Methods and compositions for treating HIV

Abstract

The invention features nucleic acid constructs encoding chimeric immune T-cell receptors (CIRs) that are useful for treating HIV in patients. In general, the CIRs contain an extracellular domain which targets HIV or HIV infected cells (e.g., the extracellular domain of CD4), a transmembrane domain, and a cytoplasmic domain for mediating T-cell activation (e.g., CD3 zeta and/or the partial extracellular domain of CD28). The invention also features the use of host cells expressing CIRs in the treatment of HIV.

Claims

1. A vector comprising: a) a nucleic acid construct encoding a chimeric protein comprising (i) an extracellular domain of CD4, or a fragment thereof, wherein the fragment binds specifically to gp120, (ii) a transmembrane domain, and (iii) a cytoplasmic domain comprising a) the cytoplasmic domain of the CD3 zeta chain, or a fragment thereof, wherein the fragment modulates activation of T-cells and b) the cytoplasmic domain of CD28, wherein the chimeric protein is capable of forming a homodimer when expressed in a T-cell, and b) a nucleic acid construct encoding an siRNA specific to an HIV gene, wherein the siRNA is capable of suppressing HIV infection and/or replication in a host cell expressing the chimeric protein.

2. The vector of claim 1, wherein the homodimer comprises at least one intermolecular disulfide bond.

3. The vector of claim 1, wherein said transmembrane domain comprises a polypeptide selected from the group consisting of the transmembrane domain of the CD3 zeta chain and the transmembrane domain of CD28.

4. The vector of claim 3, wherein said transmembrane domain comprises amino acids 7-30 of SEQ ID NO:3.

5. The vector of claim 1, wherein said chimeric protein further comprises a c-myc tag.

6. The vector of claim 1, wherein said extracellular domain of CD4 comprises amino acids 1-372 of SEQ ID NO:1.

7. The vector of claim 1, wherein said cytoplasmic domain of the CD3 zeta chain comprises amino acids 31-142 of SEQ ID NO:3.

8. The vector of claim 1, wherein said cytoplasmic domain of CD28 comprises amino acids 180-220 of SEQ ID NO:2.

9. The vector of claim 1, wherein said cytoplasmic domain comprises the amino acid sequence of SEQ ID NO:10.

10. The vector of claim 1, wherein said nucleic acid construct encoding an siRNA comprises a nucleic acid encoding an siRNA against CCR5 or a nucleic acid encoding an siRNA against Tat/Rev.

11. The vector of claim 1, wherein said nucleic acid construct encoding an siRNA comprises a nucleic acid encoding an siRNA against CCR5.

12. The vector of claim 1, wherein said nucleic acid construct encoding an siRNA comprises a nucleic acid encoding an siRNAagainst Tat/Rev.

13. An isolated host cell comprising the vector of claim 1.

14. The isolated host cell of claim 13, wherein said host cell is a T cell.

15. An isolated host cell comprising the vector of claim 1, wherein said nucleic acid construct encoding an siRNA comprises a nucleic acid encoding an siRNA against CCR5 or a nucleic acid encoding an siRNA against Tat/Rev.

16. The host cell of claim 15, wherein said nucleic acid construct encoding an siRNA comprises a nucleic acid encoding an siRNA against CCR5.

17. The host cell of claim 15, wherein said nucleic acid construct encoding an siRNA comprises a nucleic acid encoding an siRNA against Tat/Rev.

18. A method of treating a patient infected with HIV by administering a composition comprising said host cell of claim 13.

19. The method of claim 18, wherein said host cell is a T cell isolated from said patient.

20. The host cell of claim 15, wherein the host cell is a CD8+ T cell.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a diagram showing the structure of the indicated chimeric immune T-cell receptors (CIRs).

(2) FIG. 2 is a diagram showing the organization of an exemplary nucleic acid construct encoding a 2.sup.nd generation CIR and siRNA construct.

(3) FIG. 3 is a series of graphs showing the cellular surface expression of the indicated CIR. PBMCs were transduced with retrovirus and stained with anti-CD4-FITC and anti-CD8-APC antibodies after four days and analyzed by flow cytometry. % CD8+ cells expressing Hege CIR is 52%, 1.sup.st generation CIR is 44%, and 2.sup.nd generation CIR is 39%. A representative experiment of four is shown.

