Pr13.5 promoter for robust T-cell and antibody responses
09828414 · 2017-11-28
Assignee
Inventors
Cpc classification
A61P43/00
HUMAN NECESSITIES
C12N2710/24122
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2710/24143
CHEMISTRY; METALLURGY
International classification
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The invention encompasses recombinant poxviruses, preferably modified Vaccinia Ankara (MVA) viruses, comprising a Pr13.5 promoter operably linked to a nucleotide sequence encoding an antigen and uses thereof. The invention is drawn to compositions and methods for the induction of strong CD8 T cell and antibody responses to a specific antigen(s) by administering one or more immunizations of the recombinant MVA to a mammal, preferably a human.
Claims
1. A method of inducing a robust CD8 T cell response against a neoantigen in a human comprising administering one or more administrations of a recombinant modified Vaccinia Ankara (MVA) virus to the human; wherein the recombinant MVA comprises a Pr13.5 promoter operably linked to a nucleotide sequence encoding the neoantigen, wherein the Pr13.5 promoter comprises at least 2 copies of SEQ ID NO:1, and wherein the at least 2 copies of SEQ ID NO:1 are separated by 30-40 nucleotides.
2. The method of claim 1, wherein the Pr13.5 promoter comprises SEQ ID NO:2.
3. A recombinant modified Vaccinia Ankara (MVA) virus comprising a Pr13.5 promoter operably linked to a nucleotide sequence encoding a neoantigen, wherein the Pr13.5 promoter comprises at least 2 copies of SEQ ID NO:1, and wherein the at the at least 2 copies of SEQ ID NO:1 are separated by 30-40 nucleotides.
4. The recombinant MVA of claim 3, wherein the Pr13.5 promoter comprises SEQ ID NO:2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION OF THE INVENTION
(10) HeLa cells were infected with MVA-BN and RNA was prepared. Primers specific for various MVA ORFs were generated and RACE-PCR (FirstChoice® RLM-RACE Kit, Life Technologies, Darmstadt, Germany) was used to generate PCR products representative of the MVA RNAs encoding these ORFs. The PCR products were sequenced to identify the transcription start sites. Based on this information, promoters were identified for the transcription of mRNAs encoding these ORFs. The MVA promoters for the following ORFs were inserted into MVA constructs to drive expression of the ovalbumin (OVA) gene: MVA13.5 (CVA022; WR 018), MVA050L (E3L; WR 059), MVA022L (K1L; WR 032), and MVA170R (B3R; WR 185).
(11) HeLa cells were infected in vitro with the recombinant MVA viruses and ovalbumin protein expression was examined by FACS analysis. No ovalbumin protein expression was detected by FACS analysis for constructs containing the MVA050L (E3L; WR 059), MVA022L (K1L; WR 032), and MVA170R (B3R; WR 185) promoters at 2, or even 4, hours after infection. In contrast, high level ovalbumin expression was detected with the MVA13.5 (CVA022; WR 018) promoter already after 2 hours.
(12) A putative promoter core element for the MVA13.5L ORF was previously identified in Yang et al., 2010, as containing a 15 nt core sequence, and an untranslated leader of 177 nt. However, the current study indicated that the transcriptional start sites used by MVA13.5L ORF were downstream of the start site identified by Yang et al. by more than 100 nucleotides. Consequently, the MVA13.5 promoter identified by the inventors differs from the promoter core element identified by Yang et al.
(13) The MVA13.5 promoter identified by the inventors contains a repeat of over 40 nucleotides: TAAAAATAGAAACTATAATCATATAATAGTGTAGGTTGGTAGTA (SEQ ID NO:1). The repeated sequence can also be found in many other poxviruses, for example, horsepox virus, monkeypox virus, cowpox virus, variola virus, vaccinia virus, camelpox virus, rabbitpox virus, Ectromelia virus, and taterapox virus (
(14) Two MVA constructs were generated with promoters containing one copy (MVA13.5 short; SEQ ID NO:1) or two copies (MVA13.5 long; SEQ ID NO:2) of the repeat driving expression of the ovalbumin (OVA) gene. High level ovalbumin expression was detected after infection of HeLa cells in vitro with both of the constructs. (
(15) Ovalbumin RNA expression directed by various promoters in infected HeLa cells in vitro was measured at various time points by RT-qPCR. Both MVA13.5 short and MVA13.5 long showed high levels of early RNA expression. (
(16) CD8 T cell responses against recombinantly expressed OVA under control of the promoters PrS, Pr7.5 opt+spacer, Pr13.5 short and Pr13.5 long were determined in mice after one, two, and three immunizations of recombinant MVA per mouse (
(17) The average ratio of OVA-specific to B8R-specific CD8 T cells was approximately 2.5 for MVA13.5-long after 3 immunizations. The other 3 constructs showed an average ratio of less than 1. Thus, a reversal of the immunodominance hierarchy could be achieved by using the Pr13.5 long promoter for expression of the neoantigen, but not by using the other promoters.
