 48306 LibA_45045_Reep5 90491 LibB_10774_Clec5a 87335 LibA_63693_mmu-mir-6970 86327 LibB_21757_Gm5941 53975 LibB_00272_1700010D01Rik 53412 Tumor 5-1 reads Tumor 5-2 reads Non_Lib Cdkn2a sgRNA 519570 Non_Lib Cdkn2a sgRNA 159353 LibA_36065_Olfr1243 113721 LibA_45974_Rnf41 66438 LibA_60658_Zfp35 60292 LibB_00914_2610008E11Rik 58889 LibB_17813_Fastkd5 59459 LibB_40856_Piga 57336 LibB_09614_Cdkn2b 57848 LibA_23193_Gstm6 55389 LibB_41633_Pml 57456 LibB_07516_C2cd5 35674 LibA_53331_Tecr 56282 LibB_15677_Egln2 29171 LibA_35899_Olfr1181 52368 LibB_56234_Tspan32 28000 LibA_55795_Trim36 49251 LibA_54542_Tmem204 27549 LibB_22324_Golga7 23205 LibA_48907_Slc22a13 21054 LibB_35753_Olfr1124 19699 LibB_41670_Pnldc1 19393 LibB_51847_Stpg1 19052 LibA_24448_Hmbs 18900 LibB_05253_Arpc2 18719 LibA_43603_Ptgdr 18545 LibB_25109_Htr2c 18487 LibB_16894_F11r 18259 LibA_12548_Cxcl12 17780 LibB_45181_Rffl 17726 LibA_41775_Podnl1 17588 LibB_11689_Cplx2 16962 LibB_47900_Serpinb7 16538 LibA_60429_Zfp119b 16101 LibA_33403_Nckap1 16081 LibA_29313_Lrig1 15791 LibA_65968_mmu-mir-190a 15125 Tumor 5-3 reads Tumor 5-4 reads Non_Lib Cdkn2a sgRNA 437562 Non_Lib Cdkn2a sgRNA 420576 LibB_39752_Pcdha7 74428 LibB_39516_Parm1 149148 LibA_25389_Ifitm10 59669 LibA_05076_Arid3a 51927 LibA_61878_mmu-mir-6899 55426 LibA_14919_Drosha 41430 LibA_52111_Sun5 53318 LibA_01192_4930402H24Rik 39138 LibB_08039_Card10 46197 LibB_54964_Tmprss11g 38160 LibB_40945_Pik3ca 45558 LibA_64958_mmu-mir-7024 26097 LibA_34695_Nr3c2 43931 LibB_26738_Kalrn 41919 LibA_06560_Batf2 41821 LibB_49468_Slc3a2 41319 LibB_17831_Fat4 40673 LibB_01544_4933406M09Rik 39333 LibB_56849_Ubash3b 37997 LibA_24184_Hip1 37410 LibB_15961_Ell 36507 LibB_02143_AU022252 36309 LibB_09073_Cd226 36151 LibA_66012_mmu-mir-7088 35294 LibA_01258_4930444P10Rik 35078 LibB_38229_Olfr749 34955 LibA_30114_Mal2 34779 LibB_40238_Pdlim4 34671 LibB_34799_Nrtn 34388 LibB_23705_Hars2 32513 LibB_22105_Gm9 30709 LibA_63598_mmu-mir-99b 25488 LibB_20082_Gli2 23750 LibB_44971_Rdh12 20585 LibB_00946_2610507B11Rik 18384 Tumor 5_5 reads Tumor 5-6 reads Non_Lib Cdkn2a sgRNA 344749 Non_Lib Cdkn2a sgRNA 256253 LibA_60936_Zfp58 81510 LibB_55404_Tpd52 172586 LibB_52439_Syvn1 55188 LibB_41976_Pon2 168052 LibA_19117_Fxyd1 55131 LibA_53332_Tecr 76909 LibB_51502_Ssxb2 52977 LibA_47925_Serpinb9c 60232 LibB_58325_Vmn1r32 51702 LibB_44752_Rbm15 57035 LibB_23010_Grk1 49789 LibA_12850_Cyp2g1 52435 LibA_29632_Lsg1 44093 LibA_39356_Paip2b 42966 LibB_56483_Ttll11 29847 LibB_23557_H2-Q2 28699 LibA_26034_Inhbb 29357 LibB_16359_Epm2aip1 18351 LibB_42928_Prodh2 29097 LibB_49525_Slc46a3 28516 LibB_52503_Tab3 28091 LibB_38405_Olfr825 27805 LibB_10173_Chd8 26702 LibB_35565_Olfr1040 26572 LibA_18146_Fcgrt 25848 LibB_55502_Tra2a 25796 LibA_17421_Fam207a 