(4) FIG. 4A is a pair of graphs showing survival of the indicated cell type when incubated with HIV-infected CEM-SS cells at the indicated ratio. Transduced PBMCs were co-cultured with HIV-infected CEM-SS cells or uninfected CEM-SS cells at an Effector to Target (E:T) ratio of 1:1 or 1:10. Aliquots of cells were taken from the cultures at day three and stained with anti-CD4 and anti-CD8 antibodies as described above. Data shown is % modified cells (CD8+ CIR+) at each time point. A representative of two experiments is shown.

(5) FIG. 4B is a pair of graphs showing flow cytometry analysis from day three for Hege CIR cells. Hege CIR T-cells disappear (Hege+HIV, upper right quadrant) when cultured at an E:T ratio of 1:10. % Modified cells=(Q2/Q2+ Q4) is shown in each plot. (Q2 is upper right quadrant and Q4 is lower right quadrant.)

(6) FIG. 5 is a graph showing survival of Hege CIR cells when incubated with HIV-infected CEM-SS cells at the indicated ratio in the presence and absence of AZT. Transduced PBMCs were co-cultured with HIV-infected CEM-SS cells or uninfected CEM-SS cells at an Effector to Target (E:T) ratio of 1:1 or 1:10. Aliquots of cells were taken from the cultures at day three and stained with anti-CD4 and anti-CD8 antibodies as described for FIG. 3. Data shown is % modified cells (CD8+CIR+ cells) from one experiment.

(7) FIG. 6 is a series of graphs showing expression of the indicated markers on the indicated cells when exposed to HIV. Non-transduced or 1.sup.st and 2.sup.nd generation CIR transduced T-cells were co-cultured with HIV infected CEM-SS cells for two days and stained with anti-CD8 and anti-p24gag antibodies. An aliquot of unstained cells were washed and continued to culture for another nine days and stained with anti-CD8 and anti-p24gag antibodies. A representative of two experiments is shown. At day two, infected CD8+ cells show as a distinct population (circled) in the 1.sup.st and 2.sup.nd generation T-cells compared to non-transduced cells. There is no distinct population of cells seen in non-Td CD8+ cells (day two, upper right quadrant). % modified cells for this experiment is: 1.sup.st generation=67% and 2.sup.nd generation=68%.

(8) FIG. 7 is a graph showing the percent of specific killing as a function of the ratio of Effector to Target cells. Hege CIR, 1.sup.st, and 2.sup.nd generation T-cells were cultured with .sup.51Cr labeled uninfected or chronically infected with HIV-1 IIIB CEM-SS cells. Cytotoxicity is determined from .sup.51Cr release to the culture media after 18 hrs of co-culture at the indicated ratios of Effector to Target, and % specific killing is calculated as follows: (experimental-control)/(maximal-control)×100. % modified cells for Hege is 47%, for 1.sup.st generation is 25%, and for 2.sup.nd generation is 47%. Data shown is representative of two experiments. This is calculated by taking mean value of CEM-SS control as spontaneous release=(Expt-control)/(Max-control).

(9) FIG. 8 is a pair of graphs showing the amount of secretion of the indicated cytokine in the indicate cells types. 1.sup.st and 2.sup.nd generation T-cells were assayed for IL2 or interferon gamma (IFNγ) secretion by culturing for 24 hrs on anti-CD4 (5 μg/ml) coated plates. Data represented as fold change over 1.sup.st generation. IL2 data shown is average±SEM of three experiments. IFN-γ data shown is average±SEM of two experiments. % modified cells are similar for 1.sup.st and 2.sup.nd generation T-cells.

DETAILED DESCRIPTION OF THE INVENTION

(10) The invention features nucleic acid constructs encoding chimeric immune T-cell receptors (CIRs) that are useful for treating HIV in patients. In general, the CIRs contain an extracellular domain which targets HIV or HIV-infected cells (e.g., the extracellular domain of CD4), a transmembrane domain, and a cytoplasmic domain for mediating T-cell activation (e.g., CD3 zeta and/or the partial extracellular domain of CD28). The invention also features the use of host cells expressing CIRs in the treatment of HIV. When expressed in the host cells, the CIRs can be engineered to homodimerize, thereby increasing their potency. These host cells can also contain nucleic acid constructs encoding siRNA against HIV genes in order to, e.g., disrupt HIV infection of the host T-cells. The structure of a prior art CIR and the structures of CIRs containing the transmembrane domain of CD3 zeta and partially extracellular domain of CD28 are depicted in FIG. 1.

