CITRULLINATED NUCLEOPHOSMIN PEPTIDES AS CANCER VACCINES

20230173047 · 2023-06-08

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to modified nucleophosmin peptides that can be used in cancer immunotherapy. The modified peptides may be used as vaccines or as targets for T cell receptor (TCR) and adoptive T cell transfer therapies. Such vaccines or targets may be used in the treatment of cancer.

    Claims

    1. A citrullinated T cell antigen which comprises, consists essentially of, or consists of i) the amino acid sequence AKFINYVKNCFRMTD, wherein the arginine (R) residue is replaced with citrulline, or ii) the amino acid sequence of i), with the exception of 1, 2 or 3 amino acid substitutions, and/or 1, 2 or 3 amino acid insertions, and/or 1, 2 or 3 amino acid deletions in a non-arginine position.

    2. The antigen of claim 1, which comprises, consists essentially of, or consists of i) one or more of the following amino acid sequences: AKFINYVKNCFRMTDQEAIQ LPKVEAKFINYVKNCFRMTD wherein the arginine (R) residue is replaced with citrulline, or ii) one or more of the amino acid sequences of i), with the exception of 1, 2 or 3 amino acid substitutions, and/or 1, 2 or 3 amino acid insertions, and/or 1, 2 or 3 amino acid deletions in a non-citrulline position.

    3. A complex of the antigen of claim 1 or claim 2 and an MHC molecule, optionally wherein the MHC molecule is MHC class II, optionally selected from HLA-DR4 and DP4.

    4. A binding moiety that binds the polypeptide of claim 1 or claim 2.

    5. The binding moiety of claim 4, which binds the polypeptide when it is in complex with MHC.

    6. The binding moiety of claim 4 or claim 5, wherein the binding moiety is a T cell receptor (TCR) or an antibody.

    7. The binding moiety of claim 6, wherein the TCR is on the surface of a cell.

    8. An antigen as defined in claim 1 or claim 2, a complex as defined in claim 3, or a binding moiety as defined in any one of claims 4-7 for use in medicine.

    9. The antigen, complex, and/or binding moiety for use as defined in claim 8 for use in treating or preventing cancer.

    10. The antigen, complex, and/or binding moiety for use as defined in claim 9, wherein the cancer is AML, lung, colorectal, renal, breast, ovary and liver tumours.

    11. A pharmaceutical composition comprising an antigen as defined in claim 1 or claim 2, a complex as defined in claim 3, and/or a binding moiety as defined in any one of claims 4-7, together with a pharmaceutically acceptable carrier.

    12. A method of identifying a binding moiety that binds a complex as claimed in claim 3, the method comprising contacting a candidate binding moiety with the complex and determining whether the candidate binding moiety binds the complex.

    Description

    EXAMPLES

    [0091] The present invention will now be described further with reference to the following examples and the accompanying drawings.

    [0092] FIG. 1: Sequence alignment of spliced variants of Human Nucleophosmin Alignment of Human nucleophosmin NPM1.1 against two alternatively spliced isoforms (NPM1.2 and NPM1.3). Light grey represents non-homologous regions.

    [0093] FIG. 2: Screening IFNʏ responses to citrullinated Nucleophosmin peptide pools Transgenic mouse strains expressing HHDII/DP4 or human HLA-DR4 mice were used to screen for IFNy responses to peptide (A and B). Mice were immunised with peptide pools of 4-5 non-overlapping NPM peptides over three weeks. Splenocytes were harvested 21 days after the initial dose was administered. Ex vivo responses to stimulation with human NPM peptides was assessed by IFNy ELISpot. Media only responses were used as a negative control. For each pool n=3 mice. Statistical significance of peptide response was compared to media only responses for each pool and determined using ANOVA with Dunnett’s post-hoc test * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001.

    [0094] FIG. 3: Defining NPM core epitope that induces strong IFNʏ responses HLA-DP4 (A and B) and HLA-DR4 (C) transgenic mice were immunised with three doses of NPM 261-280 cit (A) or 266-285 cit (B) or a combination of NPM 261-280 cit and NPM 266-285 cit (C) peptide over a course of three weeks, with weekly immunisations. Splenocytes were collected 7 days after the third dose was administered. Ex vivo IFNy ELISpot was performed to determine the response to NPM 261-280 cit, NPM 266-285 cit and NPM 266-280 cit peptides. Statistical significance of peptide response to NPM 266-280 cit was compared to the responses to media alone, NPM 260-280 cit and NPM 266-285 cit using using ANOVA with Dunnett’s post-hoc test * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001.

