COMPOSITION FOR TREATING OR PREVENTING COLORECTAL DISEASE CONTAINING CONSTRUCT FOR EXPRESSION OF P8 PROTEIN DERIVED FROM LACTIC ACID BACTERIA
20230183301 · 2023-06-15
Inventors
Cpc classification
C12N2800/22
CHEMISTRY; METALLURGY
A61K38/16
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61P1/00
HUMAN NECESSITIES
C12N15/70
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to a construct for expression of P8 protein derived from lactic acid bacteria, and a composition for treating or preventing colorectal disease containing the same. The P8 protein expression construct of the present disclosure may endogenously express P8 protein in cancer cells, thereby significantly enhancing the anticancer effect of the P8 protein through cell-cycle arrest activity.
Claims
1. A P8 protein expression construct comprising: (a) a promoter; and (b) a P8 protein-encoding nucleotide sequence operatively linked to the promoter.
2. The P8 protein expression construct of claim 1, wherein the P8 protein-encoding nucleotide sequence is the nucleotide sequence of SEQ ID NO: 3.
3. The P8 protein expression construct of claim 1, wherein the promoter is a promoter for expression in eukaryotic cells.
4. The P8 protein expression construct of claim 1, wherein the expression construct is a plasmid vector- or viral vector-based expression construct.
5. A pharmaceutical composition for treating or preventing colorectal disease, the pharmaceutical composition containing: (a) a therapeutically effective amount of a P8 protein expression construct comprising a P8 protein-encoding nucleotide sequence operatively linked to a promoter; and (b) a pharmaceutically acceptable carrier.
6. The pharmaceutical composition of claim 5, wherein the P8 protein-encoding nucleotide sequence is the nucleotide sequence of SEQ ID NO: 3.
7. The pharmaceutical composition of claim 5, wherein the promoter is a promoter for expression in eukaryotic cells.
8. The pharmaceutical composition of claim 5, wherein the expression construct is a plasmid vector- or viral vector-based expression construct.
9. The pharmaceutical composition of claim 5, wherein the colorectal disease is any one or more selected from the group consisting of colorectal cancer, colon polyps, colitis, ischemic bowel disease, dysentery, intestinal vascular dysplasia, diverticulosis, irritable bowel syndrome, and Crohn's disease.
Description
DESCRIPTION OF DRAWINGS
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
BEST MODE
[0045] Specific examples described in the present specification are intended to represent exemplary embodiments or examples of the present disclosure, and the scope of the present disclosure is not limited thereby. It will be apparent to those skilled in the art that variations and other uses of the present disclosure do not depart from the scope of the present disclosure as defined in the appended claims of the present specification.
Examples
[0046] Experimental Methods
[0047] 1. Bacterial Strains and Culture Thereof
[0048] P8 protein was obtained from a Lactobacillus rhamnosus (LR) KCTC 12202BP areain, which was isolated from the human feces. LR is a probiotic and was obtained from the culture collection maintained at Cell Biotech Co., Ltd (Gimpo, Korea). A pCI-neo expression vector was used as a delivery vehicle for endogenous expression of P8 protein. Cells were cultured for 18 to 24 hours at 37° C. in De Man, Rogosa and Sharpe agar (MRS) broth (Difco, Detroit, Mich., USA). Escherichia coli (E. coli) strains DH5a and C41 (DE3) (Novagen, Madison, Wis., USA) were cultured in Luria-Bertani (LB) broth (Difco) at 37° C. for 18 to 24 hours.
