PROCESS FOR THE BIOREACTIVE EXTRACTION OF PRODCUCED OXYGEN FROM A REACTION CHAMBER, AND USE OF PHOTOTROPHIC MICRO-ORGANISMS IN THE RECOVERY OF HYDROGEN

20230183756 · 2023-06-15

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to a method for extracting oxygen form a reaction chamber, as well as a use of microorganisms in such a method and a photobioreactor for carrying out the method.

    According to the invention, the method comprises the steps—irradiating at least one phototropic microorganism with light under anaerobic conditions in a reaction chamber, and—in situ bonding of produced oxygen by means of the microorganism by oxidation of an oxygen-utilizing substrates.

    Claims

    1. A method for the bioreactive extraction of produced oxygen from a reaction chamber, comprising the following steps: irradiating at least one phototropic microorganism under anaerobic conditions in a reaction chamber, and in situ bonding of produced oxygen by means of the microorganism by oxidation of an oxygen-utilizing substrate.

    2. The method according to claim 1, wherein the at least one phototropic microorganism has or produces at least one oxygen-converting enzyme.

    3. The method according to claim 2, wherein the at least one enzyme is selected from the group hydrogenase, nitrogenase and/or oxidoreductase.

    4. The method according to claim 1, wherein, during irradiation of the at least one phototropic microorganism, hydrogen or methanol is also released in addition to oxygen.

    5. The method according to claim 1, characterized in that the oxidoreductases are selected from the group of oxidases or oxygenases, preferably monooxygenases, dioxygenases or coenzyme-independent oxygenases.

    6. The method according to claim 1, wherein algae or cyanobacteria, preferably cyanobacteria, are used as phototropic microorganism.

    7. The method according to claim 1, characterized in that a, in particular genetically modified, cyanobacterial strain is used as microorganism, which stem has the alkane monooxygenase enzyme system AlkBGT.

    8. The method according to claim 1, characterized in that the genetically modified cyanobacterial strain Synechocystis sp. PCC6803, which has or produces the alkane monooxygenase enzyme system AlkBGT, is used.

    9. The method according to claim 8, characterized in that methyl nonanoate is used as substrate.

    10. A use of phototropic microorganisms which, in addition to hydrogenases, nitrogenases or oxidoreductases, as hydrogen-producing enzyme, additionally have or produce oxidoreductases as oxygen-converting enzymes, for obtaining hydrogen (H.sub.2) or methanol and oxygen (O.sub.2) from water or aqueous liquids and solutions and for simultaneous in-situ removal of the oxygen (O.sub.2) using corresponding substrates which form products with the oxygen.

    11. A photobioreactor comprising the genetically modified cyanobacterial strain Synechocystis sp. PCC6803 which has or produces the alkane monooxygenase enzyme system AlkBGT.

    Description

    [0055] FIG. 1: graphic representation of an extraction of photosynthetically produced oxygen by the alkane monooxygenase enzyme system AlkBGT which has been introduced genetically into the cyanobacterial strain Synechocystis sp. PCC6803, in a manner carried out according to the invention.

    [0056] Different conditions come into question for carrying out the method according to the invention. The only essential is the presence of molecular oxygen as oxidizing agent.

    Example 1

    [0057] Production of a genetically modified strain—Synechocystis sp. PCC6803, containing the alkane monooxygenase enzyme system AlkBGT

    [0058] The introduction of the gene coding for the alkane monooxygenase enzyme system AlkBGT took place via a plasmid-based approach (pRSF_Ptrc1O:BGTII). The following protocols and cloning steps describe the structure of the plasmid. Table 1 lists the strains and plasmids used and produced during the cloning process.