    [0095] FIG. 4: Human Nucleophosmin 266-285 induces strong IFNʏ and Granzyme B responses Transgenic mice were immunised with three doses of NPM 266-285 cit (A) or 266-285 wt (B) peptide over a course of three weeks, with weekly immunisations. Splenocytes were collected 21 days after the initial dose was administered. Ex vivo IFNy ELISpot was performed to determine the response to NPM 266-285 cit and 266-285 wt. To determine if the responses were mediated by CD4 or CD8 T cells an ex vivo ELISpot was performed in the presence of an anti CD4 or CD8 blocking antibody. Statistical significance of peptide responses was compared using ordinary one-way ANOVA comparison * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001, NS = not significant. When the ELISpot spot count exceeded 1000 spots a value of 1000 was assigned.

    [0096] FIG. 5: Expression of NPM on cancer cell lines and detection of NPM 266-285 cit following in vitro citrullination Immunoblot (A) of lysates from HeLa (Lane 1), ladder (Lane 2), PY8119 (Lane 3), PY230 (Lane 4), pan02 (Lane 5), LLC2 (Lane 6), TRAMP (Lane 7), ID8 (Lane 8), B16F1 (Lane 9), ladder (Lane 10), recombinant NPM (Lane 11) cell lines against ladder probed for nucleophosmin (NPM) and β actin. The bands correspond to the expected size for NPM (35 kDa) and β-actin (42 kDa). In vitro citrullination of NPM was performed in the presence of either PAD2 or PAD4, followed by mass spectrometry analysis (B) to identify the sites of citrullination.

    [0097] FIG. 6: Human Nucleophosmin 266-285 cit peptide provides an in vivo survival advantage in anti-tumour studies HHDII/DP4 mice were challenged with B16 tumour with IFNy inducible DP4 and 4 days later immunised with NPM266-285 cit or wt peptides. Overall survival (A) and tumour volume (B) at day 24 post tumour implant are shown for control mice (CpG/MPLA only) and mice immunised with either NPM 266-285 cit peptide or NPM 266-285 wt peptide, n=10 in CpG/MPLA control group, n=20 in immunised groups, results are shown from two independent experiments. Statistical differences between immunised and control mice were determined by Mantel-Cox test, p values are shown. For tumour volume medians and p values are shown as determined by Mann Whitney U test.

    [0098] FIG. 7: Human Nucleophosmin 266-285 cit peptide induces responses in human PBMCs PBMCs were isolated from 10 healthy donors, HLA typing was performed on each donor, 9 HLA-DP4 positive donors (2 also express HLA-DR4) and 1 HLA-DP4 negative donors were used. PBMCs isolated from each donor was cultured with media or human NPM 266-285 cit peptide. PMBCs were labelled with CSFE prior to stimulation with NPM 266-285 cit peptide, a representative flow cytometry plot is shown (A). The proliferative responses of CD4 populations within the CSFE labelled cell population was assessed by flow cytometry on days 7 and 10 (B). The ability of proliferating or non-proliferating CD4 cells to express IFNy (C), Granzyme B (D) and CD134 (E) was assessed on days 7 and 10, responses on day 10 are represented.

    [0099] FIG. 8: Immune response to human Nucleophosmin 266-285 cit peptide is mediated by naive T cells PBMCs isolated from healthy donors were either CD45RO depleted or left non-depleted and cultured with media or human NPM 266-285 cit peptide. PMBCs were labelled with CSFE prior to stimulation with NPM 266-285 cit peptide. The proliferative responses of CD4 populations within the CSFE labelled cell population was assessed by flow cytometry on day 11 (FIG. 8). The T cell responses were compared with non-depleted CD45RO cultures.

    [0100] FIG. 9: Nucleophosmin sequence comparison Alignment of human NPM with equivalent sequences from other species (Mouse, Cow, Pig, Sheep, Horse, Dog).

    [0101] FIG. 10: PAD2 is responsible for citrullinated NPM in vivo To assess if PAD2 is important for citrullination of NPM, HLA-DP4 mice were challenged with B16F1 tumour cells expressing inducible DP4 tumour cells lacking PAD2 enzymes followed by immunisation on day 4, 11 and 18. Tumour growth and survival was monitored and n= 10 mice/group. Overall survival shown on (A) and tumour volumes at day 28 on (B). Statistical differences between immunised and control mice were determined by Mantel-Cox test, p values are shown. For tumour volume medians and p values are shown as determined by Mann Whitney U test.

