METHOD FOR REDUCING HOST NUCLEIC ACIDS IN BIOLOGICAL SAMPLE AND APPLICATIONS

Abstract

A method of reducing host nucleic acids in a biological sample and a use thereof, which belong to the technical field of gene detection is provided. The method includes the steps of a) performing pre-treatment for the biological sample under a mild condition with partial lysis and/or no lysis of host cell membrane, thereby obtaining a liquid sample; and b) taking the liquid sample followed by adding a nucleic acid digestion reagent, thereby degrading the host nucleic acid which is exposed in the liquid sample. The method is used for reducing host nucleic acids in a biological sample and non-selectively enriching the targets, such as bacteria, fungi, viruses, mycoplasma/chlamydia.

Claims

1. A method of reducing host nucleic acids in a biological sample, comprising: a) performing a pre-treatment for the biological sample under a mild condition with at least one of partial lysis and no lysis of host cell membrane, thereby obtaining a liquid sample; and b) taking the liquid sample followed by adding a nucleic acid digestion reagent, thereby degrading the host nucleic acid which is exposed in the liquid sample.

2. The method of reducing host nucleic acids in a biological sample of claim 1, wherein the mild condition comprises a step of pre-treating the sample with a treatment solution having a relative concentration of 50% to 2200% in relative to isotonic solution; or wherein the mild condition comprises a step of performing ultrasonic treatment for the sample at a power of 0.1 W to 32 W, each treatment lasting for 0.1-10 min, with 0 to 30 s gap, 1 to 10 cycles; or; wherein the mild condition comprises a step of striking the sample with a pressure of 0.1 to 1600 psi, each strike lasting for 0.1 to 15 min, with 0 to 30 s gap, 1 to 10 cycles; or wherein the mild condition comprises a step of treating the sample with 0.1 to 500 mg/L saponin or other detergents having a similar effect as the saponin for 0.1 to 60 min.

3. The method of reducing host nucleic acids in a biological sample of claim 2, wherein the mild condition comprises steps of pre-treating the sample with a treatment solution having a relative concentration of 50% to 550% in relative to isotonic solution.

4. The method of reducing host nucleic acids in a biological sample of claim 3, wherein the mild condition comprises a step of pre-treating the sample with a treatment solution having a relative concentration of 50% to 150% in relative to isotonic solution.

5. The method of reducing host nucleic acids in a biological sample of claim 4, wherein in Step a), the biological sample is taken and pre-treated with a treatment solution having a relative concentration of 90% to 110% in relative to isotonic solution.

6. The method of reducing host nucleic acids in a biological sample of claim 5, wherein the treatment solution is 0.45% to 20% sodium chloride solution or 2.5% to 7.5% glucose solution.

7. The method of reducing host nucleic acids in biological sample of claim 6, wherein the treatment solution is 0.45% to 1.35% sodium chloride solution.

8. The method of reducing host nucleic acids in a biological sample of claim 1, wherein partial lysis or no lysis of the host cell membranes means that a proportion of host living cells is ≥0, detected by a Trypan blue staining method, an Annexin V cell apoptosis detection, or a method of staining living cells with PI.

9. The method of reducing host nucleic acids in a biological sample of claim 8, wherein partial lysis or no lysis of the host cell membranes means that the proportion of host living cells is >0, detected by a Trypan blue staining method, an Annexin V cell apoptosis detection, or a method of staining living cells with PI.

10. The method of reducing host nucleic acids in biological sample of claim 9, wherein partial lysis or no lysis of the host cell membranes means that the proportion of the host living cells is ≥20, detected by a Trypan blue staining method, an Annexin V cell apoptosis detection, or a method of staining living cells with PI.

11. The method of reducing host nucleic acids in a biological sample of claim 1, wherein the nucleic acid digestion reagents comprise at least one of nucleases and compounds that degrade nucleic acids.

12. The method of reducing host nucleic acids in a biological sample of claim 11, wherein the nucleic acid digestion reagent is at least one selected from the group consisting of Benzonase, Turbo DNase, HL-SAN, DNase I, or Propidium monoazide.

13. The method of reducing host nucleic acids in a biological sample of claim 11, wherein in step b), the nucleic acid digestion reagent is replaced with a nucleic acid blocker, blocking free nucleic acids from entering subsequent detection steps.

14. The method of reducing host nucleic acids in a biological sample of claim 1, wherein the biological sample is a biological sample that is suspected of infection in clinic.

15. The method of reducing host nucleic acids in a biological sample of claim 14, wherein the biological sample comprises bronchoalveolar lavage fluid, cerebrospinal fluid, sputum, blood, pleural fluid, ascites, tissue, urine, pus, bone marrow, pericardial effusion, joint fluid, drainage fluid.

16. A method of detecting pathogenic microorganism, comprising a step of reducing host nucleic acids in a biological sample.