(11) Extracellular Domains

(12) The CIRs of the invention feature an extracellular domain able to specifically bind HIV and cells infected with HIV. The HIV protein gp120 binds human CD4. Therefore, the extracellular domain of the CIRs of the invention can include the extracellular domain of CD4 (e.g., human CD4 or fragments thereof). Alternatively, the extracellular domain can include any binding moiety specific for HIV and cells infected with HIV, including, HIV specific antibodies (e.g., single-chain Fv antibody fragments that are specific to gp120 or gp41).

(13) The extracellular domain can optionally include a further protein tag, e.g., a c-myc tag (EQKLISEEDL (SEQ ID NO:4) of human origin, at the N-terminus. The c-myc tag does not obstruct CD4 binding to gp120. Inclusion of c-myc in the sFv based-CIR design does not appear to affect CIR function, but can facilitate future study of the construct.

(14) Cytoplasmic Domains

(15) The CIRs of the invention also feature a cytoplasmic domain for signaling modulating activation of the host T-cells when bound to HIV or HIV-infected cells. Cytoplasmic domains useful for use in the CIRs of the invention include CD3 zeta, or fragments thereof, and for the cytoplasmic domain of CD28, or fragments thereof. The invention also features the fusion of polypeptides derived from multiple extracellular domains for potentiating activation of T-cells when bound to HIV or HIV-infected cells (e.g., a cytoplasmic domain that includes both active fragments of CD3 zeta and CD28).

(16) Transmembrane Domains

(17) The CIRs of the invention feature transmembrane domains derived from CD4, CD28, CD3 zeta, or another protein. Furthermore, the transmembrane domain (or the partial extracellular domains, “pEC”) can be engineered to facilitate homodimerization of the CIRs when expressed in host T-cells. This can be accomplished, e.g., with the addition or substitution of cysteine residues capable of forming disulfide bonds with a paired molecule.

(18) The inclusion of the transmembrane region of the zeta chain or the transmembrane and partial extracellular domain of CD28 provides the capability of intermolecular disulfide bonds. CIRs containing these transmembrane/partial extracellular domains are predicted to form disulfide-linked dimers through a cysteine residue located in the transmembrane of zeta or in the proximal cysteine residue located in the partial extracellular domain of CD28 (position 123 of CD28), mimicking the dimer configuration of native zeta and CD28.

(19) siRNA Constructs

(20) The DNA constructs and host cells of the invention also optionally feature components to suppress HIV infection of host T-cells. Such components include siRNA constructs for suppression of HIV replication. These siRNA constructs can be specific for various HIV targets (reviewed in Morris (2006) Gene Ther 13:553-558; Rossi (2006) Biotechniques Suppl:25-29; Nekhai (2006) Curr Opin Mol Ther 8:52-61; and Cullen (2005) AIDS Rev 7:22-25). One example is an siRNA targeting a highly conserved sequence in an exon common to both tat and rev, has been shown to be effective to prevent virus expression and replication (See, e.g., SEQ ID No. 1). In order to prevent HIV infection of host T-cells, the invention also features components to decrease expression of T cell coreceptors (e.g., CCR5 and CCR4). Such suppression would be expected to hinder infection of host T-cells as people with CCR5Δ32 mutation are resistant to HIV infection. The invention also features the inclusion of multiple siRNA constructs (e.g., constructs against HIV genes and T-cell receptors used for HIV infection). Here, one siRNA construct can block infection and while a second siRNA construct prevents progression of infection.

(21) Methods of designing and expressing siRNA constructs are well known in the art. For example, the siRNA constructs of the invention can utilize long-hairpin RNA (1hRNA) to express both CCR5 and Tat/Rev siRNAs. Use of a 1hRNA is a viable approach in controlling HIV-1 replication since a single long transcript can in theory be processed into multiple siRNAs. Multiple targeting can be achieved from a single long-hairpin precursor, suggesting that multiple siRNAs can be processed from the long hairpins in vivo. The siRNA constructs of the invention can also include a promoter directing expression in host T-cells. Examples of such promoters are U6 and tRNA promoters. Expressing shRNAs from tRNA promoters has several advantages, compared to the more commonly used U6 and H1 promoters: tRNA promoters are smaller, provide a variety of options, and are typically expressed at lower levels. Smaller promoters may be desirable in the nucleic acid constructs of the invention to facilitate inclusion in a vector including a CIR expression construct. An example of a nucleic acid construct containing a CIR and siRNA is set forth in FIG. 2.