    [0102] FIG. 11: NPM266-285cit mediated survival advantage is achieved through MHC II To assess if NPM266-285cit is also effective in the absence of MHC II HLA-DP4 mice were challenged with B16F1 tumour cells expressing HHDII but lacking DP4 followed by immunisation on day 4, 11 and 18. Tumour growth and survival was monitored and n= 10 mice/group. Overall survival shown on (A) and tumour volumes at day 28 on (B). Statistical differences between immunised and control mice were determined by Mantel-Cox test, p values are shown. For tumour volume medians and p values are shown as determined by Mann Whitney U test.

    METHODS

    1.1. Commercial mAbs

    [0103] Anti-IFNʏ antibody (clone XMG1.2), anti-mouse CD4 (clone GK1.5), anti-mouse CD8 (clone 2.43) and anti-human CD4 (clone OKT-4) were purchased from BioXcell, USA. Anti-human CD134 (clone REA621) and anti-human CD8 (clone REA734) were purchased from Miltenyi, Germany. Anti-human CD4 (clone RPA-T4), anti-human Granzyme B (clone GB11) were purchased from Thermo Fisher Scientific, USA, anti-human IFNʏ (clone E780) was purchased from eBioscience, USA.

    1.2. Cell Lines

    [0104] The T-cell/B-cell hybrid cell line T2 stably transfected with functional MHC class II DR4 (DRB1*0401;T2 DR4) has been previously described (Kovats et al. 1997). The murine melanoma B16F1, murine pancreatic pan02 cell lines were obtained from the American Tissue Culture Collection (ATCC) and cultured in RPMI medium 1640 (GIBCO/BRL) supplemented with 10% fetal calf serum (FCS), L-glutamine (2 mM) and sodium bicarbonate buffered unless otherwise stated. The murine transgenic TRAMP cell was obtained from ATCC and cultured in dulbecco’s modified Eagle’s medium with 4 mM L-glutamine adjusted to contain 1.5 g/L sodium bicarbonate and 4.5 g/L glucose supplemented with 0.005 mg/ml bovine insulin and 10 nM dehydroisoandrosterone, 90%; fetal bovine serum, 5%; Nu-Serum IV, 5%. The murine mammary adenocarcinoma cell line PY8119 and PY230 were obtained from ATCC and cultured in Ham’s F12 Kaighn’s medium, 5% FBS, the PY230 cell line was also cultured in the presence of 0.1% MITO+ Serum Extender (Corning). The human cell line HeLa and mouse cell line LLC2 were obtained from ATCC and cultured in Eagle’s Minimum Essential Medium supplemented with 10% fetal calf serum. The ID8 cell line was provided by Dr K. Roby at KUMC University of Kansas, USA and cultured in DMEM supplemented with 10% FCS.

    1.3. Immunogens

    1.3.1. Peptides

    [0105] Peptides >90% purity were synthesized by Peptide Synthetics (Fareham, UK) and stored lyophilised in 0.2 mg aliquots at -80° C. On day of use they were reconstituted to the appropriate concentration in 10% dimethyl formamide.

    1.4. Plasmids and Transfections

    [0106] Construction of pVitro 2 chimeric and inducible HLA-DR4 plasmids have been described previously (Brentville et al. 2016; Metheringham et al. 2009). To generate the HHDII plasmid, cDNA was synthesized from total RNA isolated from EL4-HHD cells. This was used as a template to amplify HHD using the forward and reverse primers and sub cloned into pCR2.1. The HHD chain, comprising of a human HLA-A2 leader sequence, the human β2-microglobulin (β2M) molecule covalently linked via a glycine serine linker to the α 1 and 2 domains of human HLA-A*0201 MHC class I molecule and the α3, transmembrane and cytoplasmic domains of the murine H-2Db class I molecule, was then inserted into the EcoRV/Hindlll sites of the mammalian expression vector pCDNA3.1 obtained from Invitrogen.

    [0107] Endotoxin free plasmid DNA was generated using the endofree Qiagen maxiprep kit (Qiagen, Crawley).

