USE OF AN ANTIMICROBIAL PEPTIDE TP4 IN TREATING A CANCER
20170340700 · 2017-11-30
Inventors
Cpc classification
A61K45/06
HUMAN NECESSITIES
International classification
Abstract
The preset invention relates to a new approach for treating a cancer, particularly a malignant tumor, a multidrug-resistant (MDR) cancer, a recurrent cancer or a metastatic cancer, using a specific cationic antimicrobial peptide (CAP), tilapia piscidin 4 (TP4), which is derived from Nile Tilapia (Oreochromis niloticus). Also provided is a method for treating a breast cancer, particularly triple negative breast cancer (TNBC) with TP4.
Claims
1. A method for treating a cancer in a subject, comprising administering to the subject a composition comprising a therapeutically effective amount of tilapia piscidin 4 (TP4), together with a pharmaceutically acceptable carrier.
2. The method of claim 1, wherein TP4 has an amino acid sequence set forth in SEQ ID NO: 1.
3. The method of claim 1, wherein TP4 may be a functional fragment or variant of TP4.
4. The method of claim 1, wherein the cancer is breast cancer.
5. The method of claim 1, wherein the cancer is triple negative breast cancer (TNBC).
6. The method of claim 1, wherein the cancer is a malignant tumor, a multidrug-resistant (MDR) cancer, a recurrent cancer or a metastatic cancer.
7. The method of claim 6, wherein the metastatic cancer cells possess negatively-charged phosphatidylserine (PS) or anionic structures on their outer membrane.
8. The method of claim 1, wherein the treatment of the cancer is through induction of FBJ murine osteosarcoma viral oncogene homolog B (FOSB).
9. A method for controlling tumor cell growth in a subject suffering from a malignant tumor, comprising administering to the subject a composition comprising a therapeutically effective amount of TP4, together with a pharmaceutically acceptable carrier.
10. A method for treating a subject with a malignant tumor, a MDR cancer, a recurrent cancer or a metastatic cancer, comprising administering to the subject a composition comprising a therapeutically effective amount of TP4 in combination with one or more anti-cancer drugs at a ratio to provide a synergistic effect in treating the cancer.
11. A pharmaceutical composition for treating a malignant tumor, a multidrug-resistant (MDR) cancer, a recurrent cancer or a metastatic cancer, comprising TP4 in combination with one or more anti-cancer drugs at a ratio to provide a synergistic effect in treating the cancer.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0020] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiment which is presently preferred. It should be understood, however, that the invention is not limited to this embodiment.
[0021] In the drawings:
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
DETAILED DESCRIPTION OF THE INVENTION
[0095] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which this invention belongs.
[0096] As used herein, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a sample” includes a plurality of such samples and equivalents thereof known to those skilled in the art.
[0097] As used herein, the term “tilapia piscidin 4” or “TP4” refers to a cationic antimicrobial peptide (CAP) or a functional fragment or variant thereof, which is derived from Nile Tilapia (Oreochromis niloticus). TP4 has the amino acid sequence of FIHHIIGGLFSAGKAIHRLIRRRRR (SEQ ID NO: 1), as disclosed in Peng et al. (Peng et al., Five different piscidins from Nile tilapia, Oreochromis niloticus: analysis of their expressions and biological functions; PLoS One 7(11):e50263, 2012).
[0098] The term “a functional fragment or variant thereof” as used herein refers to a fragment or variant of the peptide that maintains same or similar activity, and exhibits same or similar properties.
[0099] As used herein, “FBJ murine osteosarcoma viral oncogene homolog B,” also known as “FOSB” or “FosB,” refers to a protein that, in humans, is encoded by the FOSB gene. The FOSB gene belongs to one member of the FOS gene family, which encode leucine zipper proteins that can dimerize with proteins of the JUN family (e.g., c-Jun, JunD), thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation.
[0100] It was unexpectedly found in the invention that a tilapia piscidin 4 (TP4) is potential for treatment of a cancer, through induction of FBJ murine osteosarcoma viral oncogene homolog B (FOSB).
[0101] In the invention, it is found that TP4 acts to control tumor cell growth by inducing an AP-1 protein called FOSB, the expression of which is negatively associated with the pathological grade of the tumor, and TP4 is targeted to the mitochondria where it disrupts calcium homeostasis and activates FOSB. FOSB overexpression results in TNBC cell death, whereas inhibition of calcium signaling eliminates FOSB induction and blocks TP4-induced TNBC cell death. Interestingly, both TP4 and anthracyclines strongly induced FOSB, particularly in TNBC, indicating that FOSB is suitable as a biomarker of drug responses. Accordingly, the invention provides TP4 can be used as a novel therapeutic approach toward a malignant tumor, such as TNBC, which involves targeting the “road-to-die” signaling mediated by FOSB.
