ANTI-CXCR4 ANTIBODY COMBINED WITH ACTIVATED AND EXPANDED NATURAL KILLER CELLS FOR CANCER IMMUNOTHERAPY

20230181635 · 2023-06-15

    Inventors

    Cpc classification

    International classification

    Abstract

    This disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of an isolated population of natural killer (NK) cells, preferably activated and expanded NK (NKAE) cells, and an antibody or an antigen-binding portion thereof that binds specifically to C-X-C Chemokine Receptor 4 (CXCR4) expressed on the surface of a cancer cell.

    Claims

    1. A method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of: (a) an isolated population of natural killer (NK) cells; and (b) an isolated antibody or an antigen-binding portion thereof that binds specifically to C-X-C Chemokine Receptor 4 (CXCR4) expressed on the surface of a cancer cell.

    2. The method of claim 1, wherein the population of NK cells comprises activated and expanded NK (NKAE) cells.

    3. The method of claim 2, wherein the NKAE cells are produced by: (a) stimulating NK cells with IL-2, IL-12, IL-15, and/or IL-21 in combination with feeder cells; or (b) coculturing peripheral blood mononuclear cells from healthy donors with (i) irradiated β-lymphoblastoid cells modified to express a membrane-bound form of interleukin-15 (IL-15) and 41BB ligand, and (ii) interleukin-2 (IL-2).

    4. (canceled)

    5. The method of claim 3, wherein the modified β-lymphoblastoid cells are K562-mb15-41BBL cells.

    6. The method of claim 1, wherein the NK cells are administered to the subject by intravenous, intraarterial, intraperitoneal or intrathecal injection, or injection into a tumor resection cavity. (Previously Presented) The method of claim 1, wherein a dose ranging from about 10.sup.6 to about 10.sup.14 of said NK cells are administered to the subject weekly.

    8. The method of claim 1, wherein: (a) the antibody or antigen-binding portion thereof is a monoclonal antibody or an antigen-binding portion thereof; (b) the subject is a human and the antibody or fragment thereof binds to a human CXCR4 receptor; and/or (c) the antibody or an antigen-binding portion thereof disrupts the interaction between CXCR4 and C-X-C motif chemokine 12 (CXCL12) and inhibits CXCR4/CXCL12 signaling.

    9-10. (canceled)

    11. The method of claim 8, wherein the antibody or an antigen-binding portion thereof exhibits one or more of the following characteristics: (a) binds to CXCR4 on a surface of a cancer cell with a K.sub.D of about 1×10.sup.−8 M or lower as determined by surface plasmon resonance (SPR); (b) inhibits binding of CXCL12 to CXCR4 with an EC.sub.50 of less than about 30 nM; (c) inhibits CXCL12-induced calcium flux in cells expressing CXCR4 with an EC.sub.50 of less than about 1 nM; (d) inhibits CXCL12-induced migration of cells expressing CXCR4 with an EC.sub.50 of less than about 20 nM; (e) inhibits capillary tube formation by human umbilical vein endothelial cells; induces apoptosis in cells expressing CXCR4; (g) inhibits proliferation of CXCR4.sup.+ tumor cells in vitro; (h) inhibits CXCR4.sup.+ tumor cell proliferation and/or induces CXCR4.sup.+ tumor cell apoptosis in vivo; (i) inhibits metastases of CXCR4.sup.+ tumor cells; and (j) increases survival time of a CXCR4.sup.+ tumor-bearing subject.

    12. The method of claim 1, wherein the anti-CXCR4 antibody or portion thereof comprises the CDR1, CDR2 and CDR3 domains in a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 25, and the CDR1, CDR2 and CDR3 domains in a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 29.

    13. The method of claim 1, wherein the anti-CXCR4 antibody or portion thereof comprises a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 25 or 33, and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 29 or 37.

    14. The method of claim 1, wherein the anti-CXCR4 antibody or portion thereof comprises a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 1, a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 5, a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 9, a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 13, a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 17, and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 21.

    15. The method of claim 1, wherein the antibody or antigen-binding portion thereof: (a) cross-competes with ulocuplumab for binding to human CXCR4; (b) binds to substantially the same epitope in human CXCR4 as does ulocuplumab; (c) is a chimeric, humanized or human monoclonal antibody or a portion thereof; (d) comprises a heavy chain constant region which is of a human IgG1, IgG2, or IgG4 isotype; (e) is ulocuplumab or an antigen-binding portion thereof; is a human IgG1 variant of ulocuplumab or an antigen-binding portion thereof; and/or (g) is chosen from the Abs designated c414H5, c515H7, Antibody I, 6C7, and h3G10.A57.A58 or is an antigen-binding portion thereof.

    16. The method of claim 1, wherein the cancer is a solid tumor or a hematological malignancy.

    17. The method of claim 16, wherein the solid tumor is a cancer selected from small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), squamous NSCLC, non-squamous NSCLC, squamous cell cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), ovarian cancer, cervical cancer, carcinoma of the fallopian tubes, uterine (endometrial) cancer, carcinoma of the endometrium, uterine sarcoma, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the urethra, cancer of the ureter, prostate cancer, metastatic castration-resistant prostate cancer (mCRPC), testicular cancer, penile cancer, bladder cancer, breast cancer, triple negative breast cancer (TNBC), male breast cancer, germ cell tumor, sarcoma, skin cancer, basal cell carcinoma, squamous cell carcinoma, Merkel cell carcinoma, bone cancer, melanoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), thyroid cancer, oral cancer, mouth cancer, salivary gland cancer, throat cancer, esophageal cancer, gastrointestinal cancer, gastric cancer, cancer of the small intestine, gallbladder and bile duct cancer, colorectal cancer, colon carcinoma, rectal cancer, anal cancer, liver cancer, hepatoma, kidney cancer, renal cell carcinoma, cancer of the endocrine system, tumors of the thymus gland, thymona, cancer of the parathyroid gland, cancer of the adrenal gland, soft tissue sarcoma, mesothelioma, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain cancer, glioma, brain stem glioma, glioblastoma, glioblastoma multiforme (GBM), neuroblastoma, pituitary adenoma, epidermoid cancer, solid tumors of childhood, pediatric sarcoma, metastatic cancer, cancer of unknown primary origin, environmentally-induced cancers, virus-related cancers, AIDS-related cancers, Kaposi's sarcoma, cancers of viral origin, advanced, refractory and/or recurrent solid tumors, and any combination of the preceding solid tumors.

    18. (canceled)

    19. The method of claim 16, wherein the hematological malignancy is selected from acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CIVIL), Hodgkin's lymphoma (HL), non-Hodgkin's lymphomas (NHLs), Burkitt's lymphoma, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, mantle cell lymphoma, mycosis fungoides, anaplastic large cell lymphoma, precursor T-lymphoblastic lymphoma, sinonasal natural killer/T-cell lymphoma, multiple myeloma (MM), myelodysplastic syndrome (MDS), smoldering myeloma, monoclonal gammopathy of undetermined significance (MGUS), advanced, metastatic, refractory and/or recurrent hematological malignancies, and any combination of the preceding hematological malignancies.

    20. The method of claim 1, wherein the antibody or antigen-binding portion thereof is administered: (a) at a flat dose of about 50 to about 2000 mg once or twice about every week, once about every 2 weeks, or once about every 3 weeks; (b) at a flat dose of about 200, about 400, about 800, about 1600, or about 2000 mg once about every week or once about every 2 weeks; and/or (c) to the subject by intravenous or subcutaneous administration.

    21. The method of claim 1, wherein: (a) the NK cells and the antibody or antigen-binding portion thereof are administered sequentially to the subject; (b) the NK cells are administered before the antibody or antigen-binding portion thereof; (c) the antibody or antigen-binding portion thereof is administered before the NK cells; (d) the NK cells and the antibody or antigen-binding portion thereof are administered concurrently in separate compositions; or (e) the NK cells and the antibody or antigen-binding portion thereof are admixed in a single composition and administered concurrently.

    22. A kit for treating a subject afflicted with a cancer, the kit comprising: (a) one or more dosages ranging from about 50 to about 2000 mg of an antibody or an antigen-binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell; (b) one or more dosages ranging from about 10.sup.6 to about 10.sup.14 of a population of NKAE cells; and (c) instructions for using the antibody or portion thereof and the NKAE cells in the method of claim 2.

    23. The method of claim 16, wherein the solid tumor is a pediatric tumor.

    24. The method of claim 23, wherein the pediatric tumor it a rhabdomyosarcoma, an osteosarcoma, a neuroblastoma, a retinoblastoma, or Ewing sarcoma.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0017] FIG. 1 shows an analysis of CXCR4 expression in six sarcoma cell lines (RH30, CW9019, A4573, A673, MG-63 and 143B) by (A) flow cytometry, and (B) quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). The alveolar rhabdomyosarcoma RH30 cell line showed the highest CXCR4 expression.

    [0018] FIG. 2 shows the migration and invasion capacity of the different sarcoma cell lines (RH30, CW9019, A4573, A673, MG-63 and 143B) towards (A) fetal bovine serum (FBA) or (B) CXCL12 (100 ng/ml). The RH30 cell line showed the highest migration and invasion indices towards CXCL12 (FIG. 2B). Migration capacity was tested using 8 μm-pore membranes Transwell assays, and invasion capacity was measured under the same conditions using Matrigel-coated Transwell membranes.

    [0019] FIG. 3 shows the cytotoxicity and inhibition of migration and invasion by NKAE and anti-CXCR4 therapy, individually or in combination, on rhabdomyosarcoma (RH30) cells in vitro. A, NKAE cells showed high cytotoxicity against RH30 cells. Specific lysis in the absence of Ab, with ulocuplumab (MDX1338; 100 μg/ml) or IgG4 control mAb (100 μg/ml) was determined at the indicated NKAE: RH30 effector:target (E:T) ratios. B-C, Ulocuplumab (MDX1338) and NKAE cells each efficiently reduced RH30 cells migration and invasion towards CXCL12, but only the combination of both agents completely abrogated it. RH30 cells migration towards a gradient of human recombinant CXCL12 chemokine was tested using Transwell plates. Ab concentration was 100 μg/ml and NKAE: RH30 E:T ratio was 5:1 (B). Invasion capacity was measured under the same conditions using Matrigel-coated Transwell membranes (C).

    [0020] FIG. 4 shows the effects of NKAE cell and anti-CXCR4 therapy, individually or in combination, on the growth of GFP.sup.+ Luc.sup.+ RH30 rhabdomyosarcoma tumor implants in the abdominal region of immunodeficient NSG mice. A, Growth of RH30 tumor implants. Five treatment arms were established: untreated; IgG4; ulocuplumab (MDX1338); NKAE cells; a combination of NKAE cells and ulocuplumab. Mice received 6 doses of mAb (15 mg/kg, twice a week), and 3 doses of NKAE (5×10.sup.6 cells, once a week). Luminescent tumors were monitored for 35 days. B, Quantification of the presence of tumor cells measured by luminescence of implanted GFP.sup.+ Luc.sup.+ RH30 cells in the treated mice. The ulocuplumab treatment alone moderately inhibited growth of the RH30 tumor implants, whereas NKAE treatment completely prevented it.

    [0021] FIG. 5 shows the effects of NKAE cells and ulocuplumab, individually or in combination, on the formation of lung micrometastasis from RH30 tumors in mice. A, Relative expression of human CXCR4 in RH30 lung metastatic lesions in mice measured by qRT-PCR using a human CXCR4 specific probe. Indicated values are relative to the expression of the indicated gene by a 10.sup.6 RH30 cells pellet. Ulocuplumab (MDX1338) reduced RH30 lung micrometastasis incidence, while the combination of ulocuplumab and NKAE completely eliminated it. B, Relative expression of human GUS in RH30 lung metastatic lesions in mice measured by qRT-PCR. The combination of both NKAE cell therapy and treatment with ulocuplumab (MDX1338) is required to completely suppress RH30 lung micrometastasis in vivo.

    [0022] FIG. 6 shows the confirmation of the inhibition of rhabdomyosarcoma RH30 micrometastases by histological methods. Lung micrometastases in untreated mice lungs were identified by hematoxylin and eosin staining (a), A/u sequence in situ hybridization (b), and CXCR4-specific mAb stain (c). Arrows identify detected micrometastases. The combination of both NKAE cell therapy and treatment with ulocuplumab is required to completely suppress RH30 lung micrometastasis in vivo (d).

    [0023] FIG. 7 shows the level of CXCR4 expression on rhabdomyosarcoma patients' tumors A, Representative stainings corresponding to samples with negative (a), medium (b) and high (c) CXCR4 cytoplasmic expression. A specimen with high nuclear CXCR4 staining is also shown (d). B, CXCR4 expression score of specimens at diagnosis. C, Diagnostic versus post-chemotherapy and relapse specimens. Median±SD is shown. Non-parametric unpaired Mann-Whitney test applied.

    DETAILED DESCRIPTION OF THE INVENTION

    [0024] The present invention relates to methods for treating cancer in a subject comprising administering a combination of NKAE cell immunotherapy and an anti-CXCR4 Ab to the subject.

    Terms

    [0025] In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application.

    [0026] “Administering” refers to the physical introduction of a composition comprising a therapeutic agent to a subject, using any of the various methods and delivery systems known to those skilled in the art. A preferred route for administration of a therapeutic Ab such as an anti-CXCR4 Ab is intravenous or subcutaneous administration. Other routes of administration include intramuscular, intraperitoneal, or other parenteral routes of administration, for example by injection or infusion. The term “parenteral administration” as used herein means modes of administration other than enteral and topical administration. A preferred route for administration of NKAE cells is intravenous administration. Other routes of administration include intraarterial, intrafemoral, intraperitoneal, or intrathecal injection, intratumoral or injection into a tumor resection cavity. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.

