USE OF SEPT9 INHIBITORS FOR TREATING HEPATITIS B VIRUS INFECTION
20230183692 · 2023-06-15
Inventors
- Lykke Pedersen (Horsholm, DK)
- Souphalone Luangsay (Basel, CH)
- Johanna Marie Walther (Basel, CH)
- Alan James Mueller-Breckenridge (Basel, CH)
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a SEPT9 inhibitor for use in treatment of an HBV infection, in particular a chronic HBV infection. The invention in particular relates to the use of SEPT9 inhibitors for destabilizing cccDNA, such as HBV cccDNA. The invention also relates to nucleic acid molecules which are complementary to SEPT9 and capable of reducing the level of a SEPT9 mRNA. Also comprised in the present invention is a pharmaceutical composition and its use in the treatment of a HBV infection.
Claims
1. A method of treating or preventing a Hepatitis B virus (HBV) infection in a subject in need thereof, the method comprising administering to the subject a therapeutically or prophylactically effective amount of a SEPT9 (Septin 9) inhibitor.
2. The method according to claim 1, wherein the HBV infection is a chronic infection, or wherein the SEPT9 inhibitor is capable of reducing cccDNA (covalently closed circular DNA) in an HBV infected cell.
3. (canceled)
4. The method according to claim 1, wherein said inhibitor is an nucleic acid molecule of 12 to 60 nucleotides in length comprising a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 95% complementary to a mammalian SEPT9 target sequence and is capable of reducing the expression of SEPT9 mRNA in a cell which expresses the SEPT9 mRNA.
5. The method according to claim 1, wherein said inhibitor is selected from the group consisting of a single stranded antisense oligonucleotide, an siRNA and a shRNA.
6. The method according to claim 4, wherein the mammalian SEPT9 target sequence is SEQ ID NO: 1.
7. The method according to claim 4, wherein the contiguous nucleotide sequence is at least 98% complementary to the target sequence of SEQ ID NO: 1 and SEQ ID NO: 2.
8. (canceled)
9. The method according to claim 4, wherein the amount of SEPT9 mRNA is reduced by at least 60%.
10. A nucleic acid molecule of 12 to 30 nucleotides in length comprising a contiguous nucleotide sequence of at least 12 nucleotides which is 90% complementary to a mammalian SEPT9 target sequence, wherein the nucleic acid molecule is capable of inhibiting the expression of SEPT9 mRNA.
11. The nucleic acid molecule according to claim 10, wherein the contiguous nucleotide sequence is fully complementary to SEQ ID NO: 1.
12. The nucleic acid molecule according to claim 10, wherein the nucleic acid molecule comprises a contiguous nucleotide sequence of 12 to 25.
13. The nucleic acid molecule of claim 10, wherein the nucleic acid molecule is a RNAi molecule.
14. The nucleic acid molecule of claim 10, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide.
15. The nucleic acid molecule according to claim 10, wherein the nucleic acid molecule comprises one or more 2′ sugar modified nucleosides.
16. The nucleic acid molecule according to claim 15, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides.
17. (canceled)
18. The nucleic acid molecule according to claim 10, wherein the contiguous nucleotide sequence comprises at least one phosphorothioate internucleoside linkage.
19. The nucleic acid molecule according to claim 18, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
20. (canceled)
21. The nucleic acid molecule according to claim 10, wherein the nucleic acid molecule, or contiguous nucleotide sequence thereof, comprises a gapmer of formula 5′-F-G-F′-3′, wherein regions F and F′ independently comprise 1 - 4 2′ sugar modified nucleosides and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H.
22. A conjugate compound comprising a nucleic acid molecule according to claim 10 and at least one conjugate moiety covalently attached to said nucleic acid molecule.
23. The conjugate compound of claim 22, wherein the conjugate moiety is or comprises a GalNAc moiety.
24. The conjugate compound of claim 22, wherein the conjugate compound comprises a physiologically labile linker composed of 2 to 5 linked nucleosides comprising at least two consecutive phosphodiester linkages, wherein the physiologically labile linker is covalently bound at the 5′ or 3′ terminal of the nucleic acid molecule.
25. A pharmaceutically acceptable salt of a nucleic acid molecule according to claim 10.
26. A pharmaceutical composition comprising a nucleic acid molecule according to claim 10 and a pharmaceutically acceptable excipient.
27. An in vivo or in vitro method for inhibiting SEPT9 expression in a target cell which is expressing SEPT9, said method comprising administering a nucleic acid molecule according to claim 10 in an effective amount to said cell.
28. A method for treating or preventing a disease in a subject suffering from or susceptible to the disease, the method comprising administering to the subject a therapeutically or prophylactically effective amount of a nucleic acid molecule according to claim 10.
29. The method according to claim 28, wherein the disease is a Hepatitis B Virus (HBV) infection.
30. (canceled)
31. (canceled)
32. (canceled)
Description
BRIEF DESCRIPTION OF FIGURES
[0025]
[0026]
[0027]
[0028]
[0029] The compounds in
[0030] The two different diastereoisomers shown in each of
DEFINITIONS
HBV Infection
[0031] The term “hepatitis B virus infection” or “HBV infection” is commonly known in the art and refers to an infectious disease that is caused by the hepatitis B virus (HBV) and affects the liver. A HBV infection can be an acute or a chronic infection. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million individuals worldwide. Approximately 686,000 deaths annually are attributed to HBV-related end-stage liver diseases and hepatocellular carcinoma (HCC) (GBD 2013; Schweitzer et al., Lancet. 2015 Oct 17;386(10003):1546-55). WHO projected that without expanded intervention, the number of people living with CHB infection will remain at the current high levels for the next 40-50 years, with a cumulative 20 million deaths occurring between 2015 and 2030 (WHO 2016). CHB infection is not a homogenous disease with singular clinical presentation. Infected individuals have progressed through several phases of CHB-associated liver disease in their life; these phases of disease are also the basis for treatment with standard of care (SOC). Current guidelines recommend treating only selected CHB-infected individuals based on three criteria - serum ALT level, HBV DNA level, and severity of liver disease (EASL, 2017). This recommendation was due to the fact that SOC i.e. nucleos(t)ide analogs (NAs) and pegylated interferon-alpha (PEG-IFN), are not curative and must be administered for long periods of time thereby increasing their safety risks. NAs effectively suppress HBV DNA replication; however, they have very limited/no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the main targets of novel drugs aiming for HBV cure. In the plasma of CHB individuals, HBsAg subviral (empty) particles outnumber HBV virions by a factor of 103 to 105 (Ganem & Prince, N Engl J Med. 2004 Mar 11;350(11): 1118-29); its excess is believed to contribute to immunopathogenesis of the disease, including inability of individuals to develop neutralizing anti-HBs antibody, the serological marker observed following resolution of acute HBV infection.
[0032] In some embodiments, the term “HBV infection” refers to “chronic HBV infection”.
[0033] Further, the term encompasses infection with any HBV genotype.
[0034] In some embodiments, the patient to be treated is infected with HBV genotype A.
[0035] In some embodiments, the patient to be treated is infected with HBV genotype B.
[0036] In some embodiments, the patient to be treated is infected with HBV genotype C.
[0037] In some embodiments, the patient to be treated is infected with HBV genotype D.
[0038] In some embodiments, the patient to be treated is infected with HBV genotype E.
[0039] In some embodiments, the patient to be treated is infected with HBV genotype F.
[0040] In some embodiments, the patient to be treated is infected with HBV genotype G.
[0041] In some embodiments, the patient to be treated is infected with HBV genotype H.
[0042] In some embodiments, the patient to be treated is infected with HBV genotype I.
[0043] In some embodiments, the patient to be treated is infected with HBV genotype J.
cccDNA (Covalently Closed Circular DNA)
[0044] cccDNA is the viral genetic template of HBV that resides in the nucleus of infected hepatocytes, where it gives rise to all HBV RNA transcripts needed for productive infection and is responsible for viral persistence during natural course of chronic HBV infection (Locarnini & Zoulim, Antivir Ther. 2010;15 Suppl 3:3-14. doi: 10.3851/IMP1619). Acting as a viral reservoir, cccDNA is the source of viral rebound after cessation of treatment, necessitating long term, often lifetime treatment. PEG-IFN can only be administered to a small subset of CHB due to its various side effects.
[0045] Consequently, novel therapies that can deliver a complete cure, defined by degradation or elimination of HBV cccDNA, to the majority of CHB patients are highly needed.
Compound
[0046] Herein, the term “compound” means any molecule capable of inhibition SEPT9 expression or activity. Particular compounds of the invention are nucleic acid molecules, such as RNAi molecules or antisense oligonucleotides according to the invention or any conjugate comprising such a nucleic acid molecule. For example, herein the compound may be a nucleic acid molecule targeting SEPT9, in particular an antisense oligonucleotide or a siRNA.
Oligonucleotide
[0047] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.
[0048] The oligonucleotides referred to in the description and claims are generally therapeutic oligonucleotides below 70 nucleotides in length. The oligonucleotide may be or comprise a single stranded antisense oligonucleotide, or may be another nucleic acid molecule, such as a CRISPR RNA, a siRNA, shRNA, an aptamer, or a ribozyme. Therapeutic oligonucleotide molecules are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. shRNA’s are however often delivered to cells using lentiviral vectors from which they are then transcribed to produce the single stranded RNA that will form a stem loop (hairpin) RNA structure that is capable of interacting with the RNA interference machinery (including the RNA-induced silencing complex (RISC)). In an embodiment of the present invention the shRNA is chemically produced shRNA molecules (not relying on cell based expression from plasmids or viruses). When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. Generally, the oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. Although in some embodiments the oligonucleotide of the invention is a shRNA transcribed from a vector upon entry into the target cell. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.
[0049] In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 70 nucleotides in length, such as from 12 to 60, such as from 13 to 50, such as from 14 to 40, such as from 15 to 30, such as from 16 to 25, such as from 16 to 22, such as from 16 to 20 contiguous nucleotides in length. Accordingly, the oligonucleotide of the present invention, in some embodiments, may have a length of 12 to 25 nucleotides. Alternatively, the oligonucleotide of the present invention, in some embodiments, may have a length of 15 to 22 nucleotides.
[0050] In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 24 or less nucleotides, such as 22, such as 20 or less nucleotides, such as 18 or less nucleotides, such as 14, 15, 16 or 17 nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if a nucleic acid molecule is said to include from 12 to 25 nucleotides, both 12 and 25 nucleotides are included.
[0051] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides in length
[0052] The oligonucleotide(s) are for modulating the expression of a target nucleic acid in a mammal. In some embodiments, the nucleic acid molecules, such as for siRNAs, shRNAs and antisense oligonucleotides, are typically for inhibiting the expression of a target nucleic acid(s).
[0053] In one embodiment of the invention oligonucleotide is selected from a RNAi agent, such as a siRNA or shRNA. In another embodiment, the oligonucleotide is a single stranded antisense oligonucleotide, such as a high affinity modified antisense oligonucleotide interacting with RNase H.
[0054] In some embodiments, the oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides.
[0055] In some embodiments, the oligonucleotide comprises phosphorothioate internucleoside linkages.
[0056] In some embodiments, the oligonucleotide may be conjugated to non-nucleosidic moieties (conjugate moieties).
[0057] A library of oligonucleotides is to be understood as a collection of variant oligonucleotides. The purpose of the library of oligonucleotides can vary. In some embodiments, the library of oligonucleotides is composed of oligonucleotides with overlapping nucleobase sequence targeting one or more mammalian SEPT9 target nucleic acids with the purpose of identifying the most potent sequence within the library of oligonucleotides. In some embodiments, the library of oligonucleotides is a library of oligonucleotide design variants (child nucleic acid molecules) of a parent or ancestral oligonucleotide, wherein the oligonucleotide design variants retaining the core nucleobase sequence of the parent nucleic acid molecule.
Antisense Oligonucleotides
[0058] The term “antisense oligonucleotide” or “ASO” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self complementarity is less than 50% across of the full length of the oligonucleotide.
[0059] Advantageously, the single stranded antisense oligonucleotide of the invention does not contain RNA nucleosides, since this will decrease nuclease resistance.
[0060] Advantageously, the oligonucleotide of the invention comprises one or more modified nucleosides or nucleotides, such as 2′ sugar modified nucleosides. Furthermore, it is advantageous that the nucleosides which are not modified are DNA nucleosides.
RNAi Molecules
[0061] Herein, the term “RNA interference (RNAi) molecule” refers to short double-stranded oligonucleotide containing RNA nucleosides and which mediates targeted cleavage of an RNA transcript via the RNA-induced silencing complex (RISC), where they interact with the catalytic RISC component argonaute. The RNAi molecule modulates, e g., inhibits, the expression of the target nucleic acid in a cell, e.g. a cell within a subject. such as a mammalian subject. RNAi molecules includes single stranded RNAi molecules (Lima at al 2012 Cell 150: 883) and double stranded siRNAs, as well as short hairpin RNAs (shRNAs). In some embodiments of the invention, the oligonucleotide of the invention or contiguous nucleotide sequence thereof is a RNAi agent, such as a siRNA.
siRNA
[0062] The term “small interfering ribonucleic acid” or “siRNA” refers to a small interfering ribonucleic acid RNAi molecule. It is a class of double-stranded RNA molecules, also known in the art as short interfering RNA or silencing RNA. siRNAs typically comprise a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as the guide strand), wherein each strand are of 17 to 30 nucleotides in length, typically 19 to 25 nucleosides in length, wherein the antisense strand is complementary, such as at least 95% complementary, such as fully complementary, to the target nucleic acid (suitably a mature mRNA sequence), and the sense strand is complementary to the antisense strand so that the sense strand and antisense strand form a duplex or duplex region. siRNA strands may form a blunt ended duplex, or advantageously the sense and antisense strand 3′ ends may form a 3′ overhang of e.g. 1, 2 or 3 nucleosides to resemble the product produced by Dicer, which forms the RISC substrate in vivo. Effective extended forms of Dicer substrates have been described in US 8,349,809 and US 8,513,207, hereby incorporated by reference. In some embodiments, both the sense strand and antisense strand have a 2 nt 3′ overhang. The duplex region may therefore be, for example 17 to 25 nucleotides in length, such as 21 to 23 nucleotides in length.
[0063] Once inside a cell the antisense strand is incorporated into the RISC complex which mediate target degradation or target inhibition of the target nucleic acid. siRNAs typically comprise modified nucleosides in addition to RNA nucleosides. In one embodiment, the siRNA molecule may be chemically modified using modified internucleotide linkages and 2′ sugar modified nucleosides, such as 2′-4′ bicyclic ribose modified nucleosides, including LNA and cET or 2′ substituted modifications like of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA. In particular 2′fluoro, 2′-O-methyl or 2′-O-methoxyethyl may be incorporated into siRNAs.
[0064] In some embodiments, all of the nucleotides of an siRNA sense (passenger) strand may be modified with 2′ sugar modified nucleosides such as LNA (see WO2004/083430, WO2007/085485 for example). In some embodiments, the passenger stand of the siRNA may be discontinuous (see WO2007/107162 for example). The incorporation of thermally destabilizing nucleotides occurring at a seed region of the antisense strand of siRNAs have been reported as useful in reducing off-target activity of siRNAs (see WO2018/098328 for example). Suitably the siRNA comprises a 5′ phosphate group or a 5′-phosphate mimic at the 5′ end of the antisense strand. In some embodiments, the 5′ end of the antisense strand is a RNA nucleoside.
[0065] In one embodiment, the siRNA molecule further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. The phosphorothioaie or methylphosphonate internucleoside linkage may be at the 3′- terminus one or both strand (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkage may be at the 5′-terminus of one or both strands (e.g., the antisense strand; or the sense strand); or the phosphorothioate or methylphosphonate internucleoside linkage may be at the both the 5′- and 3′-terminus of one or both strands (e.g., the antisense strand; or the sense strand). In some embodiments, the remaining internucleoside linkages are phosphodiester linkages. In some embodiments, siRNA molecules comprise one or more phosphorothioate internucleoside linkages.
[0066] In siRNA molecules phosphorothioate internucleoside linkages may reduce or the nuclease cleavage in RICS, it is therefore advantageous that not all internucleoside linkages in the antisense strand are modified.
[0067] The siRNA molecule may further comprise a ligand. In some embodiments, the ligand is conjugated to the 3′ end of the sense strand.
[0068] For biological distribution, siRNAs may be conjugated to a targeting ligand, and/or be formulated into lipid nanoparticleslipid nanoparticles.
[0069] Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA, such as siRNA molecules suitable for therapeutic use, and methods of inhibiting the expression of the target gene by administering the dsRNA molecules such as siRNAs of the invention, e.g., for the treatment of various disease conditions as disclosed herein.
shRNA
[0070] The term “short hairpin RNA” or “shRNA” refers to molecules that are generally between 40 and 70 nucleotides in length, such as between 45 and 65 nucleotides in length, such as 50 and 60 nucleotides in length and form a stem loop (hairpin) RNA structure which interacts with the endonuclease known as Dicer which is believed to processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs which are then incorporated into an RNA-induced silencing complex (RISC). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing. shRNA oligonucleotides may be chemically modified using modified internucleotide linkages and 2′ sugar modified nucleosides, such as 2′-4′ bicyclic ribose modified nucleosides, including LNA and cET or 2′ substituted modifications like of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA.
[0071] In some embodiments, shRNA molecule comprises one or more phosphorothioate internucleoside linkages. In RNAi molecules phosphorothioate internucleoside linkages may reduce or the nuclease cleavage in RICS it is therefore advantageous that not al internucleoside linkages in the stem loop of the shRNA molecule are modified. Phosphorothioate internucleoside linkages can advantageously be placed in the 3′ and/or 5′ end of the stem loop of the shRNA molecule, in particular in the part of the molecule that is not complementary to the target nucleic acid. The region of the shRNA molecule that is complementary to the target nucleic acid may however also be modified in the first 2 to 3 internucleoside linkages in the part that is predicted to become the 3′ and/or 5′ terminal following cleavage by Dicer.
