Peptide exhibiting wrinkle-improving activity and uses thereof

11672749 · 2023-06-13

Assignee

Inventors

Cpc classification

International classification

Abstract

A peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4, a pharmaceutical composition for preventing or treating skin disease including the peptide, a cosmetic composition for skin condition improvement including the peptide, a food composition for skin condition improvement including the peptide, a method of preventing or treating skin disease using the peptide, and a use of the peptide in preventing or treating skin disease or improving skin condition are described.

Claims

1. A method of improving a skin condition of a subject, the method comprising administering a peptide consisting of the amino acid sequence of SEQ ID NO: 2 to the subject, optionally wherein (a) the N-terminus of the peptide is linked to a protecting group, or (b) the C-terminus of the peptide is modified.

2. The method of claim 1, wherein (a) the N-terminus of the peptide is linked to a protecting group, which is optionally selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and a polyethylene glycol (PEG), or (b) the C-terminus of the peptide is modified, optionally by being linked to a group selected from the group consisting of an amino group (—NH.sub.2) and an azide group (—NHNH.sub.2).

3. The method of claim 1, wherein the skin condition improvement is wrinkle improvement, skin regeneration, skin elasticity improvement, wound regeneration, acne improvement, or skin whitening.

4. A method of improving a skin condition of a subject, the method comprising contacting the skin of the subject with a cosmetic composition for skin condition improvement comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2, optionally wherein (a) the N-terminus of the peptide is linked to a protecting group, or (b) the C-terminus of the peptide is modified.

5. The method of claim 4, wherein (a) the N-terminus of the peptide is linked to a protecting group, which is optionally selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and a polyethylene glycol (PEG), or (b) the C-terminus of the peptide is modified, optionally by being linked to a group selected from the group consisting of a hydroxyl group (OH), an amino group (—NH.sub.2) and an azide group (—NHNH.sub.2).

6. The method of claim 4, wherein the skin condition improvement is wrinkle improvement, skin regeneration, skin elasticity improvement, wound regeneration, acne improvement, or skin whitening.

7. A method of treating a skin disease in a subject, the method comprising administering a pharmaceutical composition for treating skin disease comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2 to the subject, optionally wherein (a) the N-terminus of the peptide is linked to a protecting group, or (b) the C-terminus of the peptide is modified.

8. The method of claim 7, wherein (a) the N-terminus of the peptide is linked to a protecting group, which is optionally selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and a polyethylene glycol (PEG), or (b) the C-terminus of the peptide is modified, optionally by being linked to a group selected from the group consisting of an amino group (—NH.sub.2) and an azide group (—NHNH.sub.2).

9. The method of claim 7, wherein the skin disease is psoriasis, atopic dermatitis, non-allergic dermatitis, or xeroderma.

10. A method of improving a skin condition of a subject, the method comprising administering a food composition for skin condition improvement comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2 to the subject, optionally wherein (a) the N-terminus of the peptide is linked to a protecting group, or (b) the C-terminus of the peptide is modified.

11. The method of claim 10, wherein (a) the N-terminus of the peptide is linked to a protecting group, which is optionally selected from the group consisting of an acetyl group, a fluorenylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and a polyethylene glycol (PEG), or (b) the C-terminus of the peptide is modified, optionally by being linked to a group selected from the group consisting of an amino group (—NH.sub.2) and an azide group (—NHNH.sub.2).

12. The method of claim 10, wherein the skin condition improvement is wrinkle improvement, skin regeneration, skin elasticity improvement, wound regeneration, acne improvement, or skin whitening.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a graph showing evaluation results of proliferation of fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to an embodiment the present disclosure;

(2) FIG. 2 is a graph showing evaluation results of proliferation of fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to an embodiment the present disclosure;

(3) FIG. 3 is a graph showing evaluation results of proliferation of fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 3 according to an embodiment the present disclosure;

(4) FIG. 4 is a graph showing evaluation results of proliferation of fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 4 according to an embodiment the present disclosure;

(5) FIG. 5 is a graph showing evaluation results of proliferation of keratinocytes of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to an embodiment the present disclosure;

(6) FIG. 6 is a graph showing evaluation results of proliferation of keratinocytes of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to an embodiment the present disclosure;

(7) FIG. 7 is a graph showing evaluation results of proliferation of keratinocytes of a peptide consisting of an amino acid sequence of SEQ ID NO: 3 according to an embodiment the present disclosure;

(8) FIG. 8 is a graph showing evaluation results of proliferation of keratinocytes of a peptide consisting of an amino acid sequence of SEQ ID NO: 4 according to an embodiment the present disclosure;

