PREVENTIVE OR THERAPEUTIC PHARMACEUTICAL COMPOSITION FOR CORONAVIRUS INFECTION COMPRISING TETRAARSENIC HEXOXIDE
20230181632 · 2023-06-15
Assignee
Inventors
- Ill Ju BAE (Gangwon-do, KR)
- Seong Jin Kim (Seoul, KR)
- Kwang Soo LYOO (Goyang-si, Gyeonggi-do, KR)
- Kyung Min YANG (Incheon, KR)
- Zhaoyan WU (Seoul, KR)
- Min Jung SON (Seoul, KR)
- Kyoungwha PANG (Seoul, KR)
Cpc classification
International classification
Abstract
Disclosed herein is a pharmaceutical composition comprising tetraarsenic hexoxide as an active ingredient. Having excellent antiviral activity against coronaviruses, the pharmaceutical composition can be advantageously applied to the prevention or treatment of coronavirus diseases.
Claims
1. A pharmaceutical composition, comprising tetraarsenic hexoxide as an active ingredient for preventing or treating a coronavirus disease.
2. The pharmaceutical composition of claim 1, wherein the coronavirus disease is selected from the group consisting of coronavirus disease-19 (COVID-19) caused by infection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), severe acute respiratory syndrome (SARS) caused by infection of severe acute respiratory syndrome coronavirus (SARS-CoV), and Middle East respiratory syndrome (MERS) caused by infection of Middle East respiratory syndrome-related coronavirus (MERS-CoV).
3. The pharmaceutical composition of claim 1, wherein the coronavirus disease is coronavirus disease-19 (COVID-19) caused by infection of severe acute respiratory syndrome 2 (SARS-CoV-2).
4. A health functional food composition, comprising tetraarsenic hexoxide as active ingredient for preventing or alleviating a coronavirus disease.
5. The health functional food composition of claim 4, wherein the coronavirus disease is selected from the group consisting of coronavirus disease-19 (COVID-19) caused by infection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), severe acute respiratory syndrome (SARS) caused by infection of severe acute respiratory syndrome coronavirus (SARS-CoV), and Middle East respiratory syndrome (MERS) caused by infection of Middle East respiratory syndrome-related coronavirus (MERS-CoV).
6. The health functional food composition of claim 4, wherein the coronavirus disease is coronavirus disease-19 (COVID-19) caused by infection of severe acute respiratory syndrome 2 (SARS-CoV-2).
7. A method for preventing or treating a coronavirus disease in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising tetraarsenic hexoxide as an active ingredient.
8. The method of claim 7, wherein the coronavirus disease is selected from the group consisting of coronavirus disease-19 (COVID-19) caused by infection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), severe acute respiratory syndrome (SARS) caused by infection of severe acute respiratory syndrome coronavirus (SARS-CoV), and Middle East respiratory syndrome (MERS) caused by infection of Middle East respiratory syndrome-related coronavirus (MERS-CoV).
9. The method of claim 7, wherein the coronavirus disease is coronavirus disease-19 (COVID-19) caused by infection of severe acute respiratory syndrome 2 (SARS-CoV-2).
Description
BRIEF DESCRIPTION OF DRAWINGS
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
BEST MODE FOR CARRYING OUT THE INVENTION
[0037] Hereinafter, preferred embodiments of the present disclosure will be described in detail. However, the present disclosure is not limited to the embodiments described herein, but may be embodied in other forms. Rather, the embodiments are provided so that the content introduced herein will be thorough and complete, and will fully convey the spirit of the present disclosure to those skilled in the art.
Example 1. Assay for Antiviral Activity Against Coronaviruses
[0038] Effects of the tetraarsenic hexoxide compound of the present disclosure on coronaviruses were examined through a CPE (cytopathic effect) assay that accounts for comparison of viability between infected cells.
Example 1-1. Vero Cell Culture
[0039] Vero E6 cells, which are derived from kidney cells extracted from an African green monkey, were seeded at a density of 1×10.sup.4 cells/well into 96-well plates and incubated overnight in DMEM (Dulbecco's modified Eagle's medium) supplemented with glucose, 10% FBS (fetal bovine serum), 1% PS (penicillin+streptomycin), 1% L-glutamine 200 mM, 1% sodium pyruvate 100 mM, and nonessential amino acids before being washed with a PBS buffer.
