Pharmaceutical Composition Comprising Compound Capable of Penetrating Blood-Brain Barrier as Effective Ingredient for Preventing or Treating Brain Cancer

20230181596 · 2023-06-15

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is a pharmaceutical composition for the prevention or treatment of brain cancer, containing a compound capable of penetrating the blood-brain barrier as an active ingredient, the pharmaceutical composition for the prevention or treatment of brain cancer is capable of efficiently penetrating the blood-brain barrier of the brain to thereby effectively inhibit LRRK2 protein expression, and is thus useful in the prevention or treatment of brain cancer.

    Claims

    1. A method of treating a subject having a brain cancer, comprising administering an effective amount of an LRRK2 (leucin-rich repeat kinase-2) protein inhibitor to the subject, wherein the LRRK2 protein inhibitor is: (20) (2S,6R)-2,6-dimethyl-4-(6-(5-(1-methylcyclopropoxy)-1H-indazol-3-yl)pyrimidin-4-yl)morpholine.

    2. A method of treating a subject having a brain cancer, comprising: administering an effective amount of an LRRK2 (leucin-rich repeat kinase-2) protein inhibitor to the subject; and administering an effective amount of Avastin to the subject, wherein the LRRK2 protein inhibitor is: (20) (2S,6R)-2,6-dimethyl-4-(6-(5-(1-methylcyclopropoxy)-1H-indazol-3-yl)pyrimidin-4-yl)morpholine.

    Description

    DESCRIPTION OF DRAWINGS

    [0017] FIG. 1 is images showing the results of Western blotting of LRRK2 protein expression in cancer tissue obtained from brain tumor patients.

    [0018] FIG. 2 is images showing the results of evaluation of the correlation between LRRK2 protein phosphorylation and brain tumor malignancy.

    [0019] FIG. 3 is an image showing the results of analysis of a nucleic acid sequence encoding the LRRK2 protein expressed in brain tumor cells.

    [0020] FIG. 4a schematically shows the structure of a lentiviral vector expressing the LRRK2 protein.

    [0021] FIG. 4b is images showing the overexpression of the LRRK2 protein in cells infected with a lentiviral vector expressing the LRRK2 protein.

    [0022] FIG. 4c is images showing the self-renewal of tumor cells in cells infected with a lentiviral vector expressing the LRRK2 protein.

    [0023] FIG. 5a is images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line NC001 cells with the compounds of Examples 10, 11, 12, 20 and 21.

    [0024] FIG. 5b is images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line NCC01 cells with the compounds of Examples 11, 12, 20, 21 and 22.

    [0025] FIG. 6 is a graph showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line NCC01 cells with the compounds of Examples 10, 11, 12, 20 and 21.

    [0026] FIGS. 7 and 8 are images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line NC001 cells with the compound of Example 10 at various concentrations.

    [0027] FIGS. 9 and 10 are images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line NCC01 cells with the compound of Example 12 at various concentrations.

    [0028] FIGS. 11 and 12 are images showing the results of Western blotting over time after treatment of brain-tumor-patient-derived cell line NCC01 cells with the compound of Example 12 at a concentration of 100 nM.

    [0029] FIGS. 13 to 15 are images showing the results of Western blotting 1 day after treatment of NCC01 cells with the compound of Example 12 in the concentration range of 50 nM to 2,000 nM.

    [0030] FIG. 16 is images showing the death of brain tumor cells induced by inhibiting the activity of mitochondria using the compound of Example 12.

    [0031] FIG. 17 is images showing the inhibition of the activity of mitochondria present in brain tumor stem cells using the compound of Example 12.

    [0032] FIG. 18 is images showing the inhibition of mitochondrial activity by suppressing TRAP1 expression using the compound of Example 12.

    [0033] FIG. 19a is images showing that the growth of spheres formed from NCC01 cells exposed to hypoxic conditions is inhibited by shRNA against the LRRK2 gene.

    [0034] FIG. 19b is images showing the results of Western blotting of LRRK2 protein expression in NC001 cells exposed to hypoxic conditions.

    [0035] FIG. 19c is images showing that the growth of spheres formed from 528NS cells exposed to hypoxic conditions is inhibited by shRNA against the LRRK2 gene.

    [0036] FIG. 19d is images showing the results of Western blotting of LRRK2 protein expression in 528NS cells exposed to hypoxic conditions.

    [0037] FIGS. 20 and 21 are images showing the results of evaluation of cell cycle FACS 1 day after treatment of NCC01 cells with the compounds of Example 11, 12 and 21 at concentrations of 100 nM.

    [0038] FIG. 22 is an image showing the results of observation of changes in number of days of survival after oral administration of the compound of Example 12 to a brain-tumor-induced mouse model.

    [0039] FIG. 23 is images showing the result of measurement of changes in tumor size after oral administration of the compound of Example 12 to a brain-tumor-induced mouse model.

    [0040] FIG. 24 is an image showing an increase in the therapeutic effect on brain tumors when the compound of Example 12 is administered in combination with Avastin.

    [0041] FIG. 25 is images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line NCC01 cells with the compound of Comparative Example.

    [0042] FIG. 26 is images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line 448T cells with the compounds of Examples 10, 11, 12, 20 and 21.

    [0043] FIG. 27 is images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line 448T cells with the compound of Example 12 at various concentrations.

    [0044] FIG. 28 is an image showing the results of observation of changes in number of days of survival after oral administration of the compounds of Examples 12, 20 and 21 to a brain-tumor-induced mouse model.

    [0045] FIG. 29 is images showing the results of Western blotting upon treatment of brain-tumor-patient-derived cell line 448T cells with the compound of Comparative Example and the compounds of Examples 1, 11 and 12.

    BEST MODE

    [0046] Hereinafter, a detailed description will be given of the present invention.

    [0047] The present invention pertains to a pharmaceutical composition for the prevention or treatment of brain cancer, containing an LRRK2 (leucin-rich repeat kinase-2) protein inhibitor as an active ingredient.

    [0048] In an embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 1 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00001##

    [0049] in Chemical Formula 1,

    [0050] R.sup.1 is —H, —OH, halogen, nitro, nitrile, a C.sub.1-10 linear or branched alkyl, a C.sub.1-10 linear or branched alkoxy, a C.sub.1-5 linear or branched alkylamino, or a C.sub.1-5 linear or branched dialkylamino;

    [0051] R.sup.2 is —H, —OH, halogen, nitro, nitrile, or an unsubstituted or at-least-one-halogen-substituted C.sub.1-10 linear or branched alkyl, or is linked with R.sup.3 to form an unsubstituted, substituted or fused 5- to 8-membered-ring heterocycloalkyl containing at least one N or an unsubstituted or substituted 5- or 6-membered-ring heteroaryl containing at least one N,

    [0052] in which the substituted 5- to 8-membered-ring heterocycloalkyl and the substituted 5- or 6-membered-ring heteroaryl are independently a 5- to 8-membered-ring heterocycloalkyl and a 5- or 6-membered-ring heteroaryl substituted with at least one substituent selected from the group consisting of —OH, ═O, halogen and a C.sub.1-5 linear or branched alkyl, and,

    [0053] the fused 5- to 8-membered-ring heterocycloalkyl is a 5- to 8-membered-ring heterocycloalkyl fused with an unsubstituted C.sub.6-10 aryl;

    [0054] R.sup.3 is —H, —OH, halogen, nitro, nitrile, a C.sub.1-10 linear or branched alkyl, a C.sub.1-10 linear or branched alkoxy, a C.sub.1-5 linear or branched alkylamino, a C.sub.1-5 linear or branched dialkylamino, a C.sub.1-5 linear or branched alkylsulfonyl C.sub.6-10 arylamino, or a C.sub.1-5 linear or branched alkylsulfonylamino C.sub.6-10 arylamino, or is linked with R.sup.2 to form an unsubstituted, substituted or fused 5- to 8-membered-ring heterocycloalkyl containing at least one N,

    [0055] in which the substituted 5- to 8-membered-ring heterocycloalkyl is independently a 5- to 8-membered-ring heterocycloalkyl substituted with at least one substituent selected from the group consisting of —OH, ═O, halogen and a C.sub.1-5 linear or branched alkyl, and

    [0056] the fused 5- to 8-membered-ring heterocycloalkyl is a 5- to 8-membered-ring heterocycloalkyl fused with an unsubstituted 06-10 aryl; and