25523 LibB_44549_Rarres2 24875 LibB_13009_Cypt3 20325 Tumor 5-7, Xcl803_804 reads Tumor 5-8 reads Non_Lib Cdkn2a sgRNA 557730 Non_Lib Cdkn2a sgRNA 720448 LibB_19898_Gif 394377 LibB_49455_Slc39a7 898551 LibB_31702_Morn1 380768 LibB_53909_Timp3 680480 LibA_09612_Cdkn2b 379473 LibB_40853_Pifo 631964 LibA_19126_Fxyd4 360222 LibB_10374_Chst10 549417 LibB_44494_Rap1gap2 192583 LibB_60451_Zfp169 438788 LibB_57494_Usp14 160978 LibA_19159_Fzd3 413102 LibA_33521_Ndufa11 156299 LibA_16349_Ephb4 346490 LibA_46638_Rspry1 154153 LibA_35927_Olfr1195 335671 LibA_57601_Usp38 153594 LibB_32542_Mtrf1 296276 LibB_06455_Baat 151006 LibB_23312_Gtpbp6 278908 LibA_18990_Fsd1l 150912 LibB_22204_Gnb1l 241183 LibB_54358_Tmem151a 103753 LibA_14192_Diras1 183056 LibA_58144_Vmn1r187 87832 LibA_04825_Arcn1 156153 LibA_58447_Vmn1r63 86398 LibA_36096_Olfr1253 138404 LibB_16547_Ero1l 132065 LibA_36078_Olfr1248 62184 Tumor 5-9 reads Tumor 6-1 reads Non_Lib Cdkn2a sgRNA 264447 Non_Lib Cdkn2a sgRNA 368121 LibA_57366_Uox 73405 LibA_17464_Fam216a 113770 LibB_26396_Ism1 73241 LibA_45041_Reep3 80199 LibB_29348_Lrp4 72812 LibB_34463_Noxa1 79634 LibB_34951_Ntsr2 68839 LibA_51486_Sstr4 72958 LibA_10483_Cirbp 68255 LibB_59988_Zbed4 66525 LibB_53715_Them6 66741 LibA_21983_Gm8267 58878 LibB_35552_Olfr1036 65267 LibA_33671_Necap2 55764 LibB_18821_Foxn4 65121 LibA_62608_mmu-mir-7675 54543 LibA_59865_Ybey 64282 LibB_03015_Adamdec1 46663 LibB_18541_Flg2 39408 LibA_41372_Plcxd3 45851 LibA_65134_mmu-mir-7038 37737 LibB_19470_Gart 41490 LibA_08613_Ccdc66 36439 LibB_27554_Klhdc8a 37507 LibA_34733_Nrbp2 36428 LibB_14309_Dlx5 35096 LibB_14892_Drd2 35058 LibA_08107_Casp1 34261 LibB_01710_6330403K07Rik 35054 LibA_02512_Acaa1a 33977 LibA_65124_mmu-mir-106b 35046 LibB_05210_Armc7 32057 LibA_09613_Cdkn2b 34893 LibA_12624_Cyb561d2 32043 LibA_55631_Trappc6b 34466 LibB_57704_Uvssa 31753 LibA_31165_Mfsd3 34265 LibA_53129_Tcf23 28339 LibB_14205_Disp1 34190 LibB_23798_Hbs1l 33917 LibA_48501_Sike1 33618 LibA_48721_Slc11a2 33487 LibA_32679_Mup4 33401 LibA_30517_Mb21d2 33289 LibB_44971_Rdh12 33019 LibA_24829_Hrasls 32972 LibA_38972_Orm3 31859 LibB_52238_Sybu 30887 Tumor 6-2 reads Tumor 6-3 reads Non_Lib Cdkn2a sgRNA 294384 Non_Lib Cdkn2a sgRNA 315812 LibA_18221_Fer1l5 74571 LibB_01749_7420426K07Rik 139127 LibB_41378_Pld5 56460 LibB_02162_AW209491 69609 LibA_38419_Olfr827 52438 LibA_10308_Chrd 69515 LibA_45229_Rfx2 31383 LibB_07911_Cap1 65520 LibB_52314_Syne3 30058 LibB_50056_Smg5 65089 LibB_23042_Grm7 29876 LibA_30721_Mcts2 28533 LibB_09614_Cdkn2b 28296 LibB_46980_Sap25 27609 LibA_27300_Khdrbs1 27222 LibB_08605_Ccdc64b 26685 LibA_06409_BC061194 26671 LibB_04082_Anapc11 26327 LibA_06437_BC100451 26274 LibA_19051_Fubp3 26248 LibB_36191_Olfr1289 26175 LibB_10820_Clk2 26098 