    TABLE-US-00001 TABLE 1 Strain/plasmid structures used and produced during the cloning process. Strain/plasmid Description Reference E. coli DH5α F.sup.− Φ80lacZΔM15 Δ(lacZYA-argF) U169 (Hanahan recA1 endA1 hsdR17 (rK.sup.−, mK.sup.+) phoA 1983) supE44 λB.sup.− thi.sup.−1 gyrA96 relA1 Synechocystis sp. PCC6803 Geographical origin: California, USA (Stanier Obtained from the Pasteur Culture et al. 1971) Collection of Cyanobacteria (PCC, Paris, France) pBT10 Alkane monooxygenase expression (Schrewe system (alkBFG, alkST) in pCOM10 et al. 2011) pSB1AC3_Ptrc1O:GFPmut3B P.sub.trc1O promoter, GFPmut3B gene (Huang et (BBa_E0040) in pSB1AC3 al. 2010) pSB1AC3_Ptrc1O:Term pSB1AC3 with the p.sub.trc1O promoter from This paper pSB1AC3_Ptrc1O:GFPmut3B via XbaI, PstI (Gibson assembly) pSB1AC3_PrnpB:lacI PrnpB (constitutive promoter of the (Huang et RNase P gene) controlling a variant of al. 2010) the lac repressor lacI in pSB1AC3 pSB1AC3_PrnpB:lacI_Ptrc1O:Term pSB1AC3_Ptrc1O:Term with PrnpB:lacI This paper from pSB1AC3_PrnpB:lacI via XbaI (Restriction, Ligation) pPMQAK1 Broad host range Plasmid, RSF ori, mob (Huang et gene al. 2010) pPMQAK1_PrnpB:lacI_Ptrc1O:Term pPMQAK1 with PrnpB:lacI_Ptrc1O:Term This paper from pSB1AC3_PrnpB:lacI_Ptrc1O:Term via EcoRI, PstI (Restriction, Ligation) pPMQAK1_PrnpB:lacI_Ptrc1O:BGTII pPMQAK1_PrnpB:lacI_Ptrc1O:Term with This paper alkBGT genes from pBT10 (successive genes, optimized RBS, C-terminal Strep- tag II) via Spel (Gibson assembly) pRSF_Ptrc1O:BGTII pPMQAK1_PrnpB:lacI_Ptrc1O:BGTII This paper with additional terminator (biobrick #BBa_B0015 via XbaI (Gibson assembly)

    [0059] As part of the cloning process, the following method steps such as restriction, amplification etc. were carried out as below.

    [0060] The restriction endonucleases were obtained from Thermo Scientific—Germany GmbH (Schwerte, Germany) and used as recommended.

    [0061] An amplification of DNA fragments was carried out by polymerase chain reaction (PCR) applying the Phusion High Fidelity (HF) DNA polymerase from Thermo Scientific—Germany GmbH (Schwerte, Germany) via the recommended 3-step protocol with corresponding primers (listed in Table 2). Corresponding accumulation temperatures (T.sub.An) and elongation times (t.sub.EL) are described below in the respective process step.

    [0062] A desired overlap extension PCR (OEPCR) was carded out by inserting 50 ng each of DNA fragments in a 100 μL standard PCR batch. Corresponding primers were added after 5 PCR cycles.

    [0063] Plasmid DNA was dephosphorylated by means of FastAP Thermosensitive Alkaline Phosphatase from Thermo Scientific— Germany GmbH (Schwerte, Germany) as recommended.

    [0064] Subsequently, plasmid DNA and amplified DNA fragments were purified via the PCR Clean-up Gel Extraction Kit from MACHERY-NAGEL GmbH & Co. KG (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany).

    [0065] Gibson assembly took place via a single-step isothermal, in vitro recombinant cloning method described by Gibson et al. 2009 (Gibson et al. 2009).

    [0066] Ligation took place via the T4 DNA ligase from Thermo Scientific—Germany GmbH (Schwerte, Germany) as recommended.

    [0067] Finally, PCR-amplified DNA sequences were verified by sequencing via Eurofins MWG (Ebersberg, Germany).

    [0068] The present paper refers to the known processes named in Table 1 with respect to the reference noted in Table 1.