    [0057] Y is

    ##STR00002##

    [0058] in which R.sup.4, R.sup.5 and R.sup.6 are independently —H, —OH, halogen, nitro, nitrile, a C.sub.1-10 linear or branched alkyl, a C.sub.1-10 linear or branched alkoxy, an unsubstituted or substituted 5- to 8-membered-ring heterocycloalkyl containing at least one hetero atom selected from the group consisting of N and O, or an unsubstituted or substituted 5- to 8-membered-ring heterocycloalkylcarbonyl containing at least one hetero atom selected from the group consisting of N and O,

    [0059] in which the substituted 5- to 8-membered-ring heterocycloalkyl is a 5- to 8-membered-ring heterocycloalkyl substituted with a C.sub.1-5 linear or branched dialkylamino or a 6-membered-ring heterocycloalkyl which contains at least one N and which is substituted with at least one C.sub.1-5 linear or branched alkyl, and

    [0060] R.sup.7, R.sup.8 and R.sup.9 are independently —H, —OH, halogen, nitro, nitrile, an unsubstituted or at-least-one-hydroxyl-group-substituted C.sub.1-10 linear or branched alkyl, or an unsubstituted or substituted 5- to 8-membered-ring heterocycloalkyl containing at least one hetero atom selected from the group consisting of N and O,

    [0061] in which the substituted 5- to 8-membered-ring heterocycloalkyl is a 5- to 8-membered-ring heterocycloalkyl substituted with at least one substituent selected from the group consisting of —OH, ═O, halogen and an O-containing 4- or 5-membered-ring unsubstituted heterocycloalkyl.

    [0062] Preferably,

    [0063] R.sup.1 is —H or —NH(CH.sub.3);

    [0064] R.sup.2 is —H, halogen, or —CF.sub.3, or is linked with R.sup.3 to form

    ##STR00003##

    [0065] R.sup.3 is —H, —NH(CH.sub.3), —NH(CH.sub.2CH.sub.3),

    ##STR00004##

    or is linked with R.sup.2 to form

    ##STR00005##

    and

    [0066] Y is

    ##STR00006##

    [0067] in which R.sup.4, R.sup.5 and R.sup.6 are independently —H, methoxy, halogen,

    ##STR00007##

    and R.sup.7, R.sup.8 and R.sup.9 are independently —H, methyl, halogen,

    ##STR00008##

    [0068] More preferably, the compound represented by Chemical Formula 1 is any one selected from the following compound group:

    [0069] (1) 5-chloro-N4-(2-(isopropylsulfonyl)phenyl)-N2-(2-methoxy-4-(4-(4-methylpiperazin-1-yl)piperidin-1-yl)phenyl)pyrimidine-2,4-diamine; (2)N-(2-(2-(3-chloro-4-methoxyphenylamino)-5-fluoropyrimidin-4-ylamino)phenyl)methanesulfonamide; (6) (4-(dimethylamino)piperidin-1-yl)(3-methoxy-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino)phenyl)methanone; (8) N4-ethyl-N2-(1-(3-fluoro-1-(oxetan-3-yl)piperidin-4-yl)-3-methyl-1H-pyrazol-4-yl)-5-(trifluoromethyl)pyrimidine-2,4-diamine; (10) 2-[(2-methoxy-4-[[4-(4-methylpiperazin-1-yl)piperidin-1-yl]carbonyl]phenyl)amino]-5,11-dimethyl-5,11-dihydro-6H-pyrimido[4,5-b][1,4]benzodiazepin-6-one; (11) (4-(4-(ethylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino) fluoro-5-methoxyphenyl)(morpholino)methanone; (12) (3-methoxy-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin ylamino)phenyl)(morpholino)methanone; (14) 1-(5-chloro-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino)-1H-pyrazol-1-yl)-2-methylpropan-2-ol; and (16) N2-(5-chloro-1-((3S,4R)-3-fluoro-1-(oxetan-3-yl)piperidin-4-yl)-1H-pyrazol-4-yl)-N4-methyl-5-(trifluoromethyl)pyrimidine-2,4-diamine.

    [0070] In another embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 2 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00009##

    [0071] in Chemical Formula 2,

    [0072] L.sup.1 and L.sup.2 are independently —O—, —CH.sub.2—, —NH—, or —S—;

    [0073] A.sup.1 is an unsubstituted or substituted C.sub.3-10 cycloalkyl, in which the substituted C.sub.3-10 cycloalkyl is a C.sub.3-10 cycloalkyl substituted with at least one substituent selected from the group consisting of —OH, halogen, nitrile, nitro, a C.sub.1-5 linear or branched alkyl and a C.sub.1-5 linear or branched alkoxy;

    [0074] A.sup.2 is an unsubstituted or substituted 5- or 6-membered-ring heteroaryl containing at least one hetero atom selected from the group consisting of N, O and S, in which the substituted 5- or 6-membered-ring heteroaryl is a 5- or 6-membered-ring heteroaryl substituted with at least one substituent selected from the group consisting of —OH, halogen, nitrile, nitro, a C.sub.1-5 linear or branched alkyl and a C.sub.1-5 linear or branched alkoxy; and

    [0075] A.sup.3, A.sup.4 and A.sup.5 are independently —H, a C.sub.1-5 linear or branched alkyl or a C.sub.1-5 linear or branched alkoxy.

    [0076] Preferably, L.sup.1 and L.sup.2 are independently —CH.sub.2—, —NH—, or —S—;

    [0077] A.sup.1 is

    ##STR00010##

    [0078] A.sup.2 is

    ##STR00011##

    and

    [0079] A.sup.3, A.sup.4 and A.sup.5 are independently —H or methyl.

    [0080] More preferably, the compound represented by Chemical Formula 2 is any one selected from the following compound group:

    [0081] (7) (S)-3-(cyclopropylthio)-7-methyl-1-(1H-pyrazol-3-yl)-6,7-dihydrothieno[3,4-c]pyridin-4(5H)-one; and (9) 3-(cyclopentylthio)-6,6-dimethyl-1-(1H-pyrazol-3-yl)-6,7-dihydrobenzo[c]thiophen-4(5H)-one.

    [0082] In still another embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 3 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00012##

    [0083] in Chemical Formula 3,

    [0084] L.sup.3 is absent, —NH—, or —O—;

    [0085] L.sup.4 is N or C;

    [0086] E.sup.1 is —H, —OH, halogen, nitrile, nitro, a C.sub.1-5 linear or branched alkyl, or a C.sub.1-5 linear or branched alkoxy;

    [0087] E.sup.2 is absent when L.sup.4 is N, or is

    ##STR00013##

    when L.sup.4 is C,

    [0088] E.sup.5 is a C.sub.1-5 linear or branched alkyl; E.sup.3 is —H, —OH, halogen, nitrile, nitro, a C.sub.1-5 linear or branched alkyl, a C.sub.1-5 linear or branched alkoxy, an unsubstituted or substituted C.sub.6-10 cycloalkyl, or an unsubstituted or substituted 5- to 8-membered-ring heterocycloalkyl containing at least one hetero atom selected from the group consisting of N and O,

    [0089] in which the substituted C.sub.6-10 cycloalkyl and the substituted 5- to 8-membered-ring heterocycloalkyl are independently a C.sub.6-10 cycloalkyl and a 5- to 8-membered-ring heterocycloalkyl substituted with at least one substituent selected from the group consisting of —OH, halogen, a C.sub.1-3 linear or branched alkyl, and a C.sub.1-3 linear or branched alkoxy; and

    [0090] E.sup.4 is an unsubstituted or substituted 6- to 8-membered-ring heterocycloalkylcarbonyl C.sub.1-5 linear or branched alkyl containing at least one N, or an unsubstituted or substituted 6- to 8-membered-ring heteroaryl containing at least one N,

    [0091] wherein the substituted 6- to 8-membered-ring heterocycloalkyl and the substituted 6- to 8-membered-ring heteroaryl are independently substituted with a C.sub.6-10 aryl or an unsubstituted or substituted 6-membered-ring heterocycloalkyl containing at least one hetero atom selected from the group consisting of N and O,

    [0092] the substituted 6-membered-ring heterocycloalkyl is a 6-membered-ring heterocycloalkyl substituted with —OH, halogen, or an unsubstituted or at-least-one-halogen-substituted C.sub.1-5 linear or branched alkyl.