(22) TABLE-US-00004 shRNA sequences tat/rev shRNA-sense strand SEQ ID NO: 5 5′ -GCGGAGACAGCGACGAAGAGC- 3′ Ref: Scherer, L. J., R. Frank, and J. J. Rossi. 2007. Nucleic Acids  Res 35: 2620-2628. ccr5 shRNA-sense strand SEQ ID NO: 6 5′ - GCCUGGGAGAGCUGGGGAA - 3′ Ref: Ehsani, Mol Ther Epub ahead of print. shRNA within CIR (SEQ ID NO: 7) -Myc-CD4-CD28-zeta-tcaggtggtggcggttcaggcggaggtggctctggcggtggcggatcg                                     Generic linker (G4S)3 GCCCGGATAGCTCAGTcGGTAGAGCACAGACTTTAATCTGAGGGTCCAGGGTCAAGTCCCTGTTCGGGC                        tRNA promoter GCCA GCCTGGGAGAGCTGGGGAATTTGTACGTAGTTCCCCAGCTCTCCCAGGC ccr5 shRNA sense     shRNA loop  ccr5 shRNA antisense ggtggcagtggctccggaggttcaggaagcggcggtagtgggagc           generic linker (GGSGS)3 GCGGAGACAGCGACGAAGAGCCTTCCTGTCAGAGCGGAGACAGCGACGAAGAGCTTTTTGAA tat/rev shRNA sense   shRNA loop   tat/rev shRNA      terminator                                     antisense          sequence
Nucleic Acid Constructs

(23) The nucleic acid constructs of the invention are useful for expressing CIRs and siRNA constructs in host T-cells. CIRs and siRNA constructs can be included in a single nucleic acid construct or multiple nucleic acid constructs. In order to facilitate transfection of host cells, the nucleic acid construct can be included in a viral vector (e.g., a retroviral vector or adenoviral vector) or be designed to be transfected into a host cell via electroporation or chemical means (e.g., using a lipid transfection reagent).

(24) Examples of Nucleic Acid Constructs

(25) TABLE-US-00005 Myc-CD4-zeta (1.sup.st generation (dimer)) SEQ ID NO: 8 ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGC GCTCCTCCCAGCAGCCACTCAGGGAGAGCAGAAGCTGATCTCCGAGGAGG myc (underline) ACCTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACC CD4 TGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAA CCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCAT CCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGA AACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTA CATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCG GATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACC CTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAG TCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGC TGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAG AAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGC CTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCC CACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGG CAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAA GAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGA TGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAG TATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAA GTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGA AAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTG AGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGC GGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAGTG ACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGG TCCACCCCGGTGCCTAGGCTGGATCCCAAACTCTGCTACCTGCTGGATGG zeta (Underline) AATCCTCTTCATCTATGGTGTCATTCTCACTGCCTTGTTCCTGAGAGTGA AGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAG CTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGA CAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGA ACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAG GCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCA CGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACG CC Myc-CD4-CD28-zeta (2.sup.nd generation) SEQ ID NO: 9 ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGC GCTCCTCCCAGCAGCCACTCAGGGAGAGCAGAAGCTGATCTCCGAGGAGG myc (underline) ACCTGAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACC CD4 TGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAA CCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCAT CCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGA AACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTA CATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCG GATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACC CTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAG TCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGC TGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAG AAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGC CTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCC CACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGG CAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAA GAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGA TGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAG TATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAA GTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAG AAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGC TGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAG GCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAG TGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACAT GGTCCACCCCGGTGCCTAGGAAAATTGAAGTTATGTATCCTCCTCCTTAC CD28 (underline) CTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACA CCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGC TGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTG GCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAG TGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATT ACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCAGAGTG zeta AAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCA GCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAG AACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGA GGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGC ACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGAC GCC

(26) The amino acid sequence for the CD28 and CD3 zeta portions of the 2.sup.nd generation construct is

(27) TABLE-US-00006 (SEQ ID NO: 10) K I E V Met Y P P P Y L D N E K S N G T I I H V K G K H L C P S P L F P G P S K P F W V L V V V G G V L A C Y S L L V T V A F I I F W V R S K R S R L L H S D Y Met N Met T P R R P G P T R K H Y Q P Y A P P R D F A A Y R S R V K F S R S A D A  P A Y Q Q G Q N Q L Y N E L N L G R R E E Y D V L D K R R G R D P E Met G G K P R R K N P Q E G L Y N E L Q K D K Met A E A Y S E I G Met K G E R R R G K G H D G L Y Q G L S T A T K D T Y D A
Host T-Cells

(28) The host T-cells of the invention can be isolated from, e.g., a patient infected with HIV. The host T-cells are transfected or infected with nucleic acid constructs of the invention (e.g., nucleic acid constructs encoding a CIR and, optionally, one or more siRNA constructs). Prior to administration to a patient the T-cells can be expanded in cell culture. In one embodiment, the modified T-cells are administered to the patient from whom they were originally isolated.