    [0027] An “antibody” (Ab) shall include, without limitation, a glycoprotein immunoglobulin (Ig) which binds specifically to an antigen and comprises at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, or an antigen-binding portion thereof. Each H chain comprises a heavy chain variable region (abbreviated herein as V.sub.H) and a heavy chain constant region. The heavy chain constant region of an IgG Ab comprises three constant domains, C.sub.H1, C.sub.H2 and C.sub.H3. Each light chain comprises a light chain variable region (abbreviated herein as V.sub.L) and a light chain constant region. The light chain constant region of an IgG Ab comprises one constant domain, C.sub.L. The V.sub.H and V.sub.L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). Each V.sub.H and V.sub.L comprises three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the Abs may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

    [0028] An immunoglobulin may derive from any of the commonly known isotypes, including but not limited to IgA, secretory IgA, IgG and IgM. IgG subclasses are also well known to those in the art and include but are not limited to human IgG1, IgG2, IgG3 and IgG4. “Isotype” refers to the Ab class or subclass (e.g., IgM, IgG1, or IgG4) that is encoded by the heavy chain constant region genes. The term “antibody” includes, by way of example, both naturally occurring and non-naturally occurring Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or nonhuman Abs; wholly synthetic Abs; and single chain Abs. A nonhuman Ab may be humanized partially or fully by recombinant methods to reduce its immunogenicity in man. Where not expressly stated, and unless the context indicates otherwise, the term “antibody” also includes an antigen-binding fragment or an antigen-binding portion of any of the aforementioned immunoglobulins, and includes a monovalent and a divalent fragment or portion, and a single chain Ab.

    [0029] An “isolated” Ab refers to an Ab that is substantially free of other Abs having different antigenic specificities (e.g., an isolated Ab that binds specifically to CXCR4 is substantially free of Abs that bind specifically to antigens other than CXCR4). An isolated Ab that binds specifically to, for example, human CXCR4 may, however, have cross-reactivity to other antigens, such as CXCR4 molecules from different species. Moreover, an “isolated” Ab may also refer to an Ab that is purified so as to be substantially free of other cellular material and/or chemicals.

    [0030] The term “monoclonal” Ab (mAb) refers to a non-naturally occurring preparation of Ab molecules of single molecular composition, i.e., Ab molecules whose primary sequences are essentially identical, which exhibits a single binding specificity and affinity for a particular epitope. A mAb is an example of an isolated Ab. MAbs may be produced by hybridoma, recombinant, transgenic or other techniques known to those skilled in the art.

    [0031] A “chimeric” Ab refers to an Ab in which the variable regions are derived from one species and the constant regions are derived from another species, such as an Ab in which the variable regions are derived from a mouse Ab and the constant regions are derived from a human Ab.

    [0032] A “human” mAb (HuMAb) refers to a mAb having variable regions in which both the framework and CDR regions are derived from human germline immunoglobulin sequences. Furthermore, if the Ab contains a constant region, the constant region also is derived from human germline immunoglobulin sequences. The human Abs of the invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). However, the term “human” Ab, as used herein, is not intended to include Abs in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. The terms “human” Abs and “fully human” Abs are used synonymously.

    [0033] A “humanized” mAb refers to a mAb in which some, most or all of the amino acids outside the CDR domains of a non-human mAb are replaced with corresponding amino acids derived from human immunoglobulins. In one embodiment of a humanized form of an Ab, some, most or all of the amino acids outside the CDR domains have been replaced with amino acids from human immunoglobulins, whereas some, most or all amino acids within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications of amino acids are permissible as long as they do not abrogate the ability of the Ab to bind to a particular antigen. A “humanized” Ab retains an antigenic specificity similar to that of the original Ab.

    [0034] An “anti-antigen” Ab refers to an Ab that binds specifically to an antigen. For example, an anti-CXCR4 Ab is an Ab that binds specifically to CXCR4.

    [0035] An “antigen-binding portion” of an Ab (also called an “antigen-binding fragment”) refers to one or more fragments of an Ab that retain the ability to bind specifically to the antigen bound by the whole Ab.

    [0036] A “cancer” refers a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth divide and grow results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream.

    [0037] “C-X-C Chemokine Receptor 4” (CXCR4; also known in the art as, for example, LESTR, Fusin or CD184) refers to a 7-transmembrane G-protein coupled receptor expressed on leukocytes, platelets and other non-hematopoietic cells that comprise the tumor stromal microenvironment. It is also over-expressed in the majority of human cancers and on Tregs and MDSCs. CXCR4 binds to a single ligand, CXCL12. The term “CXCR4” as used herein includes human CXCR4 (hCXCR4), variants, isoforms, and species homologs of hCXCR4, and analogs having at least one common epitope with hCXCR4. The complete hCXCR4 amino acid sequence can be found under GENBANK® Accession No. CAA12166 and is set forth in SEQ ID NO: 43.

    [0038] The term “immunotherapy” refers to the treatment of a subject afflicted with, or at risk of contracting or suffering a recurrence of, a disease by a method comprising inducing, enhancing, suppressing or otherwise modifying an immune response. “Treatment” or “therapy” of a subject refers to any type of intervention or process performed on, including the administration of an active agent to, the subject with the objective of reversing, alleviating, ameliorating, inhibiting, slowing down or preventing the onset, progression, development, severity or recurrence of a symptom, complication or condition, or biochemical indicia associated with a disease.

    [0039] A “subject” includes any human or nonhuman animal. The term “nonhuman animal” includes, but is not limited to, vertebrates such as nonhuman primates, sheep, dogs, and rodents such as mice, rats and guinea pigs. In preferred embodiments, the subject is a human. The terms “subject” and “patient” are used interchangeably herein.

    [0040] A “therapeutically effective amount” or “therapeutically effective dosage” of a drug or therapeutic agent is any amount of the drug or agent that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention or reduction of impairment or disability due to the disease affliction. In addition, the terms “effective” and “effectiveness” with regard to a treatment includes both pharmacological effectiveness and physiological safety. Pharmacological effectiveness refers to the ability of the drug to promote disease regression, e.g., cancer regression, in the patient. Physiological safety refers to an acceptable level of toxicity, or other adverse physiological effects at the cellular, organ and/or organism level (adverse effects) resulting from administration of the drug. The efficacy of a therapeutic agent can be evaluated using a variety of methods known to the skilled practitioner, such as by assaying the activity of the agent in in vitro assays, in animal model systems predictive of efficacy in humans, or in human subjects during clinical trials.

    [0041] By way of example for the treatment of tumors, a therapeutically effective amount of an anti-cancer agent preferably inhibits cell growth or tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to untreated subjects.

    [0042] In other preferred embodiments of the invention, tumor regression may be observed and continue for a period of at least about 20 days, more preferably at least about 40 days, or even more preferably at least about 60 days. Notwithstanding these ultimate measurements of therapeutic effectiveness, evaluation of immunotherapeutic drugs must also make allowance for “immune-related” response patterns.

    [0043] A therapeutically effective amount of a drug includes a prophylactically effective amount, which is any amount of the drug that, when administered alone or in combination with an another therapeutic agent to a subject at risk of developing a disease (e.g., a subject having a pre-malignant condition who is at risk of developing a cancer) or of suffering a recurrence of the disease, inhibits the development or recurrence of the disease (e.g., a cancer). In preferred embodiments, the prophylactically effective amount prevents the development or recurrence of the disease entirely. “Inhibiting” the development or recurrence of a disease means either lessening the likelihood of the disease's development or recurrence, or preventing the development or recurrence of the disease entirely.

    [0044] The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the indefinite articles “a” or “an” should be understood to refer to “one or more” of any recited or enumerated component.

    [0045] The term “about” refers to a numeric value, composition or characteristic that is within an acceptable error range for the particular value, composition or characteristic as determined by one of ordinary skill in the art, which will depend in part on how the value, composition or characteristic is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or within more than 1 standard deviation per the practice in the art. Alternatively, it can mean a range of plus or minus 20%, more usually a range of plus or minus 10%. When particular values, compositions or characteristics are provided in the application and claims, unless otherwise stated, the meaning of “about” should be assumed to be within an acceptable error range for that particular value, composition or characteristic. In dosing frequencies in drug administration regimens, the terms “once about every week,” “once about every two weeks,” or any other similar dosing interval terms as used herein mean approximate numbers. For example, “once about every week” can include every 7 days ±one day, i.e., every 6 days to every 8 days. “Once about every 2 weeks” can include every 14 days ±3 days, i.e., every 11 days to every 17 days. Similar approximations apply, for example, to once about every 3 weeks, once about every 4 weeks, or once about every month.

    [0046] The term “substantially the same” or “essentially the same” refers to a sufficiently high degree of similarity between two or more numeric values, compositions or characteristics that one of skill in the art would consider the difference between these values, compositions or characteristics to be of little or no biological and/or statistical significance within the context of the property being measured. The difference between numeric values being measured may, for example, be less than about 30%, preferably less than about 20%, and more preferably less than about 10%.

    [0047] As described herein, any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.

    [0048] Various aspects of the invention are described in further detail in the following subsections.

    Therapeutic Methods

    [0049] Sarcomas, primarily including Ewing sarcoma, osteosarcoma and soft tissue sarcomas, are a group of relatively rare mesenchymal-derived tumors (Stiller et al., 2013).

    [0050] Despite their low incidence among human malignancies and advances in adjuvant chemotherapy and surgical-wide resection, prognosis remains poor, mainly due to the high propensity for lung metastasis, which is the leading cause of mortality in patients with sarcomas.

    [0051] Chemokines and their interaction with their corresponding receptors have been shown to play a fundamental role in the mechanisms of cancer development and the appearance of metastasis (Vela et al., 2015). The expression levels of chemokines and their receptors are altered in malignant cells. This is the case of CXCR4, the chemokine receptor most frequently overexpressed in tumor cells. The interaction of CXCR4 with its ligand, CXCL12, activates a cascade of cellular signaling that promotes the survival, proliferation, adhesion and migration of the tumor cells that express it. All this can lead to the relapse of the primary tumor, and an increase in its capacity to generate distant metastases in organs in which the ligand is secreted, especially bone marrow and lungs (Chatterjee et al., 2014; Duda et al., 2011).

    [0052] The usurping of CXCL12/CXCR4 signaling pathways by tumor cells for metastasis and protection from apoptosis long ago identified the blockade of this axis as a novel opportunity for cancer therapy. A pioneering report by Muller et al. (2001) demonstrated the in vivo relevance of CXCR4 as a target for cancer therapy, linking the expression of CXCR4 in breast carcinomas with their ability to generate regional lymph node and lung metastases. These data were supported by experiments in which a neutralizing murine anti-human CXCR4 mAb, Clone 44717.111, led to a significant decrease in lung, inguinal and axillary lymph node metastases. Subsequently, similar results were obtained treating xenografts of a human non-Hodgkin lymphoma (Bertolini et al., 2002) and of a primary human acute myeloid leukemia (Tavor et al., 2004) with another murine anti-human CXCR4 Ab (Clone 12G5). In both models, a significant reduction on tumor progression was reported. In endometrial cancer xenografts, treatment with 12G5 mAb led to a complete inhibition of spontaneous metastases in liver and lung, and a 28-fold decrease in metastatic index in the peritoneum (Gelmini et al., 2009).

    [0053] Interestingly, on in intratibial human osteosarcoma xenograft model, 12G5 mAb reduced metastatic spread to the lung (Brennecke et al., 2014).

    [0054] Adoptively transferred NK cells, mainly resting NK cells (Rubnitz et al., 2010; Curti et al., 2011) or IL-2-cultured NK cells (Bachanova et al., 2014; Shi et al., 2013; Miller et al., 2005) have been used in clinical trials. The use of activated and expanded NK cells co-cultured with human-derived antigen presenting cells is an emerging alternative (Szmania et al., 2015; Leivas et al., 2016; Ishikawa et al., 2004; Vela et al., 2018). The results of these trials show that both autologous and haploidentical NKAE is a safe therapy with no serious adverse effects and is a feasible approach for the treatment of different cancer types.

    [0055] Data presented herein, show that ulocuplumab, a human mAb that blocks the CXCR4/CXCL12 axis, efficiently reduces migration and invasion index of metastatic rhabdomyosarcoma RH30 cells in in vitro experiments but it requires the combination of ulocuplumab with NKAE cells to completely abrogate migration and invasion. Similarly, in in vivo experiments, the combination of ulocuplumab and NKAE therapy was required to eliminate not only the growth of implanted RH30 tumors, but also their dissemination capacity, suppressing lung micrometastasis formation. Accordingly, this disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of: (a) an isolated population of NK cells, preferably NKAE cells; and (b) an isolated Ab or an antigen-binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell. In preferred embodiments of any of the present methods, the subject is a human patient.

    [0056] As shown in Example 3, an anti-CXCR4 Ab (ulocuplumab) and NKAE cell therapy, administered as monotherapy, each potently reduced both the migration of RH30 alveolar rhabdomyosarcoma cells towards CXCL12 in vitro (FIG. 3B) and the invasion capacity of these cells in vitro (FIG. 3C). Notably, an even greater level of inhibition of migration and invasion of the RH30 cells was exhibited by the combination of anti-CXCR4 and NKAE cell therapy, i.e., anti-CXCR4 interacted synergistically with NKAE cell therapy to completely abrogate both migration and invasion (FIGS. 3B and C). A combination of two therapies is considered synergistic if the antitumor effect of the combination is greater than the effect observed with monotherapy using the more efficacious treatment or greater than the sum of the level of inhibition exhibited by each treatment individually. It has been demonstrated that the anti-CXCR4 Ab, ulocuplumab, directly inhibits growth and proliferation and induces apoptosis of cancer cells (WO 2008/060367; WO 2013/071068; Kuhne et al., 2013), and these tumor-inhibitory properties may contribute to the efficacy of the combination therapy disclosed herein.

    [0057] A similar synergistic effect between anti-CXCR4 and NKAE cell therapy was demonstrated in vivo (Example 4). The anti-tumor activity of an anti-CXCR4 Ab and NKAE cell therapy, administered as monotherapy or in combination, was measured in a mouse model of RH30 alveolar rhabdomyosarcoma. Ulocuplumab exhibited a moderate inhibitory effect on tumor growth whereas NKAE cell therapy completely inhibited tumor growth in this mouse tumor model (FIG. 4). However, qRT-PCR analysis (FIG. 5) and immunohistochemical staining and in situ hybridization (FIG. 6) revealed RH30 lung micrometastasis in the NKAE-treated mice. NKAE therapy had only a very modest effect on lung metastasis whereas ulocuplumab had a more pronounced effect (FIG. 5), but the combination of both therapies exhibited a strong synergistic effect in completely eliminated lung metastasis (FIGS. 5 and 6).