17. The method of detecting pathogenic microorganism of claim 16, wherein the method of detecting pathogenic microorganism includes detecting microbial nucleic acid based on high-throughput sequencing, comprising: a) treating a sample to be tested by performing a pre-treatment for the sample under a mild condition with at least one of partial lysis and no lysis of host cell membrane, thereby obtaining a liquid sample and taking the liquid sample followed by adding a nucleic acid digestion reagent, thereby degrading the host nucleic acid which is exposed in the liquid sample; b) extracting nucleic acids from the sample; c) constructing a library; d) performing sequencing on a machine; and e) analyzing data.

18. A method of diagnosing infectious diseases, comprising a step of reducing host nucleic acids in a biological sample.

19. A kit for diagnosing infectious diseases, comprising: a cell membrane lysis reagent, comprising a mild lysis reagent for at least one of partially lysing and non-lysing the cell membrane of host cells in a biological sample; and a nucleic acid digestion reagent, comprising a nucleic acid remover for degrading free host nucleic acid or a nucleic acid blocker for blocking free nucleic acid from entering subsequent detection steps.

20. The kit for diagnosing infectious diseases of claim 19, wherein the host cell membrane lysis reagent comprises a treatment solution at a relative concentration of 90% to 110% in relative to plasma isotonic solution, or 0.1 to 100 mg/L saponin or other equivalent reagents; and wherein the nucleic acid digestion reagents comprise nucleases and/or compounds that degrade nucleic acids.

Description

BRIEF DESCRIPTION

[0059] Some of the examples will be described in detail, with reference to the following figures, wherein like designations denote like members, wherein:

[0060] FIG. 1 shows a schematic diagram of analysis of reads difference between samples removing host nucleic acids and samples non-removing host nucleic acids, wherein the samples removing host nucleic acids are treated with normal saline;

[0061] FIG. 2 shows fold change of enriched pathogen reads for different kinds of pathogens;

[0062] FIG. 3 shows a schematic diagram of evaluating the depletion proportion of host nucleic acid, by quantitative PCR (qPCR);

[0063] FIG. 4 shows a schematic diagram of effect of hypotonic normal saline in gradient concentrations on the lysis of leukocyte in Example 2;

[0064] FIG. 5 shows a schematic diagram of effect of hypertonic normal saline in gradient concentrations on the lysis of leukocyte in Example 2;

[0065] FIG. 6 shows a schematic diagram of analysis of reads difference between samples removing host nucleic acids and samples non-removing host nucleic acids, for sputum, cerebrospinal fluid, pleural effusion, tissue samples; and

[0066] FIG. 7 shows a schematic diagram of analysis of reads difference between 5M data for samples removing host nucleic acids and 20 M data for samples non-removing host nucleic acids.

DETAILED DESCRIPTION

[0067] For better understanding of the present disclosure, embodiments of the present disclosure will be fully described below in reference to relevant drawings. Some embodiments of the present invention are given in the drawings. However, the present disclosure can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided for the purpose of making the disclosed contents of the present disclosure more thorough and complete.

[0068] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those normally understood by one skilled in the conventional art in the technical field that the present disclosure is belonged to. The terms used in the description of the present disclosure herein are only for the purpose of describing specific embodiments, and are not intended to limit the present disclosure. The term “and/or” used herein refers to any one or more relevant items and their combination.

[0069] Unless otherwise specially mentioned, the raw materials used hereinafter are commercially available.

Example 1

[0070] Samples were respectively treated with isotonic saline, by differential lysis, and by directly extracting nucleic acids. Results were compared.

[0071] (I). NGS Sequencing

[0072] I. Preparation of Samples

[0073] Fifty-seven bronchoalveolar lavage fluid (BALF) samples from patients (derived from patients suffering from lower respiratory infection) who were suspected of lower respiratory tract infection, were taken out from a freezer at 4° C., and three sub-samples were taken from each BALF sample and labelled, each sub-sample was 600 μl. The first sub-sample was treated with isotonic normal saline according to Method A (i.e., removing host nucleic acids by direct nuclease digestion) described as below and then nucleic acids were extracted. The second sub-sample was treated by a conventional differential lysis method according to Method B (i.e., removing host nucleic acids by differential lysis method) described as below and then nucleic acids were extracted. The third sub-sample was treated according to Method C (i.e., direct nucleic acid extraction) described as below, without removing host nucleic acids, and nucleic acids were directly extracted.

[0074] II. Pre-Treatment of the Samples

[0075] A. Direct Nuclease Digestion

[0076] 1. The prepared samples were centrifuged at 12000 g for 5 min, and supernatant was removed, and 850 μl PBS was added for resuspending the samples. The PBS was isotonic 1×PBS (10 mmol/L Na.sub.2HPO.sub.4; 17.5 mmol/L KH.sub.2PO.sub.4; 137 mmol/L NaCl; 2.65 mmol/L KCl; pH 7.4)

[0077] 2. 98 μl of 10× Benzonase Buffer and 2 μl of Benzonase (500 U) were added to the solution and the solution was incubated at 37° C. for 60 min.

[0078] 3. After incubation, the solution was centrifuged at 12000 g for 3 min, and supernatant was removed and 50 μl liquid was remained.

[0079] 4. 550 μl of 1×PBS was used for suspending the residues, and 6 μl of 0.5 M EDTA was added and mixed well.