(18) Antibody responses against recombinantly expressed OVA under control of various promoters were determined in mice after one, two, and three immunizations of recombinant MVA per mouse. (
(19) Pr13.5 Promoters
(20) The invention encompasses isolated nucleic acids comprising or consisting of a Pr13.5 promoter. Within the context of this invention, a “Pr13.5 promoter” comprises at least 1 copy of a nucleic acid sequence of at least 40 bases having at least 95% identity with SEQ ID NO:1. Thus, a “Pr13.5 promoter” can, in various embodiments, refer to an MVA nucleotide sequence, a synthetic sequence, or an analogous poxviral sequence from a poxvirus other than MVA. Preferably, the Pr13.5 promoter comprises at least 1 copy of a nucleic acid sequence of at least 40 bases having at least 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:1. The nucleic acid sequence is preferably 40, 41, 42, 43, 44, or 45 bases in length.
(21) The percent identity can be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. (Nucl. Acids Res. 12:387, 1984) and available from the University of Wisconsin Genetics Computer Group (UWGCG). The preferred default parameters for the GAP program include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess, Nucl. Acids Res. 14:6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps. Other programs used by one skilled in the art of sequence comparison may also be used.
(22) Preferably, the Pr13.5 promoter is operably linked to a heterologous nucleic acid sequence. Within the context of this invention, “heterologous nucleic acid sequence” means a nucleic acid sequence to which the promoter is not linked in nature. Within the context of this invention, “operably linked” means that the promoter can drive expression of the heterologous nucleic acid sequence in a poxvirus infected cell. The heterologous nucleic acid sequence preferably encodes a neoantigen. Within the context of this invention, a neoantigen refers to an antigen not naturally expressed by the poxviral vector.
(23) The Pr13.5 promoter can be operably linked to a heterologous nucleic acid sequence by recombinant DNA technology. In various embodiments, the heterologous nucleic acid sequence is introduced into the 13.5 ORF of the poxvirus.
(24) Preferably, the Pr13.5 promoter is a naturally occurring poxvirus promoter. For example, the Pr13.5 promoter can be from modified vaccinia Ankara (MVA) virus, monkeypox virus, cowpox virus, variola virus, vaccinia virus, camelpox virus, rabbitpox virus, Ectromelia virus, or taterapox virus Pr13.5 promoter. Preferred Pr13.5 promoters can be selected from the viruses shown in
(25) In various embodiments, the Pr13.5 promoter is a synthetic Pr13.5 promoter.
(26) The Pr13.5 promoter can contain 1, 2, 3, 4, 5, 6, or more copies of a sequence of at least 40, 41, 42, 43, 44, or 45 nucleotides that has at least 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:1.
(27) Preferably, the Pr13.5 promoter contains 1 copy of the nucleotide sequence of SEQ ID NO:1.
(28) In some embodiments, the Pr13.5 promoter contains 1 copy of the nucleotide sequence of SEQ ID NO:1 and 1, 2, 3, 4, 5, 6, or more copies of a sequence of at least 40, 41, 42, 43, or 44 nucleotides that has at least 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:1.
(29) Preferably, the Pr13.5 promoter contains at least 1 copy of a nucleotide sequence of at least 40 bases that has at least 98% identity with SEQ ID NO:1.