Contiguous Nucleotide Sequence
[0072] The term “contiguous nucleotide sequence” refers to the region of the nucleic acid molecule which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments, all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is included in the guide strand of an siRNA molecule. In some embodiments, the contiguous nucleotide sequence is the part of an shRNA molecule which is 100% complementary to the target nucleic acid. In some embodiments, the oligonucleotide comprises the contiguous nucleotide sequence, such as a F—G—F′ gapmer region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group (e.g. a conjugate group for targeting) to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleobase sequence of the antisense oligonucleotide is the contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is 100% complementary to the target nucleic acid.
Nucleotides and Nucleosides
[0073] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.
Modified Nucleoside
[0074] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. Advantageously, one or more of the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.
Modified Internucleoside Linkage
[0075] The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. The oligonucleotides of the invention may therefore comprise one or more modified internucleoside linkages, such as a one or more phosphorothioate internucleoside linkages, or one or more phosphorodithioate internucleoside linkages.
[0076] With the oligonucleotide of the invention it is advantageous to use phosphorothioate internucleoside linkages.
[0077] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In some embodiments, at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments, all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
[0078] In some advantageous embodiments, all the internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
[0079] It is recognized that, as disclosed in EP 2 742 135, antisense oligonucleotides may comprise other internucleoside linkages (other than phosphodiester and phosphorothioate), for example alkyl phosphonate/methyl phosphonate internucleoside linkages, which according to EP 2 742 135 may for example be tolerated in an otherwise DNA phosphorothioate gap region.
Nucleobase
[0080] The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.
[0081] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2′thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
[0082] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.
Modified Oligonucleotide
[0083] The term “modified oligonucleotide” describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages. The term chimeric” oligonucleotide is a term that has been used in the literature to describe oligonucleotides comprising modified nucleosides and DNA nucleosides. The antisense oligonucleotide of the invention is advantageously a chimeric oligonucleotide.
Complementarity
[0084] The term “complementarity” or “complementary” describes the capacity for Watson-Crick base-pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).
[0085] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pair) between the two sequences (when aligned with the target sequence 5′-3′ and the oligonucleotide sequence from 3′-5′), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5′-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
[0086] The term “fully complementary”, refers to 100% complementarity.
Identity
[0087] The term “Identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif). The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity = (Matches x 100)/Length of aligned region (e.g. the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).
Hybridization
[0088] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T.sub.m) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T.sub.m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (K.sub.d) of the reaction by ΔG°=-RTIn(K.sub.d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. ΔG° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37° C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ΔG° is less than zero. ΔG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for ΔG° measurements. ΔG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ΔG° values below -10 kcal for oligonucleotides that are 10 to 30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated ΔG° values below -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to a target nucleic acid with an estimated ΔG° value in the range of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or-16 to -27 kcal such as -18 to -25 kcal.
Target Nucleic Acid
[0089] According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian SEPT9 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as SEPT9 target nucleic acid.
[0090] Suitably, the target nucleic acid encodes a SEPT9 protein, in particular mammalian SEPT9, such as the human SEPT9 gene encoding pre-mRNA or mRNA sequences provided herein as SEQ ID NO: 1.
[0091] The therapeutic nucleic acid molecules of the invention may for example target exon regions of a mammalian SEPT9 (in particular siRNA and shRNA, but also antisense oligonucleotides), or may for example target any intron region in the SEPT9 pre-mRNA (in particular antisense oligonucleotides). The human SEPT9 gene encodes 47 transcripts, 37 of which are protein coding and therefore potential nucleic acid targets. In an embodiment, the target is a mature SEPT9 mRNA which encodes for a SEPT9 protein.
[0092] Table 1 lists predicted exon and intron regions of SEQ ID NO: 1, i.e. of the human SEPT9 pre-mRNA sequence.
TABLE-US-00001 Exon and intron regions in the human SEPT9 pre-mRNA Exonic regions in the human SEPT9 premRNA (SEQ ID NO: 1) Intronic regions in the human SEPT9 premRNA (SEQ ID NO: 1) ID start end ID start end E1 931 986 I1 987 26572 E2 26573 26629 I2 26630 121490 E3 121491 122135 I3 122136 201575 E4 201576 201767 I4 201768 206855 E5 206856 206984 I5 206985 207671 E6 207672 207753 I6 207754 208158 E7 208159 208296 I7 208297 210173 E8 210174 210291 I8 210292 212052 E9 212053 212148 I9 212149 212411 E10 212412 212508 I10 212509 216746 E11 216747 216798 I11 216799 217954 E12 217955 220025
[0093] Suitably, the target nucleic acid encodes a SEPT9 protein, in particular mammalian SEPT9, such as human SEPT9 (See for example Table 2 and Table 3) which provides an overview on the genomic sequences of human, cyno monkey and mouse SEPT9 (Table 2) and on pre-mRNA sequences for human, monkey and mouse SEPT9 and for the mature mRNAs for human SEPT9 (Table 3).
[0094] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 2 and/or 3, or naturally occurring variants thereof (e.g. sequences encoding a mammalian SEPT9).
TABLE-US-00002 Genome and assembly information for SEPT9 across species Species Chr. Stra nd Genomic coordinates Start End Assembly ensembl gene_id Human 17 Fwd 77280569 77500596 GRCh38.p12 ENSG00000184640 Cyno monkey 16 Fwd 74667799 74881595 Macaca_fascicularis_5.0 ENSMFAG00000035 508 Mouse 11 Fwd 117199661 117362325 GRCm38.p4 ENSMUSG00000059 248 Fwd = forward strand. Rv = reverse strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence).
[0095] If employing the nucleic acid molecule of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0096] For in vivo or in vitro application, the therapeutic nucleic acid molecule of the invention is typically capable of inhibiting the expression of the SEPT9 target nucleic acid in a cell which is expressing the SEPT9 target nucleic acid. In some embodiments, said cell comprises HBV cccDNA. The contiguous sequence of nucleobases of the nucleic acid molecule of the invention is typically complementary to a conserved region of the SEPT9 target nucleic acid, as measured across the length of the nucleic acid molecule, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides. The target nucleic acid is a messenger RNA, such as a pre-mRNA which encodes mammalian SEPT9 protein, such as human SEPT9, e.g. the human SEPT9 pre-mRNA sequence, such as that disclosed as SEQ ID NO: 1, the monkey SEPT9 pre-mRNA sequence, such as that disclosed as SEQ ID NO: 2, or the mouse SEPT9 pre-mRNA sequence, such as that disclosed as SEQ ID NO: 3. SEQ ID NOs: 1-3 are DNA sequences - it will be understood that target RNA sequences have uracil (U) bases in place of the thymidine bases (T).
[0097] Further information on exemplary target nucleic acids is provided in Tables 2 and 3.
TABLE-US-00003 Overview on target nucleic acids Target Nucleic Acid, Species, Reference Sequence ID SEPT9 Homo sapiens pre-mRNA SEQ ID NO: 1 SEPT9 Macaca fascicularis pre-mRNA SEQ ID NO: 2 SEPT9 Mus musculus pre-mRNA SEQ ID NO: 3
[0098] Note SEQ ID NO: 2 comprises regions of multiple NNNNs, where the sequencing has been unable to accurately refine the sequence, and a degenerate sequence is therefore included. For the avoidance of doubt the compounds of the invention are complementary to the actual target sequence and are not therefore degenerate compounds.
[0099] In some embodiments, the target nucleic acid is SEQ ID NO: 1.
[0100] In some embodiments, the target nucleic acid is SEQ ID NO: 2.
[0101] In some embodiments, the target nucleic acid is SEQ ID NO: 3.
Target Sequence
[0102] The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide or nucleic acid molecule of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid with a nucleobase sequence that is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, target sequence or target region. In some embodiments, the target sequence is longer than the complementary sequence of a nucleic acid molecule of the invention, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several nucleic acid molecules of the invention.
[0103] In some embodiments, the target sequence is a sequence selected from the group consisting of a human SEPT9 mRNA exon, such as a SEPT9 human mRNA exon selected from the group consisting of e1, e2, e3, e4, e5, e6, e7, e8, e9, e10, e11 and e12 (see for example Table 1 above).
[0104] Accordingly, the invention provides for an oligonucleotide, wherein said oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as fully complementary to an exon region of SEQ ID NO: 1, selected from the group consisting of e1 - e12 (see Table 1).
[0105] In some embodiments, the target sequence is a sequence selected from the group consisting of a human SEPT9 mRNA intron, such as a SEPT9 human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5, i6, i7, i8, i9, i10 and i11 (see for example Table 1 above).
[0106] Accordingly, the invention provides for an oligonucleotide, wherein said oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as fully complementary to an intron region of SEQ ID NO: 1, selected from the group consisting of i1 - i11 (see Table 1).
[0107] In some embodiments, the target sequence is selected from the group consisting of SEQ ID NOs: 4, 5, 6 and 7. In some embodiments, the contiguous nucleotide sequence as referred to herein is at least 90% complementary, such as at least 95% complementary to a target sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6 and 7. In some embodiments, the contiguous nucleotide sequence is fully complementary to a target sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6 and 7.
[0108] The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to a region on the target nucleic acid, such as a target sequence described herein.
[0109] The target nucleic acid sequence to which the therapeutic oligonucleotideis complementary or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous nucleotide sequence is between 12 to 70 nucleotides, such as 12 to 50, such as 13 to 30, such as 14 to 25, such as 15 to 20, such as 16 to 18 contiguous nucleotides.
[0110] In some embodiments, the oligonucleotideof the present invention targets a region shown in Table 4.
TABLE-US-00004 Exemplary target regions Target region start SEQ ID NO: 1 end SEQ ID NO:1 Target region start SEQ ID NO: 1 end SEQ ID NO:1 Target region start SEQ ID NO: 1 end SEQ ID NO:1 1C 799 814 690C 65723 65739 1379C 131572 131585 2C 806 819 691C 65725 65740 1380C 131912 131925 3C 932 960 692C 66327 66340 1381C 132157 132172 4C 962 978 693C 66553 66566 1382C 132375 132388 5C 1729 1742 694C 66602 66620 1383C 132518 132554 6C 1732 1746 695C 66603 66620 1384C 132519 132534 7C 1734 1747 696C 66707 66720 1385C 132521 132555 8C 2213 2226 697C 66810 66825 1386C 132542 132556 9C 2589 2608 698C 66810 66823 1387C 132543 132556 10C 2589 2603 699C 66810 66824 1388C 132584 132603 11C 2590 2606 700C 66811 66824 1389C 132710 132723 12C 2590 2607 701C 66812 66825 1390C 133013 133026 13C 2590 2604 702C 66813 66826 1391C 133279 133293 14C 2592 2610 703C 66813 66829 1392C 133281 133294 15C 2592 2609 704C 66813 66827 1393C 133365 133378 16C 2593 2609 705C 66814 66829 1394C 133368 133385 17C 2594 2611 706C 67662 67675 1395C 133369 133388 18C 2594 2610 707C 67668 67682 1396C 133369 133383 19C 2596 2611 708C 67727 67749 1397C 133370 133386 20C 2598 2613 709C 67727 67743 1398C 133370 133387 21C 2599 2614 710C 67728 67744 1399C 133370 133384 22C 2599 2613 711C 67729 67749 1400C 133372 133389 23C 2599 2612 712C 67729 67745 1401C 133373 133389 24C 2600 2613 713C 67730 67746 1402C 133377 133391 25C 2704 2721 714C 67731 67747 1403C 133408 133424 26C 2732 2746 715C 67732 67749 1404C 133412 133426 27C 2875 2888 716C 67732 67748 1405C 133504 133519 28C 3353 3369 717C 67734 67749 1406C 133505 133519 29C 4037 4050 718C 67737 67750 1407C 133505 133518 30C 4059 4073 719C 67838 67851 1408C 133508 133524 31C 4059 4072 720C 67993 68008 1409C 133508 133523 32C 4062 4078 721C 68515 68528 1410C 133509 133523 33C 4062 4077 722C 68524 68537 1411C 133509 133522 34C 4063 4077 723C 68525 68540 1412C 133510 133524 35C 4063 4076 724C 68529 68543 1413C 133768 133785 36C 4064 4078 725C 68530 68543 1414C 133768 133783 37C 4077 4093 726C 68531 68546 1415C 133771 133785 38C 4077 4091 727C 68543 68557 1416C 133771 133784 39C 4077 4092 728C 68543 68556 1417C 133772 133785 40C 4077 4090 729C 68665 68685 1418C 134001 134018 41C 4174 4189 730C 68665 68681 1419C 134002 134018 42C 4174 4188 731C 68665 68683 1420C 134002 134019 43C 4175 4189 732C 68665 68678 1421C 134002 134016 44C 4176 4189 733C 68665 68682 1422C 134004 134022 45C 4177 4190 734C 68669 68685 1423C 134004 134021 46C 4348 4361 735C 68672 68685 1424C 134005 134028 47C 4602 4616 736C 68813 68827 1425C 134005 134021 48C 4602 4615 737C 68814 68827 1426C 134006 134028 49C 4826 4839 738C 70042 70070 1427C 134006 134022 50C 4828 4846 739C 70058 70072 1428C 134007 134023 51C 4833 4846 740C 70389 70403 1429C 134008 134024 52C 4942 4957 741C 70431 70444 1430C 134009 134025 53C 4942 4956 742C 70470 70483 1431C 134010 134026 54C 4943 4957 743C 70488 70504 1432C 134011 134028 55C 4944 4957 744C 70503 70517 1433C 134011 134027 56C 4945 4958 745C 70597 70610 1434C 134013 134028 57C 4945 4959 746C 70661 70699 1435C 134014 134028 58C 4960 4973 747C 70661 70676 1436C 134015 134028 59C 5632 5646 748C 70661 70680 1437C 134247 134260 60C 6153 6166 749C 70661 70686 1438C 134248 134261 61C 6388 6402 750C 70662 70699 1439C 134475 134489 62C 6414 6427 751C 70663 70701 1440C 134782 134795 63C 6990 7003 752C 70663 70678 1441C 134936 134949 64C 7041 7057 753C 70663 70682 1442C 135054 135067 65C 7220 7233 754C 70663 70688 1443C 135059 135075 66C 7483 7496 755C 70664 70701 1444C 135059 135074 67C 7822 7838 756C 70665 70680 1445C 135059 135072 68C 7897 7919 757C 70665 70684 1446C 135059 135076 69C 8083 8102 758C 70665 70690 1447C 135059 135073 70C 8108 8121 759C 70667 70682 1448C 135060 135073 71C 8511 8524 760C 70667 70686 1449C 135060 135077 72C 8544 8560 761C 70667 70692 1450C 135061 135074 73C 8544 8558 762C 70669 70684 1451C 135062 135075 74C 8544 8559 763C 70669 70688 1452C 135063 135076 75C 8544 8557 764C 70669 70694 1453C 135064 135077 76C 8641 8655 765C 70671 70686 1454C 135064 135078 77C 8654 8667 766C 70671 70690 1455C 135066 135079 78C 8659 8672 767C 70671 70696 1456C 135066 135081 79C 8790 8807 768C 70673 70688 1457C 135067 135081 80C 8790 8805 769C 70673 70692 1458C 135068 135081 81C 8793 8807 770C 70673 70698 1459C 135069 135083 82C 8793 8806 771C 70675 70690 1460C 135073 135086 83C 8794 8807 772C 70675 70694 1461C 135968 135981 84C 8839 8857 773C 70675 70700 1462C 136242 136257 85C 8839 8856 774C 70677 70692 1463C 137120 137134 86C 8840 8856 775C 70677 70696 1464C 137887 137902 87C 8841 8858 776C 70677 70702 1465C 137887 137901 88C 8841 8857 777C 70679 70694 1466C 137888 137902 89C 8843 8858 778C 70679 70698 1467C 137889 137902 90C 8844 8858 779C 70681 70696 1468C 137890 137903 91C 8845 8858 780C 70681 70700 1469C 137890 137904 92C 8957 8979 781C 70683 