[0102] In this invention, TP4 is found to be selectively toxic to breast cancer cells. According to the in vitro and in vivo data shown in breast cancer cell-lines and xenograft models as provided in the examples, it is indicated that TP4 can be developed as a novel agent to treat TNBC. It is found in the invention that TP4 damaged TNBC cells through the ERK/FOSB/cJUN axis in a calcium-dependent manner. Activation of FOSB in TNBC requires calcium signaling, which is transduced by selective targeting of TP4 to the mitochondria. In addition, induction of CDH1 by TP4 may also contribute to TNBC suppression. Interestingly, widely-used anthracyclines also induced FOSB in TNBC cells. This finding, together with the observation that FOSB overexpression triggers TNBC cell death, indicates that FOSB may be a novel therapeutic target for treating TNBC.
[0103] It is also found in the invention that the level of FOSB is significantly down regulated in grade II/III tumor samples (moderately differentiated or poorly differentiated tumor) isolated from TNBC patients (see
[0104] The mechanisms by which TP4 and anthracyclines induce FOSB and mediate BC cell death are different. While some BC-targeting peptides were reported to be localized to the nucleus and cause DNA fragmentation, no strong nuclei staining pattern of TP4 was observed in breast cancer cells (
[0105] Intratumoral injection of TP4 caused extensive necrosis of TNBC in xenograft tumor (
[0106] In summary, it can be indicated in the invention, (i) TP4 as a novel cytotoxic peptide possibly suitable for breast cancer therapy, and (ii) FOSB as a biomarker of the response to TP4 and anthracyclines, particularly in TNBC. In contrast to previous reports that TNBC can be suppressed through FRA1-mediated “road-to-survive” signaling inhibition, it is found in the invention that TNBC cell growth can be disrupted by FOSB up-regulation. TP4 and FOSB signaling are promising therapeutic candidates for TNBC treatment.
[0107] Accordingly, the invention provides a new approach using TP4 for treating a malignant tumor, a MDR cancer, a recurrent cancer or a metastatic cancer, wherein the cancer cells possess negatively-charged phosphatidylserine (PS) or anionic structures on their outer membrane.
[0108] Furthermore, the invention also provides a pharmaceutical composition for treating a subject with a malignant tumor, a MDR cancer, a recurrent cancer or a metastatic cancer, comprising a therapeutically effective amount of TP4 in combination with one or more anti-cancer drugs at a ratio to provide a synergistic effect in treating the cancer.
[0109] In the invention, the pharmaceutical composition may be formulated using any standard technology or commonly used methods known to those skilled in the art.
[0110] The term “therapeutically effective amount” as used herein refers to an amount of a drug or pharmaceutical agent which, as compared to a corresponding subject who has not received such amount, results in an effect in treatment or prevention of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder. The term also includes within its scope amounts effective to enhance normal physiological function.
[0111] For use in therapy, the therapeutically effective amount(s) of TP4 may be formulated as a pharmaceutical composition for administration.
[0112] Accordingly, the invention further provides a pharmaceutical composition comprising a therapeutically effective amount of TP4, together with one or more pharmaceutically acceptable carriers.
[0113] The term “a pharmaceutically acceptable carrier” as used herein refers to a carrier, diluent, or excipient that is pharmaceutically acceptable, in the sense of being compatible with the other ingredients of the formulation and not deleterious to the subject to be administered with the pharmaceutical composition. Any carrier, diluent or excipient commonly known or used in the field may be used in the invention, depending to the requirements of the pharmaceutical formulation.
[0114] According to the invention, the pharmaceutical composition may be adapted for administration by any appropriate route, including but not limited to topical, rectal, nasal, vaginal, oral or parenteral route. The present invention will now be described more specifically with reference to the following examples, which are provided for the purpose of demonstration rather than limitation.
Examples
[0115] 1. Materials and Method
[0116] 1.1 Reagents
[0117] TP4 (FIHHIIGGLFSAGKAIHRLIRRRRR, SEQ ID NO: 1) and TP4 biotinylated at the N-terminus were synthesized and purified by GL Biochem Ltd. (Shanghai, China) as previously described by Peng et al. Autocamtide-2 related inhibitory peptide II (AlP II) was purchased from EMD Millipore. BAPTA-AM [1,2-Bis(2-aminophenoxy)ethane-N,N,N,N-tetraacetic acid tetrakis(acetoxymethyl ester)], Paclitaxel, Docetaxel, Epirubicin hydrochloride, and Doxorubicin hydrochloride were purchased from Sigma.