LibB_40967_Pik3r3 25565 LibB_54803_Tmem5 25068 LibA_49111_Slc25a43 24707 Tumor 7 reads Tumor 8 reads Non_Lib Cdkn2a sgRNA 134486 Non_Lib Cdkn2a sgRNA 276203 LibB_36840_Olfr180 70029 LibA_43296_Psap 107483 LibA_50088_Smgc 53014 LibA_06193_B4galt1 87066 LibB_39421_Panx1 52724 LibB_06536_Banp 56283 LibA_55968_Trmt1 51603 LibA_18923_Frmd3 30606 LibA_58478_Vmn1r72 47331 LibA_64315_mmu-mir-6998 30573 LibA_08492_Ccdc17 27654 LibB_59778_Xpo7 29207 LibB_59038_Vsig10 27600 LibB_59489_Wfs1 28632 LibA_10807_Clip1 24935 LibA_45157_Rev1 27488 LibB_49250_Slc30a6 22867 LibA_02488_Ablim3 26908 LibA_10210_Chid1 22274 LibB_30520_Mbd3l2 26495 LibA_54751_Tmem39b 22145 LibB_04104_Anapc7 25382 LibB_24840_Hrh2 20682 LibA_46942_Samd14 25292 LibB_27523_Klf6 20677 LibB_13899_Dennd3 16711 LibA_29077_Lmbr1l 20198 LibB_05135_Arl2bp 14325 LibB_32862_Myl12a 20029 LibA_00425_1700025G04Rik 17153 127417 genes in PB-CRISPR-M2
TABLE-US-00004 TABLE 4 Genes that have been targeted twice or more. Gene sgRNA sgRNA sgRNA sgRNA Cdkn2b B_09614_Cdkn2b A_09612_Cdkn2b A_09613_Cdkn2b B_09614_Cdkn2b Tumor 5-1 Tumor 5-7 Tumor 5-9 Tumor 6-2 Fxyd4 B_19120_Fxyd4 A_19126_Fxyd4 Tumor 3 Tumor 5-7 mir-99b A_63598_mmu-mir-99b A_63598_mmu-mir-99b Tumor 1 Tumor 5-3 Rdh12 B_44971_Rdh12 B_44971_Rdh12 Tumor 5-3 Tumor 5-9 Tecr A_53331_Tecr A_53332_Tecr Tumor 5-1 Tumor 5-6 Trp53 A_56035_Trp53 A_56035_Trp53 Tumor 1 Tumor 2
[0116] Since each tumor in our screen contained multiple copy sgRNA insertions, we tested whether large deletions and translocations resulted from targeting by two sgRNAs could have made some contribution to tumorigenesis, as suggested by previous reports (Maddalo D, et al. Nature 516(7531):423-+(2014); Blasco R B, et al. Cell reports 9(4):1219-1227 (2014)) To survey this possibility, we chose 7 tumors: Tumor 1, 2, 3, 4-2, 5-4, 5-6, and 5-7, and performed PCR reactions with all possible combinations of primers (Table 1). However, no translocations and large deletions in 7 tumors were detected. Previous reports suggested that insertional mutagenesis by multiple transposon insertions could contribute to tumorigenesis (Bard-Chapeau E A, et al. Nature genetics 46(1):24-32 (2014); Carlson C M, et al., Proceedings of the National Academy of Sciences of the United States of America 102(47):17059-17064 (2005); Keng V W, et al. 27(3):264-274 (2009); Dupuy A J, et al. Nature 436(7048):221-226 (2005)). However, considering that the control group was injected with the same amount of PB vectors (Table 2) but did not develop any tumor, tumors obtained from the screen should be largely attributed to library-mediated CRISPR mutagenesis. Taken together, these analyses suggest that identified TSGs could be the main reason for the increased tumorigenesis in the screen.
