DIAGNOSIS AND TREATMENT OF CANCERS SHOWING HIGH EXPRESSION OF PIWI AND/OR NMD COMPLEX PROTEIN

20230184774 · 2023-06-15

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides an application of a drug or a pharmaceutical composition in the treatment of cancers showing high expression of PIWI and/or an NMD complex protein, such as gastric cancer. When applied in the treatment of cancers showing high expression of PIWI and/or an NMD complex protein, such as gastric cancer, the drug or the pharmaceutical composition of the present invention not only can effectively treat cancers, particularly gastric cancer, but also has higher specificity and will not cause harm to normal cells and body functions.

    Claims

    1-11. (canceled)

    12. A method for diagnosing or treating cancers with expression of PIWI and NMD complex proteins, wherein the method comprises diagnosis or treatment using a medicament that targets PIWI or reduces expression of PIWI or NMD complex proteins, or using the pharmaceutical composition comprising the medicament that targets PIWI or reduces expression of PIWI or NMD complex proteins.

    13. The method of claim 12, wherein the method comprises diagnosis or treatment using the medicament by one or more of following mechanisms: (a) to inhibit growth of cancer cells; (b) to inhibit progression of cancer cell cycle; (c) to inhibit migration of cancer cells; (d) to inhibit tumorigenicity of cancer cells; (e) to inhibit metastasis of cancer cells in vivo; (f) to regulate cell cycle pathways of cancer cells; (g) to regulate focal adhesion and adherens junction signaling pathways of cancer cells.

    14-15. (canceled)

    16. A method for inhibiting growth of cancer cells, inhibiting operation of cancer cell cycle, inhibiting migration of cancer cells, inhibiting tumorigenesis ability of cancer, inhibiting metastasis ability of cancer, regulating signaling pathways of cancer cell cycle or focal adhesion and adherens junction signaling pathways of cancer cells, wherein the method comprises inhibition or regulation by a medicament that targets PIWI or reduces expression of PIWI or NMD complex proteins, or using the pharmaceutical composition comprising the medicament that targets PIWI or reduces expression of PIWI or NMD complex proteins; wherein the cancer is a cancer with expression of PIWI and NMD complex proteins.

    17-18. (canceled)

    19. A use of PIWI in screening of a medicament that diagnoses or treats cancers with expression of PIWI and NMD complex proteins, wherein the medicament targets PIWI or reduces expression of PIWI or NMD complex proteins; preferably, the cancer is a cancer with expression of NMD complex proteins and high expression of PIWI; more preferably, the cancer is a cancer with expression of NMD complex proteins and high expression of PIWI; furthermore preferably, the cancer is a cancer with high expression of PIWI and NMD complex proteins.

    20. (canceled)

    21. A use of PIWI or NMD complex proteins as biomarkers or therapeutic targets for cancers with expression of PIWI and NMD complex proteins; preferably, the PIWI comprises PIWIL1, PIWIL2, PIWIL3 and PIWIL4; or, the NMD complex proteins are UPF1, UPF2, SMG1, UPF3, SMG5, SMG6 and SMG7, preferably UPF1, UPF2 and SMG1, or, the cancer is gastric cancer, such as early or advanced gastric cancer; more preferably, the cancer is a cancer with expression of NMD complex proteins and high expression of PIWI; furthermore preferably, the cancer is a cancer with high expression of PIWI and NMD complex proteins.

    22. A biomarker for detection or diagnosis of cancers with expression of PIWI and NMD complex proteins, wherein the biomarker comprises PIWI and NMD complex proteins; preferably, the PIWI comprises PIWIL1, PIWIL2, PIWIL3 and PIWIL4; or, the NMD complex proteins are UPF1, UPF2, SMG1, UPF3, SMG5, SMG6 and SMG7, preferably UPF1, UPF2 and SMG1, or, the cancer is gastric cancer, such as early or advanced gastric cancer; more preferably, the cancer is a cancer with expression of NMD complex proteins and high expression of PIWI; furthermore preferably, the cancer is a cancer with high expression of PIWI and NMD complex proteins.

    23. A kit for detection or diagnosis of cancers with expression of PIWI and NMD complex proteins, wherein the kit comprises antibodies for detection of PIWI and antibodies for detection of NMD complex proteins; preferably, the PIWI comprises PIWIL1, PIWIL2, PIWIL3 and PIWIL4; or, the NMD complex proteins are UPF1, UPF2, SMG1, UPF3, SMG5, SMG6 and SMG7, preferably UPF1, UPF2 and SMG1, or, the cancer is gastric cancer, such as early or advanced gastric cancer; more preferably, the cancer is a cancer with expression of NMD complex proteins and high expression of PIWI; furthermore preferably, the cancer is a cancer with high expression of PIWI and NMD complex proteins.

    24. The method of claim 12, wherein the cancer is a cancer with expression of NMD complex proteins and high expression of PIWI; more preferably, the cancer is a cancer with high expression of PIWI and NMD complex proteins.

    25. The method of claim 12, wherein the PIWI comprises PIWIL1, PIWIL2, PIWIL3 and PIWIL4.

    26. The method of claim 12, wherein the NMD complex proteins are UPF1, UPF2, SMG1, UPF3, SMG5, SMG6 or SMG7; preferably, the NMD complex proteins are UPF1, UPF2 or SMG.

    27. The method of claim 12, wherein the medicament blocks binding of PIWI and NMD complex proteins, or reduces expression of PIWI and NMD complex proteins; preferably, the medicament blocks binding of PIWIL1 and UPF1 complex proteins.

    28. The method of claim 12, wherein the medicament is a small molecule substance, for example, a small molecule chemical substance such as a small molecule compound, or a small molecule biological substance such as a small molecule active peptide; the small-molecule compound preferably exists in a form of a pharmacologically acceptable salt of the compound, a solvent complex of the compound, a solvent complex of a pharmacologically acceptable salt of the compound, or a crystalline form of the compound; or, the medicament is a macromolecular substance, for example, a macromolecular biological substance such as a polysaccharide, a protein such as an antibody, a nucleic acid, or a macromolecular chemical substance such as a polymer compound; or, the medicament is an extract of traditional Chinese medicine and/or an animal or plant.

    29. The method of claim 12, wherein the cancer is gastric cancer, such as early or advanced gastric cancer.

    30. The method of claim 16, wherein the cancer is a cancer with expression of PIWI and NMD complex proteins, preferably the cancer is a cancer with high expression of PIWI and existence of NMD complex proteins.

    31. The method of claim 16, wherein the PIWI comprises PIWIL1, PIWIL2, PIWIL3 and PIWIL4.

    32. The method of claim 16, wherein the NMD complex proteins are UPF1, UPF2, SMG1, UPF3, SMG5, SMG6 or SMG7; preferably, the NMD complex proteins are UPF1, UPF2 or SMG.

    33. The method of claim 16, wherein the medicament blocks binding of PIWI and NMD complex proteins, or reduces expression of PIWI and NMD complex proteins; preferably, the medicament blocks binding of PIWIL1 and UPF1 complex proteins.