[0118] 1.2 Cell Culture and Stable Clone Selection
[0119] Cell-lines used in this study were purchased from the Bioresource Collection and Research Center (BCRC) in and the cells were cultured by the standard cell culture procedures and conditions provided by the BCRC. MB231 (BCRC 60425), MB453 (BCRC 60429), and HDF cells were cultured as previously described by Ting et al. MCF7 (BCRC 60429) cells were maintained in α-MEM medium (ThermoFisher Scientific) supplemented with 2 mM L-glutamine, 10% FBS, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, and antibiotics (100 U mL.sup.−1 penicillin G and 100 g mL.sup.−1 streptomycin). M10 (BCRC 60197) cells were maintained in α-MEM medium (ThermoFisher Scientific) supplemented with 10% FBS and antibiotics. With the exception of MB231 and MB453, all cells were cultured at 37° C. with 5% CO.sub.2. For the cell viability and transfection assay, 1×10.sup.4 cells [5×10.sup.3 M10 cells were seeded and cultured for 48 h to allow the cells sufficient time for attachment] were seeded into the wells of a 96-well plate and cultured overnight. For the transfection assays, cells were transfected with 0.1-0.4 μg FOSB/FOSAB expression plasmid (Origene Technology Inc.) and cell viability was determined after 72 h. The transfection efficiencies (number of cells expressing eGFP/all cells) of the MB231 transfection assays were determined by observing ten randomly selected fields (from three independent transfections) of control GFP plasmid transfections under an inverted microscope (Olympus, IX71) coupled to a digital camera (Olympus DP80), using an 10× objective lens (LCPlanFI 20×/0.40 Ph1). CellSens standard software (Olympus) was used for image acquisition. During the drug treatment assay, inhibitors (PD98059, BAPTA-AM, and AlP II) were added 30 min prior to TP4, and cell viability was determined at indicated time-points. Transfection was performed using LipofectAMINE™ 3000 (ThermoFisher Scientific), according to the manufacturer's recommendations. Knock-down cells were generated by transducing MB231 cells with pre-synthesized FOSB (or control) shRNA lentiviral particles (Santa Cruz Biotechnology), and selecting puromycin-resistant cells in accordance with the manufacturer's standard protocol. MB231 or M10 cells stably expressing eGFP or mOrange2 were generated through transfection with peGFP-puromycin or pmOrange2-C1 plasmid, followed by puromycin (5 μg mL.sup.−1) or G418 (500 μg mL.sup.−1) selection as described above.
[0120] 1.3 Antibodies
[0121] Antibodies used in this study (for the results shown in the Supplementary Results) were as follows: β-actin (1:5000, clone AC-15) and caspase 3 (1:1000, clone 74T2) were from ThermoFisher Scientific; Cytochrome C (1:500, clone EP1326Y) was from EMD Millipore; cleavage-Caspase 3 (1:1000, clone 5A1E), SAPK/JNK (1:1000), phospho-SAPK/JNK (1:1000, clone 81E11), ERK1/2 (1:5000), and phospho-ERK1/2 (1:5000) were from Cell signaling; P38 MAPK and phospho-P38 MAPK were from BD Transduction Laboratories.
[0122] 1.4 Cell Viability Assay
[0123] Cell viability was quantitatively analyzed using the CellTiter-Glo® Luminescent Cell Viability Assay kit (ATP assay) and CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay kit (MTS assay) (Promega) in accordance with the manufacturer's protocol. For MTS assay, 1×10.sup.4 cells were seeded into the wells of a 96-well plate and cultured overnight [5×10.sup.3 M10 cells were seeded and cultured for 48 h to enable sufficient well attachment]. Cells were subsequently treated with different doses of TP4 (2.5-20 μg mL.sup.−1) and harvested at the indicated time-points (3-24 h). Reaction mixtures (20 μL: MTS+PMS, using a ratio 20:1) were directly added to the cells, and the plates were incubated for 3 h at 37° C. Absorbance at 490 nm is directly proportional to the number of living cells in culture and was measured using a photometer (SpectraMax® i3, Molecular Devices). ATP assay was performed as previously described by Ting et al. Lactate dehydrogenase (LDH) assays were performed by quantitatively measuring cell lysis with a Cytotoxicity Detection Kit.sup.PLUS (LDH) (Roche) in accordance with the manufacturer's protocol. The LDH standard was purchased from Cayman Chemical. Briefly, 1×10.sup.4 cells were seeded into the wells of a 96-well plate and cultured overnight. Culture media were replaced with fresh medium containing 1% FBS and cells were subsequently treated with different doses of TP4 (2.5-20 μg mL.sup.−1). Supernatants were harvested at 3 h. After centrifugation at 200×g for 5 min to remove cell debris, supernatants were collected and 50 μL were aliquoted from each well into a new microplate. Reaction mixtures were then added and incubated for 15 min at RT. Stop solution was added to the well, and absorbance at 490 nm was determined with a reference wavelength of 600 nm.
[0124] 1.5 DNA Laddering Assay
[0125] DNA fragmentation was analyzed using the Suicide-Track™ DNA Ladder Isolation Kit (EMD Millipore) in accordance with the manufacturer's standard procedures. Sufficient DNA samples from TP4 treatment groups were extracted by collecting cells from ten 10 cm.sup.2 dishes. Precipitated DNA samples were analyzed by 1.5× agarose gel electrophoresis.
[0126] 1.6 Transcriptome Analysis
[0127] Total RNA samples were extracted from MB231 and HDF cells treated with TP4 (14 μg/mL) for 6 h. Total RNA (0.2 μg) was amplified using a Low Input Quick-Amp Labeling kit (Agilent Technologies, USA), and the cDNA was labeled with Cy3 (CyDye, Agilent Technologies, USA) during the in vitro transcription process. Cy3-labeled cRNA (0.6 μg) was fragmented to an average size of about 50-100 nucleotides by incubation with fragmentation buffer at 60° C. for 30 min. Corresponding fragmented labeled cRNA was then pooled and hybridized to an Agilent SurePrint G3 Human V2 GE 8×60K Microarray (Agilent Technologies, USA) at 65° C. for 17 h. After washing and drying using a nitrogen gun blowing, microarrays were scanned with an Agilent microarray scanner at 535 nm to detect Cy3. Scanned images were analyzed using Feature extraction 10.5.1.1 software (Agilent Technologies, USA); image analysis and normalization software was used to quantify signal and background intensity for each feature.