(30) In some embodiments, the Pr13.5 promoter contains 1 copy of a nucleotide sequence of at least 40 bases that has at least 95%, 96%, 97%, 98%, 99%, or 100%% identity with SEQ ID NO:1 and 1, 2, 3, 4, 5, 6, or more copies of a second nucleotide sequence of at least 31 nucleotides that has at least 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO:1. Preferably the second nucleotide sequence is at least 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 bases.
(31) Preferably, the repeated sequences are separated by 20-80 nucleotides, more preferably 30-40 nucleotides, and most preferably of 33, 35, 35, 36, 37, 38, 39, or 40 nucleotides.
(32) Preferably, the Pr13.5 promoter comprises at least one copy of the sequence:
(33) TABLE-US-00001 (SEQ ID NO: 2) TAAAAATAGAAACTATAATCATATAATAGTGTAGGTTGGTAGTATTGCTC TTGTGACTAGAGACTTTAGTTAGGTACTGTAAAAATAGAAACTATAATCA TATAATAGTGTAGGTTGGTAGTA.
(34) In some embodiments, the Pr13.5 promoter comprises one or more of the nucleotide changes shown in
(35) The invention encompasses methods of expressing a neoantigen comprising operably linking a Pr13.5 promoter to a heterologous nucleic acid sequence.
(36) Recombinant Poxviruses Comprising Pr13.5 Promoters
(37) The invention encompasses a recombinant poxviral vector comprising a Pr13.5 promoter operably linked to a heterologous nucleic acid sequence. In one embodiment, the heterologous nucleic acid sequence is inserted into the 13.5 ORF of a poxvirus so as to operably link the heterologous nucleic acid sequence to the endogenous viral Pr13.5 promoter. In another embodiment, the heterologous nucleic acid sequence is linked to a Pr13.5 promoter and inserted into a site in the genome other than the 13.5 ORF.
(38) Preferably, the poxvirus vector is derived from poxviruses belonging to the Chordopoxvirinae subfamily. Poxviruses include those belonging to the genera Orthopoxvirus, Parapoxvirus, Avipoxvirus, Capripoxvirus, Lepripoxvirus, Suipoxvirus, Molluscipoxvirus and Yatapoxvirus. Most preferred are poxviruses belonging to the genera Orthopoxvirus and Avipoxvirus.
(39) Other poxviruses such as racoonpox and mousepox may be employed in the present invention, for example, for the manufacture of wild-life vaccine. Members of the capripoxvirus and leporipox are also included herein as they may be useful as vectors for cattle and rabbits, respectively.
(40) In other embodiments, the poxvirus is derived from avipoxviruses. Examples of avipoxviruses suitable for use in the present invention include any avipoxvirus such as fowlpoxvirus, canarypoxvirus, uncopoxvirus, mynahpoxvirus, pigeonpoxvirus, psittacinepoxvirus, quailpoxvirus, peacockpoxvirus, penguinpoxvirus, sparrowpoxvirus, starlingpoxvirus and turkeypoxvirus. Preferred avipoxviruses are canarypoxvirus and fowlpoxvirus.
(41) Preferably, the poxvirus is a vaccinia virus, most preferably MVA. The invention encompasses recombinant MVA viruses generated with any and all MVA viruses. Preferred MVA viruses are MVA variant strains MVA-BN as, e.g., deposited at ECACC under number V00083008; MVA-575, deposited on Dec. 7, 2000, at the European Collection of Animal Cell Cultures (ECACC) with the deposition number V001 20707; and MVA-572, deposited at the European Collection of Animal Cell Cultures as ECACC V9401 2707. Derivatives of the deposited strain are also preferred.
(42) Preferably, the MVA has the capability of reproductive replication in vitro in chicken embryo fibroblasts (CEF) or other avian cell lines or in vivo in embryonated eggs, but no capability of reproductive replication in human cells in which MVA 575 or MVA 572 can reproductively replicate. Most preferably, the MVA has no capability of reproductive replication in the human keratinocyte cell line HaCaT, the human embryo kidney cell line 293, the human bone osteosarcoma cell line 143B, and the human cervix adenocarcinoma cell line HeLa.