    34. The method of claim 16, wherein the medicament is a small molecule substance, for example, a small molecule chemical substance such as a small molecule compound, or a small molecule biological substance such as a small molecule active peptide; the small-molecule compound preferably exists in a form of a pharmacologically acceptable salt of the compound, a solvent complex of the compound, a solvent complex of a pharmacologically acceptable salt of the compound, or a crystalline form of the compound; or, the medicament is a macromolecular substance, for example, a macromolecular biological substance such as a polysaccharide, a protein such as an antibody, a nucleic acid, or a macromolecular chemical substance such as a polymer compound; or, the medicament is an extract of traditional Chinese medicine and/or an animal or plant.

    35. The method of claim 16, wherein the cancer is gastric cancer, such as early or advanced gastric cancer.

    Description

    DESCRIPTION OF DRAWINGS

    [0154] FIG. 1 shows mRNA expression of PIWIL1 in six different human gastric cancer cell lines and one normal gastric epithelial cell line.

    [0155] FIG. 2 shows protein expression of PIWIL1 in six different human gastric cancer cell lines, one normal gastric epithelial cell line and positive control of mouse testis.

    [0156] FIG. 3 shows the immunofluorescence results, which indicates that PIWIL1 protein was mainly localized in the cytoplasm of gastric cancer cell.

    [0157] FIG. 4 shows the relative PIWIL1 mRNA levels in gastric cancer samples from 97 patients as compared to their paired normal tissues.

    [0158] FIG. 5 shows the protein expression of PIWIL1 and the location of PIWIL1 protein in 104 paired samples of gastric cancer tissue microarray.

    [0159] FIG. 6 shows that PIWIL1 expression is positively correlated with tumor grade and metastasis, and negatively correlated with the degree of tumor differentiation.

    [0160] FIG. 7 shows the successful knockout of PIWIL1 in gastric cancer cell SNU-1 using CRISPR-Cas9 technology.

    [0161] FIG. 8 shows that knockout of PIWIL1 at either normal serum concentration or low serum concentration (starvation) significantly inhibited the growth of gastric cancer cell SNU-1, and the inhibition effect was more obvious at the low serum concentration of 5% FBS.

    [0162] FIG. 9 shows that knockout of PIWIL1 inhibited cell cycle G1/S transition in gastric cancer cells.

    [0163] FIG. 10 shows that knockout of PIWIL1 inhibited cell migration of gastric cancer cells

    [0164] FIG. 11 shows that knockout of PIWIL1 inhibits subcutaneous tumorigenesis of gastric cancer cells in nude mice.

    [0165] FIG. 12 shows that knockout of PIWIL1 inhibited metastasis of gastric cancer cell in nude mice.

    [0166] FIG. 13 shows that RNA-Seq data from WT and PIWIL1-KO SNU-1 cells analyzed by weighted gene co-expression network analysis (WGCNA) identified 41 co-expressing modules, and the genes of 41 co-expressing modules were found to be regulated by PIWIL1.

    [0167] FIG. 14 shows that among all the gene modules regulated by PIWIL1, the blue module and turquoise module are the two modules of genes most related to PIWIL1 trait and most significantly regulated by PIWIL1. After analyzing the genes of these two modules, it was found that the cell cycle pathway, focal adhesion and adherens junction signaling pathways of cancer cells were most significantly enriched in these two modules.

    [0168] FIG. 15 shows that the mRNA expression of some important oncogenic genes related to cell cycle is inhibited by PIWIL1 knockout; the mRNA expression of some important tumor suppressor genes related to cell migration is promoted by PIWIL1 knockout.

    [0169] FIG. 16 shows that in gastric cancer cell SNU-1 with high expression of PIWI L1, piRNA expression could hardly be detected, and even piRNA enriched by PIWIL1 could not be detected.

    [0170] FIG. 17 shows that PIWIL1 mutant lacking piRNA binding ability can still regulate PIWIL1 downstream target genes and play an oncogenic function as wild-type PIWIL1 in gastric cancer.

    [0171] FIG. 18 shows that experimental results of PIWIL1 immunoprecipitation coupled Mass-Spectrum (PIWIL1-IP MS) shows that PIWIL1 could bind to UPF1 protein.

    [0172] FIG. 19 shows that PIWIL1 immunoprecipitated nonsense mRNA decay (NMD) complex proteins UPF1, UPF2, SMG1 and activated UPF1 (phosphorylated UPF1).

    [0173] FIG. 20 shows immunofluorescence results, which indicates that PIWIL1 could colocalize with UPF1 in P-bodies which the NMD pathway works in.

    [0174] FIG. 21 shows the specific binding region of PIWIL1 responsible for binding to UPF1, and that disruption of this binding region significantly disrupted the binding of PIWIL1 to UPF1, whereas disruption of piRNA binding site did not affect the binding of PIWIL1 to UPF1.

    [0175] FIG. 22 shows that loss of binding ability to UPF1 significantly affected the expression regulation of some downstream tumor suppressor genes related to cell migration by PIWIL1, and significantly affected the regulation of cell migration by PIWIL1.

    [0176] FIG. 23 shows a pattern diagram, which exhibits that different from the co-function of PIWI-piRNA complex formed by PIWI protein and piRNA in the germline, piRNA, the classic partner of PIWIL1, is almost absent in gastric cancer cells. PIWIL1 regulates the growth, migration, tumorigenesis and metastasis of gastric cancer cells through other piRNA-independent pathways, such as NMD pathway in gastric cancer.

    SPECIFIC IMPLEMENTATION MODE

    [0177] The invention is further described below by means of Examples without thereby limiting the present invention to the scope thereof. The experimental methods not specified in the following embodiments shall be selected according to the conventional methods and conditions, or according to the product instructions.

    Example 1 PIWIL1 was Highly Expressed in Gastric Cancer Cells and Tissues

    [0178] 1.1 mRNA expression of PIWIL1 in gastric cancer cells

    [0179] RNA was extracted from six different gastric cancer cell lines (AGS, HGC-27, N87, SNU-5, SNU-16 and SNU-1) and a normal gastric epithelial cell line (GES-1). The corresponding cDNA was obtained by reverse transcription, and the mRNA expression of PIWIL1 and β-Actin was detected by quantitative RT-PCR. The relative expression level of PIWIL1 in each sample was calculated using the expression level of β-Actin as the internal standard to normalize the level of PIWIL1 from the same sample (Ct.sub.PIWIL1−Ct.sub.Actin=ΔCt.sub.PIWIL1). The mRNA level of GES-1 was normalized to 1, the ratio of the relative expression of PIWIL1 in each gastric cancer cell (ΔCt.sub.PIWIL1.sub.T) to the relative expression of PIWIL1 of GES-1 (ΔCt.sub.PIWIL1.sub.N) was calculated, that is, the expression multiple of PIWIL1 in each gastric cancer cell higher or lower than that of GES-1 (ΔCt.sub.PIWIL1.sub.T−ΔCt.sub.PIWIL1.sub.N=ΔΔCt.sub.PIWIL1). Based on the relative multiplication of these seven cell lines, the bar graph of FIG. 1 was made. Ct values of each quantitative RT-PCR sample were averaged from biological replicates of three independent samples. FIG. 1 shows that the mRNA expression of PIWIL1 in different gastric cancer cells is higher than that in normal gastric epithelial cells.