Example 1-2. Cytotoxicity Assay
[0040] Cytotoxicity was examined through an MTT assay. The MTT assay is a colorimetric assay for assessing cytotoxicity or viability by taking advantage of the mitochondrial ability to convert the yellow water-soluble substrate MTT tetrazolium into purple insoluble formazan product (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide) by the action of oxidoreductase enzymes present in mitochondria of living cells.
[0041] The cultured Vero E6 cells were seeded into 96-well plates. A 1% (w/v) solution of tetraarsenic hexoxide (As.sub.4O.sub.6) in distilled water was 1,000- to 20,000-fold diluted (As.sub.4O.sub.6 25.27 μM-1.26 μM) in DMEM and each of the dilutions was applied to the 96-well plates in duplicate, followed by incubation for 48 hours. Thereafter, the supernatant was removed and a 5 mg/ml MTT solution was added in an amount of 20 μl to each well. Formazan crystals were formed during incubation at 37° C. for 4 hours. After incubation, the supernatant was removed again and DMSO was added in an amount of 100 μl/well to all wells and mixed to completely dissolve the formazan crystals. Incubation at room temperature for 15 minutes made the formazan crystals completely dissolved, followed by reading absorbance at 570 nm (A570 nm) on a microplate.
[0042] From the MTT assay results, it was found that the 1% (w/v) tetraarsenic hexoxide (As.sub.4O.sub.6) solution exhibited cytotoxicity leading to cell death until up to 1,000-fold dilution, but the cells survived and did not undergo cell death at 2,000-fold or greater dilutions of the 1% (w/v) tetraarsenic hexoxide (As.sub.4O.sub.6) solution. At least 2,000-fold dilutions of the solution were thus identified to be suitable concentrations for test use.
Example 1-3. Assay for Antiviral Efficacy
[0043] Vero E6 cells cultured in Example 1-1 were seeded at a density of 2-5×10.sup.5 cells/well into 8-well plates to which SARS-CoV-2, causative of COVID-19, provided by the Korea Disease Control and Prevention Agency, was then inoculated at a concentration of 10.sup.1.5-10.sup.2.5TCID.sub.50/ml in an amount of 100 μl/well, followed by incubation for 1 hour in a CO.sub.2 incubator to infect the cells with the coronavirus. Afterwards, the culture medium was washed with PBS. 1% (w/v) tetraarsenic hexoxide (As.sub.4O.sub.6) solution was 2,000-, 3,000-, and 4,000-fold diluted (12.64 μM, 8.42 μM, and 6.32 μM) with DMEM and 200 μl of each dilution was added.
[0044] As a negative control, DMEM free of the test material was added. After 3 days of incubation in an incubator, examination was made of a cytopathic effect (CPE) to determine effective concentrations of the test material. CPE refers to morphological changes in host cells resulting from viral infection. Degenerative morphological changes of cells are known to be associated with viral infection.
[0045] The assay for antiviral efficacy identified that the tetraarsenic hexoxide of the present disclosure has an excellent inhibitory effect on the growth of SARS-CoV-2.
TABLE-US-00001 TABLE 1 Group SARS-CoV-2 SARS-CoV-2 inoculated at inoculated at 10.sup.2.5TCID.sub.50/ 10.sup.1.5TCID.sub.50/ ml dose ml dose % Inhibition % Inhibition of CPE of CPE (cytopathic effect) Test Group 2,000-fold 100% (8/8well) 100% (8/8well) (tetraarsenic diluted hexoxide (12.64 μM) treated) 3,000-fold 37.5% (3/8well) 87.5% (7/8well) diluted (8.42 μM) 4,000-fold 37.5% (3/8well) 87.5% (7/8well) diluted (6.32 μM) Negative Control (tetraarsenic 0% (all 0% (all hexoxide not treated) morphol- morphol- ogically ogically changed) changed)
[0046] As can be seen in the table, the proliferation of viruses was 100% inhibited in Vero E6 cell group infected with 10.sup.2.5TCID.sub.50/ml SARS-CoV-2 when the cells were treated with the 2,000-fold diluted tetraarsenic hexoxide for 3 days.