(43) In preferred embodiments, the Modified vaccinia virus Ankara (MVA) virus is characterized by having the capability of reproductive replication in vitro in chicken embryo fibroblasts (CEF) and by being more attenuated than MVA-575 in the human keratinocyte cell line HaCaT, in the human bone osteosarcoma cell line 143B, and in the human cervix adenocarcinoma cell line HeLa. Preferably, the MVA virus is capable of a replication amplification ratio of greater than 500 in CEF cells.
(44) Any antigen, including those that induce a T-cell response, can be expressed by the recombinant MVA of the invention. Viral, bacterial, fungal, and cancer antigens are preferred. HIV-1 antigens, Dengue virus antigens, prostate-specific antigen (PSA) and prostatic acid phosphatase (PAP) antigen, HER-2/Neu antigens, anthrax antigens, measles virus antigens, influenza virus, picornavirus, coronavirus and respiratory syncytial virus antigens are particularly preferred antigens. Preferably, the antigen is a foreign antigen or neoantigen.
(45) The invention encompasses methods of making recombinant poxviruses, preferably MVA, comprising inserting a heterologous nucleic acid sequence into a poxvirus such that the heterologous nucleic acid sequence is operably linked to a Pr13.5 promoter.
(46) The invention encompasses use of the recombinant poxviruses of the invention in the manufacture of a medicament or vaccine for the treatment or prevention of infections and diseases of a mammal, including a human.
(47) The invention encompasses use of the recombinant poxviruses of the invention for the treatment or prevention of infections and diseases of a mammal, including a human.
(48) The invention encompasses use of the recombinant poxviruses of the invention as vaccines, particularly for the treatment or prevention of infections and diseases of a mammal, including a human.
(49) Kits Comprising Recombinant MVA
(50) The invention provides kits comprising the recombinant poxviral vector, preferably MVA virus, according to the present invention. The kit can comprise at least one, two, three, four, or more containers or vials of the recombinant poxviral vector, preferably MVA virus, together with instructions for the administration of the virus to a mammal, including a human. The instructions can indicate that the recombinant virus is administered to the mammal, preferably a human, in one or multiple (i.e., 2, 3, 4, 5, 6, etc.) dosages at specific timepoints (e.g., at least 4 weeks, at least 6 weeks, at least 8 weeks after the previous administration). Preferably, the instructions indicate that the recombinant virus is to be administered to a mammal, preferably a human, in at least 1, at least 2, at least 3, or at least 4 dosages.
(51) Methods of Inducing a CD8 T Cell and/or Antibody Response
(52) The invention encompasses methods of inducing a CD8 T cell and/or antibody response in a host. In preferred embodiments, the method comprises administering at least one, two, three, four, or five immunizations of a recombinant poxvirus, preferably MVA, comprising a Pr13.5 promoter to the mammal, including a human.
(53) Administration to a Host
(54) The recombinant poxvirus, preferably MVA, according to the invention can be used for the treatment of a wide range of mammals including humans and even immune-compromised humans. Hence, the present invention also provides a pharmaceutical composition and also a vaccine for inducing an immune response in a mammal, including a human.
(55) The vaccine preferably comprises the recombinant poxvirus, preferably MVA, in a concentration range of 10.sup.4 to 10.sup.9 TCID (tissue culture infectious dose).sub.50/ml, preferably in a concentration range of 10.sup.5 to 5×10.sup.8 TCID.sub.50/ml, more preferably in a concentration range of 10.sup.6 to 10.sup.8 TCID.sub.50/ml, and most preferably in a concentration range of 10.sup.7 to 10.sup.8 TCID.sub.50/ml, especially 10.sup.8 TCID.sub.50/ml.
(56) A preferred vaccination dose for mammal, preferably a human, comprises 10.sup.6 to 10.sup.9TCID.sub.50, most preferably a dose of 10.sup.7 TCID.sub.50 or 10.sup.8TCID.sub.50, especially 10.sup.8 TCID.sub.50.
(57) The pharmaceutical composition may generally include one or more pharmaceutically acceptable and/or approved carriers, additives, antibiotics, preservatives, adjuvants, diluents and/or stabilizers. Such auxiliary substances can be water, saline, glycerol, ethanol, oil, wetting or emulsifying agents, pH buffering substances, or the like. Suitable carriers are typically large, slowly metabolized molecules such as proteins, polysaccharides, polylactic acids, polyglycollic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, or the like.