    [0180] 1.2 Expression and Localization of PIWIL1 Protein in Gastric Cancer Cells

    [0181] Proteins were extracted from six different gastric cancer cell lines (AGS, HGC-27, N87, SNU-5, SNU-16 and SNU-1) and a normal gastric epithelial cell line (GES-1). The protein expressions of PIWIL1 and β-Actin were detected by Western Blot. FIG. 2 shows that the protein expression of PIWIL1 in different gastric cancer cells is higher than that in normal gastric epithelial cells.

    [0182] Immunofluorescence assay was performed in the cell line SNU-1 with the highest mRNA and protein expression of PIWIL1, and PIWIL1 antibody was used as the primary antibody. In FIG. 3, the dark fluorescence signal is the protein signal of PIWIL1, and the light fluorescence signal is the nuclear DAPI signal, FIG. 3 shows that PIWIL1 is largely expressed in the cytoplasm of gastric cancer cells.

    [0183] 1.3 mRNA Expression of PIWIL1 in Gastric Cancer Tissues

    [0184] 97 pairs of clinical samples of gastric tumor tissues and normal tissues were collected, RNA was extracted and the corresponding cDNA was obtained by reverse transcription. The mRNA expression levels of PIWIL1 and β-Actin were detected by quantitative RT-PCR. The expression level of β-Actin was used as the internal standard in each sample, the relative expression of PIWIL1 in each sample was calculated (Ct.sub.PIWIL1−Ct.sub.Actin=ΔCt.sub.PIWIL1), The relative expression of PIWIL1 in tumor tissue samples of each pair of samples ΔCt.sub.PIWIL1.sub.T was compared with the relative expression of PIWIL1 in normal tissue samples ΔCt.sub.PIWIL1.sub.N to obtain the differential expression of PIWIL1 in each pair of samples. Based on the differential expression fold of PIWIL1 in each pair of samples, the column of FIG. 1 was made. A value of Y coordinate >1 in FIG. 2 indicates that the mRNA expression of PIWIL1 in tumor tissue samples in each pair of samples is more than two times higher than that in the corresponding normal tissue samples. Ct values of each quantitative RT-PCR sample were averaged using three technical replicates. FIG. 4 shows that in 63 out of 97 paired gastric cancer samples, PIWIL1 mRNA expression was twice in the tumor than that in the normal tissue.

    [0185] 1.4 Expression and Localization of PIWIL1 Protein in Gastric Cancer

    [0186] The expression of PIWIL1 protein in tissue microarrays representing 104 gastric cancer patients was examined by immunohistochemistry (IHC) staining. The brown signal was the positive signal of PIWIL1. The left panel (A) of FIG. 5 is a representative IHC of PIWIL1 compared with paired normal tissues, which shows that PIWIL1 protein expression in gastric cancer tissues is significantly higher than that in paired normal tissues, and most of the PIWIL1 signal is in the cytoplasm. The box plot (B) in the upper right panel of FIG. 5 shows IHC scores tissue microarrays of PIWIL1 expression in 104 pairs of paired tumor and normal tissues in the gastric cancer. Each tissue spot on the tissue microarray was scored by stain strength (range from 0 to 3) and the percentage of PIWIL1-positive cells (range from 0 to 4), respectively. By scoring the positive scores of PIWIL1 immunohistochemical staining, it was found that PIWIL1 score in gastric cancer tissues was significantly higher than that in the paired normal tissues. The bar graph (C) in the lower right panel of FIG. 5 shows by counting the number of tissue pairs in which the IHC score is higher than, equal to, and lower than that in the paired normal tissue, respectively, the sample number in the T>N group (the IHC score is higher than that in the paired normal tissue) is significantly larger than the sample number in the two other groups.

    [0187] 1.5 The Expression of PIWIL1 in Gastric Cancer is Closely Related to the Clinicopathological Progression of Gastric Cancer

    [0188] The mRNA expression of PIWIL1 in 97 paired clinical patient samples was correlated and analyzed with pathological information (tumor stage, TNM metastasis, and differentiation degree) of these patient samples, FIG. 5 shows the expression of PIWIL1 mRNA in gastric cancer samples is significantly positive correlated with both metastasis and the tumor-node-metastasis (TNM) stage, the higher expression of the PIWIL1 mRNA, the lower the differentiation of gastric cancer and the more malignant the tumor. While the expression of PIWIL1 mRNA negative correlated with the degree of differentiation. These results suggest that the expression of PIWIL1 is closely related to the malignancy and tumor progression of gastric cancer. In FIG. 6, I, II, III, and IV denote stages 1-4. NO: no nodes metastasis are involved; N: lymph node metastasis including N1, N2, and N3; M: distant metastasis. In the lower graph: P: poor differentiation; M: moderate differentiation; H: high differentiation. SE represents standard error.

    [0189] In conclusion, it can be seen from this Example that PIWIL1 is specifically highly expressed in clinical tissues of gastric cancer patients and various gastric cancer cell lines compared with normal tissues and cell lines. The present invention proves for the first time that the gastric cancer cell line SNU-1 is a cell line with very high expression of PIWIL1. The gastric cancer cell line SNU-1 with high abundance of PIWIL1 expression can be an effective tool for screening new medicament that targets PIWIL1. The selected molecules may be (but are not limited to) proteins, antibodies, small chemical molecules, extracts of traditional Chinese medicine, and extracts of animal or plant. In addition, this Example shows that the higher the expression of PIWIL1, the higher the pathological stage of gastric cancer patients; the higher the expression of PIWIL1, the higher the degree of metastasis; the higher the expression of PIWIL1, the lower the degree of differentiation, which shows that the expression of PIWIL1 is closely related to the clinical outcome of gastric cancer, indicating that PIWIL1 is expected to be a biomolecular marker for the diagnosis and classification of gastric cancer.

    [0190] Materials and Methods

    [0191] RNA Extraction and Quantitative RT-PCR

    [0192] Total RNA was isolated by TRIzol (Invitrogen) for the RNA extraction methods of the samples in steps 1.1 and 1.2, according to the instructions of the manufacturer. For reverse transcription, we used the ABI High Capacity cDNA Reverse Transcription kit (Life Technologies, 4368814). Quantitative RT-PCR reactions were performed according to the instructions of the Bio-Rad real-time PCR system (iQ™ SYBR Green Supermix and CFX96™ real-time system). Quantitative PCR primers are listed in Table 1.

    [0193] Cell Culture and Clinical Samples

    [0194] SNU-5 cells were cultured in IMDM medium (ThermoFisher Scientific, 31980030) supplemented with 20% fetal bovine serum. SNU-1, SNU-16, N87, and HGC-27 cells were cultured in RPMI 1640 medium (ThermoFisher Scientific, 61870036) supplemented with 10% fetal bovine serum. AGS cells were cultured in ATCC-formulated F-12K Medium (ATCC, 30-2004) supplemented with 10% fetal bovine serum. GES-1 cells were cultured in DMEM medium (ThermoFisher Scientific, 11995065) supplemented with 10% fetal bovine medium. All these cell lines were incubated at 37° C. with 5% CO.sub.2.

    [0195] 97 pairs of clinical samples were purchased from the tissue bank of the Institute of Health Sciences, Chinese Academy of Sciences. The local ethics committee approved the study, and the regulations of this committee were followed.

