Adaptor for sequencing DNA at ultratrace level and use thereof

11674137 · 2023-06-13

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed is an adaptor for sequencing DNAs at ultratrace levels and its uses. The adaptor contains, from 5′terminus to 3′terminus, a Tag sequence, PolyNs, a first stem sequencing, a first loop sequence, dUTP(s), a second loop sequence, and a second stem sequence, wherein the second stem sequence is complementary to the first stem sequence when read in opposite directions, and the 5′terminus of the adaptor is phosphorylated. The adaptor is designed to form a hairpin structure itself in use and then ligated to a DNA molecule of interest, so that adaptor-adaptor ligation can be effectively avoided, eliminating the inefficient adaptor-DNA ligation problem. Such an adaptor is especially suitable for library construction and sequencing of DNAs at ultratrace levels, laying a good basis for accurate sequencing of ctDNAs.

    Claims

    1. An adaptor for sequencing DNAs at ultratrace levels, comprising, from 5′ terminus to 3′ terminus, in turn, a tag sequence, polyNs, a first stem sequence, a first loop sequence, dUTP(s), a second loop sequence, and a second stem sequence, wherein: the second stem sequence is complementary to the first stem sequence when read in opposite directions; the first loop sequence, the dUTP(s), and the second loop sequence form a portion of a loop and the dUTP(s) is/are located between the first loop sequence and the second sequence in the loop; and the 5′ terminus of the adaptor is phosphorylated; wherein the first loop sequence, the second loop sequence, the first stem sequence, and the second stem sequence are set forth in SEQ ID Nos.: 1, 2, 3 and 4, respectively.

    2. The adaptor according to claim 1, further comprising a first index sequence between the first stem sequence and the first loop sequence.

    3. The adaptor according to claim 2, further comprising a second index sequence between the second loop sequence and the second stem sequence.

    4. The adaptor according to claim 1, wherein the loop is formed during annealing.

    5. An adaptor for sequencing DNAs at ultratrace levels, comprising, from 5′terminus to 3′ terminus, in turn, a tag sequence, polyNs, a first stem sequence, a first loop sequence, dUTP(s), a second loop sequence, and a second stem sequence, wherein: the second stem sequence is complementary to the first stem sequence when read in opposite directions; the 5′ terminus of the adaptor is phosphorylated; and the first loop sequence, the second loop sequence, the first stem sequence, and the second stem sequence are set forth in SEQ ID Nos.: 1, 2, 3 and 4, respectively.

    6. The adaptor according to claim 5, further comprising a first index sequence between the first stem sequence and the first loop sequence.

    7. The adaptor according to claim 6, further comprising a second index sequence between the second loop sequence and the second stem sequence.

    8. The adaptor according to claim 5, wherein the first loop sequence, the dUTP(s), and the second loop sequence form a portion of a loop during annealing.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    (1) FIG. 1 is a schematic diagram showing the structure of an adaptor sequence in an example of the present application.

    (2) FIG. 2 is a schematic diagram showing pairing and extension of an adaptor sequence in an example of the present application.

    (3) FIG. 3 is a schematic diagram showing construction of a sequencing library using the adaptors of the present invention in an example of the present application.

    (4) FIG. 4 is a diagram showing results of cfDNA mutation detection in Sample LC2014112 in an example of the present application.

    DETAILED DESCRIPTION OF THE INVENTION

    (5) The present invention, in view of the adaptor-adaptor ligation problem found in ligation of Y-shaped adaptors to DNAs of interest, has designed a novel structured adaptor. When such an adaptor is used in, for example, sequencing, it is subject to annealing and extension first to form a hairpin structure and then ligated to a DNA molecule of interest, so as to avoid adaptor-adaptor ligation. This may eliminate bad influence of the adaptor-adaptor ligation on sequencing of DNAs at ultratrace levels. Thus, the adaptors of the present application are applicable to ultratrace leveled DNAs. In one embodiment of the present application, the adaptors of the present invention are adopted for ctDNA sequencing.

    (6) The present invention will be further described in detail with reference to the specific example and drawings. The example below is used to illustrate the present invention, and should not be construed as limiting.

    Example

    (7) An adaptor was designed in the present example as shown in FIG. 1. The adaptor contained a Tag sequence, polyNs, a first stem sequence, a first index sequence, a first loop sequence, dUTP(s), a second loop sequence, a second index sequence and a second stem sequence from 5′terminus to 3′terminus. The second stem sequence and the first stem sequence were complementary in nucleotide sequence when read in opposite directions, and the 5′terminus of the adaptor was phosphorylated. In FIG. 1, Rd1SP, Index1, SP1, U, SP2, Index2 and Rd2SP referred to the first stem sequence, the first index sequence, the first loop sequence, dTUPs, the second loop sequence, the second index sequence, and the second stem sequence, respectively.

    (8) The adaptor was firstly subject to annealing and extension, to form a hairpin structure, as shown in FIG. 2. Thereafter, the adaptor with a hairpin structure was ligated to a DNA molecule of interest.