    [0058] NK Cell Population

    [0059] Various therapeutic and vaccine strategies have been proposed based on a modulation of NK cell activity. However, NK cell activity is regulated by complex mechanisms that involve both stimulating and inhibitory signals. An important set of regulatory receptors is the HLA class I-restricted, Killer-cell Immunoglobulin-like Receptor (KIR) family which comprises both inhibitory and activating family members that recognize allotypic variants of HLA class I alleles as KIR ligands (KIRL). The NK cells of a single individual typically express different combinations of KIRs, providing a repertoire of NK cells with different specificities for HLA class I molecules.

    [0060] Membrane bound Killer-cell Activation Receptors (KARs) work together with KIRs to regulate NK cell function (Lanier, 2005). It was initially thought that there were only one KAR and one KIR (two-receptor model), but over the last decade, multiple different KARs and KIRs, such as the activating NKp46 and NKG2D receptors and the inhibitory KIR2DL receptors (see Table 1), have been discovered (opposing-signals model). Many human cancers express NKG2D ligands (NKG2DL) (Nausch and Cerwenka, 2008; Pérez-Martinez et al., 2012; Fernández et al., 2013). Indeed, it has recently been shown that the antitumor effect mediated by the NKG2D/NKG2DL interaction targets primarily tumor-initiating cells or stem tumor cells, both in multiple myeloma and sarcoma models (Fernández et al., 2015). It has been postulated that the pattern of activating/inhibitory ligands found in a tumor may be a key element in the prediction of its response to NK cell therapy.

    TABLE-US-00001 TABLE 1 Summary of activating (KARs) and inhibitory (KIRs) receptors in NK cells Receptor Function Ligands KIR (CD158) Activator or Inhibitor MHC class I molecules NKG2D (CD314) Activator MICA, MICB, ULBP1-6 DNAM1 (CD226) Activator PVRL2 (CD112), PVR (CD155) NKp46 (CD335) Activator Heparan sulfate, hemagglutinin, etc. NKp44 (CD336) Activator Heparan sulfate, PCNC, etc. NKp30 (CD337) Activator B7-H6, etc. PD-1 (CD279) Inhibitor PD-L1, PD-L2 4-1BB (CD137) Activator 4-1BBL

    [0061] NK cells can kill leukemic cells and have been administered either in the setting of hematopoietic stem cell transplantation or after non-myeloablative immunosuppressive therapy to enhance the effect of chemotherapy in patients with acute leukemia, yielding encouraging results (Hsu et al., 2005; Miller et al., 2005; Rubnitz et al., 2010). In Miller et al.'s study, 5 of 19 poor-prognosis patients with acute myeloid leukemia (AML) achieved complete remission after haploidentical NK-cell therapy. The results were even better in the study by Rubnitz et al. (2010), reporting 100% remission of 10 patients with intermediate and low risk AML.

    [0062] NK cells can also lyse malignant non-hematopoietic cells as shown by reports indicating NK cell cytotoxicity against Ewing sarcoma, neuroblastoma, osteosarcoma and hepatocellular carcinoma cell lines in vitro and in vivo (Fernández et al., 2015; Cho et al., 2010; Verhoeven et al., 2008; Pérez-Martinez et al., 2015b; Kamiya et al., 2016). Additionally, clinical data suggest that haploidentical donor NK cells may exert antitumor activity in children with solid tumors undergoing allogeneic hematopoietic stem cell transplantation partially based on an allograft-vs-tumor effect associated with KIR-HLA donor-recipient mismatch (Pérez-Martinez et al., 2009; Pérez-Martinez et al., 2015a).

    [0063] The present methods combine the demonstrated cytotoxicity of NK cells against tumors with the blockade of CXCR4/CXCL12 signaling by an anti-CXCR4 Ab. In certain preferred embodiments of the therapeutic methods disclosed herein, the population of NK cells comprises NKAE cells. IL-2 and other cytokines, including IL-12, IL-15 and/or IL-21 can induce proliferative responses in human NK cells, but only a minor fraction sustains continued growth (London et al., 1986; Lanier et al., 1988). It has been shown that sustained expansions of NK cells require additional signals, such as the presence of β-lymphoblastoid cells (London et al., 1986; Rabinowich et al., 1991; Igarashi et al., 2004). Methods that allow specific activation and expansion of human NK cells from peripheral blood has been developed, for example, methods based on the use of genetically modified K562 cells as a feeder for peripheral mononuclear cells of healthy donors allowing the expansion and activation of the NK cell population (Imai et al., 2005; Fujisaki et al., 2009; Somanchi and Lee, 2016).

    [0064] In certain embodiments of the disclosed invention, NKAE cells are produced by coculturing peripheral blood mononuclear cells (PBMCs) from healthy donors with (i) irradiated β-lymphoblastoid cells modified to express a membrane-bound form of an activating cytokine such as interleukin-15 (IL-15) or interleukin-21 (IL-21), and (ii) interleukin-2 (IL-2). In certain preferred embodiments, the β-lymphoblastoid cells are K562-mb15-41BBL cells (Fujisaki et al., 2009). The K562-mb15-41BBL cell line lacks MHC-I ligands for inhibitory KIR NK cells receptors and comprise K562 cells modified to express a membrane-bound form of the NK activating cytokine IL-15 and the activating ligand CD137 for the 4-1BB receptor on NK cells. In the experiments described herein (see Examples 3 and 4), NKAE cells were obtained by coculturing healthy donors' PBMCs with K562-mb15-41BBL cells (Fujisaki et al., 2009) and IL-2 (see Example 3). In other preferred embodiments, the β-lymphoblastoid cells used to prepare NKAE cells are K562 mb.IL21 cells (Somanchi and Lee, 2016), which comprise K562 cells modified to express a membrane-bound form of IL-21.

    [0065] Anti-CXCR4 Abs Suitable for Use in the Disclosed Methods

    [0066] The present invention provides a novel immunotherapeutic approach for treating cancer, including metastatic cancer, by combining anti-CXCR4 therapy with the demonstrated cytotoxicity of NK cells against tumors in vitro and in vivo. This combination therapy method employs an anti-CXCR4 Ab to block CXCR4/CXCL12 signaling, thereby disrupting tumor-stromal interactions, sensitizing sarcoma cells to the cytotoxicity of NK cells, and reducing tumor growth and metastatic burden.

    [0067] CXCR4 is over-expressed in more than 23 human cancers, and its overexpression contributes to tumor growth, invasion, angiogenesis, metastasis, relapse, and therapeutic resistance. Non-limiting examples of cancer types associated with CXCR4 expression or the CXCR4/CXCL12 pathway include solid tumors such as breast (Dewan et al., 2006), ovarian (Kajiyama et al., 2008), prostate (Hirata et al., 2007; Miki et al., 2007), lung (Cavallaro, 2013; Gangadhar et al., 2010), pancreatic (Billadeau et al., 2006), kidney (Jones et al., 2007; Pan et al., 2006), oral (Ishikawa et al., 2006; Onoue et al., 2006), esophageal (Wu et al., 2014), gastric (Han et al., 2014), colorectal (Lv et al., 2014), liver (Schimanski et al., 2006), brain (Bian et al., 2007), and thyroid cancer (De Falco et al., 2007), melanoma (Scala et al., 2005), rhabdomyosarcoma (Libura et al., 2002), and osteosarcoma (Laverdiere et al., 2005), as well as hematological malignancies such as acute lymphoblastic leukemia (Crazzolara et al., 2001), acute myeloid leukemia (Kalinkovich et al., 2006), multiple myeloma (Alsayed et al., 2007; Azab et al., 2009) and chronic myeloid leukemia (Jin et al., 2008).

    [0068] The interaction between CXCR4 and CXCL12 is essential for homing and maintaining hematopoietic stem cells within the BM microenvironment (Mohle et al., 1998). The prognostic significance of CXCR4 in patients with bone and soft tissue sarcomas has been extensively studied. In certain situations an inverse correlation has been established between CXCR4 expression and patient prognosis or survival, and in clinical studies, CXCR4 has been associated with increased propensity for metastasis and decreased survival. In a recent meta-analysis, including 12 studies with 997 sarcoma patients, CXCR4 expression was found to be significantly associated with poor overall survival (HR 2.37, 95% CI 1.86-3.01; P<0.001). As for clinicopathological features, CXCR4 expression was significantly associated with higher rate of metastasis (OR 6.97, 95% CI 2.28-21.31; P=0.001) and higher tumor stage (OR 7.55, 95% CI 1.25-45.47; P=0.027) (Li et al., 2015)). In the short cohort of pediatric rhabdomyosarcoma patients described in Example 5, there as a slight correlation between higher CXCR4 expression at diagnosis and relapse and fatal outcome. Tumor-initiating cells (TICs) are a subpopulation of chemoresistant tumor cells that have been shown to cause tumor recurrence and metastasis, and CXCR4 upregulation is one of the hallmarks of these cells (Duda et al., 2011). It was consistently observed that tumors that still grow after chemotherapy and those that appear after a combined surgical and chemotherapeutic approach are those that clearly express the highest CXCR4 levels (FIG. 7C). Targeting and eliminating of TICs are therefore priorities for the development of new therapeutic paradigms.

    [0069] Example 1 shows that, among six different sarcoma cell lines tested, the RH30 alveolar rhabdomyosarcoma cell line showed the highest level of CXCR4 expression (FIG. 1), concomitant with highest migration and invasion index towards CXCL12 (FIG. 2). Metastasis occurs in 20-55% of sarcoma patients and, like other cancers (Chaffer and Weinberg, 2011; Seyfried and Huysentruyt, 2013), remains the main cause of death. Whereas the efficacy of the NKAE plus anti-CXCR4 combination has been demonstrated herein with a rhabdomyosarcoma cell line, a person skilled in the art would readily recognize that the present methods for treating cancer are applicable to any cancer that over-expresses CXCR4.

    [0070] Anti-CXCR4 Abs suitable for use in the disclosed methods are Abs or antigen-binding portions thereof that bind specifically to CXCR4 with high specificity and affinity. In certain preferred embodiments, the Ab or antigen-binding portion thereof is a mAb or an antigen-binding portion thereof. In certain embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof is a chimeric Ab, preferably a humanized Ab or, more preferably, a human Ab or a portion thereof. Such chimeric, humanized or human mAbs can be prepared and isolated by methods well known in the art, e.g., as described in WO 2008/060367. In preferred embodiments, the subject is a human and the Ab or fragment thereof binds to a human CXCR4 receptor. In further preferred embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof blocks the binding of CXCR4 and CXCL12, and inhibits the activity of CXCR4, i.e., the Ab or antigen-binding portion thereof disrupts the interaction between CXCR4 and CXCL12 and inhibits CXCR4/CXCL12 signaling. In certain other embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof induces apoptosis and/or inhibits growth of CXCR4.sup.+ tumor cells in vivo (as described in WO 2013/071068).

    [0071] Anti-CXCR4 mAbs that bind specifically to CXCR4 with high affinity, specifically mAbs F7GL (ulocuplumab; also previously designated BMS-936564 and MDX-1338), F7, F9, F9GL, D1, D1GL, E2 and E2GL, have been exemplified and described in detail in WO 2008/060367. Methods of using these Abs to treat hematological malignancies are also described, for example, in WO 2008/060367, WO 2013/071068 and WO 2015/069874. Other anti-CXCR4 mAbs, that are suitable for use in the present therapeutic methods in combination with NKAE cells, have been described in, for example, WO 2008/142303, WO 2010/037831, WO 2009/140124, WO 2013/013025, and U.S. Publication No. 2015/0037328.

    [0072] Anti-CXCR4 Abs suitable for use in the present methods preferably exhibit one or more of the following characteristics that are desirable for therapeutic applications: (a) binding with high affinity to human CXCR4 expressed on a cell surface; (b) inhibiting binding of SDF-1 to CXCR4; (c) inhibiting SDF-1-induced calcium flux in cells expressing CXCR4; (d) inhibiting SDF-1-induced migration of cells expressing CXCR4; (e) inhibiting capillary tube formation by human umbilical vein endothelial cells; (f) inducing apoptosis in cells expressing CXCR4; (g) inhibiting proliferation of CXCR4.sup.+ tumor cells in vitro; (h) inhibiting CXCR4.sup.+ tumor cell proliferation and/or inducing CXCR4.sup.+ tumor cell apoptosis in vivo; (i) inhibiting metastases of CXCR4.sup.+ tumor cells; and (j) increasing survival time of a CXCR4.sup.+ tumor-bearing subject. The anti-CXCR4 mAbs disclosed in WO 2008/060367, which are suitable for use in the present methods, have been demonstrated to exhibit one or more of the following characteristics: (a) binding to human CXCR4 on a surface of a cell with an EC.sub.50 of less than about 100 nM (e.g., about 20-80 nM); (b) inhibiting binding of CXCL12 to CXCR4 with an EC.sub.50 equal to or less than about 30 nM (e.g., about 1-30 nM); (c) inhibiting CXCL12-induced calcium flux in cells expressing CXCR4 with an EC.sub.50 equal to or less than about 1 nM (e.g., about 0.1-1.0 nM); (d) inhibiting CXCL12-induced migration of cells expressing CXCR4 with an EC5o equal to or less than about 20 nM (e.g., about 10-20 nM); (e) inhibiting capillary tube formation by human umbilical vein endothelial cells; (f) inducing apoptosis in cells expressing CXCR4; (g) inhibiting proliferation of CXCR4.sup.+ tumor cells in vitro; (h) inhibiting CXCR4.sup.+ tumor cell proliferation and/or inducing CXCR4.sup.+ tumor cell apoptosis in vivo; (i) inhibiting metastases of CXCR4.sup.+ tumor cells; and (j) increasing survival time of a CXCR4.sup.+ tumor-bearing subject.

    [0073] Anti-CXCR4 Abs usable in the methods of the present invention include mAbs that bind specifically to human CXCR4 expressed on a cell surface with high affinity, for example, with a K.sub.D of 1×10.sup.−8M or less as determined by surface plasmon resonance (SPR), preferably with a K.sub.D of 5×10.sup.−9M or less, and exhibit at least five, and preferably all, of the other preceding characteristics. For example, an anti-CXCR4 Ab suitable for use in the disclosed methods of treatment (a) binds to human CXCR4 with a K.sub.D of about 5×10.sup.−9 to 1×10.sup.−10 M, as determined by surface plasmon resonance (Biacore); (b) inhibits binding of CXCL12 to CXCR4 with an EC.sub.50 of less than about 10 nM (e.g., about 1-10 nM); (c) induces apoptosis in cells expressing CXCR4; (d) inhibits proliferation of CXCR4.sup.+ tumor cells in vitro; (e) inhibits CXCR4.sup.+ tumor cell proliferation and/or induces CXCR4.sup.+ tumor cell apoptosis in vivo; and (f) inhibits metastases of CXCR4.sup.+ tumor cells.