(58) For the preparation of vaccines, the recombinant poxvirus, preferably MVA, according to the invention can be converted into a physiologically acceptable form. This can be done based on the experience in the preparation of poxvirus vaccines used for vaccination against smallpox (as described by Stickl et al. 1974).
(59) For example, the purified virus can be stored at −80° C. with a titre of 5×10.sup.8 TCID.sub.50/ml formulated in about 10 mM Tris, 140 mM NaCl pH 7.4. For the preparation of vaccine shots, e.g., 10.sup.2-10.sup.8 particles of the virus can be lyophilized in 100 μl to 1 ml of phosphate-buffered saline (PBS) in the presence of 2% peptone and 1% human albumin in an ampoule, preferably a glass ampoule. Alternatively, the vaccine shots can be produced by stepwise freeze-drying of the virus in a formulation. This formulation can contain additional additives such as mannitol, dextran, sugar, glycine, lactose or polyvinylpyrrolidone or other aids such as antioxidants or inert gas, stabilizers or recombinant proteins (e.g. human serum albumin) suitable for in vivo administration. The glass ampoule is then sealed and can be stored between 4° C. and room temperature for several months. However, as long as no need exists the ampoule is stored preferably at temperatures below −20° C.
(60) For vaccination or therapy, the lyophilisate can be dissolved in an aqueous solution, preferably physiological saline or Tris buffer, and administered either systemically or locally, i.e. parenteral, subcutaneous, intravenous, intramuscular, intranasal, or any other path of administration know to the skilled practitioner. The mode of administration, the dose and the number of administrations can be optimized by those skilled in the art in a known manner. However, most commonly a mammal, preferably a human, is vaccinated with a second administration about two weeks to six weeks after the first vaccination administration. Third, fourth, and subsequent administrations will most commonly be about two weeks to six weeks after the previous administration.
(61) The invention provides methods for immunizing mammals, including a human. In one embodiment a subject mammal, which includes rats, rabbits, mice, and humans are immunized comprising administering a dosage of a recombinant MVA to the mammal, preferably to a human. In one embodiment, the first dosage comprises 10.sup.8 TCID.sub.50 of the recombinant MVA virus and the second and additional dosages (i.e., third, fourth, fifth, etc.) comprise 10.sup.8 TCID.sub.50 of the virus. The administrations can be in a first (priming) dose and a second, or further, (boosting) dose(s).
(62) The immunization can be administered either systemically or locally, i.e. parenterally, subcutaneously, intravenously, intramuscularly, intranasally, or by any other path of administration known to the skilled practitioner.
(63) CD8 T Cell and Antibody Responses
(64) Immunizations with the recombinant MVA of the invention can induce a robust CD8 T cell response. In preferred embodiments, after the first, second, third, fourth, fifth, etc. immunization, the recombinant MVA induces a robust CD8 T cell response in the mammal, preferably a human, against the encoded antigen that is greater than the CD8 T cell response against the immunodominant viral CD8 T cell epitope, e.g. TSYKFESV (SEQ ID NO:5) encoded by the MVA vector. Preferably, after the second, third, fourth, fifth, etc. immunization, an immunodominant T cell response is induced in the mammal, preferably a human, against the encoded antigen. Preferably, after the second, third, fourth, fifth, etc. immunization, the recombinant MVA induces a CD8 T cell response in the mammal, preferably a human, against the encoded antigen that is at least 10%, 15%, 20%, 25%, 30%, or 35% of total CD8 T cells. Preferably, after the second, third, fourth, fifth, etc. immunization, the recombinant MVA increases the CD8 T cell response in the mammal, preferably a human, against the encoded antigen at least 2-, 3-, 4-, 5-, or 10-fold (i.e., from 1% to 2%, 3%, 4%, 5%, or 10% of total CD8 T cells) as compared to the response with the encoded antigen after a single administration or increases the CD8 T cell response in the mammal, preferably a human, against the encoded antigen at least 2-, 3-, 4-, 5-, or 10-fold as compared to the T cell response of a viral antigen (e.g. B8R). Preferably, the recombinant MVA generates a CD8 T cell response in the mammal, preferably a human, against the encoded antigen at least 2-, 3-, 4-, 5-, or 10-fold as compared to the T cell response against a viral antigen (e.g. B8R) after a single administration. Most preferably, the CD8 T cell response in the mammal, preferably a human, against the encoded antigen increases with 2-, 3-, 4-, or 5-, etc. immunizations to a greater extent than the response against a viral late antigen (e.g. B8R).