[0128] 1.7 AP-1 Transcription Factor Activation Assay
[0129] Activation of AP-1 was determined using the TransAM AP-1 kit (Active Motif, Inc), as previously described by Ting et al.
[0130] 1.8 Coimmunoprecipitation and Western Blot
[0131] Nuclear extracts were prepared as previously described.sup.23. Equal amounts of nuclear extract (200 μg) were used for immunoprecipitation (IP) using Dynabeads protein G (ThermoFisher Scientific), in accordance with the recommended protocol. cJUN antibody (ThermoFisher Scientific, clone C.238.2) was used for immunoprecipitation. Total cell extract preparation and Western blot were performed as previously described.sup.23. Equal amounts of boiled lysate (20 μg of total cell extract) were separated on acrylamide gels, and then transferred to PVDF membranes. The membranes were incubated in blocking solution (0.1 M PBS, 5% non-fat milk, 0.2% Tween-20) for 1 h at room temperature (RT), and then incubated in the same solution with primary or secondary antibodies (GE Healthcare Life Science). Primary antibodies were as follows: c-FOS (Cell signaling, 9F6, 1:1000), FOSB (Cell Signaling, 5G4, 1:1000), FRA1 (Cell Signaling, D80B), ATF3 (EMD Millipore, 6B8, 1:500), JUNB (Cell Signaling, C37F9, 1:1000), JUND (EMD Millipore, 1:1000), c-JUN (EMD Millipore, 6A6.2, 1:2000), Vimentin (Abeam, EPR3776, 1:5000), CDH1 (Cell Signaling, 24E10, 1:1000), Integrin α5 (Cell Signaling, 1:1000), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EMD Millipore, clone 6C5, 1:10,000), αActin (smooth muscle) (αSMA, OriGene Technologies, 1:5,000), SNAI1 (ABGENT, N-term D24, 1:500), and ZO1 (ThermoFisher Scientific, 1:1,000). Membranes were visualized with enhanced chemiluminescence (Immobilon Western Chemiluminescent HRP substrate, Merck Millipore) and detected by an imaging system (UVP, BioSpectrum™ 500). Signal intensities were determined by densitometric analysis (AlphaInnotech) using the AlphaImager program. The results were expressed as relative densitometric units (RDU) (the densitometric units of FOSB+FOSΔB divided by those of GAPDH).
[0132] 1.9 Calcium Measurement
[0133] Calcium (Ca.sup.2+) levels were determined using the Fluo-4 acetoxymethyl ester (AM) Direct Ca.sup.2+ assay kit (ThermoFisher Scientific) and Rhod-2 calcium indicator (ThermoFisher Scientific), as recommended by the manufacturer. Briefly, 1×10.sup.4 cells were seeded into a well of a 96-well plate and cultured overnight. Eight replicates were performed for each condition. Cytosolic calcium was measured by adding 2× Fluo-4 Direct™ reagent (final probenecid concentration of 5 mM) directly to each well, and then incubating the plates for 30 min at 37° C., and subsequently for 30 min at RT. Cells were treated with TP4 (5-20 μg mL.sup.−1) for 5, 10, 20, or 30 min. Fluorescence was subsequently measured using a fluorescence reader (SpectraMax® i3, Molecular Devices), using instrument settings appropriate for excitation at 494 nm and emission at 516 nm. Ca.sup.2+ levels are presented as relative fluorescent units (ARFU), determined using the following equation: F−F.sub.min/F.sub.min, where F.sub.min denotes the background-subtracted pre-stimulus fluorescence level. Mitochondrial Ca.sup.2+, was measured by incubating cells with 2 μM Rhod-2 AM ester and 0.02% pluronic F-127 for 30 min at 37° C. After three washes in D-PBS, cells were incubated for 30 min in culture medium at 37° C. Cells were treated with TP4 (5-20 μg mL.sup.−1) and fluorescence was determined kinetically every 30 sec for 30 min using a fluorescence reader with instrument settings appropriate for excitation at 552 nm and emission at 581 nm. Mitochondrial Ca.sup.2+ levels are presented as relative fluorescent units F/F0, where F0 denotes the un-stimulated fluorescence level.