    [0074] Accordingly, this disclosure provides a method for treating a subject afflicted with a cancer comprising administering to the subject a combination of therapeutically effective amounts of: (a) an isolated population of NKAE cells; and (b) an isolated Ab or an antigen-binding portion thereof that: (i) binds specifically to CXCR4 expressed on the surface of a cancer cell with high affinity, for example, with a K.sub.D of about 5×10.sup.−9M or less, (ii) inhibits binding of CXCL12 to CXCR4, for example, with an EC.sub.50 of less than about 10 nM, and (iii) inhibits CXCR4/CXCL12 signaling, for example, inhibits CXCL12-induced migration of cells expressing CXCR4, for example, with an EC.sub.50 equal to or less than about 20 nM. In certain embodiments, the Ab or an antigen-binding portion thereof also induces apoptosis in cells expressing CXCR4.

    [0075] In certain aspects, the anti-CXCR4 Abs disclosed herein for therapeutic use comprise the heavy chain and light chain CDR1's, CDR2's and CDR3's of F7, F9, D1 or E2, or combinations thereof. The amino acid sequences of the V.sub.H CDR1's of F7, F9, D1 and E2 are shown in SEQ ID NOs. 1-4, respectively. The amino acid sequences of the V.sub.H CDR2's of F7, F9, D1 and E2 are shown in SEQ ID NOs. 5-8, respectively. The amino acid sequences of the V.sub.H CDR3's of F7, F9, D1 and E2 are shown in SEQ ID NOs. 9-12, respectively. The amino acid sequences of the Vk CDR1's of F7, F9, D1 and E2 are shown in SEQ ID NOs. 13-16, respectively. The amino acid sequences of the V.sub.k CDR2's of F7, F9, D1 and E2 are shown in SEQ ID NOs. 17-20, respectively. The amino acid sequences of the V.sub.k CDR3's of F7, F9, D1 and E2 are shown in SEQ ID NOs. 21-24, respectively. The germline back-mutated “GL” variants, i.e., F7GL, F9GL, D1GL and E2GL, have the same CDRs as F7, F9, D1 and E2, respectively. The CDR regions identified throughout this disclosure were delineated using the Kabat system (Kabat et al., 1991).

    [0076] In certain other aspects, the anti-CXCR4 Abs disclosed herein for therapeutic use comprise:

    [0077] (a) the CDR1, CDR2 and CDR3 domains in a heavy chain variable region having the sequence set forth in SEQ ID NO: 25 or 33, and the CDR1, CDR2 and CDR3 domains in a light chain variable region having the sequence set forth in SEQ ID NO: 29 or 37;

    [0078] (b) the CDR1, CDR2 and CDR3 domains in a heavy chain variable region having the sequence set forth in SEQ ID NO: 26 or 34, and the CDR1, CDR2 and CDR3 domains in a light chain variable region having the sequence set forth in SEQ ID NO: 30 or 38;

    [0079] (c) the CDR1, CDR2 and CDR3 domains in a heavy chain variable region having the sequence set forth in SEQ ID NO: 27 or 35, and the CDR1, CDR2 and CDR3 domains in a light chain variable region having the sequence set forth in SEQ ID NO: 31 or 39; or

    [0080] (d) the CDR1, CDR2 and CDR3 domains in a heavy chain variable region having the sequence set forth in SEQ ID NO: 28 or 36, and the CDR1, CDR2 and CDR3 domains in a light chain variable region having the sequence set forth in SEQ ID NO: 32 or 40.

    [0081] In other preferred embodiments, the anti-CXCR4 Abs of this disclosure comprise:

    [0082] (a) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 1 or conservative modifications thereof; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 5 or conservative modifications thereof; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 9; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 13 or conservative modifications thereof; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 17 or conservative modifications thereof; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 21 or conservative modifications thereof;

    [0083] (b) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 2 or conservative modifications thereof; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 6 or conservative modifications thereof; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 10; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 14 or conservative modifications thereof; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 18 or conservative modifications thereof; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 22 or conservative modifications thereof;

    [0084] (c) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 3 or conservative modifications thereof; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 7 or conservative modifications thereof; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 11; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 15 or conservative modifications thereof; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 19 or conservative modifications thereof; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 23 or conservative modifications thereof; or

    [0085] (d) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 4 or conservative modifications thereof; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 8 or conservative modifications thereof; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 12; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 16 or conservative modifications thereof; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 20 or conservative modifications thereof; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 24 or conservative modifications thereof.

    [0086] In certain preferred embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof comprises a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 1, a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 5, a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 9, a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 13, a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 17, and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 21.

    [0087] In other embodiments, the anti-CXCR4 Abs or antigen-binding portions thereof comprise:

    [0088] (a) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 2; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 6; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 10; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 14; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 18; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 22;

    [0089] (b) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 3; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 7; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 11; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 15 a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 19; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 23; or

    [0090] (c) a heavy chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 4; a heavy chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 8; a heavy chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 12; a light chain variable region CDR1 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 16; a light chain variable region CDR2 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 20; and a light chain variable region CDR3 comprising consecutively linked amino acids having the sequence set forth in SEQ ID NO: 24.

    [0091] In certain embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof comprises the heavy and light chain variable regions of the F7GL, F7, F9GL, F9, D1GL, D1, E2GL and E2 mAbs. In certain preferred embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof comprises a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 25 or 33 and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 29 or 37.

    [0092] In other embodiments, the anti-CXCR4 Abs or antigen-binding portions thereof comprise:

    [0093] (a) a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 25 or 33 and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 29 or 37;

    [0094] (b); a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 26 or 34 and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 30 or 38;

    [0095] (c) a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 27 or 35 and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 31 or 39; or

    [0096] (c) a heavy chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 28 or 36 and a light chain variable region comprising consecutively linked amino acids having the sequence set forth in SEQ ID Nos. 32 or 40.

    [0097] In certain embodiments of the disclosed methods, the anti-CXCR4 Ab or antigen-binding portion thereof comprises a heavy chain constant region which is of a human IgG1, IgG2, IgG3, or IgG4 isotype. In further embodiments, the Ab or antigen-binding portion thereof comprises a heavy chain constant region (e.g., human IgG1 or IgG3) that possesses effector functions including ADCC, ADCP and/or CDC, for example it is of a human IgG3 or, preferably, human IgG1 isotype, or comprises a mutation (e.g., E333A or E333S; Idusogie et al., 2001) that increases effector functions, and mediates the depletion of immunosuppressant regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs). These immunosuppressant cells are known to overexpress CXCR4 (WO 2016/201425), and anti-CXCR4-mediated depletion of Tregs and/or MDSCs may contribute to enhancement of an anti-tumor effect.

    [0098] In certain other embodiments, the anti-CXCR4 Ab comprises a heavy chain constant region (e.g., human IgG2 or, preferably, IgG4) that does not possesses effector functions. In further embodiments, the IgG4 heavy chain constant region of the anti-CXCR4 Ab or antigen-binding portion thereof contains an S228P mutation (numbered using the Kabat system; Kabat et al., 1991), which replaces a serine residue in the hinge region with the proline residue normally found at the corresponding position in IgG1 isotype Abs. This mutation, which is present in ulocuplumab, prevents Fab arm exchange with endogenous IgG4 Abs, while retaining the low affinity for activating Fc receptors associated with wild-type IgG4 Abs.

    [0099] In other embodiments, the Ab comprises a light chain constant region which is a human kappa or lambda constant region.

    [0100] A suitable anti-CXCR4 Ab for use in the methods disclosed herein is ulocuplumab. Ulocuplumab has been evaluated in two Phase 1 clinical trials in subjects with various hematological malignancies including acute myeloid leukemia (AML), multiple myeloma (MM), chronic lymphocytic leukemia (CLL), follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL) with a safe and tolerable profile. Efficacy data from the AML and MM cohorts has been presented and show encouraging results for the addition of ulocuplumab to standard therapy (Becker et al., 2014; Ghobrial et al., 2014), and Phase 1/2 clinical trials in AML, and mutated CXCR4 Waldenstrom's macroglobulinemia (see patients are ongoing (see NCT02305563 and NCT03225716 on the Clinical Trials Website, http://www.clinicaltrials.gov). In certain embodiments, a human IgG1 variant of ulocuplumab is used.

    [0101] Other suitable anti-CXCR4 Abs include, for example, the Abs designated c414H5 and c515H7 (WO 2010/037831), the Abs designated Antibody I, Antibody II, Antibody III, Antibody IV, and Antibody V (U.S. Pat. No. 7,892,546), the Ab designated 6C7 (WO 2013/013025), and humanized 3G10 Abs, e.g., the Abs designated h3G1 0.A57.A58, h3G10.1.91.A58A and h3G10.1.91.A58B (U.S. Publication No. 2015/0037328).

    [0102] Anti-CXCR4 Abs usable in the methods of the disclosed invention also include antigen-binding portions of the above Abs. It has been amply demonstrated that the antigen-binding function of an Ab can be performed by fragments of a full-length Ab. Examples of binding fragments encompassed within the term “antigen-binding portion” of an Ab include (i) a Fab fragment, a monovalent fragment consisting of the V.sub.L, V.sub.H, C.sub.L and C.sub.H1 domains; (ii) a F(ab′).sub.2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the V.sub.H and C.sub.H1 domains; and (iv) a Fv fragment consisting of the V.sub.L and V.sub.H domains of a single arm of an Ab.

    [0103] These fragments, obtained initially through proteolysis with enzymes such as papain and pepsin, have been subsequently engineered into monovalent and multivalent antigen-binding fragments. For example, although the two domains of the Fv fragment, V.sub.L and V.sub.H, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker peptide that enables them to be made as a single protein chain in which the V.sub.L and V.sub.H regions pair to form monovalent molecules known as single chain variable fragments (scFv). Divalent or bivalent scFvs (di-scFvs or bi-scFvs) can be engineered by linking two scFvs in within a single peptide chain known as a tandem scFv which contains two V.sub.H and two V.sub.L regions. ScFv dimers and higher multimers can also be created using linker peptides of fewer than 10 amino acids that are too short for the two variable regions to fold together, which forces the scFvs to dimerize and produce diabodies or form other multimers. Diabodies have been shown to bind to their cognate antigen with much higher affinity than the corresponding scFvs, having dissociation constants up to 40-fold lower than the K.sub.D values for the scFvs. Very short linkers (≤3 amino acids) lead to the formation of trivalent triabodies or tetravalent tetrabodies that exhibit even higher affinities for to their antigens than diabodies. Other variants include minibodies, which are scFv-C.sub.H3 dimers, and larger scFv-Fc fragments (scFv-C.sub.H2-C.sub.H3 dimers), and even an isolated CDR may exhibit antigen-binding function.

    [0104] Accordingly, in certain embodiments, the Ab fragment is selected from a Fab, F(ab′).sub.2, Fd and Fv fragment, a single domain Ab (sdAb), a single-chain variable fragment (scFv), a divalent scFv (di-scFv) and bivalent scFv (bi-scFv), a diabody, a minibody, and an isolated CDR. In certain preferred embodiments, the Ab fragment is selected from a Fab, F(ab′).sub.2, Fd and Fv fragment and a single chain variable fragment (scFv). These Ab fragments are engineered using conventional recombinant techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact Abs. All of the above proteolytic and engineered fragments of Abs and related variants (see Hollinger and Hudson, 2005; Olafsen and Wu, 2010, for further details) are intended to be encompassed within the term “antigen-binding portion” of an Ab.

    [0105] Cross-Competing Abs

    [0106] Additional anti-CXCR4 Abs usable in the disclosed methods include Abs that bind specifically to human CXCR4 and cross-compete for binding to human CXCR4 with a reference Ab, for example, ulocuplumab (F7GL) or any of the Abs designated F7, F9, D1 and E2 (see, e.g., WO 2008/060367; WO 2013/071068). The ability of a pair of Abs to “cross-compete” for binding to an antigen indicates that a first Ab binds to substantially the same epitope region of the antigen as, and reduces the binding of, a second Ab to that particular epitope region and, conversely, the second Ab binds to substantially the same epitope region of the antigen as, and reduces the binding of, the first Ab to that epitope region. Thus, the ability of a test Ab to competitively inhibit the binding of, for example, ulocuplumab to humanCXCR4, demonstrates that the test Ab binds to substantially the same epitope region of human CXCR4 as does ulocuplumab. Accordingly, anti-CXCR4 Abs usable in the disclosed methods include Abs that bind specifically to substantially the same epitope region of the antigen as a reference Ab, for example, ulocuplumab.

    [0107] A first Ab is considered to bind to “substantially the same epitope” or “substantially the same determinant” as does a second Ab if the first Ab reduces the binding of the second Ab to an antigen by at least about 40%. Preferably, the first Ab reduces the binding of the second Ab to the antigen by more than about 50% (e.g., at least about 60% or at least about 70%). In more preferred embodiments, the first Ab reduces the binding of the second Ab to the antigen by more than about 70% (e.g., at least about 80%, at least about 90%, or about 100%). The order of the first and second Abs can be reversed, i.e. the “second” Ab can be first bound to the surface and the “first” is thereafter brought into contact with the surface in the presence of the “second” Ab. The Abs are considered to “cross-compete” if a competitive reduction in binding to the antigen is observed irrespective of the order in which the Abs are added to the antigen.

    [0108] Cross-competing Abs are expected to have similar functional properties by virtue of their binding to substantially the same epitope region of an antigen such as a CXCR4 receptor. The higher the degree of cross-competition, the more similar will the functional properties be. For example, two cross-competing Abs are expected to have essentially the same functional properties if they each inhibit binding of the other to an epitope by at least about 80%. This similarity in function is expected to be even closer if the cross-competing Abs exhibit similar affinities for binding to the epitope as measured by the dissociation constant (K.sub.D).