    [0196] Western Blotting Analysis

    [0197] Total proteins were extracted by lysis buffer [20 mM Tris-HCl pH7.4, 150 mM NaCl, 1% (v/v) IGEPAL® CA-630 (Millipore SIGMA, Cat #I8896), 1 mM EDTA, 0.5 mM DTT, cOmplete™ EDTA-free Protease Inhibitor Cocktail Tablets (MERCK, Cat #4693132001), and PhosStop Tablets (MERCK, Cat #4906837001)]. Protein samples were diluted (3:1) with a 4 Laemmli sample buffer (Biorad, Cat #1610747) and heated at 98° C. for 5 min. Proteins were isolated by the TGX Fast Cast acrylamide kit, 7.5% or 10% (Bio-Rad, 1610173TA) at 120 V, and electrotransferred to a PVDF membrane (Merck/Millipore, IPVH00010) at 0.3A for 1.5 h. The membrane was blocked with 5% Difco™ skim milk (BD Biosciences, 232100) at room temperature for 2 h, which was diluted with TBS (Bio-Rad, 1706435) supplemented with 0.1% Tween 20 (Santa Cruz Biotechnology, sc-29113). PIWIL1 antibody (Abcam, ab181056) was used at 1:1000 dilutions.

    [0198] Immunofluorescence Microscopy

    [0199] 2×10.sup.5 cells were seeded on a coverslip (Fisher, 12-545-83) in a 24-well plate. After 24 h, cells were washed three times in PBS and then fixed in 4% formaldehyde (paraformaldehyde powder, 95%, 158127-2.5KG, Sigma) at room temperature for 15 min. The fixed cells were washed in ice-cold PBST (1% Tween 20 in PBS) three times (5 min each wash), blocked in 3% BSA in PBST at room temperature for 2 h, and washed in PBST once, and then incubated with anti-PIWIL1 (Abcam, Cat #ab181056, 1:100 dilution), anti-hDcp1a (56-Y) antibodies (Santa Cruz Biotechnology, sc-100706, 1:500 dilution), and anti-UPF1 (Cell Signaling TECHNOLOGY, Cat #12040, 1:200 dilution) in 3% BSA at 4° C. overnight. After incubation, cells were washed five times in PBST, 5 min each time. Cells were incubated with the secondary antibody of FITC-conjugated AffiniPure goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories, Cat #115-095-003, 1:100 dilution) or FITC-conjugated AffiniPure goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories, Cat #111-095-003, 1:100 dilution) or Alexa Fluor 594-conjugated AffiniPure goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories, 115-585-003, Cat #1:400 dilution) or Alexa Fluor 680 (ThermoFisher Scientific, Cat #A10043, 1:500 dilution) highly cross-absorbed with donkey anti-rabbit IgG (H+L) diluted in PBST containing 3% BSA at room temperature for 2 h, followed washing once with PBST for 5 min. DAPI (Life Technologies, D1306, 1:5000 dilution) was then added to the PBST buffer and incubated at room temperature for 10 min, followed by washing three times in PBST, 5 min each time. Coverslips were removed one at a time, and we added one drop of FluorPreserve™ (Merck/Millipore, Cat #345787-25MLCN), mounted them to the glass slide, pressed gently, sealed them with nail polish, and stored them at 4° C. overnight before confocal immunofluorescence microscopy (Zeiss, LSM710).

    [0200] Immunohistochemistry

    [0201] Human gastric cancer tissue chip (Cat #HStm-Can090PT-01) was purchased from Shanghai Superchips Company. Mouse tumors for immunohistochemistry were harvested from xenograft mice, cut into 10-micrometer-thick consecutive sections, and mounted on glass slides. After deparaffinized, rehydrating, antigen retrieval, and blocking endogenous peroxidases, the sections or tissue chip were washed three times in PBS for 5 mins each and blocked for 1 h in 0.01 mol/L PBS supplemented with 0.3% Triton X-100 and 5% normal goat serum, followed by addition of anti-PIWIL1 antibody (Atlas antibody, HPA018798, 1:1000 dilution), or anti-PCNA antibody (Servicebio, GB11010-1, 1:1000 dilution), or anti-Ki67 antibody (Servicebio, GB13030-2, 1:300 dilution) at 4° C. overnight. After brief washing in 0.01 mol/L PBS, sections were exposed for 2 hours to 0.01 mol/L PBS containing horseradish peroxidase-conjugated rabbit anti-goat immunoglobulin G (1:500), followed by development with 0.003% H.sub.2O.sub.2 and 0.03% 3,3′-diaminobenzidine in Tris-HCl (pH 7.6). Immunohistochemistry for each sample was performed at least three separate times, and all sections were counterstained with hematoxylin.

    Example 2 PIWIL1 Promotes Gastric Cancer Cell Growth, Migration, Tumorigenesis and Metastasis In Vivo

    [0202] 2.1 PIWIL1 was successfully knocked out in gastric cancer cell SNU-1 by CRISPR-Cas9 technology

    [0203] A pair of sgRNAs were cloned into a pGL3-U6-sgRNA-PGK-puromycin vector. pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Professor Xingxu Huang (Addgene plasmid #51133; http://n2t.net/addgene:51133; RRID: Addgene: 51133). Based on the method (24) of Professor Huang Xingxu's Nature Methods article, the constructed PIWIL1-sgRNA plasmid and Cas9 plasmid were co-transferred into SNU-1 cells. 48 hours after transfection, Puromycin and Blasticidin S were added for cell clone selection. The genomes of the selected cell clones were extracted, and genomic PCR was performed for the identification of PIWIL1-knockout cell clone. The PCR products were sequenced for the first generation, and the sequence of the wild-type PIWIL1 gene was compared to determine whether there were any deletions or insertional mutations in the PIWIL1 gene sequence of cell clones that resulted in frameshift of the amino acid encoding PIWIL1 protein, leading to the premature stop code of PIWIL1 translation. By Western blotting assay and DNA sequencing of PIWIL1 mutant cell clones, we found that we successfully knocked out PIWIL1 in gastric cancer cell line SNU-1(FIG. 7). The sgRNA and PCR primers for knocking out PIWIL1-genomes are listed in Table 2.

    [0204] 2.2 Knockout of PIWIL1 Inhibited the Growth of Gastric Cancer Cells

    [0205] We analyzed the growth curve of SNU-1 cell clones with or without PIWIL1-KO in normal 10% FBS or starvation 5% FBS cell culture medium conditions by MTS assay in biological triplicates (SNU-1 cell clone without PIWIL1-knockout: Wide type (WT) and Knockout control (KO-Con); SNU-1 cell clone with PIWIL1-knockout: PIWIL1-knockout clone #20 and PIWIL1-knockout clone #37). The growth of cells with and without PIWIL1 knockout were compared. FIG. 8 shows that PIWIL1 knockdown significantly inhibited the growth of gastric cancer cells, especially under the condition of serum starvation.

    [0206] 2.3 Knockout of PIWIL1 Inhibited the Cell Cycle of Gastric Cancer Cells

    [0207] Cell cycle PI-staining assay of PIWIL1-WT (WT and KO-Con) or PIWIL1-KO (KO-#20 and KO-#37) SNU-1 cells were performed by Flow Cytometry. FIG. 9 shows that knockout of PIWIL1 significantly inhibited the G1/S phase transition of gastric cancer cells SNU-1.