[0134] 1.10 Immunocytochemical, Immunohistochemical, and Whole-Mount Studies
[0135] The plasma membrane and mitochondria were stained by pre-incubating biotinylated-TP4 treated cells (14 μg mL.sup.−1, 3 h) with Alexa Flour 647 dye-conjugated wheat germ agglutinin (WGA) (5 μg mL.sup.−1) (ThermoFisher Scientific) for 10 min at 37° C. or with MitoTracker® Red CMXRos probe (200 nM) (ThermoFisher Scientific) for 45 min at 37° C. prior to cell fixation. Cells were then fixed with 4% PFA (in PBS) for 15 min, and permeabilized with 0.1% Triton X-100 in PBS (PBST) for 12 min at RT. After blocking with 5% BSA in PBST, the cells were incubated overnight at 4° C. with Biotin (Santa Cruz Biotechnology, 39-15D9, 1:500), Calreticulin (1:500), Giantin (Abcam, 1:1000), or FOSB (1:500) antibody. Cells were then washed three times with TBS-T (20 mM Tris-HCl, pH 7.4, 137 mM NaCl, and 0.1% Tween-20), and incubated for 1 h at RT with secondary antibodies (1:500; ThermoFisher Scientific) conjugated to the appropriate fluorescent dye. Hochest33342 was used for nuclear staining. The fluorescent signal (which is proportional to functional mitochondria) was quantitatively determined using Image J software. Human breast adjacent normal tissue array (BRN801a) and TNBC tissue array (BR487a) were purchased from US Biomax, Inc. Commercially-available human tissue samples were used in accordance with the regulations of the “Human Subject Research Ethics Committee” of Academia Sinica. Paraffin sections were immunostained with FOSB antibody (1:50) and Hochest 33342. Fluorescent images were obtained with an inverted microscope (Olympus, IX71) coupled to a digital camera (Olympus DP80), using a 4× (UPlanFI 4×/0.13 PhL) objective lens. CellSens standard software (Olympus) was used for image acquisition. The fluorescent FOSB signal was quantitatively determined using Image J software. For whole mount staining, xenograft zebrafish were fixed using 4% PFA for 1 h at RT. After four washes for 5 min each in PBST (1% Triton-X-100), fish were incubated in blocking buffer (PBS+1% triton-X-100+10% FBS) for 1 h at RT. Fish were then washed twice with blocking buffer and incubated with FOSB antibody (1:50) for 2 days in blocking buffer. After a further three washes for 1 h each in PBST, fish were incubated with secondary antibody conjugated to Alexa Flour 647 for 2 h at RT. Fish were then washed three times with PBST for 10 min each at RT. After mounting (tissues or cells) with fluorescent mounting medium (ProLong Gold Antifade Reagent, ThermoFisher Scientific), images were obtained with an FV1000 laser-scanning confocal microscope (Olympus), using a 10× (Olympus UPlanSApo 10×, N.A. 0.40) or 60× objective lens (Olympus UPlanSApo 60×, N.A. 1.35, oil). ASW2.1 software (Olympus) was used for image acquisition, disseminated tumor foci quantitation, and the measurement of primary tumor area.
[0136] 1.11 Mice and Pathological Studies
[0137] Female BALB/c nu/nu mice were obtained from BioLASCO Taiwan, Co., Ltd., and housed at the Laboratory Animal Facility, National Taiwan Ocean University, Keelung, Taiwan. Mice were maintained in pathogen-free sterile isolators, according to the guidelines of the Council of Agriculture (COA, Taiwan), and all food, water, caging, and bedding were sterilized before use. The animal protocol (103034) was approved by the Institutional Animal Care and Use Committee (IACUC) of the College of Life Science, National Taiwan Ocean University. For the TP4 treatment assay, nude mice with pre-growth MB231 tumors (n=5 for each group) were subcutaneously injected with TP4 (500 μg in 50 μL distilled water plus 10 μL KY jelly (Johnson & Johnson)) every two days for a total of fourteen times, by which time the tumors had reached an average volume of 30-50 mm.sup.3 in size. Age-matched control nude mice without tumor xenografts were injected with KY jelly (10 μL plus 50 μL distilled water). Tumor size was calculated every two days, using the following formula: volume=[(height×length×width)×3.1416]/6. Mice were sacrificed 28 days after the beginning of TP4 treatment, and the tumors were harvested and weighed. Tumor samples were fixed with formalin and embedded with paraffin. Paraffin sections were stained by Hematoxylin & Eosin (H&E) and immunostained with Ki-67 antibody (Cell Signaling, clone D2H10, 1:100). Images were obtained with an inverted microscope (Olympus, IX71) coupled to a digital camera (Olympus DP80), using a 10× (UPlanFI 10×/0.30 Ph1) and 40× (LUCPlanFI 40×/0.60 Ph2) objective lens. CellSens standard software was used for image acquisition. Fluorescent images were obtained with an FV1000 laser-scanning confocal microscope, using a 10× objective lens (UPlanSApo 10×, N.A. 0.40). ASW2.1 software was used for image acquisition and analysis.