[0080] B. Differential Lysis

[0081] 1. The prepared samples were centrifuged at 12000 g for 5 min, supernatant was removed, and 850 μl of pure water was added for resuspending the samples, which were then incubated at room temperature for 10 min. The pure water was used for differentially lysing the samples, due to its hypoosmolality.

[0082] 2. 98 μl of Benzonase Buffer and 2 μl of Benzonase (500 U) were added to the solution and the solution was incubated at 37° C. for 60 min.

[0083] 3. After incubation, the solution was centrifuged at 12000 g for 3 min, and supernatant was removed.

[0084] 4. 550 μl of 1×PBS was used for suspending the residues, and 6 μl of 0.5 M EDTA was added and mixed well.

[0085] C. Direct Nucleic Acid Extraction

[0086] The prepared samples were centrifuged at 12000 g for 5 min, supernatant was removed, 550 μl of 1×PBS was used for suspending the samples, and 6 μl of 0.5 M EDTA was added and mixed well.

[0087] III. Nucleic Acid Extraction

[0088] Nucleic acids were extracted for all samples according to the following process: DNA was extracted from BALF according to a method of extracting nucleic acid from micro-samples with genomic DNA extraction kit (DP316) manufactured by Beijing Tiangen Biochemical Technology Co., Ltd. The method of extracting nucleic acid comprises steps of:

[0089] 1. taking 600 μl of the treated sample and adding it to a tube containing glass beads followed by lysing cell membrane with a physical vibrator.

[0090] 2. after centrifugation for a short time, taking 300 μl of the treated samples and transferring it into a 1.5 ml tube; adding 10 μl of Proteinase K solution and then adding 100 μl of GB premixed with Carrier RNA (at a concentration of 1 μg/μl), and mixing the solution gently upside-down. After a centrifugation for a short time, removing liquid on the tube lid and tube inner walls;

[0091] 3. keeping the sample in a warm bath at 56° C. for 10 min and gently shaking it occasionally;

[0092] 4. adding anhydrous ethanol freeze-stored at −20° C. to the sample, followed by gently shaking the sample upside-down and placing the sample at room temperature for 3 min; after a centrifugation for a short time, removing liquid on the tube lid and tube inner walls;

[0093] 5. adding the liquid obtained from the Step 4 into a CR.sub.2 absorption column and centrifuging at 12000 rpm for 30 sec, removing waste streams, and then placing the CR.sub.2 absorption column into a collection column.

[0094] 6. adding 500 μl of Buffer GD solution to the CR.sub.2 absorption column and centrifuging at 12000 rpm for 30 sec, removing waste streams, and then placing the CR.sub.2 absorption column into a collection column;

[0095] 7. adding 600 μl of Buffer PW solution to the CR.sub.2 absorption column and centrifuging at 12000 rpm for 30 sec and removing waste streams, and then placing the CR.sub.2 absorption column into a collection column.

[0096] 8. repeating the Step 7;

[0097] 9. centrifuging the solution at 12000 rpm for 30 sec and removing waste streams, and then placing the CR.sub.2 absorption column into a collection column for 2 to 5 min at room temperature, to completely dry the residual rinse solution (Buffer PW solution) in the absorption material;

[0098] 10. transferring the CR.sub.2 absorption column into a clean centrifuge tube, dropwise adding 50 μl of elution Buffer TB to the middle of an adsorption film, placing the film at room temperature for 2 to 5 min and centrifuging it at 12000 rpm for 2 min to collect the solution into the centrifuge tube;

[0099] 11. using Qubit 3.0 fluorometer (Thermo Fisher) to accurately quantify DNA sample concentration.

[0100] IV. Construction of Library

[0101] 1. 5×TTBL and TTE Mix V1, stored at −20° C., were taken and thaw at 4° C. After complete mixing and centrifugation for a short time, magnetic beads, stored at 4° C., were taken out and placed at room temperature for 30 min until it reached equilibrium, and then the mixture was vibrated completely and mixed well, centrifuged for a short time for later use.

[0102] 2. DNA fragmentation: a 20 μl reaction system was configured with 4 μl of 5×TTBL, 1 ng DNA, 5 μl of TTE Mix V1, supplemented with ddH.sub.2O; the fragmentation reaction was performed in PCR according to the following procedures: heating lid at 105° C., reacting at 55° C. for 10 min, and storing at 10° C.

[0103] 3. After reaction, 5 μl of 5×TS was added to the product obtained from the Step 2 and the mixture was gently blow with a pipettor and mixed well, placed at room temperature for 5 min.

[0104] 4. PCR enrichment: a system described below was configured for the PCR enrichment. The system was configured with 25 μl of the product obtained from the Step 3, 10 μl of 5×TAB, 5 μl of upstream primers, 5 μl of downstream primers, and 1 μl of TAE, blow with a pipettor, and mixed well. The reaction tube was placed in a PCR machine, and the reaction was performed according to the following procedures: heating lid at 105° C., reacting a cycle (72° C. for 3 min, 98° C. for 30 sec, 98° C. for 15 sec, 60° C. for 30 sec, and 72° C. for 3 min), performing 5 to 15 cycles, and maintaining at 72° C. for 5 min, and storing at 4° C.