    [0109] Cross-competing anti-antigen Abs can be readily identified based on their ability to detectably compete in standard antigen binding assays, including surface plasmon resonance (BIAcore®) analysis, ELISA assays or flow cytometry, using either recombinant antigen molecules or cell-surface expressed antigen molecules. By way of example, a simple competition assay to identify whether a test Ab competes with ulocuplumab for binding to human CXCR4 may involve: (1) measuring the binding of ulocuplumab, applied at saturating concentration, to a BlAcore chip (or other suitable medium for surface plasmon resonance analysis) onto which human CXCR4 is immobilized, and (2) measuring the binding of ulocuplumab to a human CXCR4-coated BIAcore chip (or other medium suitable) to which the test Ab has been previously bound. The binding of ulocuplumab to the CXCR4-coated surface in the presence and absence of the test Ab is compared. A significant (e.g., more than about 40%) reduction in binding of ulocuplumab in the presence of the test Ab indicates that both Abs recognize substantially the same epitope such that they compete for binding to the CXCR4 target. The percentage by which the binding of a first Ab to an antigen is inhibited by a second Ab can be calculated as: [1-(detected binding of first Ab in presence of second Ab)/(detected binding of first Ab in absence of second Ab)]×100. To determine whether the Abs cross-compete, the competitive binding assay is repeated except that the binding of the test Ab to the CXCR4-coated chip in the presence of ulocuplumab is measured.

    [0110] In one aspect, anti-CXCR4 Abs for use in the methods of this disclosure cross-compete for binding to CXCR4 with any of mAb F7GL (ulocuplumab; having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 33 and 37, respectively), F7, having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 25 and 29, respectively), mAb 79GL (having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 34 and 38, respectively), mAb F9 (having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 26 and 30, respectively), mAb D1GL (having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 35 and 39, respectively), mAb D1 (having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 27 and 31, respectively), mAb E2GL (having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 36 and 40, respectively), and mAb E2 (having V.sub.H and V.sub.L sequences as shown in SEQ ID Nos. 28 and 32, respectively). Abs that cross-compete for binding to CXCR4 bind to the same epitope region (i.e., the same or an overlapping epitope) on CXCR4.

    [0111] In certain embodiments, the cross-competing anti-CXCR4 mAb comprises a V.sub.H region comprising consecutively linked amino acids having a sequence derived from a human V.sub.H 3-48 germline sequence as set forth in SEQ ID NO: 41 and/or a V.sub.L region comprising consecutively linked amino acids having a sequence derived from a human V.sub.K L15 germline sequence as set forth in SEQ ID NO: 42.

    Broad Spectrum of Cancers Amenable to Treatment by Disclosed Methods

    [0112] Immuno-oncology, which relies on using the flexibility of the immune system to attack and destroy cancer cells, is applicable to treating a very broad range of cancers (see, e.g., Guillerey et al., 2016; Lowry and Zehring, 2017; Callahan et al., 2016; Kamta et al., 2017; Farkona et al., 2016). Accordingly, the disclosed methods employing the administration of NK cells, preferably NKAE cells, combined with blockade of the CXCR4/CXCL12 signaling pathway is applicable to treating a wide variety of both solid and liquid tumors.

    [0113] In certain embodiments, the disclosed combination therapy methods may be used to treat a cancer which is a solid tumor. In certain preferred embodiments, the solid tumor is a pediatric tumor. In further embodiments, the pediatric tumor is a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma. Despite aggressive treatment, nearly half of children with such tumors have progressive disease. The prognosis is particularly poor for those patients with metastatic disease, at least two thirds of whom have disease progression. Outcomes after recurrence are generally dismal. For patients with recurrent Ewing sarcoma, for example, the likelihood of long-term survival is currently less than 20%, and less than 10% if relapse occurs within 2 years (Leavey et al., 2008). Therefore, new therapeutic approaches that bypass the cellular mechanisms of drug resistance are urgently needed, particularly for patients with high-risk features, such as metastatic or recurrent disease.

    [0114] In other embodiments, the solid tumor is a cancer selected from small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), squamous NSCLC, non-squamous NSCLC, squamous cell cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, pancreatic ductal adenocarcinoma (PDAC), ovarian cancer, cervical cancer, carcinoma of the fallopian tubes, uterine (endometrial) cancer, carcinoma of the endometrium, uterine sarcoma, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the urethra, cancer of the ureter, prostate cancer, metastatic castration-resistant prostate cancer (mCRPC), testicular cancer, penile cancer, bladder cancer, breast cancer, triple negative breast cancer (TNBC), male breast cancer, germ cell tumor, sarcoma, skin cancer, basal cell carcinoma, squamous cell carcinoma, Merkel cell carcinoma, bone cancer, melanoma, head and neck cancer, squamous cell carcinoma of the head and neck (SCCHN), thyroid cancer, oral cancer, mouth cancer, salivary gland cancer, throat cancer, esophageal cancer, gastrointestinal cancer, gastric cancer, cancer of the small intestine, gallbladder and bile duct cancer, colorectal cancer, colon carcinoma, rectal cancer, anal cancer, liver cancer, hepatoma, kidney cancer, renal cell carcinoma, cancer of the endocrine system, tumors of the thymus gland, thymona, cancer of the parathyroid gland, cancer of the adrenal gland, soft tissue sarcoma, mesothelioma, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain cancer, glioma, brain stem glioma, glioblastoma, glioblastoma multiforme (GBM), neuroblastoma, pituitary adenoma, epidermoid cancer, solid tumors of childhood, pediatric sarcoma, metastatic cancer, cancer of unknown primary origin, environmentally-induced cancers, virus-related cancers, AIDS-related cancers, Kaposi's sarcoma, cancers of viral origin, advanced, refractory and/or recurrent solid tumors, and any combination of the preceding solid tumors. In certain embodiments, the cancer is an advanced, unresectable, metastatic, refractory cancer, and/or recurrent cancer.

    [0115] In certain other embodiments, the present combination therapy methods may be used to treat a cancer which is a hematological malignancy. Hematological malignancies include liquid tumors derived from either of the two major blood cell lineages, i.e., the myeloid cell line (which produces granulocytes, erythrocytes, thrombocytes, macrophages and mast cells) or the lymphoid cell line (which produces B, T, NK and plasma cells), including all types of leukemias, lymphomas, and myelomas. Hematological malignancies that may be treated using the present combination therapy methods include, for example, cancers selected from acute lymphoblastic leukemia (ALL), AML, CLL, chronic myelogenous leukemia (CML), Hodgkin's lymphoma (HL), non-Hodgkin's lymphomas (NHLs), MM, smoldering myeloma, monoclonal gammopathy of undetermined significance (MGUS), advanced, metastatic, refractory and/or recurrent hematological malignancies, and any combinations of said hematological malignancies.

    [0116] In other embodiments, the hematological malignancy is a cancer selected from acute, chronic, lymphocytic (lymphoblastic) and/or myelogenous leukemias, such as ALL, AML, CLL, and CIVIL; lymphomas, such as HL, NHLs, of which about 85% are B cell lymphomas, including DLBCL, FL, CLL/small lymphocytic lymphoma (SLL), mantle cell lymphoma, marginal zone B-cell lymphomas (mucosa-associated lymphoid tissue (MALT) lymphoma, nodal marginal zone B-cell lymphoma, and splenic marginal zone B-cell lymphoma), Burkitt lymphoma, lymphoplasmacytoid lymphoma (LPL; also known as Waldenstrom's macroglobulinemia (WM)), hairy cell lymphoma, and primary central nervous system (CNS) lymphoma, NHLs that are T cell lymphomas, including precursor T-lymphoblastic lymphoma/leukemia, T-lymphoblastic lymphoma/leukemia (T-Lbly/T-ALL), peripheral T-cell lymphomas such as cutaneous T-cell lymphoma (CTLC, i.e., mycosis fungoides, Sezary syndrome and others), adult T-cell lymphoma/leukemia, angioimmunoblastic T-cell lymphoma, extranodal natural killer/T-cell lymphoma nasal type, enteropathy-associated intestinal T-cell lymphoma (EATL), anaplastic large-cell lymphoma (ALCL), and peripheral T-cell lymphoma unspecified, acute myeloid lymphoma, lymphoplasmacytoid lymphoma, monocytoid B cell lymphoma, angiocentric lymphoma, intestinal T-cell lymphoma, primary mediastinal B-cell lymphoma, post-transplantation lymphoproliferative disorder, true histiocytic lymphoma, primary effusion lymphoma, diffuse histiocytic lymphoma (DHL), immunoblastic large cell lymphoma, and precursor B-lymphoblastic lymphoma; myelomas, such as multiple myeloma, smoldering myeloma (also called indolent myeloma), monoclonal gammopathy of undetermined significance (MGUS), solitary plasmocytoma, IgG myeloma, light chain myeloma, nonsecretory myeloma, and amyloidosis; and any combinations of said hematological malignancies. The present methods are also applicable to treatment of advanced, metastatic, refractory and/or recurrent hematological malignancies.

    Pharmaceutical Compositions and Dosage Regimens

    [0117] Abs and NK cells used in the methods disclosed herein may be constituted in a composition, e.g., a pharmaceutical composition containing an Ab or a population of NKAE cells and a pharmaceutically acceptable carrier. As used herein, a “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Preferably, the carrier for a composition containing an Ab is suitable for intravenous, subcutaneous, intramuscular, parenteral, spinal or epidermal administration (e.g., by injection or infusion).

    [0118] An option for SC injection is based on Halozyme Therapeutics' ENHANZE® drug-delivery technology, involving a co-formulation of an Ab with recombinant human hyaluronidase enzyme (rHuPH20) that removes traditional limitations on the volume of biologics and drugs that can be delivered subcutaneously due to the extracellular matrix (U.S. Pat. No. 7,767,429).

    [0119] Preferably, the carrier for a composition containing NK cells is suitable for intravenous, intraarterial, intraperitoneal, intrafemoral, intrathecal, or intratumoral injection, or injection into a tumor resection cavity.

    [0120] A pharmaceutical composition of the invention may include one or more pharmaceutically acceptable salts, anti-oxidants, aqueous and non-aqueous carriers, and/or adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.

    [0121] Dosage regimens are adjusted to provide the optimum desired response, e.g., a maximal therapeutic response and/or minimal adverse effects. The dosage for administration of an anti-CXCR4 Ab may range from about 0.01 to about 20 mg/kg, preferably from about 1.0 to about 15 mg/kg, of the subject's body weight. For example, dosages can be about 0.1, 0.3, 1, 2, 3, 5, 10, 15 or 20 mg/kg body weight, and preferably, about 1, 3, 5, 10 or 15 mg/kg body weight. Alternatively, a fixed or flat dose, e.g., about 50 to about 2000 mg of the Ab, instead of a dose based on body weight, may be administered. For example, dosages can be about 200, about 400, about 800, about 1600, or about 2000 mg, and preferably, about 400, about 800, about 1600. The NKAE cells may be administered to the patient in a dose based on absolute numbers of cells ranging from about 10.sup.6 to about 10.sup.14 cells. For example, cells may be administered to the subject in doses of about 1×10.sup.5, 5×10.sup.5, 1×10.sup.6, 5×10.sup.6, 1×10.sup.7, 5×10.sup.7, 1×10.sup.8, 5×10.sup.8, 1×10.sup.9, 5×10.sup.9, 1×10.sup.10, 5×10.sup.10, 1×10.sup.11, 5×10.sup.11, 1×10.sup.12, 5×10.sup.12, 1×10.sup.13, 5×10.sup.13, or 1×10.sup.14 cells. In preferred embodiments, NKAE cells are administered to the subject in doses of about 1×10.sup.7 to 5×10.sup.10 cells, preferably 1×10.sup.8 to 5×10.sup.9 cells, more preferably about 5×10.sup.8 cells. In other embodiments, NKAE cells are administered to the subject in doses of about 1×10.sup.5 to 1×10.sup.8 cells/kg body weight, preferably about 1×10.sup.6 to 5×10.sup.7 cells/kg, more preferably about 7.5×10.sup.6 cells/kg. NKAE cells may be administered multiple times to the patient. For example, the patient may receive one to four infusions, typically two or three infusions. These infusions are generally spaced at least one week apart.

    [0122] The dosing schedule for an Ab is typically designed to achieve exposures that result in sustained receptor occupancy (RO) based on typical pharmacokinetic properties of the Ab. An exemplary treatment regime entails administration of the anti-CXCR4 Ab or antigen-binding portion thereof twice about every week, once about every week, once about every 2 weeks, once about every 3 weeks, once about every 4 weeks, or once about every month. In certain preferred embodiments, the anti-CXCR Ab is administered to the subject approximately weekly. In other embodiments, the Ab is administered once about every 2 weeks or once about every 3 weeks. In certain preferred embodiments, the NK cells are administered about weekly to the patient. In other embodiments, the NK cells are administered to the patient twice about every week or once about every 2 weeks. The dosage and scheduling may change during a course of treatment.

    [0123] In certain embodiments of any of the methods disclosed herein, the anti-CXCR4 Ab or antigen-binding portion thereof is administered to the patient by intravenous or subcutaneous administration. In further embodiments, the NK cells and the Ab or antigen-binding portion thereof are administered sequentially to the subject. “Sequential” administration means that one of the NK cells and anti-CXCR4 Ab or antigen-binding portion thereof is administered before the other. Either therapeutic may be administered first; i.e., in certain embodiments, the NK cells are administered before the Ab or antigen-binding portion thereof, whereas in other embodiments, the anti-CXCR4 Ab or antigen-binding portion thereof is administered before the NK cells. Typically, the Ab is administered by intravenous infusion over a period of about 60 minutes.

    [0124] In certain embodiments, the NK cells and the Ab or antigen-binding portion thereof are administered concurrently in separate compositions, whereas in other embodiments, the NK cells and the Ab or antigen-binding portion thereof are admixed in a single composition and administered concurrently.

    [0125] In certain embodiments of any of the therapeutic methods disclosed herein, administration of the combination of the NK cells and the Ab or antigen-binding portion thereof is continued for as long as clinical benefit is observed or until unmanageable toxicity or disease progression occurs.

    Medical Uses of the Combination of NK Cells and Anti-CXCR4 Abs

    [0126] This disclosure also provides a population of NK cells, preferably NKAE cells, and an anti-CXCR4 Ab or an antigen-binding portion thereof for use in combination in treating a subject afflicted with cancer. These therapeutic agents may be used in combination therapy of the full range of cancers disclosed herein. In certain preferred embodiments, the cancer is a pediatric tumor, for example, a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma.