TABLE-US-00001 TABLE 1 Target Codon-optimized Size cells/Mapping sequences (bp) Original P8 atggcaacagtagatcctga 222 protein aaagacattgtttctcgatg aaccaatgaacaaggtattt gactggagcaacagcgaagc acctgtacgtgatgcgctgt gggattattacatggaaaag aacagccgtgataccatcaa gactgaagaagaaatgaaac cagtcctagacatgtccgac gatgaggtcaaagccctagc agaaaaggttctcaagaagt aa (SEQ ID NO: 1) E. coli catatgagaggatcgcatca cells/ ccatcaccatcac-attacg 6XHis-TEV-P8 atatcccaacgaccgaaaac (NdeI/ ctgtattttcagggatcc-a EcoRI) tggcaacagtagatcctgaa aagacattgtttctcgatga accaatgaacaaggtatttg actggagcaacagcgaagca cctgtccgtgatgcgctgtg ggattattacatggaaaaga acagccgtgatactatcaag actgaagaagaaatgaaacc agtcctagacatgtccgacg acgaggtcaaagccctagca gaaaaggttctcaagaagta ggaattc (SEQ ID NO: 2) DLD-1 gaattcatggctactgtcga cells/ cccagaaaaaaccctgttct P8 (EcoRI/ tggacgaaccaatgaataaa NotI) gtctttgattggtccaactc tgaggccccggtacgggatg cgttgtgggattactacatg gaaaaaaattccagggatac cattaaaacagaagaagaaa tgaagccagttctggacatg agtgacgacgaagtgaaagc cctcgcggaaaaagttctca agaaataggcggccgc (SEQ ID NO: 3)
[0049] The underlined portions in the sequences shown in Table 1 above are restriction enzyme cleavage sites.
[0050] 2. Construction of Codon-Optimized His-Tagged P8 Protein, and Expression and Purification in E. coli
[0051] In order to express P8 protein in E. coli cells, the codon-optimized P8 protein gene harboring a hexa-histidine (6×His) tag and a Tobacco Etch Virus (TEV) protease cleavage site (305 bp) was synthesized by Cosmogenetech, Inc. (Seoul, Korea) (Table 1). The P8 protein was expressed using expression vector pET-28a. The P8 construct was transformed into E. coli strain C41 (DE3), which was cultured in M9 medium until the O.D. value reached 0.6. Overexpression of selenomethionine-substituted (SeMet) P8 protein was initiated by addition of 0.5 mM IPTG for 4 hours. Cells were harvested and then re-suspended in 20 mM HEPES (pH 7.5)/150 mM NaCl. After sonication, the cell supernatant was obtained by centrifugation. The P8 protein was purified by binding to Ni2+-NTA agarose (Qiagen, Valencia, Calif.), followed by washing with 20 mM HEPES (pH 7.5)/150 mM NaCl/20 mM imidazole. The 6×His tag was removed by FEY protease in the presence of 1 mM DTT. The homogeneity of the SeMet P8 protein was checked by size exclusion chromatography (HiLoad 26/60 Superdex 200 pg (GE Healthcare) equilibrated with 20 mM HEPES (pH 7.5)/150 mM NaCl).
[0052] 3. Expression of Codon-Optimized P8 Protein in DLD-1 Cells
[0053] The P8 protein gene codon for expression in mammalian cells was synthesized by Cosmogenetech, Inc. The P8 DNA fragment (236 bp) was digested with EcoRI/NotI and then cloned into the pCI-neo vector via the EcoRI/NotI site (Promega, Madison, Wis.) (Table 1). The resulting construct was then transformed into E. coli DH5a for amplification thereof. All restriction enzymes used were purchased from New England BioLabs (Ipswich, Mass.). Colorectal cancer cells (DLD-1) were transfected with plasmid DNA (pCI-neo and pCI-neo-p8). Before transfection, DLD-1 cells were plated in 6-well plates at a density of 7×10.sup.5 cells per well. After incubating overnight, the cells were transfected using Lipofectamine 3000 (Invitrogen) in accordance with the manufacturer's instructions. The transfected cells were selected in RPMI 1640 medium containing antibiotics (G-418) (Sigma, St. Louis, Mo., USA).
[0054] 4. Cell Culture
[0055] Human colorectal cancer (CRC) cell line DLD-1 was purchased from the Korean Cell Line Bank (KCLB; Seoul, Korea) and maintained under 5% CO.sub.2/37° C. in RPMI-1640 medium (Gibco, Grand Island, N.Y.) containing 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco).