(9) FIG. 9 is an image showing measurement results of phosphorylation level of MAPK (AKT elimination) in fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to an embodiment the present disclosure;

(10) FIG. 10 is an image showing measurement results of phosphorylation level of MAPK (AKT elimination) in fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to an embodiment the present disclosure;

(11) FIG. 11 is an image showing measurement results of phosphorylation level of MAPK and AKT in fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 3 according to an embodiment the present disclosure;

(12) FIG. 12 is an image showing measurement results of phosphorylation level of MAPK and AKT in fibroblasts of a peptide consisting of an amino acid sequence of SEQ ID NO: 4 according to an embodiment the present disclosure;

(13) FIG. 13 is an image showing measurement results of phosphorylation level of MAPK (AKT elimination) in keratinocytes of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to an embodiment the present disclosure;

(14) FIG. 14 is an image showing measurement results of phosphorylation level of MAPK (AKT elimination) in keratinocytes of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to an embodiment the present disclosure;

(15) FIG. 15 is an image showing results of collagen1a, fibronectin and elastin RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(16) FIG. 16 is an image showing results of collagen1a, fibronectin and elastin RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

(17) FIG. 17 is an image showing results of collagen1a, fibronectin and elastin RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 3 according to the embodiment of the present disclosure;

(18) FIG. 18 is an image showing results of collagen1a, fibronectin and elastin RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 4 according to the embodiment of the present disclosure;

(19) FIG. 19 is an image showing results of AQP3 (Aquaporin 3) RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(20) FIG. 20 is an image showing results of SIRT1 RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(21) FIG. 21 is an image showing results of AQP3 (Aquaporin 3) RT-PCR of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

(22) FIG. 22 is an image showing measurement results of an expression amount of collagen1a of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(23) FIG. 23 is an image showing measurement results of an expression amount of fibronectin of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(24) FIG. 24 is an image showing measurement results of an expression amount of elastin of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(25) FIG. 25 is an image showing measurement results of an expression amount of collagen1a of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

(26) FIG. 26 is an image showing measurement results of an expression amount of fibronectin of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

(27) FIG. 27 is an image showing measurement results of an expression amount of elastin of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

(28) FIG. 28 is an image showing results of Procollagen1a ELISA of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 according to the embodiment of the present disclosure;

(29) FIG. 29 is an image showing results of Procollagen1a ELISA of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

(30) FIG. 30 is an image showing results of Procollagen1a ELISA of a peptide consisting of an amino acid sequence of SEQ ID NO: 3 according to the embodiment of the present disclosure;

(31) FIG. 31 is an image showing results of Procollagen1a ELISA of a peptide consisting of an amino acid sequence of SEQ ID NO: 4 according to the embodiment of the present disclosure; and

(32) FIG. 32 is an image showing results of HA ELISA of a peptide consisting of an amino acid sequence of SEQ ID NO: 2 according to the embodiment of the present disclosure;

BEST MODE

(33) The present disclosure relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4.

MODE OF DISCLOSURE

(34) Hereinafter, the present invention will be described in further detail with reference to Examples. However, these Examples are for illustrative purposes only, and the present disclosure is not intended to be limited by these Examples.

Synthesis Example 1: Synthesis of Peptide

(35) 70 g of chlorotrityl chloride resin (CTC resin, Nova biochem Cat No. 01-64-0021) was placed in a reaction vessel, and 490 mL of methylene chloride (MC) was added thereto and stirred for 3 minutes. Then, the solution was removed, 490 mL of dimethylformamide (DMF) was added thereto, the mixture was stirred for 3 minutes, and then the solvent was removed. 700 mL of dichloromethane solution was added to the reactor, and 200 mmole of Fmoc-Tyr (tBu)-OH (Bachem, Switzerland) and 400 mmole of diisopropylethylamine (DIEA) were added thereto followed by stirring and dissolving. The reaction was carried out with stirring for 1 hour. After washing, methanol and DIEA (2:1) were dissolved in dechloromethane (DCM), reacted for 10 minutes, and washed with excess DCM/DMF (1:1). Then, the solution was removed, 490 mL of dimethylformamide (DMF) was added thereto, the mixture was stirred for 3 minutes, and then the solvent was removed. 700 mL of a deprotection solution (20% piperidine/DMF) was added to the reaction vessel, stirred at room temperature for 10 minutes, and then the solution was removed. The same amount of a deprotection solution was added thereto, and the reaction was maintained for 10 minutes. The solution was then removed and washed three minutes each twice with DMF, once with MC, and once with DMF to thereby prepare Tyr(tBu)-CTC resin.