    (9) In the present example, the Illumina sequencing platform was used, and the adaptor was designed as described above and shown below. As the sequencing was only performed on a sample collected from a single individual, no index sequence was arranged in the adaptor sequence. In other words, no first or second index sequence was in the adaptor sequence.

    (10) The adaptor sequence in this example was as follows.

    (11) TABLE-US-00003 (SEQ ID No.: 7) 5′-P-ACTGNNNNNNNNNNNNAGATCGGAAGAGC      Tag   PolyN      first stem sequence  ACACGTCTGAACTCCAGTCAC-U- first loop sequence  dUTP AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC          second loop sequence GACGCTCTTCCGATCT-3′.  second stem sequence

    (12) The method for constructing a sequencing library using a plurality of adaptors in this example, as shown in FIG. 3, specifically contained the steps of

    (13) (1) allowing the synthetic adaptors to base pair to form a hairpin structure in each adaptor, and allowing the 3′terminus to extend against the Tag sequence with the polyN marker,

    (14) (2) ligating the hairpin-shaped adaptors to both ends of each DNA of interest to form a closed loop structure,

    (15) (3) cleaving the products obtained in step (2) with USER Enzyme specifically recognizing dUTP to form single-stranded structures on both ends,

    (16) (4) PCR amplifying the DNAs of interest using primers designed against the first and the second loop sequences. High-fidelity DNA Polymerase I (Klenow Fragment), high-fidelity KAPA HiFi DNA polymerases, Phusion high-fidelity DNA polymerases, and Q5 high-fidelity DNA polymerases are commonly selected as the PCR polymerase in the example. Accordingly, in primer designs, the annealing temperature of the primers should match the working temperature of the DNA polymerase to be chosen.

    Experiment 1

    (17) In this experiment, the 17.sup.th exon of EGFR (exon 17th) was tested, and adaptors were ligated to both ends of the DNA fragments in a ligation reaction. The sequence of EGFR 17.sup.th exon was set forth in SEQ ID No.: 8.

    (18) TABLE-US-00004 SEQ ID No.:8: 5′-GCCTAAGAT CCCGTCCATC GCCACTGGGA TGGTGGGGGC CCTCCTCTTG CTGCTGGTGG TGGCCCTGGG GATCGGCCTC TTCATGCGAA GGCGCCACAT CGTTCGGAAG CGCACGCTGC GGAGGCTGCT GCAGGAGAGG GAG-3′

    (19) (1) Paring and Extension of Adaptor Sequence

    (20) The adaptors designed for the Illumina platform were used to sequence the DNA of SEQ ID No.: 7.

    (21) To each PCR tube was added 20 μL of 100 μM adaptors an 20 μL of water, and the resultant solution was mixed with fierce shaking and then subject to centrifugation. The adaptors' concentration became 50 μM. Annealing was performed.

    (22) The conditions for annealing were as follows.

    (23) 95° C. for 10 min, with temperature lowering gradient being 100%,

    (24) 70° C. for 10 min, with temperature lowering gradient being 5%,

    (25) 65° C. for 10 min, with temperature lowering gradient being 5%,

    (26) 60° C. for 10 min, with temperature lowering gradient being 5%,

    (27) 55° C. for 10 min, with temperature lowering gradient being 5%,

    (28) 50° C. for 10 min, with temperature lowering gradient being 5%,

    (29) 45° C. for 10 min, with temperature lowering gradient being 5%,

    (30) 40° C. for 10 min, with temperature lowering gradient being 5%,

    (31) 25° C. for 10 min, with temperature lowering gradient being 100%.

    (32) Temperature-gradient annealing was adopted in this experiment for formation of hairpin structures, which was more effective and sensitive than conventional room temperature annealing.

    (33) The annealing was followed by extension. The reaction solution for extension, 60 μL in total volume, consisted of 40 μL of annealing products, 6 μL of 10×NEB buffer, 6 μL of 10 mM dNTP, 6 μL of 5 U/μL Klenowexo, and 2 μL of ddH.sub.2O. Extension was performed at 37° C. for 60 min.

    (34) (2) Ligation of Adaptors to DNA Fragments to be Inserted

    (35) For the ligation of adaptors to DNAs of interest, the DNA ligase such as T4 liganse was used. The reaction solution, 20 μL in volume, consisted of 50 ng of DNA fragments to be inserted, 2 μL of 10× buffer, 1 μL of T4 liganse, and balance of ddH.sub.2O. The ligation was performed overnight at 16° C., at which condition the ligation efficiency was proved to be the highest.

    (36) In this experiment, 17.sup.th exon, as the DNA fragment to be inserted between adaptors, was relatively small in size and thus can be directly ligated to adaptors. Similarly, in the detection of circulating cell-free DNAs (cfDNA) extracted from the blood, as such DNAs were about 160 bp in length, they can be directly subject to ligation, too. However, genomic DNAs, which were usually longer fragments, have to be fragmented before ligation to adaptors. For example, genetic DNAs extracted from blood, had to be fragmented by NEBNext®dsDNFragmentase before ligation to adaptors. The reaction solution for fragmentation, 20 μL in total volume, consists of 16 μL of genetic gDNAs, 2 μL of 10× buffer and 2 μL of fragmentase. The fragmentation should be performed at 37° C. for 30 min.