    [0093] Preferably, L.sup.3 is absent, —NH—, or —O—;

    [0094] L.sup.4 is N or C;

    [0095] E.sup.1 is —H or methyl;

    [0096] E.sup.2 is absent when L.sup.4 is N, or is

    ##STR00014##

    when L.sup.4 is C; E.sup.3 is —H,

    ##STR00015##

    and

    [0097] E.sup.4 is

    ##STR00016##

    [0098] More preferably, the compound represented by Chemical Formula 3 is any one selected from the following compound group:

    [0099] (3) (R)-3-(4-(cyclohexylamino)-1H-pyrazole[4,3-c]pyridin-3-yl)-1-(3-phenylpiperidin-1-yl)propan-1-one; (5) 4-(4-(6-methyl-4-(tetrahydro-2H-pyran-4-yloxy)-1H-pyrazole[4,3-c]pyridin-3-yl)pyridin-2-yl)morpholine; (18) 3-(6-(4-(2-fluoroethyl)piperazin-1-yl)pyrimidin-4-yl)-5-(1-methylcyclopropoxy)-1H-indazole; and (20) (2S,6R)-2,6-dimethyl-4-(6-(5-(1-methylcyclopropoxy)-1H-indazol-3-yl)pyrimidin-4-yl)morpholine.

    [0100] In yet another embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 4 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00017##

    [0101] in Chemical Formula 4,

    [0102] α is —CH═ or —N═;

    [0103] G.sup.1 is —H, —OH, halogen, nitro, nitrile, a C.sub.1-5 linear or branched alkyl, a C.sub.1-5 linear or branched alkoxy, or an unsubstituted or substituted 5- to 8-membered-ring heteroarylamino containing at least one N,

    [0104] in which the substituted 5- to 8-membered-ring heteroaryl is a 5- to 8-membered-ring heteroaryl substituted with —OH, halogen or a C.sub.1-3 linear or branched alkyl;

    [0105] G.sup.2 is —H, —OH, halogen, nitro, nitrile, a C.sub.1-5 linear or branched alkyl, a C.sub.1-5 linear or branched alkoxy, an unsubstituted or substituted C.sub.6-10 aryl, or an unsubstituted or substituted 5- to 8-membered-ring heterocycloalkyl containing at least one hetero atom selected from the group consisting of N and O,

    [0106] in which the substituted C.sub.6-10 aryl and the substituted 5- to 8-membered-ring heterocycloalkyl are independently a C.sub.6-10 aryl and a 5- to 8-membered-ring heterocycloalkyl substituted with at least one substituent selected from the group consisting of a C.sub.1-5 linear or branched alkyl, a C.sub.1-5 linear or branched alkoxy, and a 6-membered-ring unsubstituted heterocycloalkyl C.sub.1-3 linear or branched alkyl containing N and O; and

    [0107] G.sup.3 is —H, —OH, halogen, nitro, nitrile, a C.sub.1-5 linear or branched alkyl, a C.sub.1-5 linear or branched alkoxy, an unsubstituted or at-least-one-nitrile-substituted C.sub.6-10 aryl, or an unsubstituted or substituted 5- to 10-membered-ring heteroaryl containing at least one hetero atom selected from the group consisting of N, O and S,

    [0108] in which the substituted 5- to 10-membered-ring heteroaryl is a 5- to 10-membered-ring heteroaryl substituted with at least one substituent selected from the group consisting of halogen, a C.sub.1-5 linear or branched alkyl, and nitrile.

    [0109] Preferably,

    [0110] G.sup.1 is —H or

    ##STR00018##

    [0111] G.sup.2 is

    ##STR00019##

    and

    [0112] G.sup.3 is nitrile,

    ##STR00020##

    [0113] More preferably, the compound represented by Chemical Formula 4 is any one selected from the following compound group:

    [0114] (19) 6-(1-methyl-1H-pyrazol-3-ylamino)-4-(3-methyl-4-(morpholinomethyl)phenyl)-1H-pyrrolo[2,3-b]pyridine carbonitrile; (21) 3-(4-morpholino-1H-pyrrolo[2,3-b]pyridin-3-yl)benzonitrile; and (22) 1-methyl-4-(4-morpholino-7H-pyrrolo[2,3-d]pyrimidin-5-yl)-1H-pyrrole-2-carbonitrile.

    [0115] In still yet another embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 5 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00021##

    [0116] in Chemical Formula 5,

    [0117] M.sup.1 is an unsubstituted or at-least-one-halogen-substituted C.sub.6-10 aryl;

    [0118] M.sup.2 is an unsubstituted 6- to 8-membered-ring heteroaryl containing at least one hetero atom selected from the group consisting of N, O and S; and

    [0119] M.sup.3 is an unsubstituted 6- to 8-membered-ring heterocycloalkyl containing at least one hetero atom selected from the group consisting of N, O and S.

    [0120] Preferably, the compound represented by Chemical Formula 5 is the following compound:

    [0121] (4) 2-(4-fluorobenzyloxy)-5-(1-(2-morpholinoethyl)-1H-pyrazol-4-yl)-N-(pyridin-3-yl)benzamide.

    [0122] In a further embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 6 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00022##

    [0123] in Chemical Formula 6,

    [0124] Q.sup.1 is —H, amino, a C.sub.1-5 linear or branched alkyl, or a C.sub.1-5 linear or branched alkoxy;

    [0125] Q.sup.2 is —H, or an unsubstituted C.sub.6-10 cycloalkyl;

    [0126] Q.sup.3 is —H, a C.sub.1-5 linear or branched alkyl, or a C.sub.1-5 linear or branched alkoxy; and

    [0127] Q.sup.4 is a methyl-substituted 5-membered-ring heteroaryl containing at least one N.

    [0128] Preferably, the compound represented by Chemical Formula 6 is the following compound:

    [0129] (13) (R)-4-(1-cyclopropylethylamino)-7-(1-methyl-1H-pyrazol-4-yl)cinnoline-3-carboxamide.

    [0130] In still a further embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 7 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00023##

    [0131] in Chemical Formula 7,

    [0132] T.sup.1 is —H, a C.sub.1-5 linear or branched alkyl, or an unsubstituted C.sub.3-8 cycloalkylcarbonyl.

    [0133] Preferably, the compound represented by Chemical Formula 7 is the following compound:

    [0134] (15) cyclopropyl[10,11,14,15-tetrahydro-1,16-etheno-4,8-(metheno)pyrazole[3,4-j][1,4,7,9]oxatriazacyclohexadecin-12(13H)-yl]methanone.

    [0135] In yet a further embodiment, the LRRK2 protein inhibitor may be a compound represented by Chemical Formula 8 below, an optical isomer thereof, or a pharmaceutically acceptable salt thereof:

    ##STR00024##

    [0136] in Chemical Formula 8,

    [0137] Z.sup.1 is —H, amino, a C.sub.1-5 linear or branched alkyl, or a C.sub.1-5 linear or branched alkoxy;

    [0138] Z.sup.2 is a 5- to 8-membered-ring heteroaryl containing at least one N and substituted with a C.sub.1-5 linear or branched alkyl; and

    [0139] Z.sup.3 is —H, a C.sub.1-5 linear or branched alkyl, or a C.sub.1-5 linear or branched alkoxy.

    [0140] Preferably, the compound represented by Chemical Formula 8 is the following compound:

    [0141] (17) (4-(6-amino-5-(1-isopropyl-1H-1,2,3-triazol yl)pyridin-3-yl)-2-methoxyphenyl)(morpholino)methanone.

    [0142] According to the present invention, the pharmaceutical composition may be used to treat brain cancer, particularly brain cancer in which the LRRK2 protein is expressed or activated. The LRRK2 protein activity may be exhibited through phosphorylation, of the LRRK2 protein.

    [0143] According to the present invention, the LRRK2 protein inhibitor may be used in the form of a pharmaceutically acceptable salt thereof. Here, a useful salt may be an acid addition salt formed using a pharmaceutically acceptable free acid.

    [0144] The acid addition salt may be obtained from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, phosphorous acid and the like, non-toxic organic acids such as aliphatic mono- and dicarboxylate, phenyl-substituted alkanoate, hydroxyalkanoate and alkanedioate, aromatic acids, aliphatic and aromatic sulfonic acids, etc., or organic acids such as acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, fumaric acid, etc. Examples of the pharmaceutically non-toxic salt include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, iodide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methyl benzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, benzene sulfonate, toluene sulfonate, chlorobenzene sulfonate, xylene sulfonate, phenyl acetate, phenyl propionate, phenyl butyrate, citrate, lactate, β-hydroxybutyrate, glycolate, maleate, tartrate, methane sulfonate, propane sulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate, and the like.