    [0127] One aspect of the disclosed invention is the combined use of a population of NK cells, preferably NKAE cells, and an anti-CXCR4 Ab or an antigen-binding portion thereof for the preparation of a medicament for treating a subject afflicted with a cancer. Uses of any such NKAE cells and anti-CXCR4 Ab in combination for the preparation of medicaments are broadly applicable to the full range of cancers disclosed herein. In certain preferred embodiments of these uses, the cancer is a pediatric tumor, for example, a rhabdomyosarcoma, osteosarcoma, neuroblastoma, retinoblastoma, or Ewing sarcoma.

    [0128] This disclosure also provides medical uses of a population of NKAE cells in combination with an anti-CXCR4 Ab corresponding to all the embodiments of the methods of treatment employing this combination of therapeutic agents described herein.

    Kits

    [0129] Also within the scope of the present invention are kits comprising a population of NK cells, preferably NKAE cells, and an anti-CXCR4 Ab or an antigen-binding portion thereof for therapeutic use. Kits typically include a label indicating the intended use of the contents of the kit and instructions for use. The term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit. Accordingly, this disclosure provides a kit for treating a subject afflicted with a cancer, the kit comprising: (a) one or more dosages ranging from about 50 to about 2000 mg of an Ab or an antigen-binding portion thereof that binds specifically to CXCR4 expressed on the surface of a cancer cell; (b) one or more dosages ranging from about 10.sup.6 to about 10.sup.14 of a population of NK cells, preferably NKAE cells; and (c) instructions for using the Ab or portion thereof and the NK cells in any of the combination therapy methods disclosed herein. In certain embodiments, the Abs may be co-packaged in unit dosage form. In certain preferred embodiments for treating human patients, the kit comprises any one of the anti-human CXCR4 Abs disclosed herein, e.g., ulocuplumab or an Ab that competes with ulocuplumab for binding to human CXCR4.

    [0130] The present invention is further illustrated by the following examples which should not be construed as further limiting. The contents of all references cited throughout this application are expressly incorporated herein by reference.

    EXAMPLE 1

    Expression of CXCR4 by Different Sarcoma Cell Lines

    [0131] Surface expression of CXCR4 was analyzed by flow cytometry on confluent cell cultures of different sarcoma cell lines: two rhabdomyosarcoma cell lines (RH30 and CW9019), two Ewing sarcoma cell lines (A4573 and A673) and two osteosarcoma cell lines (MG-63 and 143B). 143B (CRL-8303), MG-63 (CRL-1427) and A673 (CRL1598) cell lines were from the American Type Culture Collection. RH30 (ACC-489) was from the Leibniz-Institut DSMZ. A4573 and CW9019 were kind gifts from Dr. Javier Alonso (Institute of Health Carlos III) and Dr. Josep Roma (Vall d'Hebron Research Institute), respectively. For staining, 2×10.sup.5 cells/well were centrifuged in V-bottom 96-well plates and washed with phosphate-buffered saline (PBS, Lonza) containing 0.5% bovine serum albumin (BSA, Lonza), 1% FBS and 0.1% sodium azide (PBSst). Non-specific binding was blocked by pre-incubating the cells with 40 μg/ml rat IgG (Sigma; 100 μl final volume, 20 min, 4° C.). Cells were incubated with anti-CXCR4-APC mAb (BD Pharmingen; clone 12G5) or isotype-matched mAb (30 min, 4° C.). Samples were analyzed on a Navios cytometer (Beckman Coulter).

    [0132] For qRT-PCR, cell culture RNA was obtained using RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. The RNA was quantified by measuring the absorbance of extracts at 260 nm. The relative expression level of mRNA encoding human CXCR4 was determined by qRT-PCR using GUS gene expression as internal control. cDNA was synthesized from 1 μg of total RNA with the Superscript IV First-Strand Synthesis System (Invitrogen) and the supplier's protocol. The cDNA was amplified in duplicate with primers for human CXCR4 (Hs00237052_ml, Applied Biosystems) and for human GUS (Fw: 5′-GAAAATATGTGGTTGGAGAGCTCATT-3′, Rv: 5′-CCGAGTGAAGATCCCCTTTTTA-3′; Probe: 5′-[6FAM]CCAGCACTCTCGTCGGTGACTGTTCA[TAMRA]-3′; all from Sigma). Amplification (50 cycles; 95° C. for 15 s, 60° C. for 1 min) was monitored using Fast Start TaqMan Probe Master (Roche) labelled with 6-FAM dye and non-fluorescent quencher on the Roche LightCycler 480. Relative expression was analyzed using 2.sup.-AC.sup.T method, where ΔCT=(Ct gene of interest−Ct internal control).

    [0133] As shown in FIG. 1A, the highest proportion of CXCR4.sup.+ cells was found in RH30 alveolar rhabdomyosarcoma cell cultures, where CXCR4 expression was detected in 98.6±0.7% of cells.

    [0134] These results were in agreement with the expression of CXCR4 mRNA as determined by qRT-PCR analysis. RH30 cultures showed 1.38±0.014 relative to GUS control gene expression (FIG. 1B).

    EXAMPLE 2

    Migration and Invasion of Different Sarcoma Cell Lines Towards a CXCL12 Gradient

    [0135] The migration capacity of the different sarcoma cell lines (RH30, CW9019, A4573, A673, MG-63 and 143B) towards CXCL12 (100 ng/ml) or fetal bovine serum (FBS, 10%) was tested in Transwell assays (48 h), which are considered an in vitro indicator of in vivo metastatic potential. Cells were incubated in starving buffer (DMEM-1% FBS) for 24 h. Next, 2×10.sup.5 cells were suspended in 80 μl of migration buffer [DMEM-1% human serum albumin (HSA); Grifols] and placed in the upper compartment of 96-well transwell plates (8.0 μm pore size, Neuroprobe). The lower compartment was filled with 300 μl of migration buffer alone (unconditioned medium), migration buffer with 100 ng/ml CXCL12 (R&D Systems), or migration buffer with 10% FBS. Invasion capacity was measured under the same conditions, with the upper part of the Transwell membranes coated with 20 μl of 0.2 mg/ml Matrigel (Corning).

    [0136] After 48 h of incubation to allow cells to migrate/invade through the membrane, the cells remaining on the upper face of the membrane were removed using a cotton wool swab, while the cells on the lower side of the membrane were fixed with methanol and stained with crystal violet. After washing with PBS, the number of migrating/invading cells was determined using a Carl Zeiss Axiovert 200 microscope. Four fields per well were counted at 200×. Migration and invasion index was calculated according to the following formula: Index=100×[(no. of counted cells towards conditioned medium−no, of counted cells towards unconditioned medium)/(100−no, of counted cells towards unconditioned medium)].

    [0137] The results are shown in FIG. 2. Different sarcoma cell lines showed moderate-level migration and invasion capacity towards highly chemoattractant FBS (FIG. 2A) but negligible migration and invasion capacity under the conditions of the assay (FIG. 2B). Concomitant with its relatively high level of CXCR4 expression, only RH30 cells were able to migrate and invade, specifically, towards CXCR4 ligand, CXCL12 (FIG. 2B). The RH30 migration and invasion index towards CXCL12 was 35.23±8.3 and 104.04±16.4, respectively. Statistical analyses were performed using GraphPad Prism 7 software. Statistical significance was established at p<0.05 as evaluated by unpaired Student's t test, unless otherwise indicated. Results are shown as mean±SEM, unless otherwise indicated.

    EXAMPLE 3

    NKAE Cells are Cytotoxic Against RH30 Cells, and Anti-CXCR4 in Combination with NKAE Cells Synergistically Abrogate Migration and Invasion Capacity of RH30 Cells In Vitro

    [0138] Because ulocuplumab is a fully human IgG4 anti-CXCR4 mAb, it is not expected to induce ADCC (Davies and Sutton, 2015). The cytolytic activity of NKAE cells was measured as the percentage of killing of RH30 cells pre-coated with ulocuplumab, with an isotype control mAb, or with no mAb. NK cells from a healthy donor were activated and expanded with irradiated K562-mb15-41BBL cells (Fujisaki et al., 2009) and IL-2. Briefly, peripheral blood mononuclear cells (PBMCs) from healthy donors were isolated by centrifugation over a density gradient (Ficoll-Paque, GE Healthcare) (400 g, 30 min). The genetically modified K562mbIL15-41BBL cell line, kindly provided by Professor D. Campana (National University of Singapore), was irradiated with 100 Gy. NKAE cells were obtained by co-culturing donor's PBMCs with irradiated K562-mb15-41BBL cells in a 1:1.5 ratio plus 100 U/ml of IL-2 over 14-21 days in stem cell growth medium (SCGM, Cellgenix) supplemented with 10% human AB serum (Sigma) and 100 IU/mL IL-2 (Miltenyi). Fresh medium was added every 2-3 days to a final concentration of 1×10.sup.6 cells/ml. Percentage and phenotype of NK cells (CD3.sup.−, CD56.sup.+), T cells (CD3.sup.+, CD56.sup.−) and NKT cells (CD3.sup.+, CD56.sup.+) were monitored weekly by flow cytometry (Navios, Beckman Coulter). Labelled Abs used in this study are listed in Table 2.

    TABLE-US-00002 TABLE 2 Labeled Abs used in study. Specificity Clone Isotype Fluorochrome Manufacturer CD3 UCHT1 mIgG1 PE/Cy7 BioLegend CD45 J33 mIgG1 FITC Beckman Coulter CD56 B159 mIgG1 APC BD Biosciences CXCR4 12G5 mIgG2a APC BD Biosciences Isotype control 20102 mIgG2a APC R&D Systems

    [0139] In order to study the effects of various treatments on rhabdomyosarcoma cells, bioluminescent RH30 cells (RH30-GFP-Luc) were generated by infection with a recombinant lentivirus encoding green fluorescent protein (GFP) and firefly luciferase (Luc) under the EF1a promoter and with a neomycin resistance marker (Amsbio).

    [0140] Infected cells expressing high GFP levels were isolated by fluorescence activated cell sorting, cloned, expanded, and used for in vivo bioluminescence assays. RH-30-GFP-Luc cells retained surface CXCR4 expression and exhibited growth kinetics similar to parental RH30 cells. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Lonza) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM L-glutamine, 50 U/ml penicillin, and 50 μg/ml streptomycin (complete medium).

    [0141] RH30-GFP-Luc cells were pre-incubated (30 min) with indicated mAb concentrations. NKAE and target cells were co-cultured (4 h) at a 20:1 or a 5:1 ratio in DMEM-10% FBS, then stained with 7-AAD (10 min, 4° C.) and analyzed by flow cytometry. Gating on 7-AAD-positive cells within the GFP.sup.+ population indicated the proportion of dead target cells. Specific killing was calculated as 100×[(% dead target cells in sample−% spontaneous dead target cells)/(100−% spontaneous dead target cells)]. Target cells incubated without effector cells were used to assess spontaneous cell death.

    [0142] As seen in FIG. 3A, NKAE cells induced 23.0±1.8 specific RH30 cell killing in a 20:1 E:T ratio, while ulocuplumab and control mAbs had little or no effect on the observed cytotoxicity.

    [0143] The effects of ulocuplumab (MDX1338) and NKAE cells, individually and in combination, was also tested on the migration of RH30 alveolar rhabdomyosarcoma cells towards a gradient of human recombinant CXCL12 and the invasion capacity of these cells in vitro was tested using Transwell plates and Matrigel. For these experiments, 10.sup.5 RH30 cells were mixed with the indicated final concentration of ulocuplumab, control IgG4 mAb and/or 500,000 NKAE cells (effector:target ratio, E:T=5:1) in a final volume of 90 μl of migration buffer and the assay done as described above.

    [0144] Each of ulocuplumab and NKAE efficiently reduced in vitro RH30 cell migration (FIG. 3B) and invasion (FIG. 3C), but the combination of the two therapies interacted synergistically to completely abrogate both migration and invasion (FIGS. 3B and 3C). This combination of anti-CXCR4 and NKAE cell therapy is considered synergistic as the observed antitumor effect is greater than the effect observed with either anti-CXCR4 or NKAE cell therapy administered as monotherapy, and greater than the sum of the level of inhibition exhibited by each treatment individually.

    EXAMPLE 4

    Anti-CXCR4 Enhances In Vivo Anti-Tumor Activity of NKAE Cells in Metastic Sarcoma Mouse Tumor Model

    [0145] To assess the anti-tumor activity of NKAE cell therapy, either alone or in combination with an anti-CXCR4 Ab, an in vivo model of metastatic sarcoma was generated using CXCR4.sup.+ RH30 alveolar rhabdomyosarcoma cells, which grow as peritoneal xenografts when implanted in immunodeficient NSG™ mice. NSG™ mice (NOD.Cg-Prkdc.sup.scid Il2rg.sup.tm1Wjl/SzJ, Charles River Laboratories) were maintained in the Alberto Sols Biomedical Research Institute animal facility. All procedures were approved by Comunidad de Madrid Animal Protection Area (PROEX 220/16) and CSIC Ethics Committee.

    [0146] NKAE cells were prepared from PBMCs using K562-mb15-41BBL cells as described in Example 3.

    [0147] Lentiviral particles expressing GFP and luciferase were used to transduce RH30 alveolar rhabdomyosarcoma cells. Six-weeks-old female mice were inoculated intravenously (i.v.) with 0.5×10.sup.6 RH30-GFP.sup.+Luc.sup.+ cells on Day 0 to generate an in vivo model of metastatic sarcoma. Five treatment groups were established (5 mice/group): untreated; isotype control IgG4 mAb; anti CXCR4 ulocuplumab; NKAE cells; ulocuplumab and NKAE combination. Three doses of NKAE cells (5×10.sup.6 cells each, weekly) were administered to the mice on Days 0 (day of tumor implant), 7 and 14; and 6 doses of ulocuplumab (15 mg/kg twice per week) were administered on Days 0, 3, 7, 10, 14 and 18. The size of developing tumors as determined by luminescent signal, was measured until Day 35, when mice were sacrificed.

    [0148] Briefly, D-luciferin (150 mg/kg; Perkin Elmer) was administered intraperitoneally (i.p.) 10 min before analysis. During imaging, mice were anesthetized with isoflurane in a lightproof chamber using a IVIS-Lumina II (Caliper Lifesciences). Exposure time was 100 s. Living Image v4.5.2 (Perkin Elmer) was used to quantify the data and produce pseudocolor images.