[0138] 1.12 Zebrafish Xenotransplantation Model
[0139] AB line zebrafish (Danio rerio) were provided by the Taiwan Zebrafish Core Facility (Academia Sinica). The transgenic line (fli:eGFP) was a kind gift from JY LIN Trading Co., Ltd (Pingtung, Taiwan). Fish care, maintenance, and experimental procedures were performed in accordance with “The Ethical Guideline for Using Vertebrates as Experimental Animals in Taiwan”, and were approved by the “Ethical Committee for Using Vertebrates as Experimental Animals” of Academia Sinica. Tumor cell xenotransplantation protocols were performed in accordance with previously published methods with modifications.sup.44,45. Briefly, fertilized zebrafish eggs were incubated at 28° C. in E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM MgSO.sub.4) containing 0.2 mM PTU (Sigma). After de-chorionization at 24 hpf (hour-post-fertilization), eggs were soaked in E3 medium with tricaine (0.02 mg/mL, Sigma). After 24 h (48 hpf), embryos were orientated on a 1.8% agarose-modified microinjection plate. Tumor cells (2×10.sup.6 of MB231 or M10 cells expressing eGFP/mOrange2) were suspended in 25 μL Matrigel® matrix (12.0 mg mL.sup.−1) solution (Corning), and 10-15 nL cell suspensions were microinjected into embryos (parameters were set at 7.0 psi and 0.5-1.0 secs). Xenografted embryos were placed in a 96 well black plate with a clear bottom (Coring) and then immobilized with methyl cellulose (1.25 μL); images were obtained with an inverted microscope (Olympus IX71) equipped with a camera (Olympus DP80), using a 4× objective lens (Olympus UPlanFI 4×/0.13 phL). On every subsequent day for 5 days, the media in each well were replaced with fresh E3 media containing TP4 (3 μg mL.sup.−1), and images were obtained. The fluorescent signal (which is proportional to the number of eGFP-expressing cells) was quantitatively determined using Image J software. For time-lapse studies, immobilized and xenograft embryos received a single dose of TP4 or mock treatment before imaging and were incubated at 28° C. for 48 h. Images were obtained using the ImageXpress Micro HCS Image System (Molecular Devices). Images (including z stacks) were recorded under a 4× objective lens (Plan Fluor 4×/0.13) at 1 h intervals, using transmitted light and the FITC (EX 482/35, EM 536/40) and TRITC (EX 543/22, EM 593/40) filter sets. Every channel was captured from 5 images along the z-axis across a distance of 70 μm, and was composited to the best-focus image. Images were taken and tumor analysis was performed using the integrated MetaXpress® program (v.5.3, Custom Module Editor) to quantify the area and fluorescence intensity of the tumor inside the zebrafish. Normalized data are expressed relative to the value at 0 h.
[0140] 1.13 TUNEL Staining
[0141] TUNEL (TdT-mediated dUTP nick end labeling) staining was performed using the In Situ Cell Death Detection Kit, POD (Roche) following the standard procedures recommended by the manufacturer. Briefly, cells (MB231 and HDF) were seeded onto the chamber slide and incubated overnight. Cells were blocked, fixed, and permeabilized after TP4 treatment for 3 or 6 h. The labeling solution and TUNEL reaction mixture were then added to the cells. After three washes in PBS, cells were subjected to nuclear staining by Hochest33342. Cell images were subsequently acquired using the FLoid cell imaging station (ThermoFisher Scientific). Cells treated with DNase I served as a positive control and cells untreated with terminal transferase (the enzyme mixture) served as negative control.
[0142] 1.15 Quantitative Real-Time PCR
[0143] Zebrafish were collected (n=10 per group, for 3 experiments, a total of 30 zebrafish) at days 1-5 and homogenized in 300 μL Qiazol (Qiagen). Homogenates were vortexed for 15 sec, left to stand at RT for 5 min, and then added to 60 μL of chloroform. The mixtures were then vortexed for 15 sec, left to stand at RT for a further 3 min, and then transferred to the Phase Lock Gel™ (5 PRIME). After centrifugation at 12,000×g for 15 min, the supernatants were collected and processed using the RNA extraction kit (WELGENE Biotech). For reverse transcription, 1 μg of total RNA and the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs) were used by following the manufacturer's recommendations. For real-time PCR, 1.5 μL cDNA and SYBR Green Real-time PCR Master Mix (TOYOBO) were used with the StepOnePlus Real-Time PCR System (Applied Biosystems, Life technologies). The PCR condition was as follows: 95° C. for 1 min (holding stage); 40 cycles of 95° C. for 15 sec, 60° C. for 15 sec, and 72° C. for 45 sec; 95° C. for 15 sec, 60° C. for 1 min, and 95° C. for 15 sec (Melting curve stage). To analyze gene expression, the 44CT method was performed with α-tubulin (Tub-αlb) as the calibrator gene. Primer sequences were as follows:
TABLE-US-00001 Tubα1b: (SEQ ID NO: 2) F: TTCCCTCTGGCTACCTATG; (SEQ ID NO: 3) R: TCTTGATGGTGGCGATTGCG; Cxcl8a: (SEQ ID NO: 4) F: CTCACTTAGGCAAAATGACCAG; (SEQ ID NO: 5) R: TTCCAATGCGTCGGCTTTC; ifnφ: (SEQ ID NO: 6) F: GCCGATACAGGATAATAACGACAG; (SEQ ID NO: 7) R: AGTGTTTTGGTCCCAGTT; Il1β: (SEQ ID NO: 8) F: TTTGTGGGAGACAGACGGT; (SEQ ID NO: 9) R: CCAACTGCTTCATTTTGTGC; Il10: (SEQ ID NO: 10) F: AGCACTCCACAACCCCAATC; (SEQ ID NO: 11) R: GACCCCCTTTTCCTTCATC; Mmp9: (SEQ ID NO: 12) F: CATCCGCAACTACAAGAC; (SEQ ID NO: 13) R: TCACCTGGAGGATAAGCG; Tnfα: (SEQ ID NO: 14) F: TCTTCAAAGTCGGGTGTATG; (SEQ ID NO: 15) R: GGTCATCTCTCCAGTCTAAGG; Tnfβ: (SEQ ID NO: 16) F: GCCAAACGAAGAAGGTCAG; (SEQ ID NO: 17) R: CACCGCCAACCCATTTCA.