    [0208] 2.4 Knockout of PIWIL1 Inhibited Cell Migration of Gastric Cancer Cells

    [0209] By Transwell migration assay, cells of PIWIL1 wild-type (WT), PIWIL1 knockout control (KO-Con), PIWIL1 knockout cell clone #20 and PIWIL1 knockout cell clone #37 were photographed and observed, and the number of migrating cells with green fluorescent dye was counted. FIG. 10 shows that knockout of PIWIL1 significantly inhibited the cell migration of gastric cancer cell SNU-1.

    [0210] 2.5 Knockout of PIWIL1 Inhibited Tumorigenesis of Gastric Cancer Cells In Vivo

    [0211] PIWIL1 wild-type (WT), PIWIL1 knockout control (KO-Con), PIWIL1 knockout cell clone #20 and PIWIL1 knockout cell clone #37 were subcutaneously injected into nude mice, five mice in each group. Body weight and tumor growth were observed once a week. FIG. 11 shows that the tumorigenesis ability of PIWIL1-knockout gastric cancer cells in mice is much lower than that of wild-type PIWIL1 gastric cancer cells.

    [0212] 2.6 Knockout of PIWIL1 Inhibited the Metastasis of Gastric Cancer Cells In Vivo PIWIL1

    [0213] PIWIL1 wild-type (WT), PIWIL1 knockout control (KO-Con), PIWIL1 knockout cell clone #20 and PIWIL1 knockout cell clone #37 were infected with virus with both luciferase and GFP (green fluorescence). Luciferase and GFP double positive cells were obtained by flow cytometry. The four groups of positively labeled cells were injected into nude mice through the tail vein, five mice in each group. The fluorescence intensity of luciferase, which represents the size of tumor metastases in mice, was monitored by photographing every week. FIG. 12 shows that the metastasis ability of PIWIL1 knockout gastric cancer cells in mice is much lower than that of wild-type PIWIL1 gastric cancer cells.

    [0214] In conclusion, this Example shows that knockout of PIWIL1 in gastric cancer cells can significantly inhibit cell growth, cell cycle and cell migration, and effectively inhibit tumorigenesis and metastasis of gastric cancer cells in nude mice.

    [0215] Materials and Methods

    [0216] Cell Proliferation Assays

    [0217] Cell proliferation was determined using CellTiter 96_AQueous MTS (3-(4,5-dimethylthiazol-2-yr)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H tetrazolium, inner salt) reagent powder (Promega, G1111) according to the instructions of the manufacturer. Absorbance at 490-nm wavelength was read using EnSpire_multimode plate readers (PerkinElmer Life Sciences).

    [0218] Transwell Migration Assay

    [0219] The transwell assay was performed using Corning FluoroBlok™ cell culture inserts (Falcon, 351152) according to the instructions of the manufacturer. 1×10.sup.5 cells were seeded in each well. After three hours, cells were stained and photographed.

    [0220] In Vivo Tumorigenicity Assay

    [0221] Five-week-old male nude mice were housed under standard conditions. SNU-1 gastric cancer cells were harvested and washed with PBS and suspended in RPMI 1640 medium without serum. 5×10.sup.6 of these cells were injected subcutaneously into the right flank of nude mice. Tumor growth was measured every 7 days, and tumor volume was estimated as length×width×height×0.5236. Tumors were harvested from ether-anesthetized mice. All procedures conformed with the Guide for the Care and Use of Laboratory Animals (NIH publication No. 80-23, revised in 1996), and approved by the Animal Care and use Committee, ShanghaiTech University.

    [0222] In Vivo Metastasis Assay

    [0223] The SNU-1 gastric cancer cell line was labeled with luciferase-expressing lentivirus containing an independent open reading frame of GFP. Luciferase expression was determined by using luciferin (Xenogen, Alameda, Calif.) and an in vivo imaging system (Xenogen). The luciferase-expressing SNU-1 of PIWIL1-WT or PIWIL1-KO cells (1×10.sup.6 in 100 μl PBS) were injected through the tail vein, after which the overall health condition and bodyweight of the mice were monitored. The metastatic lesions were monitored every other week. An aqueous solution of luciferin (150 mg/kg intraperitoneally) was injected 10 min before imaging, and then the mice were anesthetized with Forane (Abbott). The mice were placed into a light-tight chamber of the CCD camera system (Xenogen), and the photons emitted from the luciferase-expressing cells within the animal were quantified for 1 min using the software program Living Image (Xenogen) as an overlay on Igor (Wavemetrics, Seattle, Wash.). All procedures conformed with the Guide for the Care and Use of Laboratory Animals (NIH publication No. 80-23, revised in 1996) and approved by the Animal Care and use Committee, ShanghaiTech University.

    Example 3 PIWIL1 Regulates Many Tumor-Related Signaling Pathways, Especially Cell Cycle Signaling Pathway and Focal Adhesion and Adherens Junction Signaling Pathways Signaling Pathway

    [0224] 3.1 RNA was extracted from cells of PIWIL1 wild-type (WT), PIWIL1 knockout control (KO-Con), PIWIL1 knockout cell clone #20 and PIWIL1 knockout cell clone #37.

    [0225] These five groups were classified into WT/KO20#, KO-Con/KO-37#, WT/37#, KO-Con/KO-20# and WT/KO20#, and RNA-Seq was performed. We further analyzed RNA-Seq data from these five groups using weighted gene co-expression network analysis (WGCNA), FIG. 13 shows that 41 co-expressing modules were identified to be regulated by PIWIL1. We then investigated the correlation between PIWIL1 trait and the co-expressed gene modules, the red color in the heat map of FIG. 13 represents the positive correlation between gene modules and trait, while the blue color represents the negative correlation, each cell contains the corresponding correlation value and significance p-value, based on this, the heat map in FIG. 14 shows that two gene clusters of blue module and turquoise module are significantly regulated by PIWIL1, the blue module genes were positively regulated by PIWIL1, while the turquoise module genes were negatively regulated by PIWIL1. Hub genes with kME≥0.9 in the gene clusters of these two modules were analyzed by KEGG pathway. It was found that the hub genes of the blue module were highly enriched in cell cycle and DNA replication pathways, while the hub genes of the turquoise module were highly enriched in focal adhesion and adherens junction signaling pathways.

    [0226] 3.2 Quantitative PCR was used to quantify the mRNA expression of 8 well-documented oncogenes in the blue module and 10 well-documented tumor suppressor genes in the turquoise module, FIG. 15 shows that the mRNA expression of eight cell cycle-related genes was inhibited by PIWIL1 knockout, the mRNA expression of 10 tumor suppressor genes related to cell adhesion was promoted by PIWIL1 knockout.

    [0227] This embodiment shows that transcriptomic studies have found that PIWIL1 can regulate cell cycle and focal adhesion signaling pathways related to the biological phenotype of gastric cancer, and promote the expression of many oncogenes and inhibit the expression of many tumor suppressor genes related to the progression of gastric cancer.