    [0145] The acid addition salt according to the present invention may be prepared through a typical method, for example, by dissolving an LRRK2 protein inhibitor derivative in an organic solvent such as methanol, ethanol, acetone, methylene chloride or acetonitrile and adding an organic acid or an inorganic acid thereto to give a precipitate, which is then filtered and dried, or by subjecting a solvent and an excess of acid to vacuum distillation, drying and then crystallization in the presence of an organic solvent.

    [0146] Also, the LRRK2 protein inhibitor according to the present invention may be prepared in the form of a pharmaceutically acceptable metal salt using a base. Specifically, an alkali metal or alkaline earth metal salt may be obtained by, for example, dissolving the compound in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating the filtrate to dryness. Here, as the metal salt, a sodium salt, a potassium salt or a calcium salt is pharmaceutically appropriate. Furthermore, the corresponding salt may be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (e.g. silver nitrate).

    [0147] In the pharmaceutical composition according to the present invention, the LRRK2 protein inhibitor, the optical isomer thereof, or the pharmaceutically acceptable salt thereof may be administered orally or parenterally in various dosage forms upon clinical administration. The formulation thereof may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like, which are usually used.

    [0148] Examples of the formulations for oral administration include tablets, pills, hard/soft capsules, liquids, suspensions, emulsions, syrups, granules, elixirs, troches and the like. These formulations may contain diluents (such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), or lubricants (such as silica, talc, stearic acid and magnesium or calcium salts thereof and/or polyethylene glycol), in addition to the active ingredient. The tablets may contain binders such as magnesium aluminum silicate, starch paste, gelatin, methyl cellulose, sodium carboxymethyl cellulose and polyvinyl pyrrolidine, and the like, and may optionally contain disintegrants such as starch, agar, alginic acid or sodium salts thereof, or boiling mixtures, absorbents, colorants, flavoring agents, and sweetening agents.

    [0149] In addition, the present invention pertains to a pharmaceutical kit for the prevention or treatment of brain cancer, including a first component containing a pharmaceutically effective amount of an LRRK2 protein inhibitor as an active ingredient and a second component containing a pharmaceutically effective amount of Avastin as an active ingredient.

    [0150] In the pharmaceutical kit for the prevention or treatment of brain cancer according to the present invention, the first component and the second component may be sequentially or simultaneously administered. When the first component and the second component are sequentially administered, the second component may be administered 30 min to 180 min, 60 min to 120 min, or 80 min to 100 min before or after administration of the first component. In an embodiment of the present invention, the second component may be administered 90 min after administration of the first component.

    [0151] When the first component and the second component included in the pharmaceutical kit are co-administered, the anticancer activity against brain cancer may be increased. The above administration may include administration to a mammal, particularly a human.

    [0152] In addition, the present invention pertains to a method of treating brain cancer, including administering an LRRK2 protein inhibitor to a subject.

    [0153] The LRRK2 protein may have the characteristics described above, and a detailed description thereof is omitted. The subject may be a mammal, particularly a human.

    [0154] The pharmaceutical composition according to the present invention, containing, as an active ingredient, the LRRK2 protein inhibitor, the optical isomer thereof, or the pharmaceutically acceptable thereof, may be administered parenterally, and examples of parenteral administration include subcutaneous injection, intravenous injection, intramuscular injection, and intrathoracic injection.

    [0155] Here, in order to produce the formulation for parenteral administration, the LRRK2 protein inhibitor, the optical isomer thereof, or the pharmaceutically acceptable salt thereof is mixed with water, along with a stabilizer or a buffer, to afford a solution or suspension, which is prepared in an ampoule or vial unit dosage form. The composition may be sterilized, and may further contain an adjuvant, such as a preservative, a stabilizer, a hydration or emulsification accelerator, a salt for controlling osmotic pressure, and a buffer, as well as other therapeutically useful substances, and may be formulated through typical mixing, granulating or coating.

    [0156] Moreover, the dose of the pharmaceutical composition according to the present invention, containing the LRRK2 protein inhibitor, the optical isomer thereof, or the pharmaceutically acceptable salt thereof as the active ingredient, administered to a human may vary depending on the patient's age, body weight, gender, dosage form, state of health and severity of disease, and is typically 0.1 to 1000 mg/day, and preferably 1 to 500 mg/day based on an adult patient weighing 70 kg, and moreover, may be administered once or several times a day at regular time intervals, as prescribed by a doctor or pharmacist.

    [0157] In addition, the present invention pertains to a method of treating brain cancer, including administering an LRRK2 protein inhibitor to a subject and administering Avastin to the subject.

    [0158] The LRRK2 protein may have the characteristics described above, and a detailed description thereof is omitted.

    [0159] In the method of treating brain cancer according to the present invention, the LRRK2 protein inhibitor and Avastin may be sequentially or simultaneously administered. When the LRRK2 protein inhibitor and Avastin are sequentially administered, Avastin may be administered 30 min to 180 min, 60 min to 120 min, or 80 min to 100 min before or after administration of the LRRK2 protein inhibitor. In an embodiment of the present invention, Avastin may be administered 90 min after administration of the LRRK2 protein inhibitor.

    [0160] When the LRRK2 protein inhibitor and Avastin are co-administered, the anticancer activity against brain cancer may be increased. The above administration may include administration to a mammal, particularly a human.

    [0161] In addition, the present invention pertains to the use of an LRRK2 protein inhibitor in the preparation of a pharmaceutical composition for the treatment of brain cancer.

    [0162] The present inventors have first proved that the LRRK2 protein inhibitor is effective in significantly inhibiting tumor formation by easily penetrating the blood-brain barrier through which general drugs are difficult to pass. The experimental results therefor will be described in detail through the following experimental examples.

    MODE FOR INVENTION

    [0163] A better understanding of the present invention will be given through the following examples and experimental examples.

    [0164] Here, the examples and experimental examples are merely set forth to illustrate the present invention, and are not to be construed as limiting the present invention.

    <Example 1> Preparation of 5-chloro-N4-(2-(isopropylsulfonyl)phenyl)-N2-(2-methoxy-4-(4-(4-methylpiperazin-1-yl)piperidin-1-yl)phenyl)pyrimidine-2,4-diamine

    [0165] ##STR00025##

    [0166] The above compound was prepared with reference to WO 2004080980, WO 2005016894, WO 2009102446, WO 2012019132 or WO 2015077602.

    <Example 2> Preparation of N-(2-(2-(3-chloro methoxyphenylamino)-5-fluoropyrimidin ylamino)phenyl)methanesulfonamide

    [0167] ##STR00026##

    [0168] The above compound was prepared with reference to WO 2009127642.

    <Example 3> Preparation of (R)-3-(4-(cyclohexylamino)-1H-pyrazole[4,3-c]pyridin-3-yl)-1-(3-phenylpiperidin-1-yl)propan-1-one

    [0169] ##STR00027##

    [0170] The above compound was prepared with reference to WO 2010106333.

    <Example 4> Preparation of 2-(4-fluorobenzyloxy)-5-(1-(2-morpholinoethyl)-1H-pyrazol-4-yl)-N-(pyridin-3-yl)benzamide

    [0171] ##STR00028##

    [0172] The above compound was prepared with reference to WO 2011038572.

    <Example 5> Preparation of 4-(4-(6-methyl (tetrahydro-2H-pyran-4-yloxy)-1H-pyrazole[4,3-c]pyridin yl)pyridin-2-yl)morpholine

    [0173] ##STR00029##

    [0174] The above compound was prepared with reference to WO 2011141756.

    <Example 6> Preparation of (4-(dimethylamino)piperidin-1-yl) (3-methoxy-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino)phenyl)methanone

    [0175] ##STR00030##

    [0176] The above compound was prepared with reference to WO 2011151360.

    <Example 7> Preparation of (S)-3-(cyclopropylthio)-7-methyl-1-(1H-pyrazol-3-yl)-6,7-dihydrothieno[3,4-c]pyridin-4(5H)-one

    [0177] ##STR00031##

    [0178] The above compound was prepared with reference to WO 2012058193.

    <Example 8> Preparation of N4-ethyl-N2-(1-(3-fluoro (oxetan-3-yl)piperidin-4-yl)-3-methyl-1H-pyrazol-4-yl)-5-(trifluoromethyl)pyrimidine-2,4-diamine

    [0179] ##STR00032##

    [0180] The above compound was prepared with reference to WO 2012062783.