    TABLE-US-00002 TABLE 2 Primers used during the cloning process. SEQ.- Primer# No. sequence PAH055 1 TCCGGCTCGTATAATGTGTG GAATTGTGAGCGGATAACAA TTTCACACATACTAGTACCA GGCATCAAATAAAACG PAH056 2 TATAAACGCAGAAAGGCCC PAH057 3 TGATTTCTGGAATTCGCGGC CGCTTTCTAGATTGACAATT AATCATCCGGCTCGTATAAT GTG PAH058 4 ACACCTTGCCCGTTTTTTTG CCGGACTGCAGTATAAACGC AGAAAGGCCC PAH069 5 CTTTTCCTCGTAGAGCAC PAH070 6 GAGCCACCCGCAGTTCGAAA AATAGTACTAGAGTAGTGGA GGTTACTAGATGGCAATCGT TGTTGTTG PAH071 7 ATCAGGTAATTTTATACTCC C PAH072 8 CTATTTTTCGAACTGCGGGT GGCTCCAAGCGCTCTTTTCC TCGTAGAGCAC PAH073 9 CTTTCGTTTTATTTGATGCC TGGTACTATTTTTCGAACTG CGGGTGGCTCCAAGCGCTAT CAGGTAATTTTATACTCCC PAH077 10 GGGAGGTATTGGACCGCATT GAACTCTAGTATATAAACGC AGAAAGGCCC PAH078 11 ACGAGCCGGATGATTAATTG TCAATCTAGAGCCAGGCATC AAATAAAACG SPAH017 12 CCATCAAACAGGATTTTCG SPAH023 13 TGCCACCTGACGTCTAAGA A

    [0069] Cloning Process

    [0070] Structure of pSB1AC3 Ptrc1O:Term

    [0071] Restriction: pSB1AC3_Ptrc1O:GFP (Xbal+Pstl).fwdarw.pSB1AC3 (Xbal, Pstl)

    [0072] Amplification: Ptrc1O:Term part I of pSB1AC3_Ptrc1O:GFP [0073] (PAH055+PAH056.fwdarw.186 BP, T.sub.An: 60° C., t.sub.Elong: 10 sec) [0074] Ptrc1O:Term part II of part I [0075] (PAH057+PAH058.fwdarw.262 BP, T.sub.An: 72° C., t.sub.Elong: 10 sec)

    [0076] Gibson assembly: pSB1AC3 (Xbal, Pstl)+Ptrc1O:Term part II [0077] .fwdarw.pSB1AC3 Ptrc1O:Term

    [0078] Structure of pSB1AC3 PrnpB:lacl Ptrc1O:Term

    [0079] Restriction: pSB1AC3_Ptrc1O:Term (Xbal)

    [0080] Dephosphorylation: pSB1AC3_Ptrc1O:Term (Xbal) (FastAP, Thermo)

    [0081] Restriction: pSB1AC_PrnpB:lacl (Xbal+Spel)

    [0082] Ligation: pSB1AC3_Ptrc1O:Term (Xbal)+PrnpB:lacl (Xbal_Spel) (1:2) [0083] .fwdarw.pSB1AC3 PrnpB:lacl Ptrc1O:Term

    [0084] Verification by PCR: Clones with the PrnpB:lacl fragment in desired direction determined by PCR (SPAH017+SPAH023.fwdarw.500 BP, T.sub.An: 61° C., t.sub.Elong: 15 sec).

    [0085] Structure of pPMQAK1 PrnpB:lacl Ptrc1O:Term

    [0086] Restriction: pPMQAK1 (EcoRI+Pstl)

    [0087] Restriction: pSB1AC3_PrnpB:lacl_Ptrc1O:Term (EcoRI+Pstl)

    [0088] Ligation: pPMQAK1 (EcoRI, PstI)+PrnpB:lacl_Ptrc1O:Term (EcoRI, PstI) (1:5) [0089] .fwdarw.pPMQAK1 PrnpB:lacl Ptrc1O:Term

    [0090] Structure of pPMQAK1_PrnpB:lacl Ptrc1O:BGTII

    [0091] Restriction: pPMQAK1_PrnpB:lacl_Ptrc1O:Term (Spel)

    [0092] Amplification: oAlkBII (PAH059+PAH067.fwdarw.1283 BP, T.sub.An: 65° C., t.sub.Elong: 25 sec) [0093] oAlkGII (PAH068+PAH069.fwdarw.568 BP, T.sub.An: 60° C., t.sub.Elong: 25 sec) [0094] oAlkTII (PAH070+PAH071.fwdarw.1204 BP, T.sub.An: 65° C., t.sub.Elong: 25 sec)