70698 1470C 138036 138053 93C 8957 8977 782C 70683 70702 1471C 138036 138055 94C 8957 8973 783C 70685 70700 1472C 138036 138051 95C 8957 8975 784C 70687 70702 1473C 138036 138057 96C 8957 8970 785C 70741 70755 1474C 138039 138053 97C 8957 8974 786C 70773 70787 1475C 138039 138052 98C 8961 8977 787C 71566 71581 1476C 138040 138053 99C 8964 8977 788C 71566 71580 1477C 138040 138055 100C 8964 8979 789C 71567 71581 1478C 138070 138084 101C 8966 8979 790C 71568 71581 1479C 138424 138437 102C 8971 8984 791C 71573 71586 1480C 139405 139418 103C 9101 9118 792C 71673 71689 1481C 139522 139535 104C 9101 9116 793C 71673 71688 1482C 139741 139757 105C 9104 9118 794C 71673 71686 1483C 140443 140456 106C 9104 9117 795C 71673 71687 1484C 140444 140461 107C 9105 9118 796C 71674 71687 1485C 141404 141417 108C 9147 9161 797C 71675 71688 1486C 141419 141432 109C 9149 9162 798C 71676 71689 1487C 141527 141540 110C 9203 9216 799C 71736 71749 1488C 141528 141541 111C 9487 9500 800C 71834 71848 1489C 141818 141836 112C 9688 9705 801C 72220 72233 1490C 141970 141986 113C 9689 9705 802C 72705 72718 1491C 141970 141984 114C 9689 9706 803C 73266 73279 1492C 142574 142589 115C 9689 9703 804C 73272 73285 1493C 142578 142593 116C 9693 9708 805C 74100 74113 1494C 142582 142595 117C 9694 9708 806C 74105 74119 1495C 142583 142596 118C 9695 9708 807C 74788 74810 1496C 142583 142597 119C 9792 9806 808C 75094 75107 1497C 142616 142629 120C 9792 9805 809C 75158 75171 1498C 143152 143182 121C 10003 10016 810C 75311 75324 1499C 143232 143245 122C 10144 10157 811C 75413 75429 1500C 143312 143326 123C 10247 10262 812C 75413 75428 1501C 143453 143476 124C 10247 10260 813C 75413 75426 1502C 143656 143669 125C 10248 10262 814C 75413 75427 1503C 143684 143697 126C 10249 10262 815C 75414 75427 1504C 144528 144542 127C 10251 10266 816C 75415 75428 1505C 144618 144637 128C 10251 10264 817C 75416 75429 1506C 144645 144658 129C 10252 10266 818C 76104 76117 1507C 144672 144686 130C 10253 10266 819C 76948 76963 1508C 146564 146577 131C 10255 10270 820C 76949 76964 1509C 147703 147716 132C 10255 10268 821C 76951 76965 1510C 147861 147876 133C 10256 10270 822C 77149 77166 1511C 148164 148177 134C 10257 10270 823C 77149 77162 1512C 149164 149177 135C 10259 10274 824C 77151 77166 1513C 149463 149477 136C 10259 10272 825C 77159 77174 1514C 149546 149559 137C 10260 10274 826C 77159 77173 1515C 149547 149560 138C 10261 10274 827C 77160 77174 1516C 149795 149817 139C 10263 10278 828C 77161 77174 1517C 149823 149837 140C 10263 10276 829C 77162 77175 1518C 149871 149889 141C 10264 10278 830C 77162 77176 1519C 150320 150333 142C 10265 10278 831C 77789 77804 1520C 150422 150435 143C 10267 10280 832C 77789 77803 1521C 150422 150436 144C 10300 10319 833C 77790 77804 1522C 150423 150436 145C 10301 10315 834C 77791 77804 1523C 150424 150437 146C 10401 10414 835C 77796 77809 1524C 150424 150438 147C 10412 10425 836C 77915 77929 1525C 150426 150439 148C 10413 10426 837C 77970 77984 1526C 150432 150445 149C 10413 10427 838C 78289 78302 1527C 150513 150526 150C 10463 10476 839C 78968 78981 1528C 150732 150746 151C 10464 10486 840C 79018 79032 1529C 150732 150747 152C 10464 10480 841C 79486 79499 1530C 150735 150750 153C 10465 10481 842C 79584 79597 1531C 150745 150758 154C 10466 10482 843C 79589 79605 1532C 150955 150969 155C 10467 10483 844C 79589 79604 1533C 151053 151071 156C 10468 10484 845C 79589 79602 1534C 151054 151071 157C 10469 10486 846C 79589 79606 1535C 151159 151172 158C 10469 10485 847C 79589 79603 1536C 151257 151270 159C 10471 10486 848C 79590 79603 1537C 151262 151278 160C 10472 10486 849C 79590 79607 1538C 151262 151283 161C 10473 10486 850C 79591 79604 1539C 151262 151277 162C 10482 10496 851C 79592 79605 1540C 151262 151275 163C 10482 10495 852C 79593 79606 1541C 151262 151279 164C 10580 10594 853C 79594 79607 1542C 151262 151280 165C 10727 10744 854C 79607 79620 1543C 151262 151286 166C 10727 10746 855C 79987 80002 1544C 151262 151276 167C 10727 10742 856C 80000 80014 1545C 151262 151284 168C 10730 10744 857C 80012 80026 1546C 151263 151276 169C 10730 10743 858C 80012 80027 1547C 151264 151277 170C 10731 10744 859C 80012 80025 1548C 151265 151278 171C 10731 10746 860C 80099 80112 1549C 151266 151279 172C 10935 10950 861C 80345 80370 1550C 151267 151287 173C 10935 10949 862C 80346 80366 1551C 151267 151280 174C 10936 10950 863C 80347 80365 1552C 151268 151281 175C 10937 10950 864C 80347 80364 1553C 151269 151282 176C 10961 10974 865C 80348 80371 1554C 151270 151283 177C 11148 11161 866C 80348 80364 1555C 151270 151287 178C 11149 11164 867C 80349 80371 1556C 151271 151284 179C 11196 11209 868C 80349 80365 1557C 151272 151285 180C 11914 11927 869C 80350 80366 1558C 151273 151286 181C 11922 11937 870C 80351 80367 1559C 151274 151287 182C 11923 11937 871C 80352 80368 1560C 151450 151463 183C 11923 11936 872C 80353 80369 1561C 151471 151484 184C 11924 11937 873C 80354 80371 1562C 152267 152280 185C 11925 11938 874C 80354 80370 1563C 152377 152391 186C 12042 12062 875C 80356 80371 1564C 152866 152879 187C 12042 12058 876C 80357 80371 1565C 153678 153692 188C 12042 12060 877C 80358 80371 1566C 153681 153695 189C 12042 12055 878C 80472 80494 1567C 155687 155702 190C 12042 12059 879C 80472 80492 1568C 155846 155859 191C 12046 12062 880C 80472 80488 1569C 156250 156264 192C 12049 12062 881C 80472 80490 1570C 156607 156621 193C 12422 12437 882C 80472 80485 1571C 156655 156671 194C 12423 12437 883C 80472 80489 1572C 156722 156735 195C 12423 12436 884C 80476 80492 1573C 156772 156785 196C 12426 12441 885C 80479 80492 1574C 157707 157720 197C 12427 12441 886C 80479 80494 1575C 158831 158844 198C 12427 12440 887C 80481 80494 1576C 159712 159725 199C 12430 12445 888C 80486 80499 1577C 159717 159730 200C 12431 12445 889C 80486 80501 1578C 159737 159750 201C 12431 12444 890C 80489 80502 1579C 159850 159865 202C 12434 12449 891C 80617 80634 1580C 159852 159865 203C 12435 12449 892C 80617 80632 1581C 160455 160468 204C 12435 12448 893C 80620 80634 1582C 160944 160957 205C 12438 12453 894C 80620 80633 1583C 161633 161646 206C 12439 12453 895C 80621 80634 1584C 161733 161751 207C 12439 12452 896C 81065 81082 1585C 161760 161773 208C 12442 12457 897C 81068 81082 1586C 161778 161794 209C 12443 12457 898C 81325 81342 1587C 161780 161794 210C 12443 12456 899C 81325 81340 1588C 161780 161793 211C 12446 12462 900C 81328 81342 1589C 161939 161952 212C 12446 12461 901C 81328 81341 1590C 161939 161962 213C 12447 12461 902C 81329 81342 1591C 161940 161953 214C 12447 12460 903C 81458 81472 1592C 161941 161961 215C 12448 12462 904C 81755 81773 1593C 161941 161954 216C 12565 12581 905C 82369 82382 1594C 161942 161955 217C 12565 12578 906C 82810 82836 1595C 161943 161956 218C 12688 12705 907C 82811 82829 1596C 161944 161957 219C 12688 12701 908C 82811 82828 1597C 161944 161961 220C 12690 12705 909C 82812 82828 1598C 161945 161958 221C 12831 12844 910C 82813 82829 1599C 161946 161959 222C 12855 12872 911C 82814 82830 1600C 161947 161960 223C 12855 12870 912C 82815 82838 1601C 161948 161961 224C 12858 12872 913C 82815 82831 1602C 161948 161962 225C 12858 12871 914C 82816 82838 1603C 161950 161963 226C 12859 12872 915C 82816 82832 1604C 162202 162215 227C 13273 13287 916C 82817 82833 1605C 162968 162981 228C 13274 13287 917C 82818 82834 1606C 163017 163035 229C 13279 13292 918C 82819 82835 1607C 163018 163035 230C 13530 13543 919C 82820 82836 1608C 163044 163058 231C 13535 13551 920C 82821 82838 1609C 163230 163243 232C 13535 13550 921C 82821 82837 1610C 163231 163245 233C 13535 13548 922C 82823 82838 1611C 163240 163254 234C 13535 13549 923C 82824 82838 1612C 164790 164803 235C 13536 13549 924C 82825 82838 1613C 164957 164972 236C 13537 13550 925C 82922 82939 1614C 164960 164974 237C 13538 13551 926C 82922 82935 1615C 165108 165121 238C 13725 13738 927C 82924 82939 1616C 165760 165773 239C 13741 13755 928C 82932 82947 1617C 165778 165793 240C 13742 13755 929C 82932 82946 1618C 165796 165810 241C 13749 13762 930C 82933 82947 1619C 165796 165809 242C 13852 13866 931C 82934 82947 1620C 165808 165821 243C 13854 13867 932C 82935 82948 1621C 165890 165903 244C 13856 13871 933C 82935 82949 1622C 165913 165926 245C 13856 13869 934C 82950 82963 1623C 166498 166511 246C 13857 13871 935C 83081 83098 1624C 166963 166976 247C 13858 13871 936C 83081 83096 1625C 167057 167071 248C 14015 14030 937C 83084 83098 1626C 167698 167715 249C 14016 14030 938C 83084 83097 1627C 167797 167811 250C 14222 14235 939C 83085 83098 1628C 167798 167811 251C 14987 15001 940C 84001 84014 1629C 167914 167933 252C 15767 15784 941C 84827 84840 1630C 167916 167932 253C 15768 15784 942C 84838 84852 1631C 167916 167931 254C 15768 15783 943C 85047 85061 1632C 167916 167929 255C 15769 15784 944C 85263 85276 1633C 167916 167933 256C 15770 15784 945C 85278 85296 1634C 167916 167930 257C 15772 15788 946C 85333 85355 1635C 167917 167930 258C 15772 15787 947C 85385 85405 1636C 167918 167931 259C 15773 15788 948C 85717 85730 1637C 167919 167932 260C 15774 15788 949C 86342 86358 1638C 167920 167933 261C 15811 15825 950C 86991 87004 1639C 168129 168142 262C 15887 15901 951C 87120 87134 1640C 168206 168219 263C 15959 15974 952C 87121 87134 1641C 168215 168232 264C 16077 16095 953C 87145 87158 1642C 168218 168232 265C 16078 16095 954C 87748 87762 1643C 168222 168235 266C 16184 16198 955C 87749 87762 1644C 168223 168236 267C 17076 17090 956C 87759 87773 1645C 168223 168237 268C 17543 17556 957C 87759 87774 1646C 168332 168354 269C 18238 18256 958C 87759 87772 1647C 168332 168352 270C 18372 18389 959C 87874 87887 1648C 168332 168348 271C 18372 18387 960C 87893 87907 1649C 168332 168350 272C 18375 18389 961C 87894 87907 1650C 168332 168345 273C 18375 18388 962C 88005 88022 1651C 168332 168349 274C 18376 18389 963C 88005 88020 1652C 168336 168352 275C 18528 18541 964C 88008 88022 1653C 168339 168352 276C 19124 19142 965C 88008 88021 1654C 168339 168354 277C 19418 19436 966C 88009 88022 1655C 168341 168354 278C 19539 19552 967C 88410 88425 1656C 168346 168359 279C 19543 19557 968C 88410 88424 1657C 168346 168361 280C 19543 19556 969C 88411 88425 1658C 169624 169637 281C 19642 19657 970C 88412 88425 1659C 169634 169647 282C 19642 19656 971C 88417 88430 1660C 169950 169963 283C 19643 19657 972C 88555 88569 1661C 169993 170011 284C 19644 19657 973C 88556 88569 1662C 170013 170027 285C 19645 19658 974C 88563 88576 1663C 170747 170763 286C 19645 19659 975C 88858 88873 1664C 170786 170799 287C 19673 19686 976C 89771 89784 1665C 170832 170853 288C 20123 20136 977C 90601 90614 1666C 170857 170888 289C 20145 20158 978C 90960 90974 1667C 170890 170917 290C 20275 20288 979C 91239 91259 1668C 170952 170969 291C 20383 20396 980C 91273 91287 1669C 171124 171137 292C 20405 20418 981C 92313 92327 1670C 171205 171221 293C 20491 20504 982C 92407 92423 1671C 171548 171561 294C 20535 20548 983C 92457 92473 1672C 172068 172083 295C 20825 20845 984C 92468 92487 1673C 172378 172391 296C 20827 20865 985C 92636 92649 1674C 172774 172788 297C 20829 20867 986C 92649 92662 1675C 172857 172871 298C 20831 20869 987C 92687 92700 1676C 173032 173045 299C 20833 20871 988C 92703 92728 1677C 173037 173053 300C 20859 20873 989C 92709 92722 1678C 173037 173052 301C 20861 20875 990C 92713 92728 1679C 173037 173050 302C 21106 21123 991C 92738 92779 1680C 173037 173054 303C 21106 21121 992C 92853 92868 1681C 173037 173051 304C 21109 21123 993C 93263 93278 1682C 173038 173051 305C 21109 21122 994C 93489 93502 1683C 173038 173055 306C 21110 21123 995C 93490 93507 1684C 173039 173052 307C 21637 21651 996C 93924 93937 1685C 173040 173053 308C 21638 21651 997C 93953 93968 1686C 173041 173054 309C 21687 21705 998C 93992 94011 1687C 173042 173055 310C 21688 21705 999C 94190 94203 1688C 173175 173188 311C 21855 21868 1000C 94426 94439 1689C 173351 173364 312C 22110 22124 1001C 94593 94606 1690C 173721 173734 313C 22111 22124 1002C 94594 94610 1691C 173753 173767 314C 22524 22537 1003C 95236 95252 1692C 173793 173806 315C 22663 22676 1004C 95242 95256 1693C 174475 174490 316C 22682 22696 1005C 95245 95260 1694C 174477 174491 317C 22683 22696 1006C 95806 95819 1695C 174478 174492 318C 22793 22806 1007C 96031 96044 1696C 174480 174494 319C 22794 22808 1008C 96294 96308 1697C 174754 174767 320C 22794 22807 1009C 96791 96807 1698C 175471 175484 321C 22795 22808 1010C 96825 96841 1699C 176641 176654 322C 22963 22977 1011C 96826 96839 1700C 177161 177174 323C 23359 23372 1012C 96921 96943 1701C 177831 177844 324C 23764 23781 1013C 98235 98249 1702C 178716 178729 325C 24025 24039 1014C 98271 98286 1703C 179143 179156 326C 24325 24339 1015C 99337 99354 1704C 179221 179235 327C 24671 24684 1016C 99358 99374 1705C 179222 179235 328C 25357 25371 1017C 99438 99451 1706C 179223 179236 329C 25359 25374 1018C 99503 99516 1707C 179223 179237 330C 25526 25541 1019C 99509 99522 1708C 179238 179251 331C 25527 25541 1020C 99520 99538 1709C 179369 179386 332C 25564 25578 1021C 99587 99603 1710C 179369 179388 333C 25566 25581 1022C 100265 100278 1711C 179369 179384 334C 25614 25627 1023C 100374 100389 1712C 179369 179390 335C 26533 26546 1024C 100721 100734 1713C 179372 179386 336C 27318 27331 1025C 101246 101260 1714C 179372 179385 337C 27589 27603 1026C 101442 101455 1715C 179373 179386 338C 28014 28028 1027C 101443 101456 1716C 179373 179388 339C 28547 28560 1028C 101446 101461 1717C 180480 180493 340C 28677 28693 1029C 101449 101462 1718C 180610 180624 341C 28703 28733 1030C 101455 101473 1719C 180610 180625 342C 29411 29428 1031C 101461 101474 1720C 180611 180624 343C 29415 29429 1032C 101461 101476 1721C 180635 180648 344C 29416 29429 1033C 101473 101486 1722C 180741 180758 345C 29675 29692 1034C 101572 101587 1723C 180741 180760 346C 29678 29692 1035C 101572 101586 1724C 180746 180760 347C 29679 29692 1036C 101573 101587 1725C 180748 180761 348C 31430 31444 1037C 101574 101587 1726C 181673 181686 349C 31886 31901 1038C 101575 101588 1727C 181673 181687 350C 32462 32475 1039C 101575 101589 1728C 181680 181693 351C 33159 33174 1040C 101722 101739 1729C 181837 181853 352C 33161 33174 1041C 101722 101741 1730C 181840 181853 353C 33164 33178 1042C 101722 101737 1731C 181883 181896 354C 33166 33179 1043C 101722 101743 1732C 181884 181897 355C 33266 33279 1044C 101725 101739 1733C 181953 181966 356C 33270 33285 1045C 101725 101738 1734C 181982 181998 357C 33369 33384 1046C 101726 101739 1735C 182190 182206 358C 33369 33388 1047C 101726 101741 1736C 182190 182203 359C 33369 33383 1048C 101971 101984 1737C 182190 182207 360C 33370 33384 1049C 102535 102548 1738C 183276 183290 361C 33370 33385 1050C 102560 102576 1739C 183278 183291 362C 33371 33384 1051C 102601 102621 1740C 183280 183295 363C 33612 33625 1052C 102609 102625 1741C 183280 183293 364C 33613 33627 1053C 102618 102632 1742C 183281 183295 365C 33614 33627 1054C 102638 102655 1743C 183282 183295 366C 33725 33747 1055C 103607 103620 1744C 183303 183317 367C 33725 33745 1056C 103730 103743 1745C 183496 183509 368C 33725 33741 1057C 103768 103781 1746C 183512 183525 369C 33725 33743 1058C 103824 103839 1747C 183512 183526 370C 33725 33738 1059C 104275 104313 1748C 183775 183788 371C 33725 33742 1060C 104275 104290 1749C 183795 183808 372C 33729 33745 1061C 104275 104294 1750C 184033 184046 373C 33732 33745 1062C 104275 104300 1751C 184034 184051 374C 33732 33747 1063C 104276 104313 1752C 184034 184050 375C 33734 33747 1064C 104277 104315 1753C 184036 184051 376C 33739 33752 1065C 104277 104292 1754C 184037 184051 377C 33771 33786 1066C 104277 104296 1755C 184038 184051 378C 33773 33791 1067C 104277 104302 1756C 184048 184062 379C 33773 33790 1068C 104278 104315 1757C 184048 184063 380C 33774 33797 1069C 104279 104317 1758C 184048 184061 381C 33774 33790 1070C 104279 104294 1759C 184134 184149 382C 33775 33797 1071C 104279 104298 1760C 184135 184149 383C 33775 33791 1072C 104279 104304 1761C 184135 184148 384C 33776 33792 1073C 104280 104317 1762C 184200 184214 385C 33777 33793 1074C 104281 104319 1763C 184286 184303 386C 33778 33794 1075C 104281 104296 1764C 184286 184301 387C 33779 33795 1076C 104281 104300 1765C 184289 184303 388C 33780 33797 1077C 104281 104306 1766C 184289 184302 389C 33780 33796 1078C 104282 104319 1767C 184290 184303 390C 33782 33797 1079C 104283 104298 1768C 185258 185271 391C 33783 33797 1080C 104283 104302 1769C 185486 185501 392C 33784 33797 1081C 104283 104308 1770C 185487 185524 393C 33785 33799 1082C 104285 104300 1771C 185488 185526 394C 33785 33798 1083C 104285 104304 1772C 185488 185503 395C 34721 34737 1084C 104285 104310 1773C 185488 185507 396C 34721 34735 1085C 104287 104302 1774C 185488 185513 397C 34724 34738 1086C 104287 104306 1775C 185489 185526 398C 34725 34738 1087C 104287 104312 1776C 185490 185528 