    [0228] Materials and Methods

    [0229] Total RNA-Deep Sequencing without rRNA and Weighted Gene Co-Expression Network Analysis (WGCNA) Analysis

    [0230] 100 ng of total RNA from each cell sample was used for deep sequencing of whole transcriptome without ribosomal RNA(rRNA). The NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® was used to construct the library in accordance with the kit's instructions. The libraries were quality controlled with a Bioanalyzer 2200 (Agilent, Santa Clara, Calif.) and sequenced by HiSeq X (Illumina, San Diego, Calif.) on a 150 bp paired-end run, clean data were obtained from the raw reads by removing the adaptor sequences, and low-quality reads. Then, the clean data were then aligned to the human genome (GRCh38, NCBI) using Hisat2 (25) software. Htseq (26) software was used to get gene counts, and the RPKM method was used to determine the gene expression. WGCNA (27) was performed across all samples using the standard method with a power of 17 to cluster the expression patterns. WGCNA was used to construct a network in published data sets independently and generated an independent list of hub genes (kME>0.9) for each data set. RUVseq algorithm was used for batch-to-batch correction.

    Example 4 PIWIL1 Plays its Oncogenic Function and Regulation in Gastric Cancer in a piRNA-Independent Manner

    [0231] 4.1 piRNA was not Found in Gastric Cancer Cells with High PIWIL1 Expression

    [0232] Although it has been well demonstrated that PIWI protein family carries out various biological functions by interacting with piRNAs in germline, we detected piRNA expression in our gastric cancer cell line SNU-1 with high PIWIL1 expression to determine whether PIWIL1 can have piRNA-independent regulation and biological function in gastric cancer. Deep sequencing of small RNA was performed on wild-type and PIWIL1-knockout gastric cancer cells, piRNAs were enriched by immunoprecipitation of PIWIL1 antibody. We used the methods of immunoprecipitation of PIWIL1 antibody and NaIO.sub.4 oxidation treatment to determine whether there are any bona fide piRNAs that PIWIL1 binds with were detected in gastric cancer cell line with high expression of PIWIL1. FIG. 16 shows that although there was a large amount of piRNA expression in the mouse testis in the systemically positive control, piRNA could hardly be detected in gastric cancer cells with high expression of PIWIL1.

    [0233] 4.2 PIWIL1 Protein without piRNA Binding Ability Still Plays the Same Oncogenic Biological Function and Regulation as Wild-Type PIWIL1 Protein in Gastric Cancer

    [0234] Based on previous studies, it was concluded that lysine at 572, glutamine at 572, and glutamine at 607 of human PIWIL1 are evolutionally conserved piRNA binding site (28-29). We constructed PIWIL1 expression plasmid with lack of piRNA binding ability by mutating these three amino acids into alanine. The wild-type PIWIL1 expression plasmid and the PIWIL1 expression plasmid lacking piRNA binding ability were respectively transferred into PIWIL1 knockout SNU-1 gastric cancer cell clone, and the complement experiment was conducted to investigate the effect of the loss of piRNA binding ability on the regulation of PIWIL1 on its downstream target genes, especially those related to tumor progression, and to investigate the effect of loss of piRNA binding ability on PIWIL1 on cell cycle and migration of cancer cells. FIG. 17 shows that when PIWIL1 loses piRNA binding ability, it can still regulate oncogenes related to cell cycle and tumor suppressor genes related to cell-cell adhesion like wild-type PIWIL1. Furthermore, FIG. 17 shows that PIWIL1 without piRNA binding ability can still rescue the cell cycle arrest and cell migration inhibition induced by PIWIL1 knockdown as well as wild-type PIWIL1.

    [0235] In conclusion, this Example shows that PIWIL1 does not depend on piRNA to regulate gastric cancer cell cycle operation and cell migration. Meanwhile, PIWIL1 can also regulate the expression of many important oncogenes and tumor suppressor genes in a piRNA independent manner, especially genes related to cell cycle and cell migration phenotype. Therefore, these piRNA-independent biological functions and gene expression regulation of PIWIL1 are expected to make PIWIL1 a good target for gastric cancer therapy, especially for gastric cancer patients with rapid tumor growth and metastasis, and the effect of piRNA should not be considered for PIWIL1-targeted therapy in such patients.

    [0236] Materials and Methods

    [0237] Small RNA-Seq Library Construction and Sequencing

    [0238] Small RNA libraries were prepared from the extracted 1 μg total RNA or 100 ng PIWIL1-antibody-pulled down RNA using NEBNext Multiplex Small RNA Library Prep Set from Illumina11 (Set 1) (NEB, Cat #E7300S) according to the manufacturer's instructions. The libraries were sequenced using the Illumina HiSeqX platform for 150-nucleotide pair-end runs.

    [0239] Construction of Small RNA-Seq Library Using β-Elimination by NaIO4-Oxidation

    [0240] 20 μg total RNA was oxidized to achieve β-elimination by exposing to 20 mM NaIO.sub.4 (SigmaAldrich, Cat #311448) in 200 mM lysine-HCl buffer (pH 8.5, Sigma-Aldrich, Cat #62929) in a total volume of 40 μl at 37° C. for 30 min with shaking in a dark tube. The reaction was quenched by 2 μl ethylene glycol. The RNA was column-purified (RNA Clean & Concentrator-5, Zymo, Cat #R1015) and eluted in 8 μl molecular biology grade, RNase-free water. 6W eluted RNA was used for constructing Small RNA libraries by NEBNext Multiplex Small RNA Library Prep Set (Set 1) (NEB, Cat #E7300S) according to the manufacturer's instructions. The libraries were sequenced using the Illumina HiSeqX platform for 150-nucleotide pair-end runs.

    [0241] Analyses of Small RNA Sequencing Data

    [0242] Small RNA sequences were processed with TrimGalore (version 0.4.4_dev; http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) with the default adapter trimming mode to auto-detect adapters in the 150 bp long sequencing reads. A size cutoff using 17 bp to 42 bp was applied to retain small RNA reads of suitable length. The commands were: “trim_galore—phred33—gzip-q 20—fastqc—output_dir trimmed_fqc_out—length 17—max_length 42—trim-n $read”. Subsequently trimmed reads were mapped onto the corresponding genome [human (hg38) or mouse (mm10)] using bowtie1 (version 1.2.1.1) (30) with commands “bowtie-S-p5-v 0-n 0-l 18-k 1—no-unal—al $GMAPPED_FQ Homo_sapiens. GRCh38.dna.primary_assembly.fa $read>$GMAPPED_SAM”. Genome-mapped reads were sequentially mapped to the libraries of miRNA, tRNA, rRNA, snRNA, snoRNA, piRNAs, and repetitive elements. miRNA libraries were obtained from miRBase (Mar. 11, 2018) (31). tRNA reference fasta was built by combining the tRNA sequences from GtRNAdb (32) and those from genome annotation. rRNA libraries were prepared from RNAcentral (January of 2019) (33). cDNA libraries of both snRNA and snoRNA were obtained from both genome annotation and RNAcentral (January of 2019). piRNAs were classified as de novo and known, with the former identified by proTRAC (version 2.4.2) (34), and the latter by mapping onto piRNAs from piRNABank. Commands for proTRAC were: “perl proTRAC_2.4.2. pl-genome Homo_sapiens. GRCh38.dna.primary_assembly.header.simple.fa-map $map_file-repeatmasker hg38. repeatMasker.matched.gtf-geneset Homo_sapiens.GRCm38.95.chr.gtf-pimin 25-pimax 31”. $mapfile was the mapped output using sRNAmapper (version 1.0.4) (35). Repeat-derived small RNA libraries were obtained from the RepeatMasker annotation in UCSC genome browser.