(29) In one embodiment, PBMCs are isolated by standard techniques and transduced with a CIR. Cells are administered to the patient in a dose of between 10.sup.9 and 10.sup.10 cells (e.g., 10.sup.9, 5×10.sup.9, or 10.sup.10 cells). Cells can be isolated once and expanded for multiple administrations or a separate isolation and transduction can be performed with each round of treatment.

(30) Treatment can be, e.g., a single treatment, monthly treatment, semi-annual treatment, or annual treatment.

(31) Additional Agents

(32) Additional antiviral can be, for example, a protease inhibitor, a reverse transcriptase inhibitor, an integrase inhibitor, a CCR5 antagonist, a fusion inhibitor, or a second maturation inhibitor. The additional antiviral agent can be, without limitation, azidovudine (AZT), didanosine (dideoxyinosine, ddl), d4T, zalcitabine (dideoxycytosine, ddC), nevirapine, lamivudine (epivir, 3TC), saquinavir (Invirase), ritonavir (Norvir), indinavir (Crixivan), and delavirdine (Rescriptor).

(33) Additional Therapies

(34) The methods of the invention can be combined with, e.g., lymphodepletion prior to administration of host T-cells. Furthermore, treatment can also include the administration of one or more cytokines, e.g., IL-2, IL-7, and IL-15.

(35) Experimental Results

(36) Construction of Retroviral Vectors

(37) The chimeric immune T-cell receptor (CIR) of the prior anti-HIV designer T cell trials had the structure of extracellular domain of CD4 (a polypeptide corresponding to amino acids 1-372 of SEQ ID NO:1), transmembrane domain of CD4 (a polypeptide corresponding to amino acids 373-395 of SEQ ID NO:1) and cytoplasmic domain of zeta (a polypeptide corresponding to amino acids 31-142 of SEQ ID NO:3) (Deeks et al. (2002) Mol Ther 5:788-797, Mitsuyasu et al. (2000) Blood 96:785-793) (herein “Hege CIR”, FIG. 1). We also designed a signal one-only CIR that is similar to the Hege CIR except that the transmembrane domain of zeta (a polypeptide corresponding to amino acids residues 7-30 of SEQ ID NO:3) was substituted (1.sup.st generation CIR, FIG. 1). Lastly, we created a construct that integrates CD28 as well as zeta signaling in a two signal format (2.sup.nd generation CIR, FIG. 1). This employs the same extracellular domain of CD4 (a polypeptide corresponding to amino acids 1-372 of SEQ ID NO:1) with a partial extracellular doman/transmembrane domain/cytoplasmic domain of CD28 (a polypeptide corresponding to amino acids 127-234 of SEQ ID NO:2) and is expressed as dimer.

(38) In addition, a c-myc tag (EQKLISEEDL) of human origin is also included in our constructs at the N-terminus of CD4.

(39) 1.sup.st and 2.sup.nd generation CIRs were constructed in the MFG retrovirus vector. Retrovirus was created by ping pong between the E+86 ecotropic and PG13 amphotropic cell lines. PG13 is a helper cell line derived from murine fibroblasts that is used to create vector producer cells (VPC) for retroviral production. VPCs were sorted for the highest transgene expression and viral supernatants were harvested as described Beaudoin et al. ((2008) J Virol Methods 148:253-259).

(40) Expression of CIRs

(41) Viral supernatants from PG13 VPCs were used to transduce human PBMCs. PBMCs from normal healthy individuals were purified and activated with anti-CD3 antibody (OKT3) and 100 U/ml IL2 for two days and transduced with retrovirus by spinoculation on a retronectin coated plate. We determined the surface expression of CIRs on CD8+ T-cells by double staining for CD8 and CD4 and determined the transduction rate (as % modified cells, FIG. 3). Transduction of activated human T-cells routinely yield 40 to 70% transduction rates with these anti-HIV CIRs.