399C 34829 34843 1088C 104289 104304 1777C 185490 185505 400C 34830 34843 1089C 104289 104308 1778C 185490 185509 401C 34845 34858 1090C 104289 104314 1779C 185490 185515 402C 34850 34863 1091C 104291 104306 1780C 185491 185528 403C 34962 34975 1092C 104291 104310 1781C 185492 185530 404C 34979 34996 1093C 104291 104316 1782C 185492 185507 405C 34979 34994 1094C 104293 104308 1783C 185492 185511 406C 34982 34996 1095C 104293 104312 1784C 185492 185517 407C 34982 34995 1096C 104293 104318 1785C 185493 185530 408C 34983 34996 1097C 104295 104310 1786C 185494 185532 409C 36134 36150 1098C 104295 104314 1787C 185494 185509 410C 36134 36151 1099C 104295 104320 1788C 185494 185513 411C 36134 36148 1100C 104297 104312 1789C 185494 185519 412C 36137 36152 1101C 104297 104316 1790C 185495 185532 413C 36139 36154 1102C 104299 104314 1791C 185496 185534 414C 36140 36153 1103C 104299 104318 1792C 185496 185511 415C 36142 36156 1104C 104301 104316 1793C 185496 185515 416C 36154 36167 1105C 104301 104320 1794C 185496 185521 417C 37221 37236 1106C 104303 104318 1795C 185497 185534 418C 37221 37235 1107C 104305 104320 1796C 185498 185536 419C 37222 37236 1108C 104515 104529 1797C 185498 185513 420C 37223 37236 1109C 104526 104539 1798C 185498 185517 421C 37228 37241 1110C 104526 104541 1799C 185498 185523 422C 37373 37386 1111C 104529 104543 1800C 185499 185536 423C 37639 37652 1112C 104531 104545 1801C 185500 185538 424C 37965 37978 1113C 104556 104574 1802C 185500 185515 425C 38276 38292 1114C 104557 104574 1803C 185500 185519 426C 39112 39125 1115C 104595 104615 1804C 185500 185525 427C 39195 39217 1116C 104596 104614 1805C 185501 185538 428C 39221 39236 1117C 104596 104613 1806C 185502 185517 429C 39238 39254 1118C 104597 104613 1807C 185502 185521 430C 39259 39287 1119C 104598 104614 1808C 185502 185527 431C 39307 39323 1120C 104599 104616 1809C 185504 185519 432C 39354 39368 1121C 104599 104615 1810C 185504 185523 433C 39520 39540 1122C 104601 104616 1811C 185504 185529 434C 39563 39582 1123C 104602 104616 1812C 185506 185521 435C 39591 39646 1124C 104603 104616 1813C 185506 185525 436C 39641 39665 1125C 104707 104722 1814C 185506 185531 437C 39653 39667 1126C 104707 104721 1815C 185508 185523 438C 39654 39667 1127C 104708 104722 1816C 185508 185527 439C 39665 39680 1128C 104709 104722 1817C 185508 185533 440C 39667 39680 1129C 104710 104723 1818C 185510 185525 441C 39676 39689 1130C 104710 104724 1819C 185510 185529 442C 39687 39704 1131C 104980 104997 1820C 185510 185535 443C 39749 39766 1132C 105142 105155 1821C 185512 185527 444C 39881 39895 1133C 105227 105241 1822C 185512 185531 445C 40315 40332 1134C 105634 105647 1823C 185512 185537 446C 40326 40339 1135C 105935 105948 1824C 185514 185529 447C 40327 40340 1136C 106055 106068 1825C 185514 185533 448C 40725 40739 1137C 106749 106762 1826C 185514 185539 449C 40753 40766 1138C 108053 108067 1827C 185516 185531 450C 40828 40845 1139C 108079 108093 1828C 185516 185535 451C 40833 40849 1140C 108111 108124 1829C 185518 185533 452C 40847 40861 1141C 108193 108206 1830C 185518 185537 453C 40847 40860 1142C 108242 108260 1831C 185520 185535 454C 40933 40948 1143C 108242 108267 1832C 185520 185539 455C 40934 40948 1144C 108242 108259 1833C 185522 185537 456C 40934 40947 1145C 108243 108259 1834C 185524 185539 457C 41081 41098 1146C 108244 108267 1835C 185786 185812 458C 41081 41096 1147C 108244 108260 1836C 186089 186103 459C 41084 41098 1148C 108245 108267 1837C 187455 187468 460C 41084 41097 1149C 108245 108261 1838C 187536 187549 461C 41085 41098 1150C 108246 108262 1839C 187570 187583 462C 41813 41826 1151C 108247 108263 1840C 187594 187607 463C 42035 42048 1152C 108248 108264 1841C 187700 187715 464C 42046 42060 1153C 108249 108265 1842C 187702 187715 465C 42394 42407 1154C 108250 108267 1843C 187705 187719 466C 42784 42805 1155C 108250 108266 1844C 187707 187720 467C 42815 42828 1156C 108252 108267 1845C 187710 187724 468C 43505 43518 1157C 108253 108267 1846C 187712 187725 469C 44251 44264 1158C 108254 108267 1847C 187715 187729 470C 44252 44269 1159C 108315 108329 1848C 189197 189211 471C 44252 44268 1160C 109578 109592 1849C 189201 189215 472C 44254 44269 1161C 109779 109799 1850C 189202 189216 473C 44255 44269 1162C 109779 109792 1851C 189203 189216 474C 44256 44269 1163C 109780 109793 1852C 189234 189248 475C 44363 44378 1164C 109781 109794 1853C 189235 189248 476C 44363 44377 1165C 109782 109795 1854C 189241 189255 477C 44364 44378 1166C 109782 109799 1855C 189242 189255 478C 44365 44378 1167C 109783 109796 1856C 189328 189341 479C 44366 44379 1168C 109784 109797 1857C 189353 189366 480C 44366 44380 1169C 109785 109798 1858C 189388 189402 481C 44381 44394 1170C 109786 109799 1859C 189389 189402 482C 44693 44706 1171C 109787 109800 1860C 189404 189417 483C 44886 44899 1172C 109858 109871 1861C 189436 189449 484C 45063 45076 1173C 109884 109901 1862C 189484 189497 485C 45550 45563 1174C 109885 109902 1863C 189509 189522 486C 45566 45579 1175C 109885 109901 1864C 189524 189537 487C 46504 46518 1176C 109887 109902 1865C 189616 189629 488C 46504 46517 1177C 109888 109902 1866C 189679 189692 489C 47117 47130 1178C 109889 109902 1867C 189727 189741 490C 47761 47774 1179C 109899 109913 1868C 189728 189741 491C 48059 48076 1180C 109899 109914 1869C 189746 189760 492C 48059 48074 1181C 109899 109912 1870C 189768 189781 493C 48062 48076 1182C 109985 110000 1871C 189850 189864 494C 48062 48075 1183C 109986 110000 1872C 189871 189884 495C 48063 48076 1184C 109986 109999 1873C 189903 189917 496C 51324 51337 1185C 110032 110047 1874C 189904 189917 497C 51451 51464 1186C 110033 110047 1875C 189999 190012 498C 51699 51713 1187C 110034 110047 1876C 190003 190016 499C 51703 51718 1188C 110054 110067 1877C 190050 190064 500C 51704 51718 1189C 110130 110144 1878C 190094 190107 501C 51706 51721 1190C 110131 110144 1879C 190105 190120 502C 51709 51724 1191C 110144 110161 1880C 190110 190123 503C 51711 51724 1192C 110144 110159 1881C 190452 190465 504C 51714 51728 1193C 110147 110161 1882C 190911 190931 505C 51716 51730 1194C 110147 110160 1883C 190977 190991 506C 51716 51729 1195C 110148 110161 1884C 190986 190999 507C 52657 52671 1196C 111693 111709 1885C 191022 191035 508C 52685 52698 1197C 111914 111927 1886C 191066 191096 509C 52804 52817 1198C 111978 111991 1887C 191110 191124 510C 52901 52918 1199C 112522 112535 1888C 191533 191550 511C 53045 53058 1200C 113014 113028 1889C 191685 191701 512C 53050 53063 1201C 113014 113027 1890C 192166 192179 513C 53499 53512 1202C 113017 113033 1891C 192229 192248 514C 53593 53606 1203C 113017 113032 1892C 192267 192280 515C 53598 53611 1204C 113018 113032 1893C 192368 192381 516C 53848 53861 1205C 113018 113031 1894C 193000 193016 517C 53853 53869 1206C 113019 113033 1895C 193002 193016 518C 53853 53874 1207C 113149 113162 1896C 193004 193017 519C 53853 53868 1208C 113165 113180 1897C 193684 193697 520C 53853 53866 1209C 113639 113652 1898C 193775 193788 521C 53853 53870 1210C 113972 113985 1899C 194043 194056 522C 53853 53871 1211C 113977 113990 1900C 194115 194128 523C 53853 53867 1212C 114427 114444 1901C 194211 194224 524C 53854 53867 1213C 114505 114520 1902C 194342 194355 525C 53855 53868 1214C 114506 114519 1903C 194963 194977 526C 53856 53869 1215C 114508 114522 1904C 195208 195221 527C 53857 53870 1216C 114607 114624 1905C 196504 196517 528C 53858 53871 1217C 114610 114624 1906C 196510 196523 529C 53859 53872 1218C 114611 114624 1907C 197407 197420 530C 53860 53873 1219C 114625 114638 1908C 197546 197562 531C 53861 53874 1220C 114726 114739 1909C 198107 198121 532C 56431 56451 1221C 114858 114871 1910C 198108 198121 533C 56431 56447 1222C 114953 114966 1911C 198132 198145 534C 56432 56448 1223C 114958 114974 1912C 198236 198249 535C 56433 56449 1224C 114958 114973 1913C 198236 198253 536C 56434 56451 1225C 114958 114971 1914C 198237 198250 537C 56434 56450 1226C 114958 114975 1915C 198238 198251 538C 56436 56451 1227C 114958 114976 1916C 198239 198252 539C 56438 56453 1228C 114958 114972 1917C 198240 198253 540C 56439 56453 1229C 114959 114972 1918C 198241 198254 541C 56439 56452 1230C 114960 114973 1919C 199001 199014 542C 56440 56453 1231C 114960 114977 1920C 199399 199416 543C 56689 56702 1232C 114961 114974 1921C 199433 199447 544C 56888 56902 1233C 114962 114975 1922C 199982 199995 545C 57519 57532 1234C 114963 114976 1923C 200105 200118 546C 57629 57643 1235C 114964 114977 1924C 201599 201612 547C 57630 57643 1236C 114964 114978 1925C 201698 201721 548C 57631 57645 1237C 114966 114979 1926C 201737 201750 549C 57843 57856 1238C 115114 115130 1927C 201752 201765 550C 57843 57858 1239C 115139 115152 1928C 201942 201955 551C 57847 57865 1240C 115216 115230 1929C 202723 202736 552C 57848 57865 1241C 115362 115383 1930C 202809 202822 553C 57849 57862 1242C 116149 116162 1931C 203322 203339 554C 57849 57864 1243C 117192 117205 1932C 203595 203610 555C 57854 57868 1244C 117205 117218 1933C 203698 203711 556C 57865 57879 1245C 117205 117220 1934C 205286 205301 557C 57865 57878 1246C 117207 117220 1935C 205288 205301 558C 58001 58015 1247C 117212 117225 1936C 205509 205526 559C 58001 58014 1248C 117252 117265 1937C 205509 205524 560C 58112 58129 1249C 117355 117372 1938C 205512 205526 561C 58112 58127 1250C 117355 117370 1939C 205512 205525 562C 58115 58129 1251C 117358 117372 1940C 205513 205526 563C 58115 58128 1252C 117358 117371 1941C 205773 205790 564C 58116 58129 1253C 117359 117372 1942C 205773 205786 565C 58944 58958 1254C 117379 117392 1943C 205775 205790 566C 58946 58959 1255C 117420 117434 1944C 205918 205933 567C 58947 58962 1256C 117420 117433 1945C 205921 205955 568C 58948 58962 1257C 117536 117549 1946C 205942 205956 569C 58949 58962 1258C 117692 117706 1947C 205943 205957 570C 59054 59069 1259C 117692 117705 1948C 206118 206131 571C 59054 59068 1260C 117929 117943 1949C 206852 206866 572C 59055 59069 1261C 117931 117944 1950C 206903 206922 573C 59056 59069 1262C 119402 119415 1951C 207326 207340 574C 59057 59070 1263C 119403 119416 1952C 207388 207401 575C 59057 59071 1264C 119521 119536 1953C 207731 207744 576C 59072 59085 1265C 119521 119535 1954C 207800 207814 577C 59370 59385 1266C 119522 119536 1955C 208172 208188 578C 59370 59384 1267C 119523 119536 1956C 208202 208215 579C 59371 59385 1268C 119524 119537 1957C 208217 208230 580C 59372 59385 1269C 119524 119538 1958C 208256 208281 581C 59373 59386 1270C 120110 120123 1959C 208329 208343 582C 59373 59387 1271C 120916 120929 1960C 208573 208588 583C 59390 59403 1272C 120921 120934 1961C 209367 209380 584C 59525 59538 1273C 121153 121166 1962C 209718 209731 585C 59569 59582 1274C 121533 121546 1963C 210001 210015 586C 59689 59705 1275C 121541 121560 1964C 210175 210191 587C 59689 59707 1276C 121594 121614 1965C 210235 210248 588C 59689 59702 1277C 121616 121629 1966C 210259 210276 589C 59689 59706 1278C 121679 121698 1967C 210278 210296 590C 59834 59851 1279C 121760 121775 1968C 210868 210881 591C 59834 59849 1280C 121853 121873 1969C 210869 210884 592C 59837 59851 1281C 121961 121977 1970C 210983 210996 593C 59837 59850 1282C 122017 122030 1971C 210988 211001 594C 59838 59851 1283C 122070 122090 1972C 211127 211141 595C 60325 60338 1284C 122124 122137 1973C 211128 211141 596C 60780 60794 1285C 122443 122456 1974C 211135 211148 597C 60943 60958 1286C 122713 122726 1975C 211237 211253 598C 60943 60957 1287C 123690 123705 1976C 211237 211258 599C 60944 60958 1288C 123692 123705 1977C 211237 211252 600C 60945 60958 1289C 123793 123806 1978C 211237 211250 601C 60950 60963 1290C 123921 123937 1979C 211237 211254 602C 60999 61017 1291C 123924 123937 1980C 211237 211255 603C 61000 61017 1292C 124080 124093 1981C 211237 211251 604C 61216 61231 1293C 124136 124150 1982C 211237 211259 605C 61216 61229 1294C 124483 124497 1983C 211238 211251 606C 61216 61230 1295C 124551 124564 1984C 211239 211252 607C 61217 61230 1296C 125444 125457 1985C 211240 211260 608C 61218 61231 1297C 125480 125493 1986C 211240 211253 609C 61219 61232 1298C 125880 125893 1987C 211241 211254 610C 61220 61233 1299C 126098 126111 1988C 211242 211255 611C 61253 61266 1300C 126100 126113 1989C 211243 211256 612C 61258 61271 1301C 126100 126114 1990C 211243 211260 613C 61412 61425 1302C 126102 126117 1991C 211244 211257 614C 61501 61514 1303C 126102 126121 1992C 211245 211258 615C 61506 61519 1304C 126107 126120 1993C 211246 211259 616C 62148 62161 1305C 126705 126719 1994C 211247 211260 617C 62171 62184 1306C 126705 126720 1995C 212059 212081 618C 62197 62215 1307C 126709 126722 1996C 212122 212138 619C 62198 62215 1308C 126714 126730 1997C 212186 212199 620C 62420 62434 1309C 126714 126735 1998C 212409 212422 621C 62422 62438 1310C 126714 126729 1999C 212424 212440 622C 62424 62438 1311C 126714 126727 2000C 212481 212497 623C 64142 64155 1312C 126714 126731 2001C 212742 212755 624C 64276 64290 1313C 126714 126732 2002C 213194 213207 625C 64277 64290 1314C 126714 126740 2003C 213194 213209 626C 64301 64314 1315C 126714 126738 2004C 213196 213216 627C 64401 64417 1316C 126714 126728 2005C 213197 213215 628C 64401 64422 1317C 126714 126736 2006C 213197 213214 629C 64401 64416 1318C 126715 126728 2007C 213197 213219 630C 64401 64414 1319C 126716 126729 2008C 213198 213214 631C 64401 64428 1320C 126717 126730 2009C 213199 213215 632C 64401 64418 1321C 126718 126731 2010C 213200 213216 633C 64401 64419 1322C 126719 126732 2011C 213201 213217 634C 64401 64427 1323C 126720 126733 2012C 213202 213219 635C 64401 64425 1324C 126721 126734 2013C 213202 213218 636C 64401 64415 1325C 126722 126735 2014C 213204 213219 637C 64401 64423 1326C 126723 126736 2015C 213205 213219 638C 64402 64415 1327C 126724 126737 2016C 213206 213219 639C 64403 64416 1328C 126725 126738 2017C 213207 213220 640C 64404 64417 1329C 126726 126739 2018C 213220 213234 641C 64405 64418 1330C 126727 126740 2019C 213220 213235 642C 64406 64419 1331C 128160 128173 2020C 213220 213233 643C 64407 64420 1332C 128429 128442 2021C 213470 213487 644C 64408 64421 1333C 128548 128561 2022C 213470 213485 645C 64409 64429 1334C 128902 128928 2023C 213473 213487 646C 64409 64422 1335C 129245 129263 2024C 213473 213486 647C 64410 64423 1336C 129722 129736 2025C 213474 213487 648C 64411 64424 1337C 130321 130334 2026C 213903 213917 649C 64412 64425 1338C 130407 130420 2027C 214421 214434 650C 64412 64429 1339C 130414 130427 2028C 214656 214669 651C 64413 64426 1340C 130519 130533 2029C 215447 215460 652C 64414 64427 1341C 130520 130533 2030C 215447 215462 653C 64415 64428 1342C 130521 130534 2031C 215452 215469 654C 64416 64429 1343C 130818 130835 2032C 215453 215466 655C 64417 64430 1344C 130819 130832 2033C 215453 215468 656C 65366 65380 1345C 130819 130834 2034C 215458 215472 657C 65371 65385 1346C 130824 130838 2035C 215458 215473 658C 65376 65390 1347C 130824 130839 2036C 215459 215476 659C 65381 65395 1348C 130825 130842 2037C 215460 215474 660C 65386 65400 1349C 130826 130840 2038C 215461 215477 661C 65484 65499 1350C 130827 130843 2039C 215461 215478 662C 65485 65499 1351C 130827 130844 2040C 215461 215475 663C 65485 65498 1352C 130827 130841 2041C 215464 215479 664C 65492 65506 1353C 130830 130845 2042C 215465 215479 665C 65493 65506 1354C 130831 130845 2043C 215466 215479 666C 65635 65652 1355C 130832 130845 2044C 215573 215588 667C 65635 65650 1356C 130950 130966 2045C 215573 215587 668C 65638 65652 1357C 130950 130963 2046C 215574 215588 669C 65638 65651 1358C 130950 130967 2047C 215575 215588 670C 65639 65652 1359C 131305 131318 2048C 215576 215589 671C 65670 65683 1360C 131561 131577 2049C 215576 215590 672C 65709 65735 1361C 131561 131582 2050C 215591 215604 673C 65710 65728 1362C 131561 131576 2051C 216217 216230 674C 65710 65727 1363C 131561 131574 2052C 216885 216898 675C 65711 65727 1364C 131561 131578 2053C 217158 217172 676C 65712 65728 1365C 131561 131579 2054C 217708 217721 677C 65713 65729 1366C 131561 131585 2055C 217853 217866 678C 65714 65730 1367C 131561 131575 2056C 218040 218053 679C 65715 65731 1368C 131561 131583 2057C 218707 218722 680C 65716 65732 1369C 131562 131575 2058C 219076 219091 681C 65717 65733 1370C 131563 131576 2059C 219101 219116 682C 65718 65740 1371C 131564 131577 2060C 219191 219205 683C 65718 65734 1372C 131565 131578 2061C 219221 219234 684C 65719 65735 1373C 131566 131579 2062C 219601 219616 685C 65720 65740 1374C 131567 131580 2063C 219814 219828 686C 65720 65736 1375C 131568 131581 2064C 219818 219832 687C 65721 65737 1376C 131569 131582 2065C 219972 219985 688C 65722 65738 1377C 131570 131583 2066C 219984 220014 689C 65723 65740 1378C 131571 131584
[0111] In some embodiments, the target sequence is selected from the group consisting of target regions 1C to 2066C as shown in Table 4 above.