[0105] 5. Sorting the product obtained from the Step 4: the magnetic beads equilibrated at room temperature in advance were used to sort the library fragments with an average length of 350 bp, according to the clean-up ratio of 0.7× beads used in first step and 0.15× beads used in the second step.

[0106] V. Sequencing on a Machine

[0107] The constructed library of nucleic acids was sequenced on Illumina NEXTSEQ550, with 20 M (20 million) reads per sample.

[0108] VI. Data Analysis

[0109] The sequenced data was analyzed and the result was shown hereinafter.

[0110] 1. Enrichment Folds of Pathogen

[0111] Pathogen reads for fifty-seven bronchoalveolar lavage fluid (BALF) samples were obtained, and the pathogen reads for samples removing host nucleic acids were compared with those for samples non-removing host nucleic acids, which were shown in FIG. 1. Specifically, FIG. 1 showed analysis result of reads difference obtained by the metagenomic sequencing after treatment of BALF with Method A and Method C, respectively. From the figure, it could be seen that there is a correlation of pathogen detection for 57 BALF samples removing host nucleic acids (Method A) and non-removing host nucleic acids (Method C), wherein the abscissa is sequences reads for samples removing host nucleic acids, and the ordinate is sequences reads for samples non-removing host nucleic acids. The results showed that the pathogens of clinical samples were effectively enriched after removal of host nucleic acids.

[0112] FIG. 2 shows the analysis of the enrichment fold changes of different kinds of pathogens. It could be seen from the figure that, when adopting the above-mentioned direct nuclease digestion method (Method A) to treat samples, the average of enrichment folds of targets, such as bacteria, fungi, viruses and mycoplasma/chlamydia, etc., were 4.9 fold (Q1=2.12 fold, Q3=14.29 fold), 23.2 fold (Q1=3.46 fold, Q3=38.92 fold), 18 fold (Q1=9.64 fold, Q3=88.05 fold), 5.25 fold (Q1=1.95 fold, Q2=8.21 fold), respectively. The above Q1 refers to the quantile 25%, and Q3 refers to the quantile 75%.

[0113] 2. Pathogen Loss Compared to the direct nucleic acid extraction method (Method C), when adopting the method of reducing host nucleic acid (Method A) in the example, no pathogen was lost, while enriching bacteria, fungi, viruses, mycoplasma/chlamydia, etc. Twenty-six bacteria, nine fungi, thirteen viruses and two chlamydia were detected in the 57 BALF samples.

[0114] However, when adopting the differential lysis method (Method B), Pseudomonas aeruginosa, Haemophilus parahaemolyticus, Stenotrophomonas maltophilia, etc. were lost in 4 samples. The results were shown in the following table.

TABLE-US-00001 TABLE 1 Sample reads with loss of Pseudomonas aeruginosa Direct nucleic acid extraction Differential Reads Sample M1942 method (Reads) lysis (Reads) Ratio Elizabethkingia 12204 55569 4.55 Stenotrophomonas 4761 813 0.17 mallophilia Pandora genus 2795 636 0.23 Acinetobacter baumanii 338 244 0.72 Pseudomonas aeruginosa 146 0 0 Human herpesvirus 5 66 41 0.62 (CMV) Human herpesvirus 6B 0 40 0 Human herpesvirus 7 2 12 6

TABLE-US-00002 TABLE 2 Sample reads with loss of Haemophilus parahaemolyticus and CMV Direct nucleic acid extraction Differential Reads Sample M1996 method (Reads) lysis (reads) Ratio Lawsonella.sub.—clevelandensis 647 301932 466.66 Haemophilus parahaemolyticus 13 0 0 Hemophilus parainfluenzae 6 912 152 Human herpesvirus 5 (CMV) 13 0 0 Streptococcus parasanguis 2 1363 681.5

TABLE-US-00003 TABLE 3 Sample reads with loss of Stenotrophomonas maltophilia Direct nucleic acid extraction Differential Reads Sample M1963 method (reads) lysis (reads) Ratio Enterococcus faecium 434 130 0.3 Stenotrophomonas 28 0 0 maltophilia Candida tropicalis 41 76 1.85 Aspergillus 15 313 20.87 Human herpesvirus 1 785 1423 1.81 (CMV) Human herpesvirus 5 39 86 2.21 (CMV) Human herpesvirus 4 1 7 7 (EBV)

TABLE-US-00004 TABLE 4 Sample reads with loss of Pseudomonas aeruginosa Direct nucleic acid extraction Differential Reads M2003 method (reads) lysis (reads) Ratio Hemophilus 374 13650 36.5 parainfluenzae Pseudomonas 355 0 0 areuginosa
(II) qPCR Assay