(42) We co-cultured transduced or non-transduced T-cells with CEM-SS HIV+ (chronically infected with HIV-1 IIIB) or HIV-cells (at an E:T ratio of 1:1 or 1:10). We determined the presence of transduced cells in the culture by staining with anti-CD4 and anti-CD8 antibodies. Co-culture of Hege CIR T-cells with CEM-SS HIV+ cells at an E:T ratio of 1:10 induced cell death and all the Hege CIR cells disappeared from the culture by day 3 (FIG. 4). At an E:T ratio of 1:1, Hege CIR T cells were still present in the culture at day 13, with killing of all target cells in the culture (observed by flow cytometry analysis). Cell death observed in the Hege CIR designer T-cells could be either due to heightened sensitivity to Activation Induced Cell Death (AICD) or to HIV infection. To test this, Hege CIR cells were treated with anti-retroviral drug AZT and co-cultured with HIV infected CEM-SS cells. AZT treated Hege CIR cells did not die when co-cultured with higher target ratio (1:10, FIG. 5). These data suggest that Hege CIR cells become infected with HIV and die by either HIV induced apoptosis or killed by other CIR containing T-cells (fratricide). These data suggest and we hypothesize that one of the reasons for the failure of Hege CIR in the clinical trials could be due to highest susceptibility to HIV infection and elimination from the patients.

(43) Susceptibility of Designer T-Cells to HIV Infection

(44) HIV infects CD4+ T-cells by binding to CD4 receptor and a co-receptor (CXCR4 or CCR5). Since CIR has an extracellular CD4 domain, we postulated that this could be used by HIV to infect all CIR+ T-cells, including CD8+ T-cells. HIV infection of CIR+CD8+ cells was determined by co-culturing CIR containing T-cells with HIV+ CEM-SS cells and staining for p24-gag antigen, an indicator of productive infection. After two days of culture, cells were stained with anti-CD8 and anti-p24 gag antibodies. In contrast to non-transduced cultures, CD8+ cells are infected with HIV in transduced cultures (1.sup.st and 2.sup.nd generation) (FIG. 6). At day 11 we did not detect any HIV infected CD8+ cells in either 1.sup.st or 2.sup.nd generation CIR containing T-cells (FIG. 6).

(45) Killing of HIV-Infected Cells by Modified T-Cells.

(46) In order to compare the potencies of Hege CIR, 1.sup.st, and 2.sup.nd generation anti-HIV CIR in killing of target cells, activated T-cells were transduced as described above. Target cells (HIV-infected or uninfected CEM-SS cells) were labeled with .sup.51Cr for 5 hrs (50 μCi for 1×10.sup.6 cells) and co-cultured with transduced T-cells at indicated E:T ratios for 18 hrs. Hege CIR T-cells and our 1.sup.st and 2.sup.nd generation designer T-cells were all equally potent in killing HIV+ target cells (FIG. 7).

(47) Cytokine Secretion by Modified T-Cells.

(48) Human T-cells transduced with 1.sup.st and 2.sup.nd generation CIR containing T-cells were tested for their ability to secrete cytokines upon stimulation through the CIR. Transduced or non-transduced T-cells were cultured on anti-CD4 antibody coated plates for 24 hrs. IL2 secretion was measured with an ELISA kit. 2.sup.nd generation T-cells produced more IL2 than 1.sup.st generation T-cells when stimulated with anti-CD4 antibody (FIG. 8). In contrast, IFNγ secretion is similar with anti-CD4 stimulation of 1.sup.st and 2.sup.nd generation designer T-cells, as is typical for T cell signaling.

(49) Conferring Resistance of Designer T-Cells to HIV Infection

(50) HIV infects CD4+ T-cells by binding to CD4 receptor and a co-receptor (CXCR4 or CCR5). As shown above, CD8+ CIR+ cells (1.sup.st and 2.sup.nd generation) are susceptible to HIV infection (day two, FIG. 6). At day 11 we did not detect any HIV infected CD8+ cells in either 1.sup.st or 2.sup.nd generation T-cells (FIG. 6). These data suggest that modified T-cells could kill other HIV infected modified T-cells. Nevertheless, this is a potential source of loss of effector cells to combat HIV and provides a new reservoir to increase patient HIV load. It is therefore becomes important to eliminate or reduce the potential for HIV to infect modified T-cells.

Other Embodiments

(51) Various modifications and variations of the described methods and compositions of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific desired embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the fields of medicine, immunology, pharmacology, endocrinology, or related fields are intended to be within the scope of the invention.

(52) All publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent publication was specifically and individually incorporated by reference.