Target Cell
[0112] The term a “target cell” as used herein refers to a cell which is expressing the target nucleic acid. For the therapeutic use of the present invention it is advantageous if the target cell is infected with HBV. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a woodchuck cell or a primate cell such as a monkey cell (e.g. a cynomolgus monkey cell) or a human cell.
[0113] In preferred embodiments, the target cell expresses SEPT9 mRNA, such as the SEPT9 pre-mRNA or SEPT9 mature mRNA. The poly A tail of SEPT9 mRNA is typically disregarded for antisense oligonucleotide targeting.
[0114] Further, the target cell may be a hepatocyte. In one embodiment, the target cell is HBV infected primary human hepatocytes, either derived from HBV infected individuals or from a HBV infected mouse with a humanized liver (PhoenixBio, PXB-mouse).
[0115] In accordance with the present invention, the target cell may be infected with HBV. Further, the target cell may comprise HBV cccDNA. Thus, the target cell preferably comprises SEPT9 mRNA, such as the SEPT9 pre-mRNA or SEPT9 mature mRNA, and HBV cccDNA.
Naturally Occurring Variant
[0116] The term “naturally occurring variant” refers to variants of SEPT9 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.
[0117] In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian SEPT9 target nucleic acid, such as a target nucleic acid of SEQ ID NO: 1 and/or SEQ ID NO: 2. In some embodiments, the naturally occurring variants have at least 99% homology to the human SEPT9 target nucleic acid of SEQ ID NO: 1. In some embodiments, the naturally occurring variants are known polymorphisms.
Inhibition of Expression
[0118] The term “inhibition of expression” as used herein is to be understood as an overall term for a SEPT9 (Septin 9) inhibitors ability to inhibit the amount or the activity of SEPT9 in a target cell. Inhibition of expression or activity may be determined by measuring the level of SEPT9 pre-mRNA or SEPT9 mRNA, or by measuring the level of SEPT9 protein or activity in a cell. Inhibition of expression may be determined in vitro or in vivo. Advantageously, the inhibition is assessed in relation to the amount of SEPT9 before administration of the SEPT9 inhibitor. Alternatively, inhibition is determined by reference to a control. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock).
[0119] The term “inhibition” or “inhibit” may also be referred to as down-regulate, reduce, suppress, lessen, lower, decrease the expression or activity of SEPT9.
[0120] The inhibition of expression of SEPT9 may occur e.g. by degradation of pre-mRNA or mRNA e.g. using RNase H recruiting oligonucleotides, such as gapmers or nucleic acid molecules that function via the RNA interference pathway, such as siRNA or shRNA. Alternatively, the inhibitor of the present invention may bind to SEPT9 polypeptide and inhibit the activity of SEPT9 or prevent its binding to other molecules.
[0121] In some embodiments, the inhibition of expression of the SEPT9 target nucleic acid or the activity of SEPT9 proteinresults in a decreased amount of HBV cccDNA in the target cell. Preferably, the amount of HBV cccDNA is decreased as compared to a control. In some embodiments, the decrease in amount of HBV cccDNA is at least 20%, at least 30%, as compared to acontrol. In some embodiments, the amount of cccDNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control.
[0122] In some embodiments, the inhibition of expression of the SEPT9 target nucleic acid or the activity of SEPT9 protein results in a decreased amount of HBV pgRNA in the target cell. Preferably, the amount of HBV pgRNA is decreased as compared to a control. In some embodiments, the decrease in amount of HBV pgRNA is at least 20%, at least 30%, as compared to a control. In some embodiments, the amount of pgRNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control.
Sugar Modifications
[0123] The oligonucleotide of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
[0124] Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
[0125] Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradical bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011/017521) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.
[0126] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2′—OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2′, 3′, 4′ or 5′ positions.
High Affinity Modified Nucleosides
[0127] A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T.sup.m). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature in the range of +0.5 to +12° C., more preferably in the range of +1.5 to +10° C. and most preferably in the range of +3 to +8° C. per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2′ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).
2′ Sugar Modified Nucleosides
[0128] A 2′ sugar modified nucleoside is a nucleoside which has a substituent other than H or —OH at the 2′ position (2′ substituted nucleoside) or comprises a 2′ linked biradical capable of forming a bridge between the 2′ carbon and a second carbon in the ribose ring, such as LNA (2′ - 4′ biradical bridged) nucleosides.
[0129] Indeed, much focus has been spent on developing 2′ sugar substituted nucleosides, and numerous 2′ substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, the 2′ modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2′ substituted modified nucleosides are 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-Fluoro-RNA, and 2′-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2′ substituted modified nucleosides.
##STR00001##
##STR00002##
##STR00003##
##STR00004##
##STR00005##
##STR00006##
[0130] In relation to the present invention 2′ substituted sugar modified nucleosides does not include 2′ bridged nucleosides like LNA.
Locked Nucleic Acid Nucleosides (LNA Nucleoside)
[0131] A “LNA nucleoside” is a 2′-sugar modified nucleoside which comprises a biradical linking the C2′ and C4′ of the ribose sugar ring of said nucleoside (also referred to as a “2′- 4′ bridge”), which restricts or locks the conformation of the ribose ring. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide/complement duplex.
[0132] Non limiting, exemplary LNA nucleosides are disclosed in WO 99/014226, WO 00/66604, WO 98/039352, WO 2004/046160, WO 00/047599, WO 2007/134181, WO 2010/077578, WO 2010/036698, WO 2007/090071, WO 2009/006478, WO 2011/156202, WO 2008/154401, WO 2009/067647, WO 2008/150729, Morita et al., Bioorganic & Med.Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.
[0133] Particular examples of LNA nucleosides of the invention are presented in Scheme 1 (wherein B is as defined above).
[0134] Scheme 1
##STR00007##
##STR00008##
##STR00009##
##STR00010##
##STR00011##
##STR00012##
##STR00013##
##STR00014##
##STR00015##
##STR00016##
##STR00017##
##STR00018##
##STR00019##
##STR00020##
##STR00021##
##STR00022##
##STR00023##
##STR00024##
[0135] Particular LNA nucleosides are beta-D-oxy-LNA, 6′-methyl-beta-D-oxy LNA such as (S)-6′-methyl-beta-D-oxy-LNA (ScET) and ENA.
RNase H Activity and Recruitment
[0136] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNase H activity, which may be used to determine the ability to recruit RNase H. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO 01/23613 (hereby incorporated by reference). For use in determining RNase H activity, recombinant human RNase H1 is available from Creative Biomart® (Recombinant Human RNase H1 fused with His tag expressed in E. coli).
Gapmer
[0137] The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof, may be a gapmer, also termed gapmer oligonucleotide or gapmer designs. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5′-flank, a gap and a 3′-flank, F-G-F′ in the ‘5 -> 3’ orientation. The “gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5′ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3′ flanking region (F′) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F′ enhance the affinity of the oligonucleotide for the target nucleic acid (i.e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F′ are 2′ sugar modified nucleosides, such as high affinity 2′ sugar modifications, such as independently selected from LNA and 2′-MOE.
[0138] In a gapmer design, the 5′ and 3′ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5′ (F) or 3′ (F′) region respectively. The flanks may further be defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5′ end of the 5′ flank and at the 3′ end of the 3′ flank.
[0139] Regions F-G-F′ form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F′.
[0140] The overall length of the gapmer design F-G-F′ may be, for example 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, such as from 15 to 20, such as 16 to 18 nucleosides.
[0141] By way of example, the gapmer oligonucleotide of the present invention can be represented by the following formulae: [0142] F.sub.1-8-G.sub.5-18-F′.sub.1-8, such as [0143] F.sub.1-8-G.sub.7-18-F′.sub.2-8 with the proviso that the overall length of the gapmer regions F-G-F′ is at least 12, such as at least 14 nucleotides in length.
[0144] In an aspect of the invention, the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1-8 nucleosides, of which 1-4 are 2′ sugar modified and defines the 5′ and 3′ end of the F and F′ region, and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H. In some embodiments, the G region consists of DNA nucleosides.
[0145] In some embodiments, region F and F′ independently consists of or comprises a contiguous sequence of sugar modified nucleosides. In some embodiments, the sugar modified nucleosides of region F may be independently selected from 2′-O-alkyl-RNA units, 2′-O-methyl-RNA, 2′-amino-DNA units, 2′-fluoro-DNA units, 2′-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2′-fluoro-ANA units.
[0146] In some embodiments, region F and F′ independently comprises both LNA and a 2′-substituted sugar modified nucleotide (mixed wing design). In some embodiments, the 2′-substituted sugar modified nucleotide is independently selected from the group consisting of 2′-O-alkyl-RNA units, 2′-O-methyl-RNA, 2′-amino-DNA units, 2′-fluoro-DNA units, 2′-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units and 2′-fluoro-ANA units.
[0147] In some embodiments, all the modified nucleosides of region F and F′ are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides, wherein region F or F′, or F and F′ may optionally comprise DNA nucleosides. In some embodiments, all the modified nucleosides of region F and F′ are beta-D-oxy LNA nucleosides, wherein region F or F′, or F and F′ may optionally comprise DNA nucleosides. In such embodiments, the flanking region F or F′, or both F and F′ comprise at least three nucleosides, wherein the 5′ and 3′ most nucleosides of the F and/or F′ region are LNA nucleosides.
LNA Gapmer
[0148] An LNA gapmer is a gapmer wherein either one or both of region F and F′ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F′ comprises or consists of beta-D-oxy LNA nucleosides.
[0149] In some embodiments, the LNA gapmer is of formula: [LNA].sub.1-5-[region G].sub.6-18 -[LNA].sub.1-5, wherein region G is as defined in the Gapmer region G definition.
MOE Gapmers
[0150] A MOE gapmers is a gapmer wherein regions F and F′ consist of MOE nucleosides. In some embodiments, the MOE gapmer is of design [MOE].sub.1-8-[Region G].sub.5-16-[MOE] .sub.1-.sub.8, such as [MOE].sub.2-7-[Region G].sub.6-14-[MOE].sub.2-7, such as [MOE].sub.3-6-[Region G] .sub.8-12-[MOE] .sub.3-6, such as [MOE].sub.5-[Region G].sub.10-[MOE].sub.5 wherein region G is as defined in the Gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art.
Region D′ or D″ in an Oligonucleotide
[0151] The oligonucleotide of the invention may in some embodiments comprise or consist of the contiguous nucleotide sequence of the oligonucleotide which is complementary to the target nucleic acid, such as a gapmer region F-G-F′, and further 5′ and/or 3′ nucleosides. The further 5′ and/or 3′ nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5′ and/or 3′ nucleosides may be referred to as region D′ and D″ herein.
[0152] The addition of region D′ or D″ may be used for the purpose of joining the contiguous nucleotide sequence, such as the gapmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or for ease of synthesis or manufacture.
[0153] Region D′ and D″ can be attached to the 5′ end of region F or the 3′ end of region F′, respectively to generate designs of the following formulas D′-F-G-F′, F-G-F′-D′’ or
[0154] D′-F-G-F′-D′’. In this instance the F-G-F′ is the gapmer portion of the oligonucleotide and region D′ or D″ constitute a separate part of the oligonucleotide.
[0155] Region D′ or D″ may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F′ region is not a sugar-modified nucleotide, such as a DNA or RNA or base modified versions of these. The D′ or D″ region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments, the additional 5′ and/or 3′ end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. Nucleotide based biocleavable linkers suitable for use as region D′ or D″ are disclosed in WO2014/076195, which include by way of example a phosphodiester linked DNA dinucleotide. The use of biocleavable linkers in poly-oligonucleotide constructs is disclosed in WO2015/113922, where they are used to link multiple antisense constructs (e.g. gapmer regions) within a single oligonucleotide.
[0156] In one embodiment, the oligonucleotide of the invention comprises a region D′ and/or D″ in addition to the contiguous nucleotide sequence which constitutes the gapmer.
[0157] In some embodiments, the oligonucleotide of the present invention can be represented by the following formulae: [0158] F-G-F′; in particular F.sub.1-8-G.sub.5-18-F′.sub.2-8 [0159] D′-F-G-F′, in particular D′.sub.1-3-F.sub.1-8-G.sub.5-18-F′.sub.2-8 [0160] F-G-F′-D″, in particular F.sub.1-8-G.sub.5-18-F′.sub.2-8-D″.sub.1-3 [0161] D′-F-G-F′-D″, in particular D′.sub.1-3- F.sub.1-8-G.sub.5-18-F′.sub.2-8-D″.sub.1-3
[0162] In some embodiments, the internucleoside linkage positioned between region D′ and region F is a phosphodiester linkage. In some embodiments, the internucleoside linkage positioned between region F′ and region D″ is a phosphodiester linkage.
Conjugate
[0163] The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may be covalently linked to the antisense oligonucleotide, optionally via a linker group, such as region D′ or D″.
[0164] Oligonucleotide conjugates and their synthesis have been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.
[0165] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates (e.g. galactose or N-acetylgalactosamine (GaINAc)), cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins (e.g. antibodies), peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.