(36) 700 mL of a DMF solution was added to another reactor, and 200 mmole of Fmoc-Arg (Pbf)-OH (Bachem, Switzerland), 200 mmole of HoBt, and 200 mmole of HBTu were added thereto, followed by dissolving with stirring. The reactor was charged with 400 mmole DIEA in two portions and stirred for at least 5 minutes until all the solids dissolved. The dissolved amino acid mixture solution was placed in a reaction vessel containing the deprotected resin and allowed to react for 1 hour at room temperature with stirring. The reaction solution was removed, and the mixture was stirred with DMF solution three times for 5 minutes and then removed. A small amount of the reaction resin was taken, and the degree of reaction was checked using a Kaiser test (Nihydrin Test). Arg(Pbf)-Tyr(tBu)-CTC resin was prepared by the same deprotection reaction twice as described above using the deprotection solution. After thoroughly washing with DMF and MC and once again performing a Kaiser test, the following amino acid adhesion experiment was performed as described above. Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, Fmoc-Lys(Boc)-OH were sequenced according to the selected amino acid sequence. The Fmoc-protecting group was reacted twice with the deprotecting solution for 10 minutes, followed by washing for removing the solution. Peptidyl resin was washed three times each with DMF, MC and methanol, dried slowly by flowing nitrogen air, and then completely dried by vacuum under reduced pressure in P.sub.2O.sub.5, followed by addition of 1,900 mL of a deodorant solution (trifluroacetic acid 81.5%, distilled water 5.0%, thioanisole 5.0%, phenol 5.0%, ethanedithiol (EDT) 2.5%, and triisopropylsilane (TIS) 1.0%). The mixture was then shaken at room temperature, and the reaction was maintained for 2 hours. The resin was filtered, and the resin was washed with a small amount of TFA solution and then combined with the mother liquid. 2,090 mL of the combined mother liquid was added with cold ether to induce precipitation, and the precipitate was collected by centrifugation and washed twice with cold ether. The mother liquid was removed and sufficiently dried under nitrogen to synthesize 79.8 g of the peptide consisting of SEQ ID NO: 1 before purification (yield: 97.0%). The molecular weight was 822.9 (theoretical value: 822.9) when the molecular weight was measured using a molecular weight analyzer.

(37) The peptide consisting of an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 was synthesized in the same manner as described above.

(38) TABLE-US-00001 TABLE 1 Analysis value (mass analyzer) SEQ Sequence Analytical Theoretical ID NO. listing value value 1 KWGGGRY  822.9  822.9 2 ILGRWCG  803.9  803.9 3 GPVH  408.4  408.4 4 EDEFKPPAAGR 1216.3 1216.3

Example 1. Assessment of Promotion of Proliferation of Fibroblasts

(39) Mouse fibroblast NIH3T3 was seeded in a 96-well plate at a density of 5×10.sup.3 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% serum-containing media. Then, treatment with the positive control, i.e., 100 nM bFGF, and 10 μM or 50 μM of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 were performed and cultured for 3 days. Then, 4 mg/mL MTT solution treatment was performed, and the reaction was carried out for 4 hours. Then, the resulting formazan was dissolved by treatment with dimethyl sulfoxide (hereinafter referred to as “DMSO”), and the absorbance at 560 nm was measured using a microplate reader. The results are shown in FIGS. 1 to 4 and Table 2.

(40) TABLE-US-00002 TABLE 2 Fibroblast proliferation (%) FIG. 1 Control SEQ ID NO: 1 bFGF 10 μM 50 μM (100 nM) 100 170 194 279 FIG. 2 Control SEQ ID NO: 2 bFGF 10 μM 50 μM (100 nM) 100 188 253 400 FIG. 3 Control SEQ ID NO: 3 bFGF 10 μM 50 μM (100 nM) 100 194 261 386 FIG. 4 Control SEQ ID NO: 4 bFGF 10 μM 50 μM (100 nM) 100 114 193 386

(41) As shown in FIGS. 1 to 4 and Table 2, the peptide consisting of an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4 was found to promote fibroblast proliferation.

Example 2. Assessment of Promotion of Proliferation of Keratinocytes

(42) Human keratinocyte HaCaT was seeded in a 6-well plate at a density of 3×10.sup.5 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% serum-containing media. Then, treatment with the positive control, i.e., 10 nM EGF, and 10 μM or 50 μM of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 were performed and cultured for 3 days. Then, 4 mg/mL MTT solution treatment was performed, and the reaction was carried out for 4 hours. Then, the resulting formazan was dissolved by treatment with dimethyl sulfoxide (hereinafter referred to as “DMSO”), and the absorbance at 560 nm was measured using a microplate reader. The results are shown in FIGS. 5 to 8 and Table 3.