    [0243] Wild-Type PIWIL1 and the piRNA Binding Mutant PIWIL1 cDNA Cloning

    [0244] Total RNA was used for cDNA synthesis by SuperScript III reverse transcriptase (Invitrogen, 18080044) according to the instructions of the manufacturer. The cDNA was used as a template for amplification by Phusion high-fidelity DNA polymerase (New England Biolabs, M0530L) in PCR and PIWIL1 was cloned into the pcDNA3.1-3×Flag.

    [0245] The cloning of the piRNA-binding mutant PIWIL1 gene was carried out by the KOD-PlusMutagenesis kit (TOYOBO, SMK-101) with pcDNA3.1-3×Flag-PIWIL1 cDNA as a template, according to the instructions of the manufacturer. PCR primers are listed in Table 2.

    Example 5 PIWIL1 Plays its Biological Function and Regulation in Gastric Cancer in a piRNA-Independent Manner Through the UPF1-Mediated Nonsense mRNA Decay Pathway (NMD Pathway)

    [0246] 5.1 PIWIL1 Binds to UPF1-Mediated NMD Complex

    [0247] By PIWIL1-immunoprecipitation coupled with mass spectrometry (PIWIL1-IP-MS), we identified UPF1 protein, which is the core protein in the nonsense mRNA decay pathway(36-37)(FIG. 18). The results of the immunoprecipitation experiment in FIG. 19 further indicate that PIWIL1 and UPF1 bind to each other and that PIWIL1 can bind to the core complex of the NMD pathway (UPF2, SMG1, and activated UPF1 (phosphorylated UPF1)). The results of immunofluorescence assay in FIG. 20 shows that PIWIL1 could co-localize with UPF1 in P-bodies, which are organelles of nonsense mRNA decay pathway.

    [0248] 5.2 PIWIL1 Binds to UPF1 Independently of piRNA and has a Specific Binding Region to UPF1

    [0249] To find out how PIWIL1 specifically binds UPF1 to participate in the NMD pathway, we need to find the binding region where PIWIL1 specifically binds UPF1. The binding pattern of PIWIL1 to UPF1 was predicted by protein modeling (38-40), based on which we constructed domain mutants of PIWIL1 lacking the ability to bind UPF1. FIG. 21 shows that amino acid region 251-383 and amino acid region 625-758 of PIWIL1 are key regions responsible for the binding of PIWIL1 to UPF1. Knockout of this region will significantly disrupt the binding of PIWIL1 to UPF1. However, the PIWIL1 mutant, which only lost piRNA binding ability, was not affected for its binding to UPF1, indicating that the binding of PIWIL1 and UPF1 does not require piRNA for synergistic NMD pathway.

    [0250] 5.3 The Specific Binding of PIWIL1 to UPF1 is Essential for the Important Biological Function and Regulation of PIWIL1 in Gastric Cancer

    [0251] The PIWIL1 mutant lacking the ability to bind UPF1 and the wild-type PIWIL1 were transfected into PIWIL1 knockout gastric cancer cell SNU-1, respectively, it was found that wild-type PIWIL1 could effectively repair the up-regulation of downstream tumor suppressor gene expression and the inhibition of cancer cell migration caused by PIWIL1 knockout, but the loss of the binding ability of PIWIL1 to UPF1 could not restore the up-regulation of downstream tumor suppressor gene expression and the effect on cell migration caused by PIWIL1 knockout(FIG. 22).

    [0252] In conclusion, this Example shows that PIWIL1 can regulate gastric cancer cell migration and tumor suppressor genes related to cell migration through the UPF1-mediated nonsense mRNA decay (NMD pathway) independently of piRNA. Therefore, the piRNA-independent regulation of PIWIL1, especially the synergistic regulation with the NMD complex, is expected to be a new treatment of PIWIL1 in the targeted therapy of gastric cancer, which will be different from the traditional piRNA-dependent treatment of PIWIL1.

    [0253] Materials and Methods

    [0254] Co-Immunoprecipitation

    [0255] Cells were lysed in co-immunoprecipitation lysis buffer [20 mM Tris-HCl pH7.4, 150 mM NaCl, 1% (v/v) IGEPAL® CA-630 (Millipore SIGMA, Cat #I8896), 1 mM EDTA, 0.5 mM DTT, cOmplete™ EDTA-free Protease Inhibitor Cocktail Tablets (MERCK, Cat #4693132001), and PhosStop Tablets (MERCK, 4906837001)], and centrifuged at 14,000 rpm for 10 minutes to remove the debris. 10 μL of empty Dynabeads®Protein G (ThermoFisher Scientific, Cat #10004D) was added to the lysates and incubated for 0.5 hours for pre-clearing. 50 μL of empty Dynabeads® Protein G was washed by Citrate-Phosphate Buffer (pH 5.0) and then incubated with 5 μg mouse monoclonal anti-PIWIL1 antibody (Millipore SIGMA, Cat #SAB4200365) or 5 μg normal mouse IgG polyclonal antibody (MERCK, Cat #12-371). 50 μL of empty Dynabeads® Protein A were washed by Citrate-Phosphate Buffer (pH 5.0) and then incubated with 15 μl rabbit monoclonal anti-UPF1 antibody (Cell Signaling TECHNOLOGY, Cat #12040) or 5 μg rabbit polyclonal anti-phosphoUpf1 (Ser1127) antibody (MERCK, Cat #07-1016) or 5 μg rabbit polyclonal anti-UPF2 antibody (Abcam, ab157108) or 5 μg normal rabbit IgG polyclonal antibody (MERCK, Cat #12-370). All these incubations were done at 4° C. for 4 hours with rotation. The Dynabeads Protein G/A-Ig complex was washed by IP wash buffer [20 mM Tris-HCl pH7.4, 200 mM NaCl, 0.05% (v/v) IGEPAL® CA-630, 0.5 mM DTT, cOmplete™ EDTA-free Protease Inhibitor Cocktail Tablets, and PhosStop Tablets] three times. The prewashed Dynabeads Protein G/A-Ig complex was incubated with the precleared lysates at 4° C. overnight with rotation. The beads were then washed with IP wash buffer twice and IP high-salt wash buffer [20 mM Tris-HCl pH7.4, 500 mM NaCl, 0.05% (v/v) IGEPAL® CA-630, 0.5 mM DTT, cOmplete™ EDTA-free Protease Inhibitor Cocktail Tablets, and PhosStop Tablets] twice. Immunoprecipitates were run on 7.5% TGX Fast Cast acrylamide gels and probed with relevant antibodies for Western blotting or detected using Coomassie Brilliant Blue staining solution based on the manufacturer's instructions.