I. Method.

[0115] The fifty-seven BALF samples were treated according to the Method A (direct nuclease digestion method) and Method C (direct nucleic acid extraction) mentioned above and detected by qPCR assay using human specific primers (F: ATCAGCCACATTGGTCTCCTGGAG (SEQ ID NO: 1), R: GTGAGCCTTTGGGTTTGTCATTTGA (SEQ ID NO: 2)), each sample was taken in an equal amount of nucleic acids, with three replicates and the qPCR reaction system was performed according to the following table:

TABLE-US-00005 TABLE 5 qPCR Reaction System Reagent Reaction system 2x μltraSYBR Mixture 25 μl Forward Primer 1 μl Reverse Primer 1 μl Template DNA 1.5-3 ng ddH.sub.2O Up to 50 μl

[0116] The qPCR reaction system configured as above was placed in an Applied biosystems 7500 system and the samples were amplified according to the parameters from the above table. The reaction was performed according to the following procedures: reacting a cycle (95° C. for 10 min, 95° C. for 15 sec, 60° C. for 1 min), performing such 40 cycles, and storing at 4° C.

II. Results.

[0117] After the reaction, the differences of ΔCt between Method C (direct nucleic acid extraction) and Method A (direct nuclease digestion method), i.e., ΔCt results of nucleic acids of samples before and after removing host nucleic acids were shown in FIG. 3. FIG. 3 showed a schematic diagram of a depletion ratio of host nucleic acids evaluated by qPCR, wherein the ordinate was the proportion of host nucleic acid depletion. The proportion of host nucleic acid depletion was obtained by firstly calculating the ΔCt results of nucleic acids of samples before and after removing host nucleic acids (i.e., the nucleic acid depletion folds), and then converting ΔCt. The average of the proportion of host nucleic acid depletion reached 70%.

Example 2

[0118] Treatment solutions at different isotonic relative concentrations have effects on sample treatment.

[0119] I. Leukocyte Lysis Assay with Gradient Normal Saline

[0120] 1. Hypotonic Lysis Experiment.

[0121] The whole blood sample was taken and added into a centrifuge tube with an anticoagulant, centrifuged at 1600 g and separated to obtain a leukocyte layer. 0.9% sodium chloride saline was regarded to be at 100% relative concentration, and a series of gradient saline was prepared to lyse the leukocytes.

[0122] The results are shown in FIG. 4, wherein the abscissa is the relative concentration of the treatment solution, and the ordinate is the proportion of living cells counted by Trypan blue staining method. The results show that the lysis ratio of leukocyte decreases gradually, as the relative concentrations of the treatment solution increases. The lysis ratio of leukocyte is the lowest when the relative concentration of the treatment solution is 100%.

[0123] 2. Hypertonic Lysis Experiment.

[0124] The whole blood sample was taken and added into a centrifuge tube with an anticoagulant, centrifuged at 1600 g and separated to obtain a leukocyte layer. Sodium chloride solution was prepared in gradient concentrations from 0.9 wt % to 24 wt % (being equivalent to 100% to 2660% relative concentration) to lyse the leukocytes.

[0125] The results are shown in FIG. 5, wherein the abscissa is the concentration of sodium chloride solution, and the ordinate is the proportion of living cells counted with Trypan blue as an indicator. The results show that, when the concentration (Con.) of sodium chloride solution reaches about 10 wt % (the relative concentration of sodium chloride solution is 1100%), the proportion of living cells decreases to 50 wt %; and when the concentration of sodium chloride solution reaches about 20 wt % (relative concentration is 2200%), the proportion of living cells decreases to 0, indicating that the cells can be completely lysed.

[0126] The above results show that, the lysis solution is 0.36%-20% of sodium chloride solution, or glucose or other salt solution having an equivalent concentration (similar lysis ability by osmotic pressure) as 0.36%-20% of sodium chloride solution. In an embodiment, the lysis solution is 0.54%-16% of sodium chloride solution, or glucose or other salt solution having an equivalent concentration as 0.54%-16% of sodium chloride solution. In an embodiment, the lysis solution is 0.63%-10% of sodium chloride solution, or glucose or other salt solution having an equivalent concentration as 0.63%-10% of sodium chloride solution.

[0127] II. Staining Assessment on the Leukocytes Lysed with Gradient Saline

[0128] A series of gradient normal saline was prepared respectively to lyse the leukocytes, according to the above method. Then the cell staining was performed and evaluated by a Trypan blue staining method, an Annexin V apoptosis detection method, and a method of staining living cells with PI, respectively. Specifically, the methods were shown as follows.

[0129] 1. Trypan Blue Staining Method

[0130] Trypan blue is a dye used to distinguish living cells from dead cells. It is an important dye that is not absorbed by healthy living cells but stains cells with damaged cell membranes. It can be used to detect dead and dying cells, and cell viability. Specifically, the method comprises steps of.

[0131] 1.1 taking 20 ul of Trypan blue and 20 ul of sample to be tested, respectively and mixing them in a ratio of 1:1.

[0132] 1.2 incubating the cells at room temperature for 2 to 3 min.

[0133] 1.3 detecting and counting the cells with optical microscope for microscopy.