[0166] Exemplary conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the ASGPR, see for example WO 2014/076196, WO 2014/207232 and WO 2014/179620 (hereby incorporated by reference). Such conjugates serve to enhance uptake of the oligonucleotide to the liver.
Linkers
[0167] A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).
[0168] In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and/or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).
[0169] Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 5 nucleosides, such as 1, 2, 3, 4 or 5 nucleosides, more preferably between 2 and 4 nucleosides and most preferably 2 or 3 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014/076195 (hereby incorporated by reference).
[0170] Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments, the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. some embodiments the linker (region Y) is a C6 amino alkyl group.
Treatment
[0171] The term “treatment” as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic. Prophylactic can be understood as preventing an HBV infection from turning into a chronic HBV infection or the prevention of severe liver diseases such as liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection.
Patient
[0172] For the purposes of the present invention the “subject” (or “patient”) may be a vertebrate. In context of the present invention, the term “subject” includes both humans and other animals, particularly mammals, and other organisms. Thus, the herein provided means and methods are applicable to both human therapy and veterinary applications. Preferably, the subject is a mammal. More preferably the subject is human.
[0173] As described elsewhere herein, the patient to be treated may suffers from HBV infection, such as chronic HBV infection. In some embodiments, the patient suffering from HBV infection may suffer from hepatocellular carcinoma (HCC). In some embodiments, the patient suffering from HBV infection does not suffer from hepatocellular carcinoma. In some embodiments, the patient does not suffer from an HCV infection.
DETAILED DESCRIPTION OF THE INVENTION
[0174] HBV cccDNA in infected hepatocytes is responsible for persistent chronic infection and reactivation, being the template for all viral subgenomic transcripts and pre-genomic RNA (pgRNA) to ensure both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling. In the context of the present invention it was for the first time shown that SEPT9 is associated with cccDNA stability. This knowledge allows for the opportunity to destabilize cccDNA in HBV infected subjects which in turn opens the opportunity for a complete cure of chronically infected HBV patients.
[0175] One aspect of the present invention is a SEPT9 inhibitor for use in the treatment and/or prevention of Hepatitis B virus (HBV) infection, in particular a chronic HBV infection.
[0176] The SEPT9 inhibitor can for example be a small molecule that specifically binds to SEPT9 protein, wherein said inhibitor prevents or reduces binding of SEPT9 protein to cccDNA.
[0177] An embodiment of the invention is a SEPT9 inhibitor which is capable of reducing cccDNA and/or pgRNA in an infected cell, such as an HBV infected cell.
[0178] In a further embodiment, the SEPT9 inhibitor is capable of reducing HBsAg and/or HBeAg in vivo in an HBV infected individual.
SEPT9 Inhibitors for Use in Treatment of HBV
[0179] Without being bound by theory, it is believed that SEPT9 is involved in the stabilization of the cccDNA in the cell nucleus, either via direct or indirect binding to the cccDNA, and by preventing the binding/association of SEPT9 with cccDNA, the cccDNA is destabilized and becomes prone to degradation. One embodiment of the invention is therefore a SEPT9 inhibitor which interacts with the SEPT9 protein, and prevents or reduces its binding/association to cccDNA.
[0180] In some embodiments of the present invention, the inhibitor is an antibody, antibody fragment or a small molecule compound. In some embodiments, the inhibitor may be an antibody, antibody fragment or a small molecule that specifically binds to the SEPT9 protein, such as the SEPT9 protein encoded by SEQ ID NO: 1.
Nucleic Acid Molecules of the Invention
[0181] Therapeutic nucleic acid molecules are potentially excellent SEPT9 inhibitors since they can target the SEPT9 transcript and promote its degradation either via the RNA interference pathway or via RNase H cleavage. Alternatively, oligonucleotides such as aptamers can also act as inhibitors of SEPT9 protein interactions.
[0182] One aspect of the present invention is a SEPT9 targeting nucleic acid molecule for use in treatment and/or prevention of Hepatitis B virus (HBV) infection. Such a nucleic acid molecule can be selected from the group consisting of single stranded antisense oligonucleotide, siRNA molecule, and shRNA molecule.
[0183] The present section describes novel nucleic acid molecule suitable for use in treatment and/or prevention of Hepatitis B virus (HBV) infection.
[0184] The nucleic acid molecule of the present invention is capable of inhibiting expression of SEPT9 in vitro and in vivo. The inhibition is achieved by hybridizing an oligonucleotide to a target nucleic acid encoding SEPT9 or which is involved in the regulation of SEPT9. The target nucleic acid may be a mammalian SEPT9 sequence. In some embodiments, the target nucleic acid may be a human SEPT9 pre-mRNA sequence, such as the sequence of SEQ ID NO: 1 or a mature SEPT9 mRNA. In some embodiments, the target nucleic acid may be a cynomolgus monkey SEPT9 sequence such as the sequence of SEQ ID NO: 2.
[0185] In some embodiments, the nucleic acid molecule of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, at least 40%, at least 50%, at least 60%, inhibition compared to the normal expression level of the target. In some embodiments, the nucleic acid molecule of the invention may be capable of inhibiting expression levels of SEPT9 mRNA by at least 60% or 70% in vitro by transfecting 25 nM nucleic acid molecule into PXB-PHH cells, this range of target reduction is advantageous in terms of selecting nucleic acid molecules with good correlation to the cccDNA reduction. Suitably, the examples provide assays which may be used to measure SEPT9 RNA or protein inhibition (e.g. example 1 and the “Materials and Methods” section). The target inhibition is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide, such as the guide strand of a siRNA or gapmer region of an antisense oligonucleotide, and the target nucleic acid. In some embodiments, the nucleic acid molecule of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired inhibition of SEPT9 expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide complementary to the target nucleic acid and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2′ sugar modified nucleosides, including LNA, present within the oligonucleotide sequence.
[0186] An aspect of the present invention relates to a nucleic acid molecules of 12 to 60 nucleotides in length, which comprises a contiguous nucleotide sequence of at least 12 nucleotides in length, such as at least 12 to 30 nucleotides in length, which is at least 95% complementary, such as fully complementary, to a mammalian SEPT9 target nucleic acid, in particular a human SEPT9 nucleic acid. These nucleic acid molecules are capable of inhibiting the expression of SEPT9.
[0187] An aspect of the invention relates to a nucleic acid molecule of 12 to 30 nucleotides in length, comprising a contiguous nucleotide sequence of at least 12 nucleotides, such as 12 to 30 nucleotides in length which is at least 90% complementary, such as fully complementary, to a mammalian SEPT9 target sequence.
[0188] A further aspect of the present invention relates to a nucleic acid molecule according to the invention comprising a contiguous nucleotide sequence of 12 to 20 nucleotides in length with at least 90% complementary, such as fully complementary, to the target sequence of SEQ ID NO: 1.
[0189] In some embodiments, the nucleic acid molecule comprises a contiguous sequence of 12 to 30 nucleotides in length, which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence.
[0190] It is advantageous if the oligonucleotide, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target sequence, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target sequence.
[0191] In some embodiments, the oligonucleotide sequence is 100% complementary to a region of the target sequence of SEQ ID NO: 1.
[0192] In some embodiments, the nucleic acid molecule or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1 and 2.
[0193] In some embodiments, the oligonucleotide or the contiguous nucleotide sequence of the invention is at least 90% or 95% complementary, such as fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3.
[0194] In some embodiments, the contiguous sequence of the nucleic acid molecule of the present invention is least 90% complementary, such as fully complementary to a region of SEQ ID NO: 1, selected from the group consisting of target regions 1C to 2066C as shown in Table 4.
[0195] In some embodiments, the nucleic acid molecule of the invention comprises or consists of 12 to 60 nucleotides in length, such as from 13 to 50, such as from 14 to 35, such as 15 to 30, such as from 16 to 22 contiguous nucleotides in length. In a preferred embodiment, the nucleic acid molecule comprises or consists of 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.
[0196] In some embodiments, the contiguous nucleotide sequence of the nucleic acid molecule which is complementary to the target nucleic acids comprises or consists of 12 to 30, such as from 13 to 25, such as from 15 to 23, such as from 16 to 22, contiguous nucleotides in length.
[0197] In some embodiments, the oligonucleotide is selected from the group consisting of an antisense oligonucleotide, siRNA and shRNA.
[0198] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA which is complementary to the target sequence comprises or consists of 18 to 28, such as from 19 to 26, such as from 20 to 24, such as from 21 to 23, contiguous nucleotides in length.
[0199] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide which is complementary to the target nucleic acids comprises or consists of 12 to 22, such as from 14 to 20, such as from 16 to 20, such as from 15 to 18, such as from 16 to 18, such as from 16, 17, 18, 19 or 20 contiguous nucleotides in length.
[0200] It is understood that the contiguous oligonucleotide sequence (motif sequence) can be modified to, for example, increase nuclease resistance and/or binding affinity to the target nucleic acid.
[0201] The pattern in which the modified nucleosides (such as high affinity modified nucleosides) are incorporated into the oligonucleotide sequence is generally termed oligonucleotide design.
[0202] The nucleic acid molecule of the invention may be designed with modified nucleosides and RNA nucleosides (in particular for siRNA and shRNA molecules) or DNA nucleosides (in particular for single stranded antisense oligonucleotides). Advantageously, high affinity modified nucleosides are used.
[0203] In advantageous embodiments, the nucleic acid molecule or contiguous nucleotide sequence comprises one or more sugar modified nucleosides, such as 2′ sugar modified nucleosides, such as comprise one or more 2′ sugar modified nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).
[0204] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.
[0205] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.
[0206] In some embodiments, the contiguous nucleotide sequence comprises 2′-O-methoxyethyl (2′MOE) nucleosides.
[0207] In some embodiments, the contiguous nucleotide sequence comprises 2′-O-methoxyethyl (2′MOE) nucleosides and DNA nucleosides.
[0208] Advantageously, the 3′ most nucleoside of the antisense oligonucleotide, or contiguous nucleotide sequence thereof is a 2′sugar modified nucleoside.
[0209] In a further embodiment the nucleic acid molecule comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the “Definitions” section under “Modified internucleoside linkage”.
[0210] Advantageously, the oligonucleotide comprises at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.
[0211] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkages.
[0212] It is advantageous if at least 2 to 3 internucleoside linkages at the 5′ or 3′ end of the oligonucleotide are phosphorothioate internucleoside linkages.
[0213] For single stranded antisense oligonucleotides it is advantageous if at least 75%, such as all, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. In some embodiments, all the internucleotide linkages in the contiguous sequence of the single stranded antisense oligonucleotide are phosphorothioate linkages.
[0214] In an advantageous embodiment of the invention the antisense oligonucleotide of the invention is capable of recruiting RNase H, such as RNase H1. An advantageous structural design is a gapmer design as described in the “Definitions” section under for example “Gapmer”, “LNA Gapmer” and “MOE gapmer”. In the present invention it is advantageous if the antisense oligonucleotide of the invention is a gapmer with an F-G-F′ design.
[0215] In all instances the F-G-F′ design may further include region D′ and/or D″ as described in the “Definitions” section under “Region D′ or D″ in an oligonucleotide”.
[0216] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 - 24, such as 12 - 18 in length, nucleosides in length wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 14, such as at least 15, such as 16 contiguous nucleotides present in SEQ ID NO 17.
[0217] The invention provides antisense oligonucleotides according to the invention, such as antisense oligonucleotides 12 - 24 nucleosides in length, such as 12 - 18 in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 14, such as at least 15, such as 16 contiguous nucleotides present in SEQ ID NO 18.
[0218] The invention provides LNA gapmers according to the invention comprising or consisting of a contiguous nucleotide sequence shown in SEQ ID NO 17 or 18. In some embodiments, the LNA gapmer is a LNA gapmer with CMP ID NO: 17_1 or 18_1 in Table 6.
[0219] In a further aspect, of the invention the nucleic acid molecules, such as the antisense oligonucleotide, siRNA or shRNA, of the invention can be targeted directly to the liver by covalently attaching them to a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPr), such as divalent or trivalent GaINAc cluster.
Conjugates
[0220] Since HBV infection primarily affects the hepatocytes in the liver it is advantageous to conjugate the SEPT9 inhibitor to a conjugate moiety that will increase the delivery of the inhibitor to the liver compared to the unconjugated inhibitor. In one embodiment, liver targeting moieties are selected from moieties comprising cholesterol or other lipids or conjugate moieties capable of binding to the asialoglycoprotein receptor (ASGPR).
[0221] In some embodiments, the invention provides a conjugate comprising a nucleic acid molecule of the invention covalently attached to a conjugate moiety.
[0222] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moieties) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S.T. and Drickamer, K. JB.C. 1996, 271, 6686) or are readily determined using methods typical in the art.
[0223] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GaINAc).
[0224] To generate the ASGPR conjugate moiety the ASPGR targeting moieties (preferably GaINAc) can be attached to a conjugate scaffold. Generally, the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GaINAc moieties linked to a spacer which links each GaINAc moiety to a brancher molecule that can be conjugated to the antisense oligonucleotide.
[0225] In a further embodiment, the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. Advantageously, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GaINAc) moieties.
[0226] GaINAc conjugate moieties can include, for example, those described in WO 2014/179620 and WO 2016/055601 and PCT/EP2017/059080 (hereby incorporated by reference), as well as small peptides with GaINAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GaINAc)3 (YEE(ahGaINAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor).
[0227] The ASGPR conjugate moiety, in particular a trivalent GaINAc conjugate moiety, may be attached to the 3′- or 5′-end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is linked to the 5′-end of the oligonucleotide.
[0228] In one embodiment, the conjugate moiety is a tri-valent N-acetylgalactosamine (GaINAc), such as those shown in
Method of Manufacture
[0229] In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect, a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
Pharmaceutical Salt
[0230] The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term “pharmaceutically acceptable salt” refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the compounds of the present invention.
[0231] In a further aspect, the invention provides a pharmaceutically acceptable salt of the nucleic acid molecules or a conjugate thereof, such as a pharmaceutically acceptable sodium salt, ammonium salt or potassium salt.
Pharmaceutical Composition
[0232] In a further aspect, the invention provides pharmaceutical compositions comprising any of the compounds of the invention, in particular the aforementioned nucleic acid molecules and/or nucleic acid molecule conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments, the nucleic acid molecule is used in the pharmaceutically acceptable diluent at a concentration of 50 to 300 .Math.M solution.
[0233] Suitable formulations for use in the present invention are found in Remington’s Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091.
[0234] In some embodiments, the nucleic acid molecule or the nucleic acid molecule conjugates of the invention, or pharmaceutically acceptable salt thereof is in a solid form, such as a powder, such as a lyophilized powder.
[0235] Compounds, nucleic acid molecules or nucleic acid molecule conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
[0236] These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.
[0237] In some embodiments, the nucleic acid molecule or nucleic acid molecule conjugate of the invention is a prodrug. In particular with respect to nucleic acid molecule conjugates the conjugate moiety is cleaved off the nucleic acid molecule once the prodrug is delivered to the site of action, e.g. the target cell.
Administration
[0238] The compounds, nucleic acid molecules or nucleic acid molecule conjugates or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).
[0239] In a preferred embodiment the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion. In one embodiment, the active nucleic acid molecule or nucleic acid molecule conjugate is administered intravenously. In another embodiment, the active nucleic acid molecule or nucleic acid molecule conjugate is administered subcutaneously.
[0240] In some embodiments, the nucleic acid molecule, nucleic acid molecule conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 - 15 mg/kg, such as from 0.2 - 10 mg/kg, such as from 0.25 - 5 mg/kg. The administration can be once a week, every second week, every third week or even once a month.
[0241] The invention also provides for the use of the nucleic acid molecule or nucleic acid molecule conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration.
Combination Therapies
[0242] In some embodiments, the inhibitor of the present invention such as the nucleic acid molecule, nucleic acid molecule conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above.
[0243] By way of example, the SEPT9 inhibitor, such as the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as oligonucleotide-based antivirals — such as sequence specific oligonucleotide-based antivirals —acting either through antisense (including other LNA oligomers), siRNAs (such as ARC520), aptamers, morpholinos or any other antiviral, nucleotide sequence-dependent mode of action.
[0244] By way of further example, the SEPT9 inhibitor, such as the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as immune stimulatory antiviral compounds, such as interferon (e.g. pegylated interferon alpha), TLR7 agonists (e.g. GS-9620), or therapeutic vaccines.
[0245] By way of further example, the SEPT9 inhibitor, such as the nucleic acid molecule or the nucleic acid molecule conjugate of the present invention may be used in combination with other actives, such as small molecules, with antiviral activity. These other actives could be, for example, nucleoside/nucleotide inhibitors (e.g. entecavir or tenofovir disoproxil fumarate), encapsidation inhibitors, entry inhibitors (e.g. Myrcludex B).
[0246] In certain embodiments, the additional therapeutic agent may be an HBV agent, an Hepatitis C virus (HCV) agent, a chemotherapeutic agent, an antibiotic, an analgesic, a nonsteroidal antiinflammatory (NSAID) agent, an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant agent.
[0247] In particular related embodiments, the additional HBV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal).
[0248] In other particular related embodiments, the additional HCV agent may be interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; pegasys; an HCV RNA replication inhibitor (e.g., ViroPharma’s VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; or an HCV monoclonal or polyclonal antibody therapy.
Applications
[0249] The nucleic acid molecules of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
[0250] In research, such nucleic acid molecules may be used to specifically modulate the synthesis of SEPT9 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically, the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.
[0251] If employing the nucleic acid molecules of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
[0252] Also encompassed by the present invention is an in vivo or in vitro method for modulating SEPT9 expression in a target cell which is expressing SEPT9, said method comprising administering a nucleic acid molecule, conjugate compound or pharmaceutical composition of the invention in an effective amount to said cell.