    <Example 9> Preparation of 3-(cyclopentylthio)-6,6-dimethyl-1-(1H-pyrazol-3-yl)-6,7-dihydrobenzo[c]thiophen-4(5H)-one

    [0181] ##STR00033##

    [0182] The above compound was prepared with reference to WO 2012118679.

    <Example 10> Preparation of 2-[(2-methoxy-4-[[4-(4-methylpiperazin-1-yl)piperidin-1-yl]carbonyl]phenyl)amino]-5,11-dimethyl-5,11-dihydro-6H-pyrimido[4,5-b][1,4]benzodiazepin-6-one

    [0183] ##STR00034##

    [0184] The above compound was prepared with reference to WO 2010080712 or WO 2015176010.

    <Example 11> Preparation of (4-(4-(ethylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino)-2-fluoro-5-methoxyphenyl)(morpholino)methanone

    [0185] ##STR00035##

    [0186] The above compound was prepared with reference to WO 2011151360.

    <Example 12> Preparation of (3-methoxy-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino)phenyl)(morpholino)methanone

    [0187] ##STR00036##

    12-1. Preparation-1 of (3-methoxy-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin ylamino)phenyl)(morpholino)methanone

    [0188] The above compound was prepared with reference to WO 2011151360.

    12-2. Preparation-2 of (3-methoxy-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin ylamino)phenyl)(morpholino)methanone

    [0189] ##STR00037##

    [0190] Step 1. 2,4-dichloro-5-iodopyrimidine (1.0 equivalent) was dissolved in THF and then added with methylamine (3.5 wt % in EtOH, 1.1 equivalents) at 0° C. The mixture was stirred at 0° C. for 2 hr, the solvent was removed therefrom, and the resulting product was used in the subsequent step without further purification (yield: 100%).

    [0191] Step 2. A two-necked round-bottom flask was purged with nitrogen gas, and CuI (5.0 equivalents) and KF (5.0 equivalents) were placed therein. The resulting mixture was heated to 150° C. and then stirred for 2 hr under reduced pressure. After the reaction, the temperature was decreased to room temperature and trimethyl(trifluoromethyl)silane (5.0 equivalents) dissolved in DMF/NMP (1:1) under nitrogen was added using a syringe. After reaction for 30 min, 2-chloro-5-iodo-N-methylpyrimidine-4-amine (1.0 equivalent) dissolved in DMF/NMP (1:1) was added using a syringe and allowed to react at 50° C. for 18 hr. After the reaction, the resulting product was added with water to form a precipitate, which was then filtered off. From the filtrate thus obtained, the organic material was extracted using EtOAc (×3). The combined organic layer was washed with brine, and the remaining water was removed using Na.sub.2SO.sub.4. The dewatered mixture was purified using MPCL (EtOAc:Hex), thereby obtaining a yellow solid target compound (yield: 70%).

    [0192] Step 3. 2-chloro-N-methyl-5-(trifluoromethyl) pyrimidine-4-amine (1.0 equivalent) and (4-amino-3-methoxyphenyl)(morpholino)methanone (1.0 equivalent) were dissolved in dioxane and added with p-toluenesulfonic acid (1.0 equivalent) at room temperature. The resulting mixture was stirred at 100° C. for 16 hr and cooled to room temperature, the solvent was removed therefrom, and then ice water was added thereto. The organic material was extracted using EtOAc (×3). The combined organic layer was washed with brine, and the remaining water was removed using Na.sub.2SO.sub.4. The dewatered mixture was purified using MPCL (EtOAc:Hex), thereby obtaining a white solid target compound (yield: 70%).

    <Example 13> Preparation of (R)-4-(1-cyclopropylethylamino)-7-(1-methyl-1H-pyrazol-4-yl)cinnoline-3-carboxamide

    [0193] ##STR00038##

    [0194] The above compound was prepared with reference to WO 2012162254.

    <Example 14> Preparation of 1-(5-chloro-4-(4-(methylamino)-5-(trifluoromethyl)pyrimidin-2-ylamino)-1H-pyrazol-1-yl)-2-methylpropan-2-ol

    [0195] ##STR00039##

    [0196] The above compound was prepared with reference to WO 2012062783.

    <Example 15> Preparation of cyclopropyl[10,11,14,15-tetrahydro-1,16-etheno-4,8-(metheno)pyrazole[3,4-j][1,4,7,9]oxatriazacyclohexadecin-12(13H)-yl]methanone

    [0197] ##STR00040##

    [0198] The above compound was prepared with reference to WO 2013046029.

    <Example 16> Preparation of N2-(5-chloro-1-((3S,4R)-3-fluoro-1-(oxetan-3-yl)piperidin-4-yl)-1H-pyrazol-4-yl)-N4-methyl-5-(trifluoromethyl)pyrimidine-2,4-diamine

    [0199] ##STR00041##

    [0200] The above compound was prepared with reference to Journal of Medicinal Chemistry (2014), 57(3), 921-936.

    <Example 17> Preparation of (4-(6-amino-5-(1-isopropyl-1H-1,2,3-triazol-4-yl)pyridin-3-yl)-2-methoxyphenyl)(morpholino)methanone

    [0201] ##STR00042##

    [0202] The above compound was prepared with reference to WO 2014106612.

    <Example 18> Preparation of 3-(6-(4-(2-fluoroethyl)piperazin-1-yl)pyrimidin-4-yl)-5-(1-methylcyclopropoxy)-1H-indazole

    [0203] ##STR00043##

    [0204] The above compound was prepared with reference to WO 2014137723.

    <Example 19> Preparation of 6-(1-methyl-1H-pyrazol-3-ylamino)-4-(3-methyl-4-(morpholinomethyl)phenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonitrile

    [0205] ##STR00044##

    [0206] The above compound was prepared with reference to WO 2014170248.

    <Example 20> Preparation of (2S,6R)-2,6-dimethyl-4-(6-(5-(1-methylcyclopropoxy)-1H-indazol-3-yl)pyrimidin-4-yl)morpholine

    [0207] ##STR00045##

    [0208] The above compound was prepared with reference to WO 2014137723.

    <Example 21> Preparation of 3-(4-morpholino-1H-pyrrolo[2,3-b]pyridin-3-yl)benzonitrile

    [0209] ##STR00046##

    [0210] The above compound was prepared with reference to WO 2015092592.

    <Example 22> Preparation of 1-methyl-4-(4-morpholino-7H-pyrrolo[2,3-d]pyrimidin-5-yl)-1H-pyrrole-2-carbonitrile

    [0211] ##STR00047##

    [0212] The above compound was prepared with reference to USA 20140005183 Aa.

    [0213] The structures of the compounds prepared in Examples 1 to 22 are shown in Table 1 below.

    TABLE-US-00001 TABLE 1 Example Chemical structure  1 [00048]embedded image  2 [00049]embedded image  3 [00050]embedded image  4 [00051]embedded image  5 [00052]embedded image  6 [00053]embedded image  7 [00054]embedded image  8 [00055]embedded image  9 [00056]embedded image 10 [00057]embedded image 11 [00058]embedded image 12 [00059]embedded image 13 [00060]embedded image 14 [00061]embedded image 15 [00062]embedded image 16 [00063]embedded image 17 [00064]embedded image 18 [00065]embedded image 19 [00066]embedded image 20 [00067]embedded image 21 [00068]embedded image 22 [00069]embedded image

    <Comparative Example> Preparation of 2-methyl-2-[3-methyl-4-[[4-(methylamino)-5-(trifluoromethyl)pyrimidin-2-yl]amino]pyrazol-1-yl]propanenitrile

    [0214] ##STR00070##

    [0215] The title compound was prepared with reference to WO 2012062783.

    <Experimental Example 1> Evaluation of LRRK2 Protein Expression in Cancer Stem Cells of Brain Tumor Patients

    [0216] In order to evaluate the potential to use the LRRK2 protein as a target protein for the treatment of brain tumors, Western blotting was performed using cancer tissues obtained from 19 brain tumor patients, and LRRK2 protein expression was thus assayed.

    [0217] Specifically, cancer tissues were obtained from brain tumor patients, and Western blotting was performed to assay the LRRK2 protein expression. The results are shown in FIG. 1.

    [0218] As shown in FIG. 1, the LRRK2 protein was expressed in cancer tissues obtained from brain tumor patients, and the expression level was elevated with an increase in brain tumor malignancy. Therefore, it was confirmed that the LRRK2 protein is useful as a target for the treatment of brain tumors.