[0134] 2. Annexin V Apoptosis Detection Method

[0135] Annexin V is a reagent for detecting cell apoptosis. In normal cells, phosphatidylserine is only distributed on the inner side of the lipid bilayer of the cell membrane. During the early stage of cell apoptosis, the membrane phosphatidylserine (PS) is translocated from the inner side of the lipid membrane to the outer side of the lipid membrane. Annexin V as a phospholipid-binding protein has a high affinity for phosphatidylserine, and it binds to the cell membrane of early apoptosis cells through phosphatidylserine exposed on the outer side of the cell. Specifically, the method comprises steps of:

[0136] 2.1 centrifuging 200 ul of the sample to be tested at 2000 rpm for 3 min, and removing a supernatant.

[0137] 2.2 resuspending the sample with 400 ul of 1× Binding Buffer.

[0138] 2.3 adding 5 ul of Annexin V-FITC to the cell suspension, mixing them gently and incubating at 2-8° C. for 15 minutes in the dark.

[0139] 2.4 detecting the cells and counting with flow cytometer or fluorescence microscope.

[0140] 3. Method of Staining Live Cells with PI

[0141] PI (Propidium iodide) is a nuclear staining reagent that can stain DNA and is often used for apoptosis detection. Although PI cannot pass through living cell membranes, it can pass through damaged cell membranes and stain nuclei. Specifically, the method comprises steps of:

[0142] 3.1 washing 200 ul of sample to be tested twice with PBS.

[0143] 3.2 resuspending the sample with 200 ul of 1×PBS.

[0144] 3.3 adding PI dye (at a final concentration of 50 ug/ml) to the sample and incubating the sample at room temperature for 30 min in the dark.

[0145] 3.4 detecting and counting the cells with flow cytometer or fluorescence microscope.

[0146] III. Treatment of Clinical Samples with Gradient Saline

[0147] 1. Method.

[0148] Referring to the method of Example 1, five BALF samples were randomly selected, and three sub-samples were taken from each BALF sample and labeled, each sub-sample was 600 μl. The sub-sample pretreatment was carried out according to the methods in Example 1. For these three sub-samples, 850 μl of isotonic saline was added to the first sub-sample (Method D), and 850 μl of sodium chloride solution at a concentration of 0.54 wt % (i.e., normal saline at a relative concentration of 60%) was added to the second sub-sample (Method E), and 850 μl of sodium chloride solution at a concentration of 20 wt % (i.e., normal saline at a relative concentration of 2200%) was added to the third sub-sample (Method F).

[0149] 2. Results

[0150] The results were shown as follows.

TABLE-US-00006 TABLE 6 Comparison of different treatment Methods Relative Sequence Relative Sequence Relative Sequence abundance of number of abundance of number of abundance of number of Sample Pathogen Method D Method D Method E Method E Method F Method F P1 Acinetobacter 17.32 458 19.48 708 20.32 540 baumanii P1 Stenotrophomonas 19.64 341 4.92 115 13.68 326 maltophilia P1 Enterococcus 0.97 28 0.84 35 0.72 18 faecium P1 Candida albicans 89.45 264 90.27 113 92 120 P2 Streptococcus 35.35 241 33.43 19468 45.61 13423 pneumoniae P2 Human herpesvirus-5 29.6 106 65.11 1297 44.3 404 (CMV) P3 Stenotrophomonas 7.81 20 0.76 951 8.34 1006 maltophilia P3 Human herpesvirus-1 15.76 11 4.08 167 23.86 150 (HSV1) P4 Lactobacillus 3.72 328 0.04 89 1.34 124 salivarius P4 Lactobacillus 0.52 50 0.03 68 0.96 90 gasseri P4 Chlamydia 1.6 65 0.08 82 2.45 230 psittaci P5 Pneumocystis 0.7 31 42.76 63 30.08 70 jiroveci

[0151] It can be seen from the above results that the enrichment folds for pathogenic microorganisms, as well as their abundance can be further increased by the direct nuclease digestion method in combination with hypotonic and mild lysis treatment. However, for some pathogenic microorganisms in the samples, their abundance decreases after the above direct nuclease digestion treatment in combination with the hypotonic and mild lysis treatment. This may be caused by drug administration or immune system attack, which makes some pathogens fragile, leading to a decrease in abundance. And it is further deduced that, using the differential lysis method may easily lead to pathogen loss, with the increasing lysis intensity.

Example 3

[0152] The samples were treated with an ultrasonic method, a high-pressure method, and a chemical method, compared with those treated with sodium chloride solution at a relative concentration of 6000.

[0153] 1. Method

[0154] Three BALF samples prepared in advance were taken (50 ul for each sample was reserved as a Trypan blue staining control), and eight sub-samples were taken from each BALF sample and labelled, each sub-sample was 600 μl. The first sub-sample was treated according to Method C of Example 1. The second sub-sample was treated according to Method E of Example 2. The third and fourth sub-samples were treated by using a sonicator (VCX130) (an ultrasonic method) with the following operating parameters: a 130 w power ultrasonic instrument, 10% or 25% power, 4.5 s sonication, with 9 s gap, 6 cycles. The fifth and sixth sub-samples were treated by using a high-pressure disrupter (Constant Systems) (high pressure method) with the following operating parameters: treated under 800 psi or 1200 psi for 5 s, with 6 s gap, 10 cycles. The seventh and eighth sub-samples were treated by adding 10 mg/L or 100 mg/L saponin (chemical method) and incubated at room temperature for 5 min.