[0144] 1.16 Statistical Analysis
[0145] For the multi-well based assay, cells were plated at least in sextuplicate. Data were collected from independently repeated experiments (n 3) and were analyzed by Prism 5 software (GraphPad Inc.). The statistical significance of any difference was determined by applying the two-tailed t-test or one-way/two-way analysis of variance (ANOVA) with Bonferroni post-test. The difference was considered statistically significant at P<0.05.
[0146] 2. Results
[0147] 2.1 TP4 Induces Selective Necrosis of TNBC Cells
[0148] Different molecular subtypes of BC cell-lines (MDA-MB231, MDA-MB453, and MCF7) were subjected to the MTS assay to investigate whether TP4 can selectively kill BC cells in vitro. It was observed that treatment with 15 μg mL.sup.−1, 5.03 μM of TP4 is sufficient to kill over 50% BC cells at 6 h, while the same dose had only minor effects on the viability of control normal human mammary epithelial cells (M10) or dermal fibroblasts (HDFs) (
TABLE-US-00002 TABLE 1 Cellular toxicity of TP4 to cells evaluated by MTS assay Dose (μg/mL) Time 2.5 5.0 10.0 15.0 20.0 MB231 3 h 95.34 ± 5.56.sup.a 90.55 ± 10.57.sup.a 75.01 ± 11.29.sup.d 52.48 ± 11.16.sup.d 30.57 ± 4.64.sup.d 6 h 95.93 ± 8.86.sup.a 82.30 ± 6.40.sup.d 65.28 ± 6.61.sup.d 42.59 ± 10.14.sup.d 26.65 ± 7.16.sup.d 12 h 87.60 ± 12.28.sup.c 79.00 ± 9.48.sup.d 61.63 ± 11.38.sup.d 38.31 ± 7.26.sup.d 19.31 ± 5.73.sup.d 24 h 87.01 ± 9.69.sup.c 71.69 ± 6.84.sup.d 57.98 ± 6.62.sup.d 29.78 ± 4.79.sup.d 16.19 ± 4.15.sup.d MB453 3 h 93.75 ± 4.33.sup.d 91.50 ± 4.32.sup.d 77.82 ± 4.33.sup.d 53.12 ± 10.90.sup.d 36.33 ± 5067.sup.d 6 h 86.51 ± 4.19.sup.d 76.46 ± 6.25.sup.d 58.58 ± 5.43.sup.d 27.09 ± 2.54.sup.d 18.25 ± 1.80.sup.d 12 h 92.21 ± 6.61.sup.d 80.18 ± 5.41.sup.d 62.25 ± 10.74.sup.d 27.32 ± 5.51.sup.d 15.02 ± 4.28.sup.d 24 h 87.84 ± 4.75.sup.d 87.00 ± 4.16.sup.d 77.24 ± 4.07.sup.d 58.93 ± 2.80.sup.d 40.15 ± 2.66.sup.d MCF7 3 h 98.00 ± 6.05.sup.a 83.74 ± 6.10.sup.d 75.01 ± 11.15.sup.d 45.15 ± 9.89.sup.d 24.63 ± 3.80.sup.d 6 h 91.20 ± 6.51.sup.b 79.17 ± 12.06.sup.d 70.30 ± 12.26.sup.d 28.28 ± 6.29.sup.d 15.48 ± 2.33.sup.d 12 h 93.01 ± 10.60.sup.b 77.79 ± 7.73.sup.d 68.89 ± 6.54.sup.d 26.23 ± 6.08.sup.d 14.36 ± 2.10.sup.d 24 h 90.83 ± 5.30.sup.b 75.19 ± 11.28.sup.d 67.00 ± 10.90.sup.d 25.09 ± 3.83.sup.d 11.90 ± 3.39.sup.d M10 3 h 100.77 ± 4.23.sup.a 97.11 ± 4.90.sup.a 90.78 ± 4.76.sup.d 84.85 ± 5.83.sup.d 67.92 ± 5.16.sup.d 6 h 94.75 ± 7.52.sup.c 92.00 ± 5.12.sup.d 83.95 ± 7.47.sup.d 78.87 ± 5.57.sup.d 60.27 ± 4.97.sup.d 12 h 96.05 ± 5.66.sup.a 92.62 ± 4.99.sup.d 83.77 ± 4.27.sup.d 65.49 ± 6.68.sup.d 47.16 ± 8.42.sup.d 24 h 93.97 ± 3.81.sup.d 91.22 ± 3.99.sup.d 80.69 ± 5.72.sup.d 58.41 ± 6.80.sup.d 44.02 ± 4.50.sup.d HDF 3 h 105.05 ± 6.49.sup.a 103.37 ± 5.88.sup.a 101.86 ± 9.49.sup.1 102.67 ± 9027.sup.a 98.64 ± 12.96.sup.a 6 h 98.59 ± 4.42.sup.a 96.79 ± 3.43.sup.a 92.87 ± 2.98.sup.c 90.85 ± 6.82.sup.d 80.98 ± 12.27.sup.d 12 h 100.01 ± 4.74.sup.a 93.79 ± 3.81.sup.b 89.56 ± 3.87.sup.d 85.92 ± 4.24.sup.d 80.46 ± 1.58.sup.d 24 h 97.20 ± 5.62.sup.a 92.72 ± 6.58.sup.c 86.10 ± 9.39.sup.d 82.22 ± 11.37.sup.d 72.18 ± 13.50.sup.d
[0149] 2.2 FOS Family Members were Induced by TP4 in TNBC Cells
[0150] To characterize the downstream events which contribute to TP4-induced TNBC death, we analyzed gene expression profiles through microarray studies. Gene ontology (GO) analysis revealed that TP4 treatment caused dramatic changes in the gene expression profiles of TNBC cells (