(65) The level of CD8 T cell response can be determined, for example, by collecting approximately 100-120 μl of blood in FACS/heparin buffer. PBMCs can be prepared by lysing erythrocytes with RBC lysis buffer. PBMCs can then be co-stained in a single reaction for OVA- and B8R-specific CD8 T cells using an anti-CD8α-FITC, CD44-PerCPCy5.5 and MHC class I dextramers complexed with their respective H-2Kb binding peptides, SIINFEKL (SEQ ID NO:4) or TSYKFESV (SEQ ID NO:5). The MHC class I SIINFEKL-dextramer (SEQ ID NO:4) can be labelled with PE and the TSYKFESV-dextramer (SEQ ID NO:5) with APC. Stained cells can be analyzed by flow cytometry on a BD Biosciences BD LSR II system. Ten thousand CD8+ T cells can be acquired per sample.
(66) Alternatively, the level of CD8 T cell response can be determined by collecting blood from an immunized mammal, preferably a human, and separating peripheral blood mononuclear cells (PBMC). These can be resuspended in growth medium containing 5 μg/ml brefeldin A (BFA, “GolgiPlug”, BD Biosciences) with 1 μM of test peptides, including peptides against immunodominant MVA epitopes (i.e., TSYKFESV; SEQ ID NO:5) (“B8R”) and peptides derived from the expressed neoantigen. The PBMC can then be incubated for 5 h at 37° C. in 5% CO2, harvested, resuspended in 3 ml cold PBS/10% FCS/2 mM EDTA and stored overnight at 4° C. The following day, the PBMC can be stained with antibodies anti-CD8a-Pac-Blue (clone 53-6.7), anti-CD62L-PE-Cy7, anti-CD44-APC-Alexa 750, and anti-CD4-PerCP-Cy5.5 (all antibodies from BD Biosciences). The PBMC can be incubated with appropriate dilutions of the indicated antibodies for 30 min at 4° C. in the dark. After washing, cells can be fixed and permeabilized by using the Cytofix/Cytoperm™ Plus kit (BD Biosciences) according to the manufacturer's instructions. After washing, PBMC can stained for intracellular interferon-γ (IFN-γ) using a FITC-conjugated anti-IFN-γ antibody (BD biosciences) diluted in perm/wash buffer (BD Biosciences). Stained cells can be analysed by flow cytometry.
(67) Immunizations with the recombinant MVA of the invention can induce a robust antibody response. Antibody responses can be measured by ELISA.
(68) Within the context of this invention, a “robust CD8 T cell response” means a higher percentage of neoantigen-specific CD8 T cells than the percentage generated with the same MVA construct containing the PrS promoter (5′AAAAATTGAAATTTTATTTTTTTTTTTTGGAATATAA 3′; SEQ ID NO:6) after a single immunization. In some embodiments, the CD8 T cell response demonstrates at least 1.5-fold or 2-fold higher neoantigen-specific CD8 T cells than that generated with the same MVA construct containing the PrS promoter (SEQ ID NO:6) after a single immunization.
(69) Within the context of this invention, a “robust antibody response” means an antibody titer that is greater than the antibody titer obtained with the same MVA construct containing the PrS promoter (SEQ ID NO:6) after a single immunization. In some embodiments, the antibody titer is at least 1.5 fold or 2-fold greater than the antibody titer obtained with the same MVA construct containing the PrS promoter (SEQ ID NO:6) after a single immunization.
(70) Whether a recombinant MVA induces a “robust CD8 T cell response” or a “robust antibody response” against a neoantigen can be determined as described in the examples herein. For example, MVA13.5 short and MVA13.5 long both induce a “robust CD8 T cell response” as herein defined. MVA13.5 long induces a “robust antibody response,” as herein defined.
(71) Although the method preferably comprises a single administration of the vector, in some embodiments, two, three, four, five, six, seven, or more immunizations of a recombinant MVA can be administered to the mammal, preferably a human.