    <Experimental Example 2> Evaluation of Prognosis in Brain Tumor Patients Due to LRRK2 Protein Phosphorylation

    [0219] The LRRK2 protein exhibits the activity thereof by being phosphorylated. Thus, changes in the prognosis of brain tumor patients due to LRRK2 protein phosphorylation in brain tumor cells were measured.

    [0220] Specifically, tissue samples were obtained from about 200 stage 3 and stage 4 brain tumor patients, and the expression of phosphorylated LRRK2 protein in the obtained tissue samples was measured through immunostaining.

    [0221] As shown in FIG. 2, the LRRK2 protein phosphorylation increased with an increase in brain tumor malignancy, that is, with progression of the brain tumor from the third stage to the fourth stage. Therefore, it was confirmed that phosphorylated LRRK2 protein is useful as a target protein for the treatment of brain tumors with high malignancy.

    <Experimental Example 3> Correlation Between LRRK2 Protein Mutation and Brain Tumor

    [0222] According to conventional studies, it has been reported that various carcinomas may be generated by mutation occurring in the LRRK2 protein, and that Parkinson's disease, which is known to be associated with the LRRK2 protein, is also caused by LRRK2 protein mutation. Thus, whether the LRRK2 protein, which was confirmed to be overexpressed in brain tumor cells in the above Experimental Example, is a mutant thereof was evaluated. Specifically, sequencing was performed using brain tumor cells obtained from five patients using the primers shown in Table 2 below.

    TABLE-US-00002 TABLE 2 Name Sequence (5′.fwdarw.3′) SEQ ID NO: LRRK2_F1_For Gagcagcggacgttcatg SEQ ID NO: 1 LRRK2_F1_rev Tatgagctgggaaatggcca SEQ ID NO: 2 LRRK2_F1_For_2 Gcgggttggaagcaggtg SEQ ID NO: 3 LRRK2_F1_rev_2 Tcagcatggagagcatcact SEQ ID NO: 4 LRRK2_F2_For Agtacccagagaatgcagca SEQ ID NO: 5 LRRK2_F2_rev Gctcccaatagaagcaagca SEQ ID NO: 6 LRRK2_F3_For Gaactggacatctgctggc SEQ ID NO: 7 LRRK2_F3_rev Ctcgtgagtgcattctggtg SEQ ID NO: 8 LRRK2_F3_For_2 Cataggaactggacatctgc SEQ ID NO: 9 LRRK2_F3_rev_2 Cattctggtgaagctccagc SEQ ID NO: 10 LRRK2_F4_For Ctcaggcagcgatggaaatt SEQ ID NO: 11 LRRK2_F4_rev Gacagccaatctcaggagga SEQ ID NO: 12 LRRK2_F5_For Gctatgcctttcttgcctcc SEQ ID NO: 13 LRRK2_F5_rev Gcagtgctgggtcttgaaaa SEQ ID NO: 14 LRRK2_F6_For Cctgtgattctcgttggcac SEQ ID NO: 15 LRRK2_F6_rev Aggctgctcggtaaactgat SEQ ID NO: 16 LRRK2_F7_For Ttcctgggttgctggagatt SEQ ID NO: 17 LRRK2_F7_rev Tcccagacacaatccagctt SEQ ID NO: 18 LRRK2_F8_For Acttctgcccaggtctttga SEQ ID NO: 19 LRRK2_F8_rev Tgtgagtaccctttccatgt SEQ ID NO: 20 ga LRRK2_F1_500F Gatctcctcctaacttcag SEQ ID NO: 21 LRRK2_F1_700r Caatgcagcacatgaagc SEQ ID NO: 22 LRRK2_F2_500F Gaagtggctgaaagtggctg SEQ ID NO: 23 LRRK2_F2_700r Gaatatcattcttgaaacac SEQ ID NO: 24 LRRK2_F3_500F Catcagcttgctcttaagg SEQ ID NO: 25 LRRK2_F3_700r Gaggctgttccttcttcc SEQ ID NO: 26 LRRK2_F5_500F Cttataaccgaatgaaac SEQ ID NO: 27 LRRK2_F5_700r Ctatagaattcctcacgac SEQ ID NO: 28 LRRK2_F7_500F Ggatcgcctgcttcagcag SEQ ID NO: 29 LRRK2_F7_700r Cattctacagcagtactg SEQ ID NO: 30 LRRK2_F8_500F Gctgctcctttgaagatac SEQ ID NO: 31 LRRK2_F8_700r Gtctaccaccactgttatg SEQ ID NO: 32

    [0223] As shown in FIG. 3, nucleic acid sequences encoding the LRRK2 protein expressed in brain tumor cells had no specific mutations such as those commonly found in Parkinson's disease, except for the known single nucleotide polymorphism (SNP). Therefore, it was confirmed that, unlike Parkinson's disease or other types of cancer, brain tumors were caused by overexpressing wild-type LRRK2 protein, resulting in cancer.

    <Experimental Example 4> Evaluation of Tumorigenicity due to overexpression of LRRK2 protein

    [0224] In order to evaluate whether brain tumors were caused by LRRK2 protein overexpression as confirmed in Experimental Example 3, a lentiviral vector (pLenti CMV GFP DEST(736-1), Addgene #19732) containing a polynucleotide encoding the LRRK2 protein was manufactured, and 528NS, 464T (Samsung Seoul Hospital, Korea) and ex-vivo cell lines were infected therewith to form tumors. Here, the cells were infected with a lentiviral vector not expressing the LRRK2 protein, as a control.

    [0225] As shown in the results of FIG. 4, the size of GSC (glioma stem cell) spheres was increased in 528NS, 464T or ex-vivo cell lines infected with lentivirus expressing the LRRK2 protein compared to the control. Therefore, it was confirmed that the LRRK2 protein overexpression resulted in a tumor.

    <Experimental Example 5> Evaluation of LRRK2 Protein phosphorylation inhibitory activity of compound (in vitro)-(1)

    [0226] In order to evaluate drug efficacy in vitro, a Western blotting experiment was performed using brain-tumor-patient-derived cell line NCC01 cells.

    [0227] More specifically, 7.5×10.sup.5 to 1.0×10.sup.6 NC001 cells were treated with the compound of each of Examples 10, 11, 12, 20, 21 and 22 at a concentration of 1.00 or 1,000 nM, and after 1 day, samples were collected and evaluated for LRRK2 protein phosphorylation inhibitory activity via Western blotting. Here, the group not treated with the compound of Example was used as a vehicle. The results are shown in FIGS. 5 and 6.

    [0228] As shown in FIGS. 5 and 6, the compounds of Examples 10, 11, 12, 20, 21 and 22 according to the present invention significantly inhibited LRRK2 protein phosphorylation in brain-tumor-patient-derived cell line NCC01 cells, compared to the vehicle.

    [0229] Therefore, it was confirmed that the compound of the present invention inhibited LRRK2 protein phosphorylation expressed in the brain-tumor-patient-derived cell line.

    <Experimental Example 6> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity of Compound Depending on Compound Concentration (In Vitro)-(1)

    [0230] In order to specifically determine the concentration of the compound of Example according to the invention at which high efficacy is exhibited, this experiment was performed in a manner similar to the evaluation of LRRK2 protein phosphorylation inhibitory activity in Experimental Example 1.

    [0231] More specifically, 7.5×10.sup.5 to 1.0×10.sup.6 NCC01 cells were treated with the compound of each of Examples 10 and 12 at concentrations of 0.5, 1, 5, 10, 50 and 100 nM, and after 1 day, samples were collected and evaluated for LRRK2 protein phosphorylation inhibitory activity via Western blotting. Here, the group not treated with the compound of Example was used as a vehicle. The results are shown in FIGS. 7 to 10.

    [0232] As shown in FIGS. 7 to 10, the phosphorylated LRRK2 protein was detected when using the compound of Example 10 at a concentration of 100 nM, but the compound of Example 12 mostly inhibited LRRK2 protein phosphorylation at concentrations of 50 and 100 nM.

    [0233] Therefore, it was confirmed that the compound of the present invention significantly inhibited LRRK2 protein phosphorylation even at low nM concentrations.

    <Experimental Example 7> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity of Compound Depending on Treatment Time (In Vitro)

    [0234] In order to evaluate changes in the activity of the compound of Example according to the present invention over time after treatment therewith, this experiment was performed in a manner similar to the evaluation of LRRK2 protein phosphorylation inhibitory activity in Experimental Example 1.