    [0095] OE-PCR: oAlkBII+oAlkGII (PAH063+PAH072.fwdarw.1859 BP, T.sub.An: 65° C., t.sub.Elong: 60 sec) [0096] .fwdarw.oBGII [0097] oBGII+oAIkTII (PAH063+PAH073.fwdarw.3096 BP, T.sub.An: 57° C., t.sub.Elong: 90 sec) [0098] .fwdarw.oBGTII

    [0099] Gibson: pPMQAK1_PrnpB:lacl_Ptrc1O:Term (Spel)+oBGT [0100] .fwdarw.pPMQAK1 PrnpB:lacl Ptrc1O:BGTII

    [0101] Structure of pRSF Ptrc1O:BGTII

    [0102] Restriction: pPMQAK1_PrnpB:lacl_Ptrc1O:BGTII (Xbal)

    [0103] Amplification: Term of pSB1AC3_Ptrc1O:GFP [0104] (PAH077+PAH078.fwdarw.191 BP, T.sub.An: 60° C., t.sub.Elong: 5 sec)

    [0105] Gibson: pPMQAK1_PrnpB:lacl_Ptrc1O:oBGTII (Xbal)+Term .fwdarw.pRSF Ptrc1O:BGTII

    [0106] Growth Conditions for Synechocystis sp. PCC6803

    [0107] Synechocystis sp. PCC6803 was cultivated in YBG11 medium, based on Shcolnick et al. 2007, upon addition of 50 mM HEPES buffer (Shcolnick et al. 2007). 50 μg mL.sup.−1 kanamycin was added as evolutionary pressure. Standard cultivation conditions comprise a culture volume of 20 mL YBG11 medium in 100 mL Erienmeyer shaking flasks with chicane, which was introduced into an orbital shaker (Multitron Pro shaker, Infors, Bottmingen, Switzerland) at 150 rpm (2.5 cm amplitude). The cultivation temperature was 30° C., at a luminous intensity of 50 μmol m.sup.−2 s.sup.−1 (LED), 0.04% CO.sub.2 and an air humidity of 75%. Growth was pursued via the optical density at a wavelength of 750 nm over a spectrophotometer (Libra S11, Biochrom Ltd, Cambridge, UK). Preparatory cultures were incubated over 200 μL of a cryostock solution and cultivated under standard conditions for 4-6 days. Main cultures, proceeding from this preparatory culture, were inoculated with a start OD.sub.750 of 0.08 and cultivated for 3 days under standard conditions until the gene expression was induced for a further day by adding 2 mM IPTG.

    [0108] YBG11: 1.49 g L.sup.−1 NaNO.sub.3, 0.074 g L.sup.−1 MgSO.sub.4.Math.7 H.sub.2O, 0.305 g L.sup.−1 K.sub.2HPO.sub.4, 10 mL L.sup.−1 YBG11 trace elements (100×), 0.019 g L.sup.−1 Na.sub.2CO.sub.3, 50 mM HEPES (pH 7.2); YBG11 trace elements (100×): 0.36 g L.sup.−1 CaCl.sub.2.Math.2 H.sub.2O, 0.63 g L.sup.−1 citric acid, 0.28 g L.sup.−1 boric acid, 0.11 g L.sup.−1 MnCl.sub.2.Math.4 H.sub.2O, 0.02 g L.sup.−1 ZnSO.sub.4.Math.7 H.sub.2O, 0.039 g L.sup.−1 Na.sub.2MoO.sub.4.Math.2 H.sub.2O, 0.007 g L.sup.−1 CuSO.sub.4.Math.5 H.sub.2O, 0.003 g L-1 Co(NO.sub.3).sub.2.Math.6 H.sub.2O, 0.1 g L.sup.−1 FeCl.sub.3.Math.6 H.sub.2O, 0.6 g L.sup.−1 Na.sub.2EDTA.Math.2 H.sub.2O