[0047] In addition, as the negative control cells, Vero E6 cells infected with 10.sup.1.5TCID.sub.50/ml of SARS-CoV-2 underwent degenerative structural changes in all wells (8/8 wells) when they were not treated with tetraarsenic hexoxide, but exhibited inhibition against viral growth by 87-100% when treated with tetraarsenic hexoxide.
[0048] Therefore, the pharmaceutical composition comprising tetraarsenic hexoxide as an active ingredient according to the present disclosure has excellent antiviral activity against coronaviruses, especially SARS-CoV-2 and, as such, can find advantageous applications in therapeutic agents for COVID-19, which is caused upon infection of SARS-CoV-2.
Example 2. Analysis for Transcriptomic Change by Tetraarsenic Hexoxide in Coronavirus-Infected Cells
[0049] An analysis was made for transcripts associated with the antiviral mechanism of tetraarsenic hexoxide upon infection with SARS-CoV-2. To this end, Vero E6 cells derived from kidney cells of African green monkeys were infected with SARS-CoV-2 and then treated with tetraarsenic hexoxide before RNA sequencing analysis. In brief, the same assay procedure as in Example 1-3 was carried out wherein the exception that the cells were infected with 10.sup.15TCID.sub.50/ml SARS-CoV-2 and the tetraarsenic hexoxide solution was 2,000-fold diluted. Used as test groups were a normal control in which Vero E6 cells had been treated with no substances, negative controls in which SARS-CoV-2-infected Vero E6 cells had been treated with DMEM free of test materials for 36 or 72 hours (SARS-Cov-2(36 h) and SARS-Cov-2 (72 h)), and tetraarsenic hexoxide-treated groups in which SARS-CoV-2-infected Vero E6 cells had been treated with tetraarsenic hexoxide for 36 or 72 hours (SARS-Cov-2+As.sub.4O.sub.6 (36 h) and SARS-Cov-2+As.sub.4O.sub.6(72 h)). Subsequently, a sample obtained from each test group was subjected to RNA sequencing.
Example 2-1. RNA Isolation and Library Preparation
[0050] From the Vero E6 cell samples prepared as above, RNA was extracted using a TRIzol reagent (Invitrogen, USA) according to the instruction of the manufacturer. The extracted RNA was evaluated for quality and integrity using 2100 Bioanalyzer (Agilent, USA). Only RNA samples with a RIN (RNA integrity number) of 8 or greater were employed. RNA was quantitated using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA) and libraries of RNA were prepared with the aid of a kit (Illumina TruSeq™ RNA Sample Preparation Kit, Illumina, USA). First, mRNA molecules with poly-A were purified with oligo-dT-attached magnetic beads, and digested RNA fragments were subjected to reverse transcription into first-strand complementary DNA (cDNA) by a reverse transcriptase in the presence of random primers. Then, second-strand cDNA was synthesized using DNA polymerase I and RNaseH (Invitrogen). The cDNA fragments were allowed to go through an end repair process by adding a single A base and then ligating the adapters. The products were then purified and enriched with PCR to create the final cDNA library.
Example 2-2. RNA Sequencing
[0051] The cDNA library was subjected to paired-end sequencing on an Illumina instrument (Illumina HiSeq 2000 sequencer, Illumina). From a total of 15 samples, 680,000 reads were created. The paired-end reads were filtered using FastQC and Trimmomatic (ver. 0.32). Subsequently, clean reads were aligned using the Hisat2 (ver.2.0.5)-Cufflinks-Cuffmerge-Cuffdiff (ver. 2.2.1) pipeline according to the Tuxedo protocol and quantitated. The reads were mapped to the African green monkey reference genome (ChlSab1.1) downloaded from Ensembl (www.ensembl.org/Chlorocebus_sabaeus/). RNA sequencing detected a total of 27,085 single genes.