[0155] After a mild lysis, the samples were treated and then nucleic acids were degraded according to the following steps:

[0156] 1. adding 300 μl of 1×PBS to each sample treated by the ultrasonic method, the high-pressure method and the chemical method.

[0157] 2. adding 98 μl of 10× Benzonase Buffer and 2 μl of Benzonase (500 U) to each treatment solution, 37° C., 60 min.

[0158] 3. after incubation, centrifuging the samples at 12,000 g for 3 min, removing the supernatant and remaining 50 μl of sample liquid.

[0159] 4. resuspending the sample with 550 μl of 1×PBS, adding 6 μl of 0.5M EDTA and mixing them well.

[0160] After the treated samples were obtained, the samples were divided into 2 parts, wherein 50 μl of the treated sample (one part) was stained with Trypan blue and the cells were counted and analyzed; for the remained 550p treated sample (the other part), sample nucleic acid extraction, library construction, computerization, etc. were carried out according to the method of Example 1.

[0161] II. Results Analysis

[0162] After treating the BALF by 60% mild hypotonicity method, the ultrasonic method, the high-pressure method and the chemical method, respectively, the samples were stained with Trypan blue according to the Example 2, and the cells were counted with an optical microscope. The results show that the proportion of living cells decreased with an increasing lysis intensity, as shown in Table 3.

TABLE-US-00007 TABLE 7 Cell counts under different lysis conditions Quantity of living Quantity Propor- cells in of living tion of Treatment Sample a primary cells after living methods Condition ID sample treatment cells Mild 60% P1 2.40E+05 4.50E+03 1.88% hypotonicity hypotonicity P2 7.86E+04 2.10E+03 2.67% method P3 6.48E+05 9.00E+03 1.39% Ultrasonic 10% Power P1 2.40E+05 5.46E+02 0.23% method P2 7.86E+04 1.07E+03 1.37% P3 6.48E+05 1.23E+04 1.90% 25% Power P1 2.40E+05 0.00E+00 0.00% P2 7.86E+04 3.43E+03 4.37% P3 6.48E+05 4.56E+03 0.70% High- 800 psi P1 2.40E+05 1.20E+04 5.00% pressure P2 7.86E+04 9.56E+03 12.17% method P3 6.48E+05 3.55E+04 5.48% 1200 psi P1 2.40E+05 2.30E+03 0.96% P2 7.86E+04 8.48E+03 10.79% P3 6.48E+05 4.37E+04 6.75% Chemical 10 mg/L P1 2.40E+05 1.10E+05 45.83% method P2 7.86E+04 4.68E+04 59.55% P3 6.48E+05 2.35E+05 36.24% 100 mg/L P1 2.40E+05 1.80E+03 0.75% P2 7.86E+04 4.65E+03 5.92% P3 6.48E+05 2.35E+04 3.62%

[0163] The P1 sample of the above-mentioned treated sample was detected and analyzed with pathogen metagenomic detection according to Example 1, and the data analysis results are shown in the following table:

TABLE-US-00008 TABLE 8 comparison among different treatment methods Hypotonicity Ultrasonic High-pressure Chemical Non-removing method method method method host nucleic 60% 10% 25% 800 1200 10 100 acids hypotonicity power power psi psi mg/L mg/L Pathogen Sequence Sequence Sequence Sequence Sequence Sequence Sequence Sequence #Sample Name number number number number number number number number P1 Streptococcus 20 75 83 98 57 63 12 78 oralis P1 Streptococcus 13 68 64 107 125 120 35 76 pneumoniae P1 Staphylococcus 0 17 23 16 34 23 5 60 aureus P1 Candida albicans 145 304 245 305 236 290 412 450 P2 Klebsiella 15 37 117 196 56 187 44 112 pneumoniae P2 Human herpesvirus-5 64 16 354 1559 453 506 83 1392 (CMV) P3 Acinetobacter 4672 12011 26732 45655 35636 32468 15673 46738 baumanii P3 Enterococcus 6 39 43 183 56 88 37 68 avium P3 Enterococcus 0 6 5 27 23 18 13 34 faecium P3 Candida albicans 7 22 85 60 56 67 5 24 P3 Candida glabrata 8 18 45 82 23 107 21 67 P3 Human herpesvirus- 0 13 76 34 16 22 7 39 4(EBV)

[0164] It can be seen from the above results that, compared with samples treated by the method of non-removing host nucleic acids (Method C in Example 1), some pathogens are obviously enriched in samples treated by the above methods, such as the mild lysis method with 60% hypotonicity, the ultrasonic method, the high-pressure method, and the chemical method, without any pathogen loss. However, there is no significant difference in pathogen sequence number for samples treated by the ultrasonic method, the high-pressure method and the chemical method, compared with those samples treated by 60% hypotonicity.