(72) In preferred embodiments, the encoded antigen is a bacterial, viral, or tumor antigen. Preferably, the antigen is a foreign antigen to the mammal, including a human.
EXAMPLES
Example 1
Generation of MVA Recombinants
(73) HeLa cells were infected with MVA-BN at an MOI of 10 (10 TCID.sub.50 per cell) and total RNA was prepared 2 and 8 hours post infection. Primers specific for various MVA ORFs were generated and RACE-PCR (FirstChoice® RLM-RACE Kit, Life Technologies, Darmstadt, Germany) was used to generate PCR products representative of the MVA RNAs encoding these ORFs. The PCR products were sequenced to identify the transcription start sites. Based on this information, promoters were identified for the RNAs encoding these ORFs. The MVA promoters for the following ORFs were inserted into MVA constructs (Baur et al., Journal of Virology, Vol. 84 (17): 8743-8752 (2010)) to drive expression of the ovalbumin (OVA) gene: MVA13.5 (CVA022; WR 018), MVA050L (E3L; WR 059), MVA022L (K1L; WR 032), and MVA170R (B3R; WR 185).
Example 2
Promoter-dependent RNA Expression Levels In Vitro
(74) Infection of Hela cells with MVA recombinant viruses at MOI of 10 was done using cold virus attachment on ice for 1 h. After attachment the cells were washed and the zero hour (0 h) time point was collected or cells were incubated at 37° C. for collection of other time points. Samples were collected at 0.5, 1, 2, 4, and 8 h p.i. Cells were homogenized and total RNA was extracted. The RNA was DNAse digested and cDNA was synthesized using oligo(dT) priming. The resulting cDNA preparations were used as template in a Taqman based qPCR reaction for the simultaneous amplification of OVA and actin cDNA. Samples were run in an AB7500 cycler from Applied Biosystem. The results are shown in
Example 3
Promoter-dependent Protein Expression Levels In Vitro
(75) HeLa cells were cultured in DMEM with 10% FCS. Hela cells were infected with MOI of 10 (10 TCID.sub.50 per cell) of the recombinant MVA virus. Infected cells were collected at 1, 2, 4, 6, 8, and 24 h p.i., fixed and permeabilized. For each sample, half of the cells were stained for OVA protein using a rabbit anti-chicken OVA antibody and the other half were stained for MVA antigens using a rabbit anti-VACV polyclonal antibody. Samples were analyzed using a FACSCalibur flow cytometry analyzer (BD Biosciences) and FlowJo software. The results are shown in
Example 4
Mice Immunizations and Bleeds
(76) Groups of mice (C57/BI6) were used for the study. Each group received a total of three immunizations. A PBS-injected group served as a control for immune responses. Blood was taken via the tail vein for analysis of immune responses throughout the study.
(77) Mice were immunized i.p. with 10.sup.8 TCID.sub.50 of the respective MVA viruses diluted in PBS (300 μL, total volume) at weeks 0, 4 and 8. Bleeds for T cell analysis were performed one week after each immunization and bleeds for antibody analysis were performed three weeks after each immunization.
Example 5
T Cell Staining and Antibody Detection
(78) Approximately 100-120 μl of blood per mouse was collected in FACS/heparin buffer. PBMCs were prepared by lysing erythrocytes with RBC lysis buffer. PBMCs were then co-stained in a single reaction for OVA- and B8R-specific CD8 T cells using an anti-CD8α-FITC, CD44-PerCPCy5.5 and MHC class I dextramers complexed with their respective H-2Kb binding peptides, SIINFEKL (SEQ ID NO:4) or TSYKFESV (SEQ ID NO:5). The MHC class I SIINFEKL-dextramer (SEQ ID NO:4) was labelled with PE and the TSYKFESV-dextramer (SEQ ID NO:5) with APC. Stained cells were analyzed by flow cytometry on a BD Biosciences BD LSR II system. Ten thousand CD8+ T cells were acquired per sample. The results are shown in
(79) Serum from whole blood was prepared. Ovalbumin ELISA and MVA ELISA were performed to detect specific antibodies (Serazym kit of Seramun Diagnostika GmbH, Heidesee, Germany). The results are shown in