    [0149] Subsequently, micrometastasis in lungs, liver, bone marrow and spleen were detected and quantified by qRT-PCR using human CXCR4-specific and human GUS TaqMAN probes. One third of mice dissected organs were used for total RNA extraction using RNAeasy Mini kit (Qiagen) according to the manufacturer's protocol. The RNA was quantified by measuring the absorpance of extracts at 260 nm. The relative expression levels of mRNA encoding human CXCR4 and human GUS were determined by semi-quantitative RT-PCR. cDNA synthesis and human CXCR4 and human GUS amplification was performed as described in Example 1. Indicated values are relative to hCXCR4 and hGUS expression by a pellet of 10.sup.6 RH30 cells.

    [0150] Micrometastasis was also detected by immunohistochemistry using hematoxylin-eosin staining and hCXCR4-specific Ab, and by fluorescence in situ hybridization using Alu-DNA as the probe. Mice dissected organs were fixed overnight in 4% paraformaldehyde (pH 7.4), washed in PBS and embedded in paraffin. Consecutive sections were cut (3 μm) and stained with hematoxylin/eosin using standard procedures. The presence of RH30 cells in the lungs was studied by immune staining using an anti-human CXCR4 Ab (R&D Systems, Clone 44716, dilution 1:50), an EnVision FLEX+ visualization system (mouse, high pH; Agilent), and counterstained with with hematoxylin/eosin. For in situ hybridization, antigen retrieval was first performed with low pH buffer (RiboCC, Roche) and protease III (Roche). Slides were then incubated with the probe Alu positive control probe II (Ventana, Roche 05272041001). Three stringency washes were performed and slides were incubated with an intermediate, rabbit anti-DNP. An OmniRabbit (Ventana, Roche) conjugated with horseradish peroxidase was used for visualization. The immunohistochemical reaction was developed using silver as the chromogen (Silver kit, Ventana, Roche), and nuclei were counterstained with Carazzi's hematoxylin. All images were captured on a Carl Zeiss Lab.A1 microscope with a AxioCam ERC5S digital camera (Carl Zeiss).

    [0151] The effect of the treatments on the growth of the luminescent tumors are shown in FIG. 4A and quantitatively in FIG. 4B. As FIG. 4B shows, ulocuplumab (MDX1338) alone moderately inhibited RH30 tumor implant growth compared to controls (992.8×10.sup.3 ±416.0×10.sup.3 in untreated mice mice vs. 394.7×10.sup.3±192.1×10.sup.3 in MDX1338-trated mice; p=0.035) whereas NKAE treatment was enough to completely prevent it (p=0.0003).

    [0152] Although the RH30 peritoneal primary tumors could be easily monitored using the luminescent detection system, its sensitivity is insufficient to determine the presence of RH30 GFP+Luc+ micrometastasis in distant organs. Therefore, the presence of human cells was assessed by qRT-PCR by amplification of human GUS or human CXCR4 mRNA in mice lungs, liver, spleen and bone marrow. Human genes expression was detected only in the mouse lungs, indicating the presence of RH30 presence in that organ (FIG. 5). NKAE therapy had minimal effect on lung metastasis whereas ulocuplumab administered as monotherapy had a more pronounced effect in reducing the incidence of lung micrometastasis as measured by relative expression of hCXCR4 (FIG. 5A) and hGUS (FIG. 5B). For human CXCR4 relative expression levels, untreated mice showed 11.4×10.sup.−3±4.7×10.sup.−3 vs. 2.0×10.sup.−3±0.6×10.sup.−3 of ulocuplumab (MDX1338)-treated mice. Human GUS relative expression was 14.5×10.sup.−3±5.4×10.sup.−3 in untreated mice vs. 2.5×10.sup.−3±1.1×10.sup.−3 in ulocuplumab-treated mice. However, the combination of both ulocuplumab and NKAE led to undetectable levels of both human CXCR4 and human GUS genes in the analyzed mice lungs (FIGS. 5A and 5B), indicating that this combination completely eliminated lung metastasis. Thus, the combination of anti-CXCR4 and NKAE cell therapy shows a strong synergistic effect in inhibiting growth of RH30 alveolar rhabdomyosarcomas and in abrogating lung metastasis.

    [0153] Immunohistochemical and in situ hybridization analysis further confirmed these results (FIG. 6). Sarcoma lung micrometastases were identified in the lungs of untreated mice by hematoxylin and eosin staining (FIG. 6a), A/u sequence hybridization (FIG. 6b), and CXCR4-specific Ab staining (FIG. 6c), whereas mice treated with the combination of NKAE and ulocuplumab showed an absence of micrometastasis (FIG. 6d).

    EXAMPLE 5

    CXCR4 Expression in Samples of Pediatric Rhabdomyosarcoma Patients is Higher in Post-Chemotherapy and Post-Release Samples than in Diagnostic Samples

    [0154] The expression of CXCR4 was evaluated by immunohistochemistry in 23 pediatric rhabdomyosarcoma specimens deposited in La Paz University Hospital Biobank from 2010 to 2017. The median follow up period was 7.9 years (range 0.6-18.4) and the median age of patients was 6.6 years (range 0.2-14.1). 14 specimens were diagnostic samples, 5 specimens were collected after chemotherapeutic treatment, and 4 specimens were relapse samples. Human cell samples were obtained after informed patient consent in accordance with the Helsinki Declaration. Research was approved by the La Paz Hospital Ethics Committee for Clinical Research (PI-2295). For tumor CXCR4 immunohistochemistry, formalin-fixed, paraffin-embedded tumor slides were deparaffinized, hydrated, stained using an anti-human CXCR4 mAb (dilution 1:10; Clone 44716; R&D Systems) and an EnVision FLEX+ visualization system (mouse, high pH; Agilent), and counterstained with hematoxylin-eosin.

    [0155] The specificity of the Ab was confirmed by immunostaining of tonsil tissue. The proportion of CXCR4.sup.+ tumor cells was assigned a score between 0 and 5, and the staining intensity a score between 0 and 3. These 2 values were added to produce the final staining score. Given recent studies describing nuclear localization of CXCR4 in some cancers (Krook et al., 2014; Li et al., 2015), both cytoplasmic and nuclear staining were assessed and equally weighted. Nuclear staining of CXCR4 was present in 15% of cases in the tested series and cytoplasmic staining in 68%.

    [0156] In diagnostic samples, no differences in CXCR4 expression between embryonic vs. alveolar rhabdomyosarcomas nor between samples from localized tumors vs. primary tumors that already had metastasized (FIG. 7A). Regarding the outcome of those patients, a slightly higher CXCR4 score was observed in those samples from patients that subsequently relapsed and also from those patients that finally died of their disease.

    [0157] Interestingly, when CXCR4 expression scores from diagnostic samples (2.8±2.1) we compared with post-chemotherapy samples (4.4±0.7) and relapse samples (6.1±4.4), a strong trend towards higher CXCR4 expression was observed in the latter samples (FIG. 7B).

    TABLE-US-00003 Sequence Listing Summary SEQ ID NO: Description 1 Heavy chain CDR1 sequence of F7 2 Heavy chain CDR1 sequence of F9 3 Heavy chain CDR1 sequence of D1 4 Heavy chain CDR1 sequence of E2 5 Heavy chain CDR2 sequence of F7 6 Heavy chain CDR2 sequence of F9 7 Heavy chain CDR2 sequence of D1 8 Heavy chain CDR2 sequence of E2 9 Heavy chain CDR3 sequence of F7 10 Heavy chain CDR3 sequence of F9 11 Heavy chain CDR3 sequence of D1 12 Heavy chain CDR3 sequence of E2 13 Light chain CDR1 sequence of F7 14 Light chain CDR1 sequence of F9 15 Light chain CDR1 sequence of D1 16 Light chain CDR1 sequence of E2 17 Light chain CDR2 sequence of F7 18 Light chain CDR2 sequence of F9 19 Light chain CDR2 sequence of D1 20 Light chain CDR2 sequence of E2 21 Light chain CDR3 sequence of F7 22 Light chain CDR3 sequence of F9 23 Light chain CDR3 sequence of D1 24 Light chain CDR3 sequence of E2 25 V.sub.H amino acid sequence of F7 26 V.sub.H amino acid sequence of F9 27 V.sub.H amino acid sequence of D1 28 V.sub.H amino acid sequence of E2 29 V.sub.L amino acid sequence of F7 30 V.sub.L amino acid sequence of F9 31 V.sub.L amino acid sequence of D1 32 V.sub.L amino acid sequence of E2 33 V.sub.H amino acid sequence of F7GL 34 V.sub.H amino acid sequence of F9GL 35 V.sub.H amino acid sequence of D1GL 36 V.sub.H amino acid sequence of E2GL 37 V.sub.L amino acid sequence of F7GL 38 V.sub.L amino acid sequence of F9GL 39 V.sub.L amino acid sequence of D1GL 40 V.sub.L amino acid sequence of E2GL 41 V.sub.H 3-48 germline amino acid sequence 42 V.sub.K L15 germline amino acid sequence 43 Human CXCR4 amino acid sequence