[0253] In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments, the target cell is present in in the liver. The target cell may be a hepatocyte.
[0254] One aspect of the present invention is related the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention for use as a medicament.
[0255] In an aspect of the invention, the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compound or pharmaceutical composition of the invention is capable of reducing the cccDNA level in the infected cells and therefore inhibiting HBV infection. In particular, the nucleic acid molecule is capable of affecting one or more of the following parameters i) reducing cccDNA and/or ii) reducing pgRNA and/or iii) reducing HBV DNA and/or iv) reducing HBV viral antigens in an infected cell.
[0256] For example, nucleic acid molecule that inhibits HBV infection may reduce i) the cccDNA levels in an infected cell by at least 40% such as 50% or 60%, reduction compared to controls; or ii) the level of pgRNA by at least 40% such as 50% or 60% reduction compared to controls. The controls may be untreated cells or animals, or cells or animals treated with an appropriate negative control.
[0257] Inhibition of HBV infection may be measured in vitro using HBV infected primary human hepatocytes or in vivo using humanized hepatocytes PXB mouse model (available at PhoenixBio, see also Kakuni et al 2014 Int. J. Mol. Sci. 15:58-74). Inhibition of secretion of HBsAg and/or HBeAg may be measured by ELISA, e.g. by using the CLIA ELISA Kit (Autobio Diagnostic) according to the manufacturers’ instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA may be measured by qPCR, e.g. as described in the Materials and Methods section. Further methods for evaluating whether a test compound inhibits HBV infection are measuring secretion of HBV DNA by qPCR e.g. as described in WO 2015/173208 or using Northern Blot; in-situ hybridization, or immuno-fluorescence.
[0258] Due to the reduction of SEPT9 levels the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention can be used to inhibit development of or in the treatment of HBV infection. In particular, through the destabilization and reduction of the cccDNA, the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention more efficiently inhibits development of or treats a chronic HBV infection as compared to a compound that only reduces secretion of HBsAg.
[0259] Accordingly, one aspect of the present invention is related to use of the SEPT9 inhibitor, such as the nucleic acid molecule, conjugate compounds or pharmaceutical compositions of the invention to reduce cccDNA and/or pgRNA in an HBV infected individual.
[0260] A further aspect of the invention relates to the use of the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention to inhibit development of or treat a chronic HBV infection.
[0261] A further aspect of the invention relates to the use of the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention to reduce the infectiousness of a HBV infected person. In a particular aspect of the invention, the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention inhibits development of a chronic HBV infection.
[0262] The subject to be treated with the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention (or which prophylactically receives nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the present invention) is preferably a human, more preferably a human patient who is HBsAg positive and/or HBeAg positive, even more preferably a human patient that is HBsAg positive and HBeAg positive.
[0263] Accordingly, the present invention relates to a method of treating a HBV infection, wherein the method comprises administering an effective amount of the SEPT9 inhibitor, such as the nucleic acid molecules, conjugate compounds or pharmaceutical compositions of the invention. The present invention further relates to a method of preventing liver cirrhosis and hepatocellular carcinoma caused by a chronic HBV infection.
[0264] The invention also provides for the use of a SEPT9 inhibitor, such as a nucleic acid molecule, a conjugate compound or a pharmaceutical composition of the invention for the manufacture of a medicament, in particular a medicament for use in the treatment of HBV infection or chronic HBV infection or reduction of the infectiousness of a HBV infected person. In preferred embodiments, the medicament is manufactured in a dosage form for subcutaneous administration.
[0265] The invention also provides for the use of a SEPT9 inhibitor, such as a nucleic acid molecule, a conjugate compound, the pharmaceutical composition of the invention for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration.
[0266] The SEPT9 inhibitor, such as the nucleic acid molecule, conjugate or the pharmaceutical composition of the invention may be used in a combination therapy. For example, nucleic acid molecule, conjugate or the pharmaceutical composition of the invention may be combined with other anti-HBV agents such as interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), adefovir, or other emerging anti-HBV agents such as a HBV RNA replication inhibitor, a HBsAg secretion inhibitor, a HBV capsid inhibitor, an antisense oligomer (e.g. as described in WO2012/145697, WO 2014/179629 and WO2017/216390), a siRNA (e.g. described in WO 2005/014806, WO 2012/024170, WO 2012/2055362, WO 2013/003520, WO 2013/159109, WO 2017/027350 and WO2017/015175), a HBV therapeutic vaccine, a HBV prophylactic vaccine, a HBV antibody therapy (monoclonal or polyclonal), or TLR 2, 3, 7, 8 or 9 agonists for the treatment and/or prophylaxis of HBV.
EMBODIMENTS OF THE INVENTION
[0267] The following embodiments of the present invention may be used in combination with any other embodiments described herein. The definitions and explanations provided herein above, in particular in the sections “SUMMARY OF INVENTION”, “DEFINITIONS” and DETAILED DESCRIPTION OF THE INVENTION” apply mutatis mutandis to the following. [0268] 1. A SEPT9 inhibitor for use in the in the treatment and/or prevention of Hepatitis B virus (HBV) infection. [0269] 2. The SEPT9 inhibitor for the use of embodiment 1, wherein the SEPT9 inhibitor is administered in an effective amount. [0270] 3. The SEPT9 inhibitor for the use of embodiment 1 or 2, wherein the HBV infection is a chronic infection. [0271] 4. The SEPT9 inhibitor for the use of embodiments 1 to 3, wherein the SEPT9 inhibitor is capable of reducing cccDNA and/or pgRNA in an infected cell. [0272] 5. The SEPT9 inhibitor for the use of any one of embodiments 1 to 4, wherein the SEPT9 inhibitor prevents or reduces the association of SEPT9 to cccDNA. [0273] 6. The SEPT9 inhibitor for the use of embodiment 5, wherein said inhibitor is a small molecule that specifically binds to SEPT9 protein, wherein said inhibitor prevents or reduces association of SEPT9 protein to cccDNA. [0274] 7. The SEPT9 inhibitor for the use of any one of embodiments 1 to 6, wherein said inhibitor is a nucleic acid molecule of 12-60 nucleotides in length comprising or consisting of a contiguous nucleotide sequence of at least 12 nucleotides in length which is at least 90% complementary to a mammalian SEPT9 target nucleic acid. [0275] 8. The SEPT9 inhibitor for the use of embodiment 7, which is capable of reducing the level of the mammalian SEPT9 target nucleic acid. [0276] 9. The SEPT9 inhibitor for the use of embodiment 7 or 8, wherein the mammalian SEPT9 target nucleic acid is RNA. [0277] 10. The SEPT9 inhibitor for the use of embodiment 9, wherein the RNA is pre-mRNA. [0278] 11. The SEPT9 inhibitor for the use of any one of embodiments 7 to 10, wherein the nucleic acid molecule is selected from the group consisting of antisense oligonucleotide, siRNA and shRNA. [0279] 12. The SEPT9 inhibitor for the use of embodiment 11, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide or a double stranded siRNA. [0280] 13. The SEPT9 inhibitor for the use of any one of embodiments 7 to 12, wherein the mammalian SEPT9 target nucleic acid SEQ ID NO: 1. [0281] 14. The SEPT9 inhibitor for the use of any one of embodiments 7 to 12, wherein the contiguous nucleotide sequence of the nucleic acid molecule is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. [0282] 15. The SEPT9 inhibitor for the use of any one of embodiments 7 to 12, wherein the contiguous nucleotide sequence of the nucleic acid molecule is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3. [0283] 16. The SEPT9 inhibitor for the use of any one of embodiments 1 to 15, wherein the cccDNA in an HBV infected cell is reduced by at least 50%, such as 60% when compared to a control. [0284] 17. The SEPT9 inhibitor for the use of any one of embodiments 1 to 15, wherein the pgRNA in an HBV infected cell is reduced by at least 50%, such as 60%, when compared to a control [0285] 18. The SEPT9 inhibitor for the use of any one of embodiments 7 to 16, wherein the mammalian SEPT9 target nucleic acid is reduced by at least 50%, such as 60%, when compared to a control. [0286] 19. A nucleic acid molecule of 12 to 60 nucleotides in length which comprises or consists of a contiguous nucleotide sequence of 12 to 30 nucleotides in length wherein the contiguous nucleotide sequence is at least 90% complementary, such as 95%, such as 98%, such as fully complementary, to a mammalian SEPT9 target nucleic acid. [0287] 20. The nucleic acid molecule of embodiment 19, wherein the nucleic acid molecule is chemically produced. [0288] 21. The nucleic acid molecule of embodiment 19 or 20, wherein the mammalian SEPT9 target nucleic acid of SEQ ID NO: 1. [0289] 22. The nucleic acid molecule of embodiment 19 or 20, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2. [0290] 23. The nucleic acid molecule of embodiment 19 or 20, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 and SEQ ID NO: 3. [0291] 24. The nucleic acid molecule of any one of embodiments 19 to 22, wherein the nucleic acid molecule is 12 to 30 nucleotides in length. [0292] 25. The nucleic acid molecule of any one of embodiments 19 to 24, wherein the nucleic acid molecule is a RNAi molecule, such as a double stranded siRNA or shRNA [0293] 26. The nucleic acid molecule of any one of embodiments 19 to 24, wherein the nucleic acid molecule is a single stranded antisense oligonucleotide. [0294] 27. The nucleic acid molecule of any one of embodiments 19 to 26, wherein the contiguous nucleotide sequence is fully complementary to a target nucleic acid sequence selected from Table 4. [0295] 28. The nucleic acid molecule of embodiment 19 to 27, which is capable of hybridizing to a target nucleic acid of SEQ ID NO: 1 and SEQ ID NO: 2 with a ΔG° below -15 kcal. [0296] 29. The nucleic acid molecule of any one of embodiments 19 to 28, wherein the contiguous nucleotide sequence comprises or consists of at least 14 contiguous nucleotides, particularly 15, 16, 17, 18, 19, 20, 21 or 22 contiguous nucleotides. [0297] 30. The nucleic acid molecule of any one of embodiments 19 to 28, wherein the contiguous nucleotide sequence comprises or consists of from 14 to 22 nucleotides. [0298] 31. The nucleic acid molecule of embodiment 30, wherein the contiguous nucleotide sequence comprises or consists of 16 to 20 nucleotides. [0299] 32. The nucleic acid molecule of any one of embodiments 19 to 31, wherein the nucleic acid molecule comprises or consists of 14 to 25 nucleotides in length. [0300] 33. The nucleic acid molecule of embodiment 32, wherein the nucleic acid molecule comprises or consists of at least one oligonucleotide strand of 16 to 22 nucleotides in length. [0301] 34. The nucleic acid molecule of any one of embodiment 19 to 33, wherein the contiguous nucleotide sequence is fully complementary to a target sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6 and 7. [0302] 35. The nucleic acid molecule of any one of embodiments 19 to 34, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the mammalian SEPT9 target nucleic acid it is complementary to. [0303] 36. The nucleic acid molecule of embodiment 35, wherein the contiguous nucleotide sequence has one mismatch compared to the mammalian SEPT9 target nucleic acid. [0304] 37. The nucleic acid molecule of embodiment 35, wherein the contiguous nucleotide sequence has two mismatches compared to the mammalian SEPT9 target nucleic acid. [0305] 38. The nucleic acid molecule of embodiment 35, wherein the contiguous nucleotide sequence is fully complementary to mammalian SEPT9 target nucleic acid. [0306] 39. The nucleic acid molecule of any one of embodiments 19 to 38, comprising one or more modified nucleosides. [0307] 40. The nucleic acid molecule of embodiment 39, wherein the one or more modified nucleosides are high-affinity modified nucleosides. [0308] 41. The nucleic acid molecule of embodiment 39 or 40, wherein the one or more modified nucleosides are 2′ sugar modified nucleosides. [0309] 42. The nucleic acid molecule of embodiment 41, wherein the one or more 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, 2′-fluoro-ANA and LNA nucleosides. [0310] 43. The nucleic acid molecule of any one of embodiments 39 to 42, wherein the one or more modified nucleosides are LNA nucleosides. [0311] 44. The nucleic acid molecule of embodiment 43, wherein the modified LNA nucleosides are selected from the group consisting of oxy-LNA, amino-LNA, thio-LNA, cET, and ENA. [0312] 45. The nucleic acid molecule of embodiment 43 or 44, wherein the modified LNA nucleosides are oxy-LNA with the following 2′-4′ bridge -O-CH.sub.2-. [0313] 46. The nucleic acid molecule of embodiment 45, wherein the oxy-LNA is beta-D-oxy-LNA. [0314] 47. The nucleic acid molecule of embodiment 43 or 44, wherein the modified LNA nucleosides are cET with the following 2′-4′ bridge -O-CH(CH.sub.3)-. [0315] 48. The nucleic acid molecule of embodiment 47, wherein the cET is (S)cET, i.e. 6′(S)methyl-beta-D-oxy-LNA. [0316] 49. The nucleic acid molecule of embodiment 43 or 44, wherein the LNA is ENA, with the following 2′ - 4′ bridge -O-CH.sub.2-CH.sub.2-. [0317] 50. The nucleic acid molecule of any one of embodiments 19 to 49, wherein the nucleic acid molecule comprises at least one modified internucleoside linkage. [0318] 51. The nucleic acid molecule of embodiment 50, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage. [0319] 52. The nucleic acid molecule of any one of embodiments 19 to 51, wherein the nucleic acid molecule is an antisense oligonucleotide capable of recruiting RNase H. [0320] 53. The nucleic acid molecule of embodiment 52, wherein the antisense oligonucleotide or the contiguous nucleotide sequence is a gapmer. [0321] 54. The nucleic acid molecule of embodiment 53, wherein the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5′-F-G-F′-3′, where region F and F′ independently comprise or consist of 1- 4 2′ sugar modified nucleosides and G is a region between 6 and 18 nucleosides which are capable of recruiting RNase H. [0322] 55. The nucleic acid molecule of embodiment 54, wherein the 1- 4 2′ sugar modified nucleosides are independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA and LNA nucleosides. [0323] 56. The nucleic acid molecule of embodiment 54 or 55, wherein one or more of the 1- 4 2′ sugar modified nucleosides in region F and F′ are LNA nucleosides. [0324] 57. The nucleic acid molecule of embodiment 56, wherein all the 1- 4 2′ sugar modified nucleosides in region F and F′ are LNA nucleosides. [0325] 58. The nucleic acid molecule of any one of embodiments 55 to 57, wherein the LNA nucleosides are selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L-amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA. [0326] 59. The nucleic acid molecule of any one of embodiments 55 to 58, wherein region F and F′ consist of identical LNA nucleosides. [0327] 60. The nucleic acid molecule of any one of embodiments 55 to 59, wherein all the 2′ sugar modified nucleosides in region F and F′ are oxy-LNA nucleosides. [0328] 61. The nucleic acid molecule of any one of embodiments 54 to 60, wherein the nucleosides in region G are DNA nucleosides. [0329] 62. The nucleic acid molecule of embodiment 61, wherein region G consists of at least 75% DNA nucleosides. [0330] 63. The nucleic acid molecule of embodiment 62, where all the nucleosides in region G are DNA nucleosides. [0331] 64. A conjugate compound comprising a nucleic acid molecule according to any one of embodiments 19 to 63, and at least one conjugate moiety covalently attached to said nucleic acid molecule. [0332] 65. The conjugate compound of embodiment 64, wherein the nucleic acid molecule is a double stranded siRNA and the conjugate moiety is covalently attached to the sense strand of the siRNA. [0333] 66. The conjugate compound of embodiment 64 or 65, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof. [0334] 67. The conjugate compound of any one of embodiments 64 to 66, wherein the conjugate moiety is capable of binding to the asialoglycoprotein receptor. [0335] 68. The conjugate compound of embodiment 67, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. [0336] 69. The conjugate compound of embodiment 68, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GaINAc). [0337] 70. The conjugate compound of embodiment 68 or 69, wherein the conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent with respect to asialoglycoprotein receptor targeting moieties. [0338] 71. The conjugate compound of embodiment 70, wherein the conjugate moiety consists of two to four terminal GaINAc moieties and a spacer linking each GaINAc moiety to a brancher molecule that can be conjugated to the antisense compound. [0339] 72. The conjugate compound of embodiment 71, wherein the spacer is a PEG spacer. [0340] 73. The conjugate compound of any one of embodiments 67 to 72, wherein the conjugate moiety is a tri-valent N-acetylgalactosamine (GaINAc) moiety. [0341] 74. The conjugate compound of any one of embodiments 67 to 73, wherein the conjugate moiety is selected from one of the trivalent GaINAc moieties in
[0364] The invention will now be illustrated by the following examples which have no limiting character.
EXAMPLES
Materials and Methods
siRNA Sequences and Compounds
[0365] TABLE-US-00005 Human SEPT9 sequences targeted by the individual components of the siRNA pool SEQ ID NO: SEPT9 target sequence 5′-3′ Position on SEQ ID NO:1 Exon 4 CAGAGCGGCUUGGGUAAAU 206850-206876 5 5 CGCACGAUAUUGAGGAGAA 20679-206983+ 207671-207684 Spanning exon 5 and 6 6 GAGAUGAUCCCAUUUGCUG 212412-212430 10 7 GCAUCCACUUCGAGGCGUA 217990-218008 12
[0366] The pool of siRNA (ON-TARGETplus SMART pool siRNA Cat. No. LU-006373-00-0005, Dharmacon) contains four individual siRNA molecules targeting the sequences listed in the above table.