[0056] 5. Cell Proliferation Assay
[0057] DLD-1 cell lines (pCI-neo (EV) and pCI-neo-P8 (P8)) were seeded in 96-well plates (1×10.sup.3 cells per well) and incubated at 37° C. After 72 hours, cell viability was determined by an MTT assay (Cell Counting Kit-8; Dojindo Laboratories, Tokyo, Japan). Absorbance was measured using a multifunctional microplate reader (SpectraMax M5; Molecular Devices, Sunnyvale, Calif., USA).
[0058] 6. Wound Healing Assay
[0059] DLD-1 cell lines (EV and P8) were seeded on 6-well plates (5×10.sup.6 cells per well). At 24 hours after seeding, the middle of the plate was scratched using a pipette tip. Then, the cells were washed three times with phosphate buffered saline (PBS) and incubated at 37° C. for 3 days. Wound healing was observed daily under a microscope (Nikon, Tokyo, Japan).
[0060] 7. ELISA Analysis
[0061] The optimized ELISA procedure was performed as follows: 96-well polystyrene plates (SPL Life Sciences, Pocheon-si, Gyeonggi-do, Korea) were coated overnight at 4° C. with 100 μL diluted anti-P8 IgG (1:5500) (poly clonal-rabbit; Young In Frontier Co., Ltd, Seoul, Korea) in ELISA coating buffer (Bethyl Laboratories, Montgomery, Tex., USA). Next, the wells were washed twice with 300 μL wash buffer (1× Tris-Buffered-Saline Buffer (TBS) with 0.05% Tween-20 (TBS-T)), followed by blocking with 300 μL blocking buffer (1×PBS and 5% Fetal Bovine Serum (FBS; Gibco)) for 1 hour at room temperature. Prior to addition of protein samples (nucleus extracts: 100 μL), the wells were washed three times with 300 μL wash buffer, followed by 150 min of incubation at mom temperature. After sample binding, the wells were washed four times with 300 μL wash buffer (TBS-T), followed by addition of 100 μL anti-P8 IgG-biotin (Young In Frontier Co., Ltd) in 1×PBS/5% FBS for 90 minutes at mom temperature. Next, the wells were washed four times with 300 μL wash buffer (TBS-T), followed by addition of 100 μL streptavidin-HRP (166 pg/mL) (Young In Frontier Co., Ltd) in 1×PBS/2.5% FBS for 30 minutes at mom temperature. Next, the wells were washed four times with 300 μL wash buffer (TBS-T), followed by color development after addition of 100 μL tetramethylbenzidine (TMB) one solution (Bethyl Laboratories; Montgomery, Tex., USA) for 20 minutes at room temperature in the dark. The reaction was stopped by addition of 50 μL stop buffer (Bethyl Laboratories). Absorbance was measured using a multifunctional microplate reader (SpectraMax M5; Molecular Devices). To construct a standard curve for P8 protein, mouse sera (2-fold dilutions: 1000 ng/mL to 15.625 ng/mL) was assayed in triplicate. Each sample was assayed at two different dilutions and run in duplicate. Results for endogenous P8 protein are reported as nanograms/milliliter (ng/mL).
[0062] 8. Western Blot Analysis
[0063] DLD-1 cells were lysed in RIPA lysis buffer containing a protease inhibitor cocktail (Roche). Next, proteins (40 μg total) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane (Amersham Bioscience, Piscataway, N.J., USA). The blotted membranes were blocked in 5% skimmed milk/T-TBS and then incubated overnight at 4° C. with appropriate primary antibodies (Cell Signaling Technology, Danvers, Mass., USA); all antibodies were diluted 1:1000. The membranes were washed three times (each for 15 min) with T-TBS and then blocked with 5% skimmed milk/T-TBS. Then, the membranes were incubated with an HRP-linked secondary antibody (Cell Signaling Technology) at 4° C. for 1 hour. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. Protein bands were detected using an enhanced chemiluminescence kit (Millipore, Billerica, Mass., USA), followed by autoradiography using a Chemi-Doc™ Touch Imaging System (Bio-Rad Laboratories, CA, USA).