    [0109] Transformation of Synechocystis sp. PCC6803 by Electroporation

    [0110] Transformation of Synechocystis sp. PCC6803 with the plasmid pRSF_Ptrc1O:BGTII was carried out via electroporation, based on a method according to Ferreira et al. 2014 (Universidade do Porto Ferreira 2014). Electrocompetent cells were produced proceeding from a 50 mL YBG11 main culture (in 100 mL Erienmeyer shaking flasks with chicane) with an OD.sub.750 of 0.5-1. The cells were harvested by centrifugation (10 min, 3180 g, 4° C.), washed three times each with 10 mL HEPES buffer (1 mM, pH 7.5) and resuspended in 1 mL HEPES buffer. The electrocompetent cells were stored by adding 5% (v/v) DMSO at −80° C. For electroporation, 0.2-1.0 μg plasmid DNA was added to 60 μL electrocompetent cells in an electroporation vessel (2 mm electrode distance), pulsed for 5 ms at 2500 V (12.5 kV cm.sup.−1) (Eppendorf Eporator, Eppendorf Vertrieb Deutschland GmbH, Wesseling-Berzdorf, Germany) and then transferred into 50 mL YBG11 medium (in 100 mL Erlenmeyer shaking flasks with chicane). After cultivation under standard conditions for 24 h, the cells were harvested by centrifugation (10 min, 3180 g, RT), resuspended in 100 μL YBG11 medium and exposed to BG11 agar plates with 50 μg mL.sup.−1 kanamycin (Stanier et al. 1971). After 4-6 days at 30° C., 20-50 μmol m.sup.−2 s.sup.−1 luminous intensity (fluorescent tubes), 0.04% CO.sub.2 and 80% air humidity (poly klima GmbH, Freising, Germany), individual colonies were transferred to fresh BG11 agar plates and incubated again. The cell mass of an agar plate was then used for inoculation of a 20 mL YBG11 preparatory culture.

    [0111] BG11 agar plates: 1.5 g L.sup.−1 NaNO.sub.3, 0.075 g L.sup.−1 MgSO.sub.4.Math.7 H.sub.2O, 0.036 g L.sup.−1 CaCl.sub.2.Math.2 H.sub.2O, 0.006 g L.sup.−1 citric acid, 0.04 g L.sup.−1 K.sub.2HPO.sub.4, 0.006 g L.sup.−1 iron ammonium citrate, 0.001 g L.sup.−1 Na.sub.2EDTA, 0.02 g L.sup.−1 Na.sub.2CO.sub.3, 1 mL L.sup.−1 BG11 trace elements (1000×), 0.3% Na.sub.2S2O.sub.3, 10 mM HEPES (pH 8), 1.5% Agar; BG11 trace elements (1000×): 2.86 g L.sup.−1 boric acid, 1.8 g L.sup.−1 MnCl.sub.2.Math.4 H.sub.2O, 0.22 g L.sup.−1 ZnSO.sub.4.Math.7 H.sub.2O, 0.39 g L.sup.−1 Na.sub.2MoO.sub.4.Math.2 H.sub.2O, 0.08 g L.sup.−1 CuSO.sub.4.Math.5 H.sub.2O, 0.05 g L.sup.−1 Co(NO.sub.3).sub.2.Math.6 H.sub.2O

    [0112] FIG. 1 shows a bioreactive extraction of photosynthetically produced oxygen by the alkane monooxygenase enzyme system AlkBGT which was introduced genetically into the cyanobacterial strain Synechocystis sp. PCC6803. The photosynthetic light reaction was induced by illumination (luminous intensity of 50 μmol m.sup.−2 s.sup.−1), while the control reaction took place without illumination. Terminally hydroxylated methyl nonanoate was detected as oxygenated product. CDW=cell dry weight

    [0113] For this, the alkane monooxygenase enzyme system AlkBGT was introduced into the cyanobacterial strain Synechocystis sp. PCC6803 (via the plasmid pRSF_Ptrc1O:BGTII, see production of the modified strain above), which is a potential biocatalyst for photosynthetic hydrogen production. After converting the reaction system from aerobic to anaerobic conditions and after adding methyl nonanoate as substrate, the formation of oxygenated product could be detected when illuminated (FIG. 1).