    (37) (3) Cleavage by dUTP specific excising enzyme

    (38) The Products Obtained in the Ligation Step were Recognized and Cleaved by a dUTP specific excising enzyme. In specific, 3 μL of NEBNext USER Enzyme was added to the DNAs after ligation, and the resultant mixture was incubated at 37° C. for 15 min.

    (39) Upon completion of cleavage, the resultant DNAs were purified. In the present experiment, DNAs in the reaction solution were purified using magnetic beads. Exemplary beads included AMPure XP magnetic beads, OMEGA magnetic beads, and the like. DNAs were incubated with beads for 10 to 15 min, where the DNAs and beads were mixed every 5 min to fully bind DNAs to beads. The, the magnetic beads were washed by 80% ethanol to enable binding of small DNA fragments to beads (not to wash away small fragments). The details were as follows.

    (40) Into 70 μL of the ligation reaction solution was added 120 μL of magnetic beads. The mixture was mixed evenly and incubated at room temperature for 15 min, during the incubation the mixture was gently mixed every 5 min. Then, each centrifugation tube filled with DNAs and beads was kept still in a magnetic stand at room temperature for 3 to 5 min. After all beads were attached to the magnetic stand, the supernatant was removed. Thereafter, 500 μL of freshly prepared 80% ethanol was added to the tube, and the genetic stand was gently and repeatedly turned to the upside-down status for 7 to 10 times and then kept still at room temperature for about 3 min. The supernatant was removed again, and ethanol was added for another washing. Then, all liquid was removed, and the centrifugation tubes were left to air dried in a 37° C. dry bath with tube caps removed, until the bead surfaces lost lustre. Nuclease-free water of 22 μL was added to the beads to sufficiently suspend the beads, and beads were then left still at room temperature for about 5 min to fully resolve DNAs in the water. The centrifugation tubes were placed on the magnetic stand again and left still at room temperature for 5 min. The supernatants were transferred to new Eppendorf tubes to obtain purified DNAs.

    (41) (4) Library Construction

    (42) Primers were designed against the first and the second loop sequences. The forward primer was set forth in SEQ ID No.: 5, and the reverse primer was set forth in SEQ ID No.:6.

    (43) The primers had sequences as below.

    (44) TABLE-US-00005 SEQ ID No.: 5: 5′-AATGATACGGCGACCACCGAGATCTACAC-3′ SEQ ID No.: 6: 5′-CAAGCAGAAGACGGCATACGTGACTGGAG-3′

    (45) KAPA 2G Robust HotStart polymerase was used in the PCR for amplification so as to construct sequencing library. The PCR amplification reaction solution, 25 μL in volume, consisted of: 12.5 μL of 2×KAPA 2G Robust HotStart Ready Mix, 1.25 μL of 10 μM forward primer, 1.25 μL of 10 μM reverse primer, 1 ng of DNA template, and balance of H.sub.2O.sub.2.

    (46) PCR reaction was performed at the following conditions: denaturation at 95° C. for 3 min; denaturation at 95° C. for 10 sec—annealing at 63° C. for 15 sec—extension at 72° C. for 10 sec, 35 cycles; final elongation at 72° C. for 5 min; final hold at 4° C.

    (47) (5) Sequencing

    (48) The PCR products were sequenced using Illumina as the sequencing platform.

    (49) Using the adaptors of the present example, the library construction method and the sequencing platform described above, cfDNAs from Sample LC2014112 were sequenced. In particular, 1 ng of cfDNAs from Sample LC2014112 were used for the library construction. The genetic testing revealed T790M mutation in the EGFR 20.sup.th exon of this sample with an incidence of 0.208%, which induced resistance to EGFR-TKI therapy. The mutation identification results were shown in FIG. 4. FIG. 4 indicated that the base at chr7:55249071 of Chrosome 7, the site key to EGFR-TKI therapy, was turned to T from the intrinsic C in the DNAs from Sample LC2014112 where such a mutation induced resistance to EGFR-TKI therapy. According to the clinical test, resistance to EGFR-TKI therapy was observed in the individual from which Sample LC2014112 was collected, which was consistant to the above sequencing results, suggesting the accuracy of the identification in the present experiment.

    (50) As a comparative example, cfDNAs from the same sample, i.e., Sample LC2014112, were sequenced by using 1 ng of these cfDNAs in library construction where traditional Y-shaped adaptors were used for ligation. The results showed that no T790M mutation was identified in EGFR using the traditional sequencing method.

    (51) Therefore, it can be seen the sequencing method of the present example using the adaptors of the present invention in library construction had good detection sensitivity and accuracy, and was particularly suitable for detection of circulating cell-free DNAs. The method of the present example can effectively avoid errors introduced in DNA amplification during DNA library construction and sequencing, and present high-fidelity DNA information of the sample.

    (52) The foregoing describes the present invention in further details by ways of embodiments, but should not be construed as limiting the particular practice of the present invention thereto. Variations or modifications can be made by an ordinary skilled in the art to which the present invention pertains without departing from the scope and spirit of the present invention.