[0064] 9. Immunocytochemistry Using ImageXpress® Micro Confocal Microscopy
[0065] Colorectal cancer cells (DLD-1) were seeded onto coverslips placed in 6-well plates. After 24 hours, P8 protein (0 to 40 μM) was added to each well for additional 72 hours. Cells were fixed in 3% paraformaldehyde (PFA) at room temperature for 15 minutes and then washed three times in PBS. The cells were permeabilized by incubation in 0.2% Triton X-100/PBS for 2 min and then washed. To reduce background signals, the cells were blocked with 4% bovine serum albumin (BSA) in PBS for 30 minutes. Next, the cells were incubated with a rabbit polyclonal anti-P8 antibody (Young In Frontier Co., Ltd) overnight at 4° C. or with a mouse monoclonal anti-EpCAM antibody (Cell Signaling Technology) at 4° C. for 2 hours. Protein localization was visualized using FITC-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.; West Grove, Pa., USA) and Alexa Fluor 568-conjugated donkey anti-mouse IgG (Invitrogen). For nuclear staining, the cells were incubated with 5 μg/mL Hoechst 33,258 (Sigma) at room temperature for 1 hour, washed three times in PBS, and then mounted. Images were obtained under an ImageXpress® Micro Confocal microscope (Molecular Devices).
[0066] 10. Flow Cytometry Assay
[0067] To investigate the effects of endogenous P8 protein on the cell cycle phase distribution, the cells were analyzed by flow cytometry. DLD-1 cell lines (EV and P8) were plated and incubated for 48 hours. The DLD-1 cells were removed from culture dishes by trypsinization, collected by centrifugation, and then washed with PBS. 5×10.sup.5 cells from each sample were fixed in ice-cold 70% ethanol and incubated on ice for at least 30 minutes. Then, the cells were washed in PBS, and re-suspended in 400 μL PBS, and 50 μL RNAse (1 mg/mL) and 50 μL propidium iodide (0.4 mg/ml) were added. After incubation (at room temperature for 1 hour), the stained nuclei were analyzed with a flow cytometer (FACSCalibur, BD Biosciences, Glostrup, Denmark) Cell cycle distribution was analyzed.
[0068] Experimental Results
[0069] 1. Endogenous P8 Protein Expression
[0070] To increase the anticancer activity of P8 protein, P8 protein was endogenously expressed in mammalian cells using a codon-optimized sequence and a pCI-neo vector (
[0071] 2. Significant Increase in Anticancer Activity by Endogenous P8 Protein Expression
[0072] To evaluate whether endogenous P8 protein expression increases its anticancer properties in vitro, the ability of P8 protein to suppress proliferation of cancer cells was measured. As a result of the experiment, endogenous P8 protein expression reduced tumor cell proliferation by about 40% (
[0073] To determine the effects of P8 protein on various signaling pathways, the signaling pathways associated with proliferation of susceptible phenotypes were examined First, whether P8 protein induces apoptosis or cell cycle arrest in DLD-1 cells was examined. The number of dead cells after treatment with 40 μM exogenous P8 protein was comparable with that of a control (
[0074] 3. Effects of P8 Protein on Anticancer Signaling Pathways in DLD-1 Cells
[0075] Next, the present inventors investigated the effects of endogenous P8 protein expression on the cell cycle using Western blotting to detect expression of cell cycle-related proteins (
[0076] Although the present disclosure has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only of a preferred embodiment thereof, and does not limit the scope of the present disclosure. Thus, the substantial scope of the present disclosure will be defined by the appended claims and equivalents thereto
INDUSTRIAL APPLICABILITY
[0077] The present disclosure relates to a construct for expression of P8 protein derived from lactic acid bacteria, and a composition for treating or preventing colorectal disease containing the same.