    [0114] As no product formation was observed at reaction conditions in darkness, the results demonstrate that the oxygen needed for the reaction came from the photosynthetic light reaction. The specific activity was 0.9±0.1 μmol.sub.oxygenated substratemin.sup.−1 g.sub.CDW.sup.−1 for the first 30 minutes. The oxygen formation rate at the same luminous intensity of 50 μmol m.sup.−2 s.sup.−1 was 3.7±0.5 μmol.sub.O2 min.sup.−1 g.sub.CDW.sup.−1 (without addition of substrate). Thus almost 25% of the produced oxygen could be absorbed enzymatically with the non-optimized biocatalyst. When observing the possible dilution of the oxygen from the aqueous phase into the gas phase (aqueous:gas phase ratio 1:10, dimensionless Henry volatility H.sub.CC=caq/cgas for O.sub.2 in water: 0.0297 at 25° C. (Sander 2015)) it is clear that the molecular oxygen has already been captured at the point of its production and bound into the substrate before escaping into the gas phase. An optimization of the oxygenation system (for example by increasing the enzyme content in the cell) is possible and would increase the proportion of extracted oxygen.

    Example 2

    Technical Application—Tube Bundle Reactor Concept

    [0115] The technical implementation of the described invention takes place preferably using a concept in which an illuminated tube bundle reactor, which contains suspended or immobilized phototropic cells, is used. The tube bundle reactor is scaled up on an industrial scale by simply increasing the number of microcapillaries used. As a special form of immobilized cells, a biofilm-based design is chosen which proved achievable for the cyanobacteria species Synechocystis sp. PCC6803 (David, C., K. Buhler and A. Schmid (2015). “Stabilization of single species Synechocystis biofilms by culivation under segmented flow.” J Ind Microbiol Biotechnol 42(7): 1083-1089). This technical implementation offers a continuous production system which contains the photosynthetic water splitting, hydrogen production, oxygen extraction, as well as substrate oxidation.

    [0116] Downstream preparation is then made possible by capturing the molecular hydrogen via the gas phase and, when using wastewater as substrate, by guiding the treated wastewater back to the continuing purification process. If, on the other hand, a combined biocatalytic production process is intended, a separation of the product with increased value creation is to be carried out for example by using an organic carrier phase. The following examples contain assumptions and values which are adapted according to the specific application and the chosen framework conditions, and show the potential of the invention.

    [0117] Specific Activity in Respect of Water Splitting by the PSII

    [0118] The microorganisms used have a content of approx. 1% of photosystem II, wherein photosystem II has a molar mass of 350 kDa (g.sub.CDW.sup.−1, molecular weight PSII (Shen, J. R. (2015). “The structure of photosystem II and the mechanism of water oxidation in photosynthesis.” Annu Rev Plant Biol 66: 23-48). The highest in vitro measured value is indicated by Dismukes et al. (Dismukes, G. C., R. Brimblecombe, G. A. Felton, R. S. Pryadun, J. E. Sheats, L. Spiccia and G. F. Swiegers (2009). “Development of bioinspired Mn.sub.4O.sub.4-cubane water oxidaton catalysts: lessons from photosynthesis.” Acc Chem Res 42(12): 1935-1943) at 1000 s.sup.−1. This leads to a specific activity of the PSII of 1700 μmol.sub.H20splitting per minute per g.sub.CDW.sup.−1. From this, the result in respect of hydrogen production is an oxygen consumption and a substrate oxidation by the organism of 850 μmol.sub.H2/O2/substrate per minute per g.sub.CDW.sup.−1.

    [0119] Product Yield by a Tube Bundle Reactor Process

    [0120] 10 g.sub.CDW L.sup.−1 biomass with a volumetric productivity of 0.51 mol.sub.H2/O2/substrate L.sup.−1 h.sup.−1 was used on 20,000 microcapillaries each 2 m long and 5 mm in diameter. A total volume of 785 L (39.3 mL capillary.sup.−1) was the result. With 2920 hours of daylight per year (light availability of 8 h per day, 365 days) the system produces 1169 kmol hydrogen, and oxidized substrate, per year.

    [0121] Energy Yield

    [0122] The condition applies that the process is not limited by hydrogenase. On the basis of a molecular weight of 2 g/mol, hydrogen has a volumetric product activity of 1.02 g.sub.H2 L.sup.−1 h.sup.−1. This results in a product yield of 2338 kg hydrogen per year, of which 60%, thus 1402 kg, can be recovered. With an underlying energy content of 33.3 kWh per kilogram hydrogen (Wikipedia), a total of 46,686 kWh per year of energy can be generated using the process according to the invention.