Example 4

[0165] Different types of samples were treated with isotonic normal saline.

[0166] 1. Methods.

[0167] Three samples of prepared sputum, cerebrospinal fluid, pleural effusion, and tissue were collected in advance, respectively, and two sub-samples were taken from each sample and labelled, each sub-sample was 600 μl. The first sub-sample was pretreated with the method A of Example 1 and then nucleic acids were extracted. The second sub-sample was treated with method C of Example 1, and nucleic acids were directly extracted without removing host nucleic acids.

[0168] Nucleic acid extraction and library construction were carried out according to Example 1, and the obtained library was sequenced using Illumina NEXTSEQ550; each sub-sample was sequenced with a data of 20M reads. The data were analyzed using the same Metagenomic sequencing method for pathogen as that in Example 1.

[0169] 2. Results.

[0170] The results were shown in FIG. 6. The analysis diagram of the reads difference between samples removing host nucleic acids and samples non-removing host nucleic acids for the sputum (triangle), cerebrospinal fluid (circle), pleural effusion (diamond), and tissue (inverted triangle) samples. It can be seen from the figure that, the method of reducing host nucleic acid in biological samples in Example 1 is suitable for different types of biological samples, and they all have good enrichment of pathogenic microorganism nucleic acid. The read ratio of pathogen between samples removing host nucleic acids and samples non-removing host nucleic acids for these 12 samples was counted, and the median of enrichment fold was 8 times (Q1=1.35, Q3=21). In summary, the method of reducing host nucleic acids in biological samples is suitable for a variety of different samples, and has the effect of reducing host nucleic acid.

Example 5

[0171] Pathological and healthy samples, both treated with isotonic saline, were compared.

[0172] 1. Method

[0173] Three BALF samples in pathological state were taken, and Hela cells were used to simulate BALF samples at cell concentrations of 10.sup.6, 10.sup.5, and 10.sup.4, respectively. Two sub-samples were taken from each BALF sample and labelled, and each sub-sample was 600 μl. The first sub-sample was pre-treated according to the Method A of Example 1 followed by extracting nucleic acids. The second sub-sample was treated according to the Method C of Example 1 and followed by directly extracting nucleic acids, without removing the host nucleic acids, wherein the step of extracting nucleic acids referred to Example 1. The obtained nucleic acids were evaluated according to the qPCR method in Example 1, and the results for samples in pathological state and samples in simulated healthy state, treated by these two methods respectively, were compared.

[0174] 2. Results.

[0175] The results are shown in the table below. After the BALF samples in the pathological state are treated with isotonic normal saline and digested with nuclease, the host nucleic acids decrease by 50%-90%, compared with samples non-removing host nucleic acids. However, for the BALF samples simulated by Hela cells, after a treatment with isotonic normal saline and then digestion with nuclease for removing the host nucleic acids, there is no significant difference in host nucleic acids, compared with samples without removing host nucleic acids. The results show that, when the clinical samples in pathological state and the simulated samples in healthy state are treated with isotonic normal saline, the clinical samples in pathological state have the effect of removing the host nucleic acids, but the samples in healthy state have no corresponding effect.

TABLE-US-00009 TABLE 9 Comparison of samples in pathological state and simulated samples in healthy state Removing Untreated Treated host nucleic Samples Samples acids average Ct average Ct (ΔCt) BALF samples in S1 24.87 26.96 2.09 pathological state S2 25.48 26.39 0.91 S3 28.89 32.9 4.01 Samples in healthy state, M1 21.45 21.61 0.16 simulated by Hela cells M2 24.83 24.7 −0.13 M3 28.43 28.67 0.24

Example 6

[0176] Currently, for metagenomic sequencing method for pathogen detection, most of the detection cost is in the sequencing. In the past, the sequencing industry assessed that the amount of sequencing data was required to reach 20M to achieve a balance between detection sensitivity and benefit.

[0177] In this example, the fastq files of 30 sub-samples from the 57 BALF samples in Example 1 were randomly intercepted and analyzed with 5M sequencing data, and compared with the detection results of the direct nucleic acid extraction method, i.e., Method C. The results are shown in FIG. 7, which is a schematic diagram of the analysis of reads difference between the 5M reads data for samples removing host nucleic acids and the 20M reads data for samples non-removing host nucleic acids. The results show that the pathogenic microorganisms are mainly distributed on the upper side of the diagonal, and there is no obvious loss of pathogenic microorganisms.

[0178] The above results show that, by removing host nucleic acids, the sequencing data of 5M is sufficient to achieve the sensitivity of conventional detection methods, and the sequencing cost is reduced to 25% of the conventional detection methods, which has significant economic benefits.

[0179] Although the present invention has been disclosed in the form of embodiments and variations thereon, it will be understood that numerous additional modifications and variations could be made thereto without departing from the scope of the invention.

[0180] For the sake of clarity, it is to be understood that the use of ‘a’ or ‘an’ throughout this application does not exclude a plurality, and ‘comprising’ does not exclude other steps or elements.