    REFERENCES

    [0158] Alsayed Y, Ngo H, Runnels J, Leleu X, Singha UK et al. (2007) Mechanisms of regulation of CXCR4/SDF-1 (CXCL12)-dependent migration and homing in multiple myeloma. Blood 109(7):2708-17. [0159] Azab A K, Runnels J M, Pitsillides C, Moreau A S, Azab F et al. (2009) CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy. Blood 113(18):4341-51. [0160] Bachanova V, Cooley S, Defor T E, Verneris M R, Zhang B et al. (2014) Clearance of acute myeloid leukemia by haploidentical natural killer cells is improved using IL-2 diphtheria toxin fusion protein. Blood 123, 3855-3863. [0161] Balkwill F (2004) The significance of cancer cell expression of the chemokine receptor CXCR4. Semin Cancer Biol 14:171-9. [0162] Bertolini 1, Dell'Agnola C, Mancuso P et al. (2002) CXCR4 neutralization, a novel therapeutic approach for non-Hodgkin's lymphoma. 62(11):3106-12. [0163] Bian W, Yang S X, Chen J H et al. (2007) Preferential expression of chemokine receptor CXCR4 by highly malignant human gliomas and its association with poor patient survival. Neurosurgery 61:570-8. [0164] Billadeau D D, Chatterjee S, Bramati P et al. (2006) Characterization of the CXCR4 signaling in pancreatic cancer cells. Int J Gastrointest Cancer 37:110-9. [0165] Becker P S, Foran J, Altman J et al. (2014) Targeting the CXCR4 pathway: Safety, tolerability and clinical activity of BMS-936564 (ulocuplumab), an anti-CXCR4 antibody, in relapsed refractory acute myeloid leukemia. 56th American Society of Hematology (ASH) Annual Meeting, San Francisco, Dec. 6-9, 2014, Oral Presentation No. 386. [0166] Brennecke P, Arlt M J, Campanile C et al. (2014) CXCR4 antibody treatment suppresses metastatic spread to the lung of intratibial human osteosarcoma xenografts in mice. Clin Exp Metastasis 31, 339-49. [0167] Callahan M, Postow M A, Wolchok J D (2016) Targeting T cell co-receptors for cancer therapy. Immunity 44(5):1069-78. [0168] Cavallaro S (2013) CXCR4/CXCL12 in non-small-cell lung cancer metastasis to the brain. Int J Mot Sci 14:1713-27. [0169] Chaffer C L, Weinberg R A (2011) A perspective on cancer cell metastasis. Science 331:1559-64. [0170] Chatterjee S, Behnam Azad B, Nimmagadda S (2014) The intricate role of CXCR4 in cancer. Adv Cancer Res 124:31-82. [0171] Chen D S, Mellman I (2013) Oncology meets immunology: the cancer-immunity cycle. Immunity 39(1):1-10. [0172] Cho D, Shook D R, Shimasaki N (2010) Cytotoxicity of activated natural killer cells against pediatric solid tumors. Clin Cancer Res 16(15):3901-9. [0173] Clinical Trials Website, https://www.clinicaltrials.gov/ct2/results?term=activated+and+expanded+NK+cells&cond=cancer, last accessed Mar. 9, 2019. [0174] Crazzolara R, Kreczy A, Mann G et al. (2001) High expression of the chemokine receptor CXCR4 predicts extramedullary organ infiltration in childhood acute lymphoblastic leukaemia. Br J Haematol 115:545-53. [0175] Davies A M, Sutton B J (2015) Human IgG4: A structural perspective. Immunological Reviews 268:139-159. [0176] De Falco V, Guarino V, Avilla E et al. (2007) Biological role and potential therapeutic targeting of the chemokine receptor CXCR4 in undifferentiated thyroid cancer. Cancer Res 67:11821-9. [0177] Dewan M Z, Ahmed S, Iwasaki Y et al. (2006) Stromal cell-derived factor-1 and CXCR4 receptor interaction in tumor growth and metastasis of breast cancer. Biomed Pharmacother 60:273-276. [0178] Domanska U M, Kruizinga R C, Nagengast et al. (2013) A review on CXCR4/CXCL12 axis in oncology: No place to hide. Eur J Cancer 49:219-30. [0179] Duda D G, Kozin S V, Kirkpatrick N D et al. (2011) CXCL12 (SDF-1)-CXCR4/CXCR7 pathway inhibition: An emerging sensitizer for anticancer therapies? Clin Cancer Res 17:2074-80. [0180] Farkona S, Diamandis E P, Blasutig IM et al. (2016) Cancer immunotherapy: the beginning of the end of cancer? BMC Medicine 14:73. [0181] Fernández L, Portugal R, Valentin J et al. (2013) In vitro natural killer cell immunotherapy for medulloblastoma. Front Oncol 3(April):94. [0182] Fernández L, Valentin J, Zalacain M (2015) Activated and expanded natural killer cells target osteosarcoma tumor initiating cells in an NKG2D-NKG2DL dependent manner. Cancer Lett 368(1):54-63. [0183] Fujisaki H, Kakuda H, Shimasaki N et al. (2009) Expansion of highly cytotoxic human natural killer cells for cancer cell therapy. Cancer Res 69(9):4010-7. [0184] Gangadhar T, Nandi S, Salgia R (2010) The role of chemokine receptor CXCR4 in lung cancer. Cancer Biol Ther 9:409-16. [0185] Gelmini S, Mangoni M, Castiglione F et al. (2009) The CXCR4/CXCL12 axis in endometrial cancer. Clin Exp Metastasis 26, 261-268. [0186] Ghobrial I, Perez R, Baz R et al. (2014) Phase Ib study of the novel anti-CXCR4 antibody ulocuplumab (BMS-936564) in combination with lenalidomide plus low-dose dexamethasone, or with bortezomib plus dexamethasone in subjects with relapsed or refractory multiple myeloma. 56th American Society of Hematology (ASH) Annual Meeting, San Francisco, Dec. 6-9, 2014, Poster Presentation No. 3483. [0187] Guillerey C, Huntington N D, Smyth M J et al. (2016) Targeting natural killer cells in cancer immunotherapy. Nature Immunol 1025-36. [0188] Han M, Lv S, Zhang Y et al. (2014) The prognosis and clinicopathology of CXCR4 in gastric cancer patients: a meta-analysis. Tumour Biol 35:4589-97. [0189] Hirata H, Hinoda Y, Kikuno N et al. (2007) CXCL12 G801A polymorphism is a risk factor for sporadic prostate cancer susceptibility. Clin Cancer Res 13:5056-62. [0190] Hollinger P, Hudson P J (2005) Engineered antibody fragments and the rise of single domains. Nature Biotech 23(9):1126-36. [0191] Hsu K C, Keever-Taylor C A, Wilton A et al. (2005) Improved outcome in HLA-identical sibling hematopoietic stem-cell transplantation for acute myelogenous leukemia predicted by KIR and HLA genotypes. Blood 105(12):4878-84. [0192] Idusogie E E, Wong P Y, Presta L G et al. (2001) Engineered antibodies with increased activity to recruit complement. J Immunol 166(4):2571-5. [0193] Igarashi T, Wynberg J, Srinivasan R et al. (2004) Enhanced cytotoxicity of allogeneic NK cells with killer immunoglobulin-like receptor ligand incompatibility against melanoma and renal cell carcinoma cells. Blood 104:170-7. [0194] Imai C, Iwamoto S, Campana D (2005) Genetic modification of primary natural killer cells overcomes inhibitory signals and induces specific killing of leukemic cells. Blood 106(1):376-83. [0195] Ishikawa E, Tsuboi K, Saijo K et al. (2004) Autologous natural killer cell therapy for human recurrent malignant glioma. Anticancer Res 24:1861-1871. [0196] Ishikawa T, Nakashiro K, Hara S et al. (2006) CXCR4 expression is associated with lymph-node metastasis of oral squamous cell carcinoma. Int J Oncol 28:61-66. [0197] Jin L, Tabe Y, Konoplev S et al. (2008) CXCR4 up-regulation by imatinib induces chronic myelogenous leukemia (CML) cell migration to bone marrow stroma and promotes survival of quiescent CML cells. Mol Cancer Ther 7:48-58. [0198] Jones J, Marian D, Weich E et al. (2007) CXCR4 chemokine receptor engagement modifies integrin dependent adhesion of renal carcinoma cells. Exp Cell Res 313:4051-65. [0199] Kabat E A, Wu T T, Perry H et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242. [0200] Kajiyama H, Shibata K, Terauchi M et al. (2008) Involvement of SDF-1alpha/CXCR4 axis in the enhanced peritoneal metastasis of epithelial ovarian carcinoma. Int J Cancer 122:91-99. [0201] Kalinkovich A, Tavor S, Avigdor A et al. (2006) Functional CXCR4-expressing microparticles and SDF-1 correlate with circulating acute myelogenous leukemia cells. Cancer Res 66:11013-20. [0202] Kamiya T, Chang Y-H, Campana D (2016) Expanded and activated natural killer cells for immunotherapy of hepatocellular carcinoma. Cancer Immunol Res 4(7):547-81. [0203] Kamta J, Chaar M, Ande A (2017) Advancing cancer therapy with present and emerging immuno-oncology approaches. Front Oncol 18(7):64. [0204] Krook M A, Nicholls L A, Scannell C A et al. (2014) Stress-induced CXCR4 promotes migration and invasion of ewing sarcoma. Mol Cancer Res 12:953-64. [0205] Kuhne M R, Mulvey T, Belanger B et al. (2013) BMS-936564/MDX-1338: a fully human anti-CXCR4 antibody induces apoptosis in vitro and shows antitumor activity in vivo in hematologic malignancies. Clin Cancer Res 19: 357-66. [0206] Lanier L L (2005) NK cell recognition. Annu Rev Immunol 23:225-74. [0207] Lanier L L, Buck D W, Rhodes L et al. (1988) Interleukin 2 activation of natural killer cells rapidly induces the expression and phosphorylation of the Leu-23 activation antigen. J Exp Med 167:1572-85. [0208] Laverdiere C, Hoang B H, Yang R et al. (2005) Messenger RNA expression levels of CXCR4 correlate with metastatic behavior and outcome in patients with osteosarcoma. Clin Cancer Res 11(7):2561-7. [0209] Leavey P J, Mascarenhas L, Marina N et al. (2008) Prognostic factors for patients with Ewing sarcoma (EWS) at first recurrence following multi-modality therapy: A report from the Children's Oncology Group. Pediatr Blood Cancer 51(3):334-8. [0210] Lee B, Sharron, M, Montaner L J et al. (1999) Quantification of CD4, CCRS, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages. Proc Natl Acad Sci USA 96:5215-20. [0211] Leivas A, Perez-Martinez A, Blanchard M J et al. (2016) Novel treatment strategy with autologous activated and expanded natural killer cells plus anti-myeloma drugs for multiple myeloma. Oncoimmunology 5(12):e1250051. [0212] Lesokhin A M, Callahan M K, Postow M A, Wolchok J D (2015) On being less tolerant: enhanced cancer immunosurveillance enabled by targeting checkpoints and agonists of T cell activation. Sci Transl Med 7(280):280sr1. [0213] Li Y-J, Dai Y-L, Zhang W B et al. (2015) Clinicopathological and prognostic significance of chemokine receptor CXCR4 in patients with bone and soft tissue sarcoma: a meta-analysis. Clin Exp Med 9:11101-12. [0214] Libura J, Drukala J, Majka M et al. (2002) CXCR4-SDF-1 signaling is active in rhabdomyosarcoma cells and regulates locomotion, chemotaxis, and adhesion. Blood 100:2597-606. [0215] London L, Perussia B, Trinchieri G (1986) Induction of proliferation in vitro of resting human natural killer cells: IL 2 induces into cell cycle most peripheral blood NK cells, but only a minor subset of low density T cells. J Immunol 137:3845-54. [0216] Long E O, Kim H S, Liu D et al. (2013) Controlling natural killer cell responses: integration of signals for activation and inhibition. Annu Rev Immunol 31:227-58. [0217] Lowry L E, Zehring W A (2017) Potentiation of natural killer cells for cancer immunotherapy: a review of literature. Front Immunol 8:1061. [0218] Lv S, Yang Y, Kwon S et al. (2014) The association of CXCR4 expression with prognosis and clinicopathological indicators in colorectal carcinoma patients: a meta-analysis. Histopathol 64:701-712. [0219] Miki J, Furusato B, Li H et al. (2007) Identification of putative stem cell markers, CD133 and CXCR4, in hTERT-immortalized primary nonmalignant and malignant tumor-derived human prostate epithelial cell lines and in prostate cancer specimens. Cancer Res 67:3153-61. [0220] Miller J S, Soignier Y, Panoskaltsis-Mortari A et al. (2005) Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer. Blood 105(8):3051-7. [0221] Mohle R, Failenschmid C, Bautz F et al. (1999) Overexpression of the chemokine receptor CXCR4 in B cell chronic lymphocytic leukemia is associated with increased functional response to stromal cell-derived factor-1 (SDF-1). Leukemia 13:1954-9. [0222] Moretta L, Locatelli F, Pende D et al. (2011) Killer Ig-like receptor-mediated control of natural killer cell alloreactivity in haploidentical hematopoietic stem cell transplantation. Blood 117(3):764-71. [0223] Nausch N, Cerwenka A (2008) NKG2D ligands in tumor immunity. Oncogene 27(45):5944-58. [0224] Nguyen D X, Bos P D, Massagué J (2009) Metastasis: From dissemination to organ-specific colonization. Nat Rev Cancer 9:274-84. [0225] Olafsen T, Wu A M (2010) Antibody vectors for imaging. Semin Nucl Med 40(3):167-81. [0226] Onoue T, Uchida D, Begum N M et al. (2006) Epithelial-mesenchymal transition induced by the stromal cell-derived factor-1/CXCR4 system in oral squamous cell carcinoma cells. Int J Oncol 29:1133-8. [0227] Pan J, Mestas J, Burdick M D et al. (2006) Stromal derived factor-1 (SDF-1/CXCL12) and CXCR4 in renal cell carcinoma metastasis. Mol Cancer 5:56. [0228] Passaro D, Irigoyen M, Catherinet C et al. (2015) CXCR4 Is Required for Leukemia-Initiating Cell Activity in T Cell Acute Lymphoblastic Leukemia. Cancer Cell 27(6):769-79. [0229] PCT Publication No. WO 2008/060367, published May 22, 2008 by Medarex, Inc. [0230] PCT Publication No. WO 2013/071068, published May 16, 2013 by Bristol-Myers Squibb. [0231] PCT Publication No. WO 2015069874, published May 14, 2015 by Bristol-Myers Squibb and Dana-Farber Cancer Institute. [0232] PCT Publication No. WO 2016/201425, published Dec. 15, 2016 by Bristol-Myers Squibb. [0233] Pegram H J, Andrews D M, Smyth M J et al. (2011) Activating and inhibitory receptors of natural killer cells. Immunol Cell Biol 89(2):216-24. [0234] Pende D, Marcenaro S, Falco M et al. (2009) Anti-leukemia activity of alloreactive NK cells in KIR ligand-mismatched haploidentical HSCT for pediatric patients: evaluation of the functional role of activating KIR and redefinition of inhibitory KIR specificity. Blood 113(13):3119-29. [0235] Pérez-Martinez A, de Prada Vicente I, Fernández L et al. (2012) Natural killer cells can exert a graft-vs-tumor effect in haploidentical stem cell transplantation for pediatric solid tumors. Exp Hematol 40(11):882-91. [0236] Pérez-Martinez A, Fernández L, Valentin J et al. (2015a) A phase I/II trial of interleukin-15-stimulated natural killer cell infusion after haploidentical stem cell transplantation for pediatric refractory solid tumors. Cytotherapy 17(11):1594-603. [0237] Pérez-Martinez A, Leung W, Muñoz E et al. (2009) KIR-HLA receptor-ligand mismatch associated with a graft-versus-tumor effect in haploidentical stem cell transplantation for pediatric metastatic solid tumors. Pediatr Blood Cancer 53(1):120-4. [0238] Pérez-Martinez A, Valentin J, Fernández L et al. (2015b) Arabinoxylan rice bran (MGN-3/Biobran) enhances natural killer cell-mediated cytotoxicity against neuroblastoma in vitro and in vivo. Cytotherapy 17(5):601-12. [0239] Pitt L A, Tikhonova A N, Hu H et al. (2015) CXCL12-Producing Vascular Endothelial Niches Control Acute T Cell Leukemia Maintenance. Cancer Cell 27(6):755-68. [0240] Rabinowich H, Sedlmayr P, Herberman R B, Whiteside T L (1991) Increased proliferation, lytic activity, and purity of human natural killer cells cocultured with mitogen-activated feeder cells. Cell Immunol 135:454-70. [0241] Rubnitz J E, Inaba H, Ribeiro R C, Pounds S et al. (2010) NKAML: a pilot study to determine the safety and feasibility of haploidentical natural killer cell transplantation in childhood acute myeloid leukemia. J Clin Oncol 28(6):955-9. [0242] Scala S, Ottaiano A, Ascierto P A et al. (2005) Expression of CXCR4 predicts poor prognosis in patients with malignant melanoma. Clin Cancer Res 11:1835-41. [0243] Schimanski C C, Bahre R, Gockel I et al. (2006) Dissemination of hepatocellular carcinoma is mediated via chemokine receptor CXCR4. Br J Cancer 95:210-7. [0244] Seyfried T N, Huysentruyt L C (2013) On the origin of cancer metastasis. Crit Rev Oncog 18(1-2):43-73. [0245] Shi J et al. (2013) NIH Public Access 143:641-653. [0246] Somanchi S S, Lee D A (2016) Ex vivo expansion of human NK cells using K562 engineered to express membrane bound IL21. Methods Mol Biol 1441:175-93. [0247] Stiller C A, Trama A, Serraino D et al. (2013) Descriptive epidemiology of sarcomas in Europe: Report from the RARECARE project. Eur J Cancer 49:684-695. [0248] Szmania S, Lapteva N, Garg T et al. (2015) Fresh ex vivo expanded natural killer cells demonstrate robust proliferation in vivo in high-risk relapsed multiple myeloma (MM) patients. J Immunother 38(1):24-36. [0249] Tavor S, Petit I, Porozov S et al. (2004) CXCR4 regulates migration and development of human acute myelogenous leukemia stem cells in transplanted NOD/SCID mice. Cancer Res 64:2817-24. [0250] U.S. Pat. No. 7,767,429, issued Aug. 3, 2010 to Bookbinder et al. [0251] Vela M, Aris M, Llorente M et al. (2015) Chemokine receptor-specific antibodies in cancer immunotherapy: Achievements and challenges. Front Immunol 6:12. [0252] Vela M, Corral D, Carrasco P et al. (2018) Haploidentical IL-15/41BBL activated and expanded natural killer cell infusion therapy after salvage chemotherapy in children with relapsed and refractory leukemia. Cancer Lett 422:107-17. [0253] Verhoeven D H J, de Hooge A S K, Mooiman E C K et al. (2008) NK cells recognize and lyse Ewing sarcoma cells through NKG2D and DNAM-1 receptor dependent pathways. Mol Immunol 45(15):3917-25. [0254] Vivier E, Raulet D H, Moretta A et al. (2011) Innate or adaptive immunity? The example of natural killer cells. Science 331(6013):44-9. [0255] Wu J, Wu X, Liang W et al. (2014) Clinicopathological and prognostic significance of chemokine receptor CXCR4 overexpression in patients with esophageal cancer: a meta-analysis. Tumour Biol 35:3709-15. [0256] Zheng Y, Dou Y, Duan L et al. (2015) Using chemo-drugs or irradiation to break immune tolerance and facilitate immunotherapy in solid cancer. Cell Immunol 294:54-59.