[0117] We next tested sgRNA of the prominent Trp53 to verify whether it would contribute to accelerated tumor formation in our PB delivery system. In the Trp53 group with Cdkn2a-sgRNA, all mice were examined at day 21 post injection, when the first mouse in this group died of tumors (
TABLE-US-00005 TABLE 5 Validated TSGs in liver tumorigenesis. pCRISPR-W9- pPB- pCAG- Tumorigenesis sgRNA_target gene pCRISPR-W9 Cdkn2a-sgRNA hNRAS.sup.G12V PBase efficiency (%) A_56035_Trp53 − + + + 10/11 (♂, 90.9%) A_56035_Trp53 + − + + 8/11 (♂, 72.7%) B_09614_Cdkn2b − + + + 11/11 (♂, 100%) B_09614_Cdkn2b + − + + 4/11 (♂, 36.4%) Control group − + + + 0/20 (♂, 0%)
[0118] We further conducted validation experiments for sgRNA of Cdkn2b, whose tumor suppressor role has not been previously implicated in mouse liver cancers. In the Cdkn2b-sgRNA group with Cdkn2a-sgRNA, at 21 days post injection, 11 out of 11 mice developed liver tumors (Table 5), with tumor numbers in each mouse >100, a big increase compared to screening experiments. In the Cdkn2b-sgRNA group, at 45 days post injection, 4 out of 11 mice developed liver tumors (
Example 8: Comparison of PB-CRISPR Library with Previous Methods
[0119] Previously, genome-wide gRNA lentiviral library was used to screen for 6-thioguanine resistant clones (Koike-Yusa et al., 2014). ES cells were first infected with lentiviral library followed by FACS sorting and expansion. 10×10.sup.6 mutant ESCs were treated with 6TG (2 M) for 5 d, and further cultured for an additional 5 d, thus obtaining 6TG resistant clones.
[0120] In comparison, we performed a PB-CRISPR library screening. ES cells were first electroporated with PB-CRISPR library. These cells were then directly used for 6TG selection, and clones were obtained 2 times faster than previous methods.
[0121] In the present invention, PB-CRISPR method has provided an efficient approach to conduct direct in vivo CRISPR library screening, as well as rapid in vivo validation of cancer genes. Compared to previous indirect in vivo screening by transplanting cultured cells (Chen S D, et al. (2015) Genome-wide CRISPR Screen in a Mouse Model of Tumor Growth and Metastasis. Cell 160(6):1246-1260.), the method of the present invention is much simpler and more likely to reveal relevant TSGs by recapitulating the complexity of the in vivo environment. In this proof-of-principle study, the application focused on a fast screening scheme, which by design is more likely to recover mutational events for early tumor occurrence, but with longer incubation time or other genetic backgrounds tumors with different mutational profiles should develop in the screening. With the increase of sample numbers, it may be possible to obtain a more complete list of TSGs involved in liver cancer development.
[0122] In the present invention, PB-CRISPR method has some advantages, for example, copy number of PB-CRISPR library can be flexibly controlled, and the screening of PB-CRISPR library can be directly in vivo.
[0123] Furthermore, this speed of tumor screening and validation in the invention is unprecedented, e.g., in the validation experiments for Cdkn2b sgRNA, numerous tumors developed within liver in less than 3 weeks. In contrast, similar previous in vivo tumor modeling using CRISPR and SB transposon or pX330 plasmid required a much longer time for tumor formation (Xue W, et al. (2014) CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature 514(7522):380-384; Weber J, et al. (2015) CRISPR/Cas9 somatic multiplex-mutagenesis for high-throughput functional cancer genomics in mice. Proceedings of the National Academy of Sciences of the United States of America 112(45):13982-13987.). One possible explanation is that PB mediates very efficient stable transposition in most hydrodynamically injected liver cells (
SEQUENCE LISTING
[0124] The sequence listing submitted herewith in the ASCII text file entitled “A002US1_ST25 Sequence Listing,” created Sep. 16, 2019, with a file size of 33.897 kilobytes, is incorporated herein by reference in its entirety.