Example 2-3. Heat Map Clustering Analysis
[0052] Transcriptomic assay was performed on each test group. Using a heat map, clustered were functionally similar genes that differed in expression level by two fold or greater and statistically showed a q value of 0.05 or lower when transcriptomes from the negative controls in which SARS-CoV-2-infected Vero E6 cells had been incubated (SARS-Cov-2(36 h) and SARS-Cov-2(72 h)) and the tetraarsenic hexoxide-treated groups in which SARS-CoV-2-infected Vero E6 cells had been treated with tetraarsenic hexoxide (SARS-Cov-2+As.sub.4O.sub.6(36 h) and SARS-Cov-2+As.sub.4O.sub.6(72 h)) were compared to that from the normal control in which Vero E6 cells had been treated with no substances. As a result, a total of 7 groups were divided on the basis of functional similarity of genes: 147 genes for group 1; 209 genes for group 2; 219 genes for group 3; 106 genes for group 4; 39 genes for group 5; 34 genes for group 6; and 67 genes for group 7 (
Example 2-4. Result of Gene Ontology Analysis for Responsive Genes in SARS-CoV-2-Infected Vero E6 Cells
[0053] Based on the clustering in Example 2-3, gene ontology (GO) term enrichment was performed for similar genes. Analysis for upper GO terms in each group hierarchically classified in
Example 2-5. Analysis for Expression Pattern of Representative Responsive Genes in SARS-CoV-2-Infected Vero E6 Cells
[0054] Treatment with tetraarsenic hexoxide upon infection with SARS-CoV-2 was found to regulate genes responsive to viral infection as measured by transcriptomic assay and GO term enrichment. In this context, representative genes responsive to viral infection were analyzed for expression patterns. As a result, treatment with tetraarsenic hexoxide upregulated the expression of the genes BAGS, HSPA1B, CRYAB, HMOX1, and HSPH1, which inhibit viral infection-induced cell death. It also increased the expression of the gene ZFAND2A, which functions to reduced intracellular arsenic toxicity (
Example 2-6. Verification Using Reverse Transcription Polymerase Chain Reaction (RT-PCR)
[0055] In order to confirm reproducibility of the genes identified through RNA sequencing, RT-PCR was performed on the genes BAG3, CRYAB, HSPH1, HMOX1, and ZFAND2A using the same RNA samples as in the transcriptomic assay.
[0056] In detail, RT-PCR was carried out using the primers of Table 2, below, complementary DNA synthesized with reverse transcriptase, and a PCR instrument (TAKARA TP350, TAKARA).
TABLE-US-00002 TABLE 2 Amplicon Gene Primer Sequence (5′.fwdarw.3′) Size (bp) BAG3 Forward: ATGACCCATCGAGAATCTGC 365 Reverse: GCTTCCACTTTCAGCACTCC CRYAB Forward: TTCTTCGGAGAGCACCTGTT 350 Reverse: AGGACCCCATCAGATGACAG HSPH1 Forward: AGGCCGCTTTGTAGTTCAGA 345 Reverse: TTTGCTTTGTCAGCATCTGG HMOX1 Forward: GCAGGAAGTCATCCCCTACA 382 Reverse: CTGGTCCTTGGTGTCATGTG ZFAND2A Forward: GGGGAAGCATTGTTCAGAAA 381 Reverse: CTGTGGTCCAAAGGGTGTCT 18s rRNA Forward: CCCAACTTCTTAGAGGGACA 158 Reverse: TAGTCAAGTTCGACCGTCTT
[0057] One μg of total RNA was reverse transcribed into cDNA which was then 4-fold diluted in deionized water. Together with 2 μl of the cDNA, 1 μl of taq polymerase, 2 μl of 10× buffer, 2 μl of each primer, and 11 μl of deionized water were mixed to form a total of 20 μl of a reaction mixture. RT-PCR was carried out with 30 cycles of 95° C. for 5 min, 58° C. for 30 sec, and 72° C. for 10 min. Expression levels of target genes were normalized to that of 18s rRNA.
[0058] Like the transcriptomic assay, RT-PCR analysis exhibited upregulated expressions of the genes BAG3, CRYAB, HSPH1, and HMOX1, which are associated with cytoprotection responsible for inhibiting virus-induced cell death and viral proliferation, and the gene ZFAND2A, which functions to reduce intracellular arsenic toxicity (