(43) TABLE-US-00003 TABLE 3 Keratinocyte proliferation (%) FIG. 5 Control SEQ ID NO: 1 EGF 10 μM 50 μM (10 nM) 100 120 136 142 FIG. 6 Control SEQ ID NO: 2 EGF 10 μM 50 μM (10 nM) 100 111 119 152 FIG. 7 Control SEQ ID NO: 3 EGF 10 μM 50 μM (10 nM) 100 183 197 187 FIG. 8 Control SEQ ID NO: 4 EGF 10 μM 50 μM (10 nM) 100 113 142 187

Example 3. Measurement of Phosphorylation Level of MAPK and AKT

(44) 3-1. Fibroblasts

(45) Mouse fibroblast NIH3T3 was seeded in a 6-well plate at a density of 5×10.sup.3 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% FBS-containing media. Then, treatment with the positive control, i.e., 100 nM bFGF, and 10 μM or 50 μM of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 were performed and cultured for 30 minutes. Then, the cells were collected to prepare cell lysate. Then, western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38) and p-Akt or actin antibody (Santacruz Biotechnology, USA). The comparison results of phosphorylation aspects thereof are shown in FIGS. 9 to 12.

(46) As shown in FIGS. 9 to 12, the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 was found to exhibit effects of promoting proliferation by activation of MAPK (ERK, p38, and JNK) and AKT, i.e., signaling factors involved in proliferation of fibroblasts.

(47) 3-2. Keratinocytes

(48) Human keratinocyte HaCaT was seeded in a 6-well plate at a density of 3×10.sup.5 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% FBS-containing media. Then, treatment with the positive control, i.e., 10 nM EGF, and 10 μM or 50 μM of the peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 were performed and cultured for 30 minutes. Then, the cells were collected to prepare cell lysate. Then, western blotting was performed using P-MAPK (p-Erk, p-JNK, p-p38) and p-Akt antibody (Santacruz Biotechnology, USA). The comparison results of phosphorylation aspects thereof are shown in FIGS. 13 and 14.

(49) As shown in FIGS. 13 and 14, the peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 was found to exhibit effects of promoting proliferation by activation of ERK and p38, i.e., signaling factors involved in proliferation of human keratinocytes.

Example 4. RT-PCR of Collagen1a, Fibronectin, and Elastin

(50) Mouse fibroblast NIH3T3 was seeded in a 6-well plate at a density of 5×10.sup.3 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% FBS-containing media, followed by culturing for 4 hours. Then, treatment with the positive control, i.e., 100 nM IGF-1, and 10 μM or 50 μM of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 were performed and cultured for 24 hours. Then, the cells were cultured and collected to isolate RNA. cDNA was synthesized using a cDNA synthesis kit (Intron, Korea) after quantification of RNA, and PCR was carried out using primers of each of PCR premix (Intron, Korea) and collagen1a, fibronectin, elastin, GAPDH in Table 4. Then, the cells were run on 5% agarose gel, and degrees of mRNA expression of the growth factors were compared in each peptide treatment condition. The results are shown in FIGS. 15 to 18.

(51) TABLE-US-00004 TABLE 4 Sequence ID No. Primer Sequence (5′-3′)  5 Collagen1a_F CACCCTCAAGAGCCTGAGTC  6 Collagen1a_R AGACGGCTGAGTAGGGAACA  7 Fibronectin_F CCAGGAACCGAGTACACCAT  8 Fibronectin_R ATACCCAGGTTGGGTGATGA  9 Elastin_F GGACCCCTGACTCGCGACCT 10 Elastin_R GGGGAGGTGGGACTGCCCAA 11 GAPDH_F GGTGTGAACGGATTTGGCCGTATTG 12 GAPDH_R CCGTTGAATTTGCCGTGAGTGGAGT

(52) As shown in FIGS. 15 to 18, the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 shows effects of increasing expression of mRNA of collagen, fibronectin, and elastin as constituents of ECM through promoting fibroblast activity, respectively.

Example 5. RT-PCR of AQP3 (Aquaporin3) and SIRT1

(53) Human keratinocyte HaCaT was seeded in a 6-well plate at a density of 3×10.sup.5 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% FBS-containing media, followed by culturing for 4 hours. Then, treatment with the positive control, i.e., 100 nM EGF, and 10 μM or 50 μM of the peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 were performed and cultured for 24 hours. Then, the cells were cultured and collected to isolate RNA. cDNA was synthesized using a cDNA synthesis kit (Intron, Korea) after quantification of RNA, and PCR was carried out using primers of each of PCR premix (Intron, Korea) and AQP3, SIRT1, and GAPDH in Table 5. Then, the cells were run on 5% agarose gel, and degrees of mRNA expression of the growth factors were compared in each peptide treatment condition. The results are shown in FIGS. 19 to 21.