    [0256] Mass Spectrometry

    [0257] The co-immunoprecipitated products were subjected to electrophoresis using 7.5% TGX Fast Cast acrylamide kit (Bio-Rad, 1610173TA) followed by Coomassie Brilliant Blue staining. Protein spots were then cut separately; the excised gel bands were first in-gel digested as described above(41). The obtained peptides were desalted, followed by nano-LC/MS/MS analysis. Orbitrap Fusion MS equipped with nano EASY LC and Easyspray column (75 μm×50 cm, PepMap RSLC C18 column, 2 100 Å, ThermoFisher Scientific) was employed to acquire MS data. The LC gradient of was 5 to 35% B (0.1% formic acid in CH.sub.3CN) in 60 min at a flow rate of 300 NL/min, the column temperate was set to 50° C. The MS data were acquired in datadependent mode. Briefly, a survey scan at 60K resolution is followed by ten HCD MS/MS scans performed in Orbitrap at 15K resolution.

    [0258] Molecular Construction of a PIWIL1 Mutant Lacking the Ability to Bind UPF1

    [0259] The cloning of PIWIL1-domain mutant was carried out by the Phanta Max Super-Fidelity DNA Polymerase kit (Vazyme, P505-d1) and Mut Express MultiS Fast Mutagenesis Kit V2 (Vazyme, C215-01), according to the instructions of the manufacturer. Primer (2-250)/(2-624)-F′ and Primer (2-250)-R′ were used to get fragment (2-250); Primer (384-861)/(384-624)-F′ and Primer (384-861)/(759-861)-R′ were used to get fragment (384-861); Primer (2-250)/(2-624)-F′ and Primer (2-624)/(384-624)-R′ were used to get fragment (2-624); Primer (759-861)-F′ and Primer (384-861)/(759-861)-R′ were used to get fragment (759-861); Primer (384-861)/(384-624)-F′ and Primer (2-624)/(384-624)-R′ were used to get fragment (384-624). The flag-PIWIL1-AN mutant cDNA (deletion of 251-383) was constructed by connecting fragment (2-250) and fragment (384-861). The flag-PIWIL1-AC mutant cDNA (deletion of 625-758) was constructed by connecting fragments (2-624) and fragment (759-861). The flag-PIWIL1-ΔNΔC mutant cDNA (deletion of 251-383 and 625-758) was constructed by connecting fragment (2-250) to fragment (384-624) and fragment (759-861). PCR primers are listed in Table 2. Quantitative PCR assay and cell migration assay are as described above.

    TABLE-US-00001 TABLE 1 Primer sequences for quantitative PCR Gene Forward Primer SEQ Reverse Primer SEQ ACTB CCCTGGAGAAGAGCTACGA  1 GGAAGGAAGGCTGGAAGAG  2 G T PIWIL1 CAGCCAAGTCACAAGGACT  3 GATGTCAGCCGGAAATGGTT  4 C PIWIL2 TTGGTTGGAGTAGGACGCTT  5 AAGGTACAGGGAGGCTTGT  6 C PIWIL4 GATGGCACCGAGATCACCTA  7 TGGTCAGTCAGCCCTGTTAG  8 UPF1 ATCCGCCTGCAGGTCCAGTA  9 GATCCGCTGCAGTGACACCA 10 FLNA GGGATCCCATCCCTAAGAGC 11 CTTGGATGCCACTTTGCCTT 12 LAMC3 ACTGTGAGCACTGTCAGGAA 13 TGCAAGGCATGCATTTGTCT 14 CCNE2 GGGGGATCAGTCCTTGCATT 15 AAGGCAGCAGCAGTCAGTA 16 T ORC6 ATGCTGAGGAAAGCAGAGG 17 TTCATCCAGGAAGCTGCAAG 18 A CDC25A GTGCCGGTATGTGAGAGAG 19 TGCGGAACTTCTTCAGGTCT 20 A MCM2 CGAGATAGAGCTGACTGGC 21 CAGTGGCAAAGACAGGGAA 22 A G CCND3 ATCACTGGCACTGAAGTGGA 23 TCTGTAGGAGTGCTGGTCTG 24 PCNA GCGTGAACCTCACCAGTATG 25 TCTCCTGGTTTGGTGCTTCA 26 MYO18B GAAGCAGATGCACCAGAAG 27 CCAATCTGGTCACAGAGGGT 28 G VCL GACCGGCCAAAGCAGCTGT 29 GATGGCAGCCTGACCGACTC 30 A SESN2 GGCTGGAGGCACTGATGTCC 31 TAGTCAGGGTGCAGGCCCAT 32 SRCIN1 ACAGAGCTCAAGGCTCACTT 33 GGCTCCTCCTTCAGGAACTT 34 TPM2 GATGCTGAAGCTGGACAAG 35 GGTCCTCAGCTTGCTTCTTG 36 G DDIT4 GAGTCCCTGGACAGCAGCA 37 CAGCAGCTGCATCAGGTTGG 38 A CCDC80 AGCAGAAGAAGGAGGGCAT 39 AGATCACCAGCAACCTCCTC 40 T PTEN GCGGAACTTGCAATCCTCAG 41 GAACTTGTCTTCCCGTCGTG 42 GADD45 AGCTGCTGGTTGATCGCACT 43 AGCAACTCATGCAGCGCTTT 44 G GADD45 TGAATGTGGACCCAGACAG 45 AAGGACTGGATGAGCGTGA 46 B C A TSC2 TACTGCGTCTGCGACTACAT 47 CCAGTCAGACTCCTGCTTCA 48 TP53 GTCCAGATGAAGCTCCCAGA 49 CAAGAAGCCCAGACGGAAA 50 C MCM10 GTGGAAGCCTTCTCTGGTCT 51 CAGCTTCTCTCTGGCCATCT 52

    TABLE-US-00002 TABLE 2 PCR primer sequences Primers ID Sequence (5′ to 3′) SEQ 2U6 hPiwil-1 E5 sg2 For atgCGTCTCaACCGcattgactataacccactgagttttagagctagaaa 53 tagcaag 2U6 hPiwil-1 E5 sg1 Rev atgCGTCTCgAAACgctgacatcccgtccccagtCGGTGTTTC 54 GTCCTTTCCACAAG hPiwil-1 E5 C9 (genomePCR) ACTGTGCCTGCCTTGTCAT 55 For hPiwil-1 E5 C9 (genomePCR) GGTAGTTCTGCTTTGAAGTGGAA 56 Rev PIWIL1-piRNA-binding mutant GCAAAATACCTGTGTACAGATTGCCCTACCCCA 57 For AGTGCATGTGTGGTGGCCCGAACCTTAGGCAAA CAGCAAACTGTCATGGCCATTGCTACAAAGATT GCCCTAGCAATGAACT PIWIL1-piRNA-binding mutant AATAGCATCGTATTTGTCCTTCCGATTACT 58 Rev (2-250)/(2-624)-F′ gatgatgacgacaaaggatccACTGGGAGAGCCCGAGCC 59 (2-250)-R′ tcaggAGGCCAAATCACCAACCTGTG 60 (384-861)/(384-624)-F′ ttggtgatttggcctCCTGAGCTCTGCTATCTTACAGGTC 61 (384-861)/(759-861)-R′ aacgggccctctagactcgagTTAGAGGTAGTAAAGGCGGT 62 TTGA (2-624)/(384-624)-R′ tgttccaggaagtggCTTCAGGGGGATGTCCACCC 63 (759-861)-F′ tgaagCCACTTCCTGGAACAGTTATTGATG 64