TABLE-US-00006 Control compounds Name Supplier Order number Sequence 5′ to 3′ sense strand SEQ ID NO Non-targeting negative control siRNA#1 Dharmacon #D-001810-01-05 UGGUUUACAUGUCGACUAA 8 Hbx positive control GA life science Custom made GCACUUCGCUUCACCUCUG 9
Oligonucleotide Synthesis
[0367] Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.
[0368] Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 .Math.mol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16 hours at 60° C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.
Elongation of the Oligonucleotide
[0369] The coupling of β-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5′-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.
[0370] For post solid phase synthesis conjugation a commercially available C6 aminolinker phorphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.
Purification by RP-HPLC
[0371] The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10 .Math.m 150 × 10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.
Abbreviations
[0372] DCI: 4,5-Dicyanoimidazole [0373] DCM: Dichloromethane [0374] DMF: Dimethylformamide [0375] DMT: 4,4′-Dimethoxytrityl [0376] THF: Tetrahydrofurane [0377] Bz: Benzoyl [0378] Ibu: Isobutyryl [0379] RP-HPLC: Reverse phase high performance liquid chromatography
T.SUB.m Assay
[0380] Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2 × T.sub.m-buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM Naphosphate, pH 7.0). The solution is heated to 95° C. for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (T.sub.m) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20° C. to 95° C. and then down to 25° C., recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T.sub.m.
[0381] Clonal growth medium (dHCGM). dHCGM is a DMEM medium containing 100 U/ml Penicillin, 100 .Math.g/ml Streptomycin, 20 mM Hepes, 44 mM NaHCO.sub.3, 15 .Math.g/ml L-proline, 0.25 .Math.g/ml insulin, 50 nM Dexamethazone, 5 ng/ml EGF, 0.1 mM Asc-2P, 2% DMSO and 10% FBS (Ishida et al., 2015). Cells were cultured at 37° C. incubator in a humidified atmosphere with 5% CO2. Culture medium was replaced 24 h post-plating and every 2 days until harvest.
ASOs Sequences and Compounds
[0382] TABLE-US-00007 list of oligonucleotide motif sequences of the invention (indicated by SEQ ID NO), as well as specific oligonucleotide compounds of the invention (indicated by CMP ID NO) designed based on the motif sequence SEQ ID NO CMP ID NO Oligonucleotide Compound 17 17_1 AGacaagtagagGAGT 18 18_1 CTggtactcgtggtCA The heading “Oligonucleotide compound” in the table represents specific designs of a motif sequence. Capital letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C are 5-methyl cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages (CMP ID NO = Compound ID NO)
HBV Infected PHH Cells
[0383] Fresh primary human hepatocytes (PHH) were provided by PhoenixBio, Higashi-Hiroshima City, Japan (PXB-cells also described in Ishida et al 2015 Am J Pathol. 185(5):1275-85) in 70,000 cells/well in 96-well plate format.
[0384] Upon arrival the PHH were infected with an MOI of 2GE using HepG2 2.2.15-derived HBV (batch Z12) by incubating the PHH cells with HBV in 4% (v/v) PEG in PHH medium for 16 hours. The cells were then washed three times with PBS and cultured a humidified atmosphere with 5% CO.sub.2 in fresh PHH medium consisting of DMEM (GIBCO, Cat# 21885) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (GIBCO, Cat# 10082), 2% (v/v) DMSO, 1% (v/v) Penicillin/Streptomycin (GIBCO, Cat# 15140-148), 20 mM HEPES (GIBCO, Cat# 15630-080), 44 mM NaHCO.sub.3 (Wako, Cat# 195-14515), 15 ug/ml L-proline (MP-Biomedicals, Cat# 0219472825), 0.25 .Math.g/ml Insulin (Sigma, Cat# I1882), 50 nM Dexamethasone (Sigma, Cat# D8893), 5 ng/ml EGF (Sigma, Cat# E9644), and 0.1 mM L-Ascorbic acid 2-phosphate (Wako, Cat# 013-12061). Cells were cultured at 37° C. incubator in a humidified atmosphere with 5% CO.sub.2. Culture medium was replaced 24 hours post-plating and three times a week until harvest.
siRNA Transfection
[0385] Four days post-infection the cells were transfected with the SEPT9 siRNA pool (see Table 5A) in triplicates. No drug controls (NDC), negative control siRNA and HBx siRNA were included as controls (See Table 5B above).
[0386] Per well a transfection mixture was prepared with 2 .Math.l of either negative control siRNA (stock concentration 1 .Math.M), SEPT9 siRNA pool (stock concentration 1 uM), HBx control siRNA (stock concentration 0.12 .Math.M) or H2O (NDC) with 18.2 .Math.l OptiMEM (Thermo Fisher Scientific Reduced Serum media) and 0.6 .Math.l Lipofectamine® RNAiMAX Transfection Reagent (Thermofisher Scientific catalog No. 13778). The transfection mixture was mixed and incubated at room temperature 5 minutes prior to transfection. Prior to transfection the medium was removed from the PHH cells and replaced by 100 .Math.l/well William’s E Medium + GlutaMAX™ (Gibco, #32551) supplemented with HepaRG supplement without P/S (Biopredic International, #ADD711C). 20 .Math.l of transfection mix was added to each well yielding a final concentration of 16 nM for the negative control siRNA or SEPT9 siRNA pool, or 1.92 nM for the HBx control siRNA and the plates gently rocked before placing into the incubator. The medium was replaced with PHH medium after 6 hours. The siRNA treatment was repeated on day 6 post-infection as described above. On day 8 post-infection the supernatants were harvested and stored at -20° C. HBsAg and HBeAg can be determined from the supernatants if desired.
LNA Treatment
[0387] Two LNA master mix plates from a 500 .Math.M stock were prepared. For LNA treatment at a final concentration of 25 .Math.M, 200 uL of a 500 .Math.M stock LNA is prepared in the first master mix plate. A second master mix plate including SEPT9 LNAs at 100 .Math.M was prepared for LNA treatment at a final concentration of 5 .Math.M, mixing 40 .Math.L of each SEPT9 LNA at 500 .Math.M and 160 .Math.L of PBS.
[0388] Four days post-infection the cells were treated with SEPT9 LNAs at final concentration of 25 .Math.M (see Table 6) in either duplicate or triplicates or with PBS as no drug control (NDC). Prior to the LNA treatment, the old medium was removed from the cells and replaced by 114 .Math.l/well of fresh PHH medium. Per well, 6 .Math.L of each SEPT9 LNA either at 500 uM or PBS as NDC were added to the 114 .Math.L PHH medium. The same treatment was repeted 3 times at day 4, 11 and 18 post-infection. Cell culture medium was changed with fresh one every three days at day 7, 14 and 21 post infection.
[0389] For the quantification of cccDNA, the infected cells were treated with entecavir (ETV) at 10 nM final concentration from day 7 to day 21 post infection. Fresh ETV treatment was repeated 5 times at day 7, 11, 14, 18 and 21 post infection. This ETV treatment was used to inhibit the synthesis of new viral DNA intermediates and to detect specifically HBV cccDNA sequences.
Measurement of HBV Antigen Expression
[0390] HBV antigen expression and secretion can be measured in the collected supernatants if desired. The HBV propagation parameters, HBsAg and HBeAg levels, are measured using CLIA ELISA Kits (Autobio Diagnostic #CL0310-2, #CL0312-2), according to the manufacturer’s protocol. Briefly, 25 .Math.L of supernatant per well is transferred to the respective antibody coated microtiter plate and 25 .Math.L of enzyme conjugate reagent is added. The plate is incubated for 60 min on a shaker at room temperature before the wells are washed five times with washing buffer using an automatic washer. 25 .Math.L of substrate A and B were added to each well. The plates are incubated on a shaker for 10 min at room temperature before luminescence is measured using an EnVision® luminescence reader (Perkin Elmer).
Cell Viability Measurements
[0391] The cell viability was measured on the supernatant free cells by the Cell Counting Kit - 8 (CCK8 from Sigma Aldrich, #96992). For the measurement the CCK8 reagent was diluted 1:10 in normal culture medium and 100 .Math.l/well added to the cells. After 1 h incubation in the incubator 80 .Math.l of the supernatants were transferred to a clear flat bottom 96 well plate, and the absorbance at 450 nm was read using a microplate reader (Tecan). Absorbance values were normalized to the NDC which was set at 100% to calculate the relative cell viabilities.
[0392] Cell viability measurements are used to confirm that any reduction in the viral parameters is not the cause of cell death, the closer the value is to 100% the lower the toxicity. LNA treatment giving cellular viability values equal or below 20% to the NDC were excluded from further analysis.
Real-Time PCR for Measuring SEPT9 mRNA Expression and the Viral Parameters pgRNA, cccDNA and HBV DNA Quantification
[0393] Following cell viability determination the cells were washed with PBS once. For siRNA treatment cells were lysed with 50 .Math.l/well lysis solution from the TaqMan® Gene Expression Cells-to-CT™ Kit (Thermo Fisher Scientific, #AM 1729) and stored at -80° C. For cells treated with LNAs, total RNA was extracted using a MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche, #05467535001) according to the manufacturer’s protocol. For quantification of SEPT9 RNA and viral pgRNA levels and the normalization control, GUS B, the TaqMan® RNA-to-Ct™ 1-Step Kit (Life Technologies, #4392656) has been used. For each reaction 2 or 4 .Math.l of cell lysate, 0.5 .Math.l 20x SEPT9 Taqman primer/probe, 0.5 .Math.l 20x GUS B Taqman primer/probe, 5 .Math.l 2x TaqMan® RT-PCR Mix, 0.25 .Math.l 40x TaqMan® RT Enzyme Mix, and 1.75 .Math.l DEPC-treated water is used. Primers used for GUS B RNA and target mRNA quantification are listed in Table 8. Technical replicates are run for each sample and minus RT controls included to evaluate potential amplification due to DNA present.
[0394] The target mRNA expression levels, as well as the viral pgRNA, were quantified in technical duplicates by RT-qPCR using a QuantStudio 12 K Flex (Applied Biosystems) with the following protocol, 48° C. for 15 min, 95° C. for 10 min, then 40 cycles with 95° C. for 15 seconds, and 60° C. for 60 seconds.
[0395] SEPT9 mRNA and pgRNA expression levels were analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene GUS B and non-transfected cells. The expression levels in siRNA-treated cells are presented as % of the average no-drug control samples (i.e. the lower the value the larger the inhibition/reduction). In LNA-treated cells, the expression levels are presented as inhibitory effect compared to non-treated cells (NDC) set as 100% and is expressed as a percentage of the mean + SD from two independent biological replicates are measured. For cccDNA quantification, total DNA was extracted from HBV infected Primary Human Hepatocytes treated with siRNA or with LNAs . Prior to the cccDNA qPCR analysis, a fraction of the siRNA treated cell lysate was digested with T5 enzyme (10 U/500 ng DNA; New England Biolabs, #M0363L) to remove viral DNA intermediates and to quantify the cccDNA molecule only. T5 digestion was done at 37° C. for 30 min. T5 digestion was not applied on LNA treated cell lysates to avoid qPCR interference in the assay To remove HBV DNA intermediates and quantify cccDNA level in LNA treated cells, cells were treated with entecavir (10 nM) for 3 weeks as described in LNA treatment section
[0396] For the quantification of cccDNA in siRNA-treated cells, each reaction mix per well contained 2 .Math.l T5-digested cell lysate, 0.5 .Math.l 20x cccDNA_DANDRI Taqman primer/probe (Life Technologies, custom #AI1RW7N, FAM-dye listed in the Table below), 5 .Math.l TaqMan® Fast Advanced Master Mix (Applied Biosystems, #4444557) and 2.5 .Math.l DEPC-treated water were used. Technical triplicates were run for each sample.
TABLE-US-00008 Primers for siRNA-treated cells Primer name Sequence SEQ ID CCCDNA_DANDRI_F CCGTGTGCACTTCGCTTCA 10 CCCDNA_DANDRI_R GCACAGCTTGGAGGCTTGA 11 CCCDNA_DANDRI_M 5′-[6FAM]CATGGAGACCACCGTGAACGCCC[BHQ1]-3′ 12 Primers for LNA-treated cells CCCDNA_Fwd 5′- CGTCTGTGCCTTCTCATCTGC-3′ 13 CCCDNA_Rev 5′- GCACAGCTTGGAGGCTTGAA -3′ 14 Mito_Fwd CCGTCTGAACTATCCTGCCC 15 Mito_Rev GCCGTAGTCGGTGTACTCGT 16
[0397] For the quantification of cccDNA in LNA-treated cells by qPCR, a master mix of 16 uL/well, with 10 ul 2x Fast SYBR™ Green Master Mix (Applied Biosystems, # 4385614), 2 ul cccDNA Primer Mix (1 uM of each forward and reverse), and 4 ul nuclease-free water per well is prepared. A master mix with 10 ul 2x Fast SYBR™ Green Master Mix (Applied Biosystems, # 4385614), 2 ul mitochondrial genome primer mix (1 uM of each forward and reverse), and 4 ul nuclease-free water per well is also prepared for normalization of the cccDNA.
[0398] For quantification of intracellular HBV DNA and the normalization control, human hemoglobin beta (HBB), each reaction mix contained 2 .Math.l undigested cell lysate, 0.5 .Math.l 20x HBV Taqman primer/probe (Life Technologies, #Pa03453406_s1, FAM-dye), 0.5 .Math.l 20x HBB Taqman primer/probe (Life Technologies, #Hs00758889_s1, VIC-dye), 5 .Math.l TaqMan® Fast Advanced Master Mix (Applied Biosystems, #4444557) and 2 .Math.l DEPC-treated water were used. Technical triplicates were run for each sample.
[0399] The qPCR was run on the QuantStudio™ K12 Flex with standard settings for the fast heating block (95° C. for 20 seconds, then 40 cycles with 95° C. for 1 second and 60 C for 20 seconds).
[0400] Any outliers were removed from the data set by excluding values with more than 0.9 difference to the median Ct of all the three biological replicates for each treatment condition. Fold changes of cccDNA (siRNA and LNA treated cells) and total HBV DNA (only siRNA treated cells) were determined from the Ct values via the 2.sup.-ddCT method and normalized to the HBB or mitochondrial DNA as housekeeping genes. For siRNA-treated cells, expression levels are presented as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction). For LNA treated cells, the inhibitory effect on cccDNA was expressed as a percentage of the mean +/-SD from three independent biological replicates compared to non-treated cells (NDC) set as 100%.
TABLE-US-00009 GUS B and SEPT9 mRNA qPCR primers (Thermo Fisher Scientific) SEPT9 (FAM): Hs00246396_m1 Housekeeping gene primers GUS B (VIC): Hs00939627_m1 pgRNA (FAM): AILIKX5
Example 1: Measurement of the Reduction of SEPT9 mRNA, HBV Intracellular DNA and cccDNA in HBV Infected PHH Cells Resulting From siRNA Treatment
[0401] In the following experiment, the effect of SEPT9 knock-down on the HBV parameters, HBV DNA and cccDNA, was tested.
[0402] HBV infected PHH cells were treated with the pool of siRNAs from Dharmacon (LU-006373-00-0005) as described in the Materials and Methods section “siRNA transfection”.
[0403] Following the 4 days-treatment, SEPT9 mRNA, cccDNA and intracellular HBV DNA were measured by qPCR as described in the Materials and Methods section “Real-time PCR for measuring SEPT9 mRNA expression and the viral parameters pgRNA, cccDNA, and HBV DNA”.
[0404] The results are shown in Table 9 as % of the average no drug control samples (i.e. the lower the value the larger the inhibition/reduction).
TABLE-US-00010 Effect on HBV parameters following knockdown of SEPT9 with pool of siRNA. Values are given as the average of biological and technical triplicates Treatment SEPT9 mRNA HBV intracellular DNA cccDNA Mean SD Mean SD Mean SD SEPT9 siRNA 17 3 50 16 34 2 HBx positive control ND ND 53 35 65 50 siRNA negative control ND ND 123 16 71 4 ND= not determined
[0405] From this it can be seen that the SEPT9 siRNA pool is capable of reducing SEPT9 mRNA, cccDNA as well as HBV DNA quite efficiently. The positive control reduced intracellular HBV DNA as expected but had no effect on cccDNA when compared to the negative control.
Example 2: Measurement of the Reduction of SEPT9 mRNA, HBV Intracellular pgRNA and cccDNA in HBV Infected PHH Cells Resulting From LNA Treatment
[0406] In the following experiment, the effect of SEPT9 knock-down on the HBV parameters, HBV DNA and cccDNA, was tested.
[0407] HBV infected PHH cells were treated with SEPT9 naked LNAs (see Table 6) as described in the Materials and Methods section “LNA treatment”.
[0408] Following 21 days-treatment, SEPT9 mRNA, cccDNA, and intracellular HBV pgRNA were measured by qPCR as described in the Materials and Methods section “Real-time PCR for measuring SEPT9 mRNA expression and the viral parameters pgRNA, cccDNA, and HBV DNA”. The results are shown in Table 10 as inhibitory effect compared to non-treated cells (NDC) set as 100% and are expressed as a percentage of the mean + SD from two independent biological replicates are measured.
TABLE-US-00011 Effect on HBV parameters following knockdown of SEPT9 with naked LNAs. Values are given as the average of either two or three biological replicates. Data show the effect with LNA at a final concentration of 25 mM CMP ID SEPTIN9 mRNA pgRNA cccDNA Mean % SD Mean % SD Mean % SD 17_1 24.05% 1.34% 87.91% 2.98% 66.20% 5.62% 18_1 52.01% 3.29% 29.25% 3.70% 69.34% 9.30% NDC 100.00% 0.00% 98.73% 1.27% 100.00% 0.00% *Non-treated cells
[0409] From this, it can be seen that SEPT9 LNAs are capable of sensibly reducing SEPT9 mRNA expression resulting in a quite efficient reduction in expression level for both pgRNA and cccDNA.