(54) TABLE-US-00005 TABLE 5 Sequence ID No. Primer Sequence (5′-3′) 13 AQP3_F CCTTCTTGGGTGCTGGAATA 14 AQP3_R ACACGATAAGGGAGGCTCTG 15 SIRT1_F TCAGTGGCTGGAACAGTGAG 16 SIRT1_R TCTGGCATGTCCCACTATCA

(55) As shown in FIGS. 19 to 21, the peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 shows effects of increasing AQP3 expression, which is a protein related to skin barrier enhancement through promotion of keratinocyte activation.

Example 6. RT-PCR of Collagen1a, Fibronectin, and Elastin

(56) Mouse fibroblast NIH3T3 was seeded in a 6-well plate at a density of 5×10.sup.3 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% serum-free media. Then, treatment with the positive control, i.e., 100 nM EGF, and the peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 were performed and cultured for 24 hours. Then, the cells were fixed for 30 minutes using 4% paraformaldehyde. Then, after washing 3 times, the cells were reacted with 0.5% Triton X-100 for 15 minutes and washed again 3 times. Then, 3% BSA was blocked for 1 hour and the primary antibody (1:100) for collagen 1a, fibronectin, and elastin was reacted overnight at 4° C. Then, the secondary antibody (1:500) was reacted at room temperature for 2 hours, stained with DAPI staining, and observation was made with a fluorescence microscope. The results thereof are shown in FIGS. 22 to 27.

(57) As shown in FIGS. 22 to 27, the peptide consisting of an amino acid sequence of SEQ ID NO: 1 or 2 shows effects of increasing expression of proteins of collagen, fibronectin, and elastin as constituents of ECM through promoting fibroblast activity, respectively.

Example 7. Procollagen1a ELISA

(58) Mouse fibroblast NIH3T3 was seeded in a 6-well plate at a density of 5×10.sup.3 cells/well, and then cultured overnight. Subsequently, the media were changed to 0.05% FBS-containing media, followed by culturing for 4 hours. Then, treatment with the positive control, i.e., 100 nM IGF-1, and the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4 were performed and cultured for 72 hours. Then, the media were collected. The amount in the medium was measured using Procollagen1a ELISA kit (Usbiological Lifescience, USA). The results thereof are shown in FIGS. 28 to 31 and Table 6.

(59) TABLE-US-00006 TABLE 6 Procollagen1a expression (%) FIG. 28 Control SEQ ID NO: 1 IGF-1 10 μM 50 μM (100 nM) 100  98 157 140 FIG. 29 Control SEQ ID NO: 2 IGF-1 10 μM 50 μM (100 nM) 100 145 146 140 FIG. 30 Control SEQ ID NO: 3 IGF-1 10 μM 50 μM (100 nM) 100 138 143 113 FIG. 31 Control SEQ ID NO: 4 IGF-1 10 μM 50 μM (100 nM) 100 122 141 113

(60) As shown in FIGS. 28 to 31 and Table 6, upon treatment with the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4, expression of pro-collagen1α protein was found to increase in fibroblasts.

Example 8. HA ELISA

(61) Human keratinocyte HaCaT was seeded in a 6-well plate at a density of 3×10.sup.5 cells/well, and then cultured overnight. The media were changed to 0.05% FBS-containing media, followed by culturing for 4 hours. Then, treatment with the positive control, i.e., 100 nM IGF-1, and the peptide consisting of an amino acid sequence of SEQ ID NO: 2 were performed and cultured for 72 hours. Then, the media were collected. An HA ELISA kit (Echelon, USA) was used to measure an amount thereof. The results thereof are shown in FIG. 32 and Table 7.

(62) TABLE-US-00007 TABLE 7 HA expression (ng/mL) FIG. 32 Control SEQ ID NO: 2 IGF-1 10 μM 50 μM (100 nM) 251 286 292 280

(63) As shown in FIG. 32 and Table 7, the peptide consisting of an amino acid sequence of SEQ ID NO: 2 shows effects of increasing HA expression, which is a protein related to skin barrier enhancement through promotion of keratinocyte activation.

INDUSTRIAL APPLICABILITY

(64) The present disclosure relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, 3, or 4, a pharmaceutical composition for preventing or treating skin disease including the peptide, a cosmetic composition for skin condition improvement including the peptide, a food composition for skin condition improvement including the peptide, a method of preventing or treating skin disease using the peptide, and a use of the peptide in preventing or treating skin disease or improving skin condition.