    [0235] More specifically, 7.5×10.sup.5 to 1.0×10.sup.6 NCC01 cells were treated with the compound of Example 12 at a concentration of 100 nM, and after 1 day, 4 days and 8 days, samples were collected and evaluated for LRRK2 protein phosphorylation inhibitory activity via Western blotting. Here, the group not treated with the compound of Example was used as a vehicle. The results are shown in FIGS. 11 and 12.

    [0236] As shown in FIGS. 11 and 12, the extent of LRRK2 protein phosphorylation was drastically reduced starting 1 day after treatment of brain-tumor-patient-derived cell line NCC01 cells with the compound of Example 12, and the reduction thereof continued over time.

    [0237] Therefore, it was confirmed that the compound of Example of the present invention inhibited LRRK2 protein phosphorylation continuously for a long period of time.

    <Experimental Example 8> Evaluation of Changes in Intracellular Signaling Pathway Due to Inhibition of LRRK2 Protein Phosphorylation (In Vitro)

    [0238] An experiment was conducted in order to determine the effect of the compound of Example according to the present invention on the intracellular signaling pathway for cancer stem cell growth.

    [0239] More specifically, 1.0×10.sup.6 NCC01 cells were treated with the compound of Example 12 at concentrations of 50, 100, 500, 1,000 and 2,000 nM. After 1 day, samples were collected and the expression of NESTIN protein, which is a cancer stem cell marker involved in the intracellular signaling pathway, was measured through Western blotting. Here, the group not treated with the compound of Example was used as a vehicle. The results are shown in FIGS. 13 to 15.

    [0240] As shown in FIGS. 13 to 15, the LRRK2 protein phosphorylation in NCC01 cells was inhibited by the compound of Example 12, which also decreased in a manner dependent on the concentration of the compound that was used.

    [0241] Therefore, it was confirmed that the compound of Example 12 according to the present invention inhibited LRRK2-protein-mediated signaling in the cells derived from brain tumor patients, thereby reducing the expression of NESTIN protein involved in tumor stem cell growth and thus inhibiting cell growth.

    <Experimental Example 9> Evaluation of Changes in Mitochondrial Function Through Inhibition of LRRK2 Protein Activity

    [0242] The LRRK2 protein, which is located in the outer membrane of mitochondria, has been reported to be involved in the fragmentation of mitochondria and the regulation of membrane potential thereof. Thus, an experiment was conducted in order to determine the effect of the compound of Example inhibiting the LRRK2 protein on the mitochondrial function.

    [0243] Specifically, NCC01 cells were treated with the compound of Example 12 at 1 μM, and after 1 day, TMRE (tetramethylrhodamine ethylester) dye for staining activated mitochondria was added thereto to evaluate changes in mitochondrial function. Here, the group not treated with the compound of Example was used as a control. The results of staining were observed with a microscope, and are shown in FIG. 16.

    [0244] As shown in FIG. 16, the activity of the mitochondria in the cells of the control was maintained, whereby the color of the TMRE dye appeared clear. However, in the cells treated with the compound of Example 12, the degree of color development of the TMRE dye was decreased, and moreover, fragmentation of nuclei in the cells occurred. Therefore, it was confirmed that the compound of Example 12 according to the present invention inhibited mitochondrial activity to thus affect the death of brain tumor cells.

    <Experimental Example 10> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity in Brain Tumor Stem Cell Line

    [0245] An experiment was conducted in order to evaluate whether apoptosis of stem cells is induced by inhibiting LRRK2 protein phosphorylation in tumor stem cells, which are known to be associated with tumor metastasis.

    [0246] Specifically, brain tumor stem cell line NCC01 cells were treated with the compound of Example 12 at a concentration of 0.1 or 1 μM, and after 1 day, the mitochondria were stained as described in Experimental Example 9 to assay changes in the function thereof. Here, the group not treated with the compound of Example was used as a vehicle. The results of staining were observed with a microscope, and are shown in FIG. 17.

    [0247] As shown in FIG. 17, the activity of the mitochondria present in the brain tumor stem cells was inhibited in the group treated with the compound of Example 12, compared to the control. Therefore, it was confirmed that the compound according to the present invention inhibited mitochondrial activity to thus induce the death of brain tumor stem cells, resulting in suppressed tumor metastasis.

    <Experimental Example 11> Evaluation of TRAP1 Expression Inhibitory Activity of LRRK2 Protein Inhibitor in Brain Tumor Stem Cell Line

    [0248] An experiment was conducted in order to evaluate whether the LKKR2 protein inhibitor according to the present invention, inhibiting the mitochondrial activity in the brain tumor stem cell line as confirmed in Experimental Example 10, has an influence on changes in expression of TRAP1 (TNF receptor associated protein 1), which is known to be involved in mitochondrial function regulation.

    [0249] Specifically, brain tumor stem cell line NCC01 cells were added with the compound of Example 12 at a concentration of 100 or 1,000 nM, and after 1 day, changes in the expression of TRAP1 were measured through Western blotting. Here, the group not treated with the compound of Example was used as a vehicle.

    [0250] As shown in FIG. 18, the expression of TRAP1 was inhibited by the compound of Example 12. Therefore, it was confirmed that the compound according to the present invention inhibited the expression of TRAP1 to thereby suppress mitochondrial activity.

    <Experimental Example 12> Evaluation of Changes in LRRK2 Protein Expression Under Hypoxic Conditions

    [0251] Conventional studies have shown that hypoxic conditions are important in the function of GSC. Thus, changes in LRRK2 protein expression under hypoxic conditions and the size of GSC spheres upon inhibiting LRRK2 protein expression were measured.

    [0252] Specifically, NCC01 and 528NS cells were exposed to hypoxic conditions and treated with two kinds of shRNA against the LRRK2 gene, after which changes in the size of spheres were measured. Here, a control was shRNA (shNT) against luciferase.

    TABLE-US-00003 TABLE 3 Name Sequence (5′.fwdarw.3′) SEQ ID NO: LRRK2 shRNA-1 CCGGCCACAAATTCAACGGA SEQ ID NO: 33 AAGAACTCGAGTTCTTTCCG TTGAATTTGTGGTTTTT LRRK2 shRNA-2 CCGGCCCAAATTGGTGGAAC SEQ ID NO: 34 TCTTACTCGAGTAAGAGTTC CACCAATTTGGGTTTTT luciferase CCGGCGCTGAGTACTTCGAA SEQ ID NO: 35 shRNA ATGTCCTCGAGGACATTTCG AAGTACTCAGCGTTTTT

    [0253] As shown in FIG. 19, the sphere size of the NCC01 (a and b) and 528NS (c and d) cells exposed to hypoxic conditions was increased compared to the control, but was suppressed by LRRK2 shRNA-1 and LRRK2 shRNA-2, which are two kinds of shRNA against the LRRK2 gene. Therefore, it was confirmed that the growth of GSC, produced under hypoxic conditions, was suppressed through inhibition of LRRK2 protein expression.

    <Experimental Example 13> Evaluation of apoptosis Induction Activity Through Inhibition of LRRK2 Protein Phosphorylation (In Vitro)

    [0254] In order to evaluate whether apoptosis of brain tumor cells is induced by inhibiting LRRK2 protein phosphorylation, an experiment was conducted using FACS (fluorescence-activated cell sorting).

    [0255] More specifically, 7.5×10.sup.5 to 1.0×10.sup.6 NCC01 cells were treated with the compound of each of Examples 11, 12 and 21 at a concentration of 100 nM, and after 1 day, samples were collected and subjected to FACS, thus assaying the apoptosis induction activity. The group not treated with the compound of Example was used as a control. The results are shown in FIGS. 20 and 21.

    [0256] As shown in FIGS. 20 and 21, the compounds of Examples 11, 12 and 21 induced the apoptosis of NCC01 cells. In particular, the compound of Example 12 exhibited an apoptosis rate about 3 times as high as the compounds of Examples 11 and 21, indicating that the compound of Example 12 according to the present invention was very effective in inducing apoptosis compared to the compounds of other Examples.

    <Experimental Example 14> Evaluation of Growth Inhibitory Activity of Compound on Brain Tumor Cells in Animal Model-(1)

    [0257] An experiment was conducted in order to evaluate whether the compound of Example according to the present invention exhibits the growth inhibitory activity on brain tumor cells in an animal model.

    [0258] More specifically, 1.0×10.sup.4 NCC01 cells, a brain-tumor-patient-derived cell line, were injected into the brain of a Balb/c-nude mouse model, and after 3 days, the compound of Example 12 was orally administered at a dose of 10 mg/kg or 60 mg/kg. After administration of the compound, the survival rate of the mice based on the survival period was determined, and the size of the tumors generated in the mice was measured using MRI. Here, the group not treated with the compound of Example was used as a vehicle. The results are shown in FIGS. 22 and 23.