TABLE-US-00003 TABLE 2 KEGG categories of pathways significantly affected by TP4 treatment of MB231 cells. Description Term Count P-Value MAPK signaling pathway hsa04010 14 8.46E−03 Adherens junction hsa04520 6 3.25E−02 Circadian rhythm hsa04710 3 3.52E−02 p53 signaling pathway hsa04115 5 7.22E−02 Pathways in cancer hsa05200 13 7.66E−02
[0151] The molecules involved by Western blotting were further examined. It was observed that active forms of both JNK and p38 were significantly decreased by TP4 treatment in TNBC cells, but not in control HDF cells (
[0152] 2.3 TP4 Induces FOSB to Trigger TNBC Cell Death
[0153] Strong induction of FOSB by TP4 in TNBC cells suggested possible involvement of FOSB in TP4-mediated TNBC cell death. A previous study indicated that FOSB is highly expressed in normal ductal mammary epithelium, but not in poorly differentiated ductal carcinoma.sup.40. To address whether FOSB expression is associated with TNBC progression, we analyzed FOSB expression in various grades of tumor samples from TNBC patients by immunohistochemical analysis. Expression of FOSB in breast normal adjacent tissue (NAT, n=26) was found to be stronger than expression in grade II (n=19) and grade III (n=10) TNBC samples (
[0154] Coimmunoprecipitation of cJUN confirmed an association between c-JUN and FRA1 (
[0155] TP4 Causes Mitochondrial Dysfunction
[0156] To characterize the mechanism of action of TP4 and the role of FOSB induction, we examined the cellular localization of TP4 in TNBC cells. Cells treated with biotinylated TP4 (14 μg mL.sup.−1) for 1 h were co-stained with biotin, organelle-specific antibodies/dye (Calreticulin for the ER; Giantin for the Golgi; and MitoTracker for the mitochondria), and fluorescent dye-conjugated WGA (for the plasma membrane). TP4 was observed to be targeted to the Golgi, mitochondria, and plasma membrane as evidenced by strong co-localization of the biotin signal with Giantin (
[0157] 2.4 Mitochondrial Calcium Leakage Caused by TP4 Induces FOSB
[0158] It was shown in Ting that CAP induces AP-1 to trigger cancer cell death through calcium signaling (Ting et al.). We next examined whether Ca.sup.2+ homeostasis is affected by TP4 treatment in TNBC cells. Intracellular Ca.sup.2+ levels were measured using fluo-4 AM Ca.sup.2+ indicators at 5-30 min after treatment of TNBC cells with TP4 (
[0159] 2.5 TP4 Inhibits Tumor Growth in a Nude Mouse Xenograft Model
[0160] To evaluate the effects of TP4 treatment on tumor growth in vivo, transplanted TNBC cells were subcutaneously injected into nude mice (n=5), and tumor growth was assessed daily for 28 days. A group of nude mice with xenografts were treated with TP4 every two days once the tumor reached a certain size. As shown in
[0161] 2.6 TP4 Prolongs the Survival of TNBC Xenograft Zebrafish
[0162] To further investigate the therapeutic ability of TP4, we generated a TNBC xenograft zebrafish model with which to study the ability of TP4 to inhibit TNBC migration and invasion. A schematic indicating the treatment procedures and analytic approaches used in this study is shown in
[0163] Given the above, it was concluded that TP4 is a potential medicament for treating breast cancer.
[0164] The descriptions and claims as provided should be understood as of demonstrative purpose instead of limitative in any way to the scope of the present invention.