    [0259] As shown in FIG. 22, the average survival period of the mice was 54 days in the vehicle and was 71 days in the group orally administered with the compound of Example 12 at 10 mg/kg, and all the mice in the group orally administered with the compound of Example 12 at 60 mg/kg survived up to 100 days (Vehicle vs 10 mg/kg: p=0.032, Vehicle vs 60 mg/kg: p<0.001).

    [0260] As shown in FIG. 23, the tumor was formed at the position to which the N0001 cells were injected in the vehicle not treated with the compound, but no tumor was observed in the group orally administered with the compound of Example 12 at 10 mg/kg or 60 mg/kg.

    [0261] Therefore, it was confirmed that the compound of Example according to the present invention significantly inhibited the formation of tumors derived from brain tumor cells in the animal model.

    <Experimental Example 15> Evaluation of Therapeutic Effect on Brain Tumor Upon Co-Administration of Compound and Avastin

    [0262] An experiment was conducted in order to determine the therapeutic effect in an animal model when the compound of Example according to the present invention was administered in combination with Avastin, prescribed as a drug for treating brain tumors.

    [0263] More specifically, orthotopic mouse models were manufactured using 5-week-old Balb/c-nude mice. U87MG cells (ATCC, USA), a brain tumor cell line, were injected 3.5 mm deep at a position 2.2 mm to the left of and 0.5 mm behind the bregma using a stereotaxic device. 3 days after injection of the cells, mice were divided into three groups of 5 mice per group (a control (vehicle), a group administered with Avastin, and a group administered with the compound of Example 12 and Avastin), and the drug was administered thereto. The compound of Example 12 was orally administered at a dose of 30 mg/kg and Avastin was injected intraperitoneally at a dose of 10 mg/kg. Thereafter, the survival period was measured when the mice showed evidence of tumor formation such as a reduction in 20% or more of the total body weight thereof or abnormal behavior. The survival graph obtained using the statistical program is shown in FIG. 24.

    [0264] As shown in FIG. 24, when the compound of Example 12 was administered in combination with Avastin, the therapeutic effect of Avastin on brain tumors was further significantly increased.

    <Experimental Example 16> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity of Compound of Comparative Example (In Vitro)

    [0265] A Western blotting experiment was carried out using brain-tumor-patient-derived cell line NCC01 cells in order to evaluate in-vitro drug efficacy of the compound of Comparative Example, known as an LRRK2 protein inhibitor.

    [0266] More specifically, 7.5×10.sup.5 to 1.0×10.sup.6 cells were treated with the compound of Comparative Example at a concentration of 0.1 or 1.0 μM, and after 1 day, samples were collected and evaluated for LRRK2 protein phosphorylation inhibitory activity through Western blotting. Here, the group not treated with the compound of Example was used as a vehicle. The results are shown in FIG. 25.

    [0267] As shown in FIG. 25, the compound of Comparative Example according to the present invention was known to inhibit LRRK2 protein expression, but did not inhibit LRRK2 protein phosphorylation.

    <Experimental Example 17> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity of Compound (In Vitro)-(2)

    [0268] A Western blotting experiment was carried out using brain-tumor-patient-derived cell line 448T cells in order to evaluate in-vitro drug efficacy. Here, the experiment was conducted in the same manner under the same conditions as in Experimental Example 5, with the exception that 448T cells (Samsung Seoul Hospital, Korea) were used in lieu of NCC01 cells, and the compounds of Examples 10, 11, 12, 20 and 21 were used.

    [0269] As shown in FIG. 26, the compounds of Examples 10, 11, 12, 20 and 21 according to the present invention significantly inhibited LRRK2 protein phosphorylation in the brain-tumor-patient-derived cell line 448T cells, compared to the vehicle.

    [0270] Therefore, it was confirmed again that the compound according to the present invention inhibited LRRK2 protein phosphorylation expressed in the brain-tumor-patient-derived cell line.

    <Experimental Example 18> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity of Compound Depending on Compound Concentration (In Vitro)-(2)

    [0271] An experiment was conducted in order to determine the concentration of the compound of Example according to the invention, which is able to exhibit high efficacy in 448T cells. Specifically, the experiment was performed in the same manner under the same conditions as in Experimental Example 6, with the exception that 448T cells were used in lieu of NCC01 cells, and the compound of Example 12 was used at concentrations of 50, 100, 500, 1,000, and 2,000 nM.

    [0272] As shown in FIG. 27, the compound of Example 12 inhibited most of the LRRK2 protein phosphorylation at a concentration of 50 nM.

    [0273] Therefore, it was confirmed again that the compound according to the present invention significantly inhibited LRRK2 protein phosphorylation even at low nM concentrations.

    <Experimental Example 19> Evaluation of Growth Inhibitory Activity of Compound on Brain Tumor Cells in Animal Model-(2)

    [0274] An experiment was conducted in order to evaluate whether the compound of Example according to the present invention exhibits the growth inhibitory activity on brain tumor cells in an animal model. Specifically, the experiment was conducted in the same manner under the same conditions as in Experimental Example 14, with the exception that 448T cells were used in lieu of NCC01 cells, and the compound of each of Examples 12, 20 and 21 was orally administered at a dose of 60 mg/kg.

    [0275] As shown in FIG. 28, the tumor was formed at the position to which the 448T cells were injected in the vehicle not treated with the compound, but no tumor was observed in the group orally administered with the compound of each of Examples 12, 20 and 21.

    [0276] Therefore, it was confirmed again that the compound of Example according to the present invention significantly inhibited the formation of tumors derived from brain tumor cells in the animal model.

    <Experimental Example 20> Evaluation of LRRK2 Protein Phosphorylation Inhibitory Activity of Compound of Example and Comparative Example (In Vitro)

    [0277] An experiment was conducted in order to evaluate the in-vitro drug efficacy of the compound of Comparative Example, known as an LRRK2 protein inhibitor. Specifically, the experiment was conducted in the same manner under the same conditions as in Experimental Example 16, with the exception that 448T cells were used in lieu of NCC01 cells, and the compounds of Examples 1, 11 and 12 were used.

    [0278] As shown in FIG. 29, the compound of Comparative Example was known to inhibit LRRK2 protein expression, but did not inhibit LRRK2 protein phosphorylation, unlike the compounds of Examples 1, 11 and 12 according to the present invention.

    <Formulation Example 1> Preparation of Pharmaceutical formulation

    [0279] 1-1. Preparation of Powder

    [0280] 500 mg of the LRRK2 protein inhibitor of the present invention

    [0281] 100 mg of lactose

    [0282] 10 mg of talc

    [0283] A powder was manufactured by mixing the above components and placing the mixture in an airtight bag.

    [0284] 1-2. Preparation of Tablet

    [0285] 500 mg of the LRRK2 protein inhibitor of the present invention

    [0286] 100 mg of corn starch

    [0287] 100 mg of lactose

    [0288] 2 mg of magnesium stearate

    [0289] A tablet was manufactured by mixing the above components and tableting the mixture in accordance with a typical tablet-manufacturing method.

    [0290] 1-3. Preparation of Capsule

    [0291] 500 mg of the LRRK2 protein inhibitor of the present invention

    [0292] 100 mg of corn starch

    [0293] 100 mg of lactose

    [0294] 2 mg of magnesium stearate

    [0295] A capsule was manufactured by mixing the above components and placing the mixture in a gelatin capsule in accordance with a typical capsule-manufacturing method.

    [0296] 1-4. Preparation of Injection

    [0297] 500 mg of the LRRK2 protein inhibitor of the present invention

    [0298] Appropriate amount of sterile distilled water for injection

    [0299] Appropriate amount of pH modifier

    [0300] An injection was manufactured using the above amounts of the components per ampoule (2 ml) in accordance with a typical injection-manufacturing method.

    [0301] 1-5. Preparation of Liquid

    [0302] 100 mg of the LRRK2 protein inhibitor of the present invention

    [0303] 10 g of isomerized sugar

    [0304] 5 g of mannitol

    [0305] Appropriate Amount of Purified Water

    [0306] A liquid was manufactured by dissolving the above components in purified water, adding an appropriate amount of lemon flavor, mixing the above components, adding purified water such that the total volume was 100 ml, placing the resulting mixture in a brown bottle and performing sterilization, in accordance with a typical liquid-manufacturing method.