    [0108] Cell lines were transfected using the Lipofectamine Transfection Reagent (Invitrogen) utilising the protocol previously described (Brentville et al. 2016). B16F1 cells were knocked out for murine MHC-I and/or MHC-II using ZFN technology (Sigma) and transfected with constitutive HLA-DP4 using the pVitro 2 chimeric plasmid. Cells were also transfected with the HHDII plasmid comprising of a human HLA-A2 leader sequence, the human β2-microglobulin (β2M) molecule covalently linked via a glycine serine linker to the α 1 and 2 domains of human HLA-0201 MHC class 1 molecule and the α3, transmembrane and cytoplasmic domains of the murine H-2Db class 1 molecule, where relevant as previously described (Xue et al. 2016). B16F1 HHDII cells were also transfected with the pVITRO2 Human HLA-DP4 plasmid and the IFNy inducible plasmid pDCGAS Human HLA-DP4 is described previously (Brentville et al. 2019).

    1.6 Western Blots

    [0109] Cell lysates were prepared in RIPA buffer containing protease inhibitor cocktail (Sigma) and proteins separated on a 4-12% NuPAGE Bis-Tris gel (Invitrogen) followed by transfer onto PVDF membrane. The membrane was blocked for 1 hour with 3%BSA then probed with antibodies to human NPM (clone FC82291, Abcam) 1 in 1000 and β actin (clone AC-15, Sigma) 1 in 15000. Proteins were visualised using thefluorescent secondary antibody IRDye 800RD and IRDye 680RD secondary anti mouse (for β actin). Membranes were imaged using a Licor Odyssey scanner. NPM protein was used as a positive control (ab114194, Abcam).

    1.7 In Vitro Citrullination

    [0110] The citrullination of NPM was performed in 0.1 M Tris-HCI pH 7.5 (Fisher), 10 mM CaCl2 (Sigma) and 5 mM DTT (Sigma). Final concentration of solution for was 376 mM Tris-HCI pH 7.5, 3.76 mM CaCl2, 1.88 mM DTT. Samples were incubated with PAD enzymes for 2 hrs at 37° C. before storing at -80° C. overnight or until use. PAD2 enzyme was used at a final concentration of 148 mU and PAD4 at a final concentration of 152 mU. PAD enzymes were purchased from Modiquest at 37 mU/.Math.l hPAD2 and 38 mU/.Math.l hPAD4.

    1.8 Mass Spectrometry

    [0111] Samples were prepared by trypsin digest at a ratio of 1:50 trypsin to protein overnight at 37° C. Samples were then dried under vacuum and resuspended in 0.1 % formic acid/5% acetonitrile in LCMS grade water before MS analysis. For MS Analysis, samples were injected via autosampler (Eksigent Ekspert nanoLC 425 LC system utilising a 1-10 .Math.l/min pump module running at 5 .Math.l/min) with a 2 min wash trap/elute configuration onto a YMC Triart C18 column (300um i.d., 3 .Math.m particle size, 15 cm) in a column oven at 35° C. Samples were gradient eluted over an 87 min runtime into a SCI EX 6600 TripleT of mass spectrometer via a Duospray (TurboV) source with a 50 .Math.m electrode. The 6600 was set up in IDA mode (Independent Data Acquisition/Data Dependent Acquisition) for 30 ions per cycle fragmentation. Total cycle time 1.8 s, TOFMS scan 250 ms accumulation; 50 ms for each product ion scan.

    [0112] Data was analysed using PEAKS Studio 8.0 (Bioinformatic Solutions Inc. Waterloo, Canada) searching the SwissProt human (Uniprot manually annotated/curated) database, 25ppm parent mass error tolerance, 0.1 Da fragment mass error tolerance searching for modifications for citrullination (R), deamidation (NQR), oxidation (M). Sites were identified as a confident modification site with a minimum ion intensity of 5%.

    1.7 Immunisations

    1.7.1. Immunisation Protocol

    [0113] HLA-DR4 mice (Taconic, USA) and the HHDII/HLA-DP4 transgenic strain of mouse as described in patent WO2013/017545 A1 (EMMA repository, France) were used, aged between 8 and 12 weeks, and cared for by the staff at Nottingham Trent University. All work was carried out under a Home Office project licence. Peptides were dissolved in 10% dimethylformamide to 1 mg/mL and then emulsified (a series of dilutions) with the adjuvant CpG and MPLA 6 .Math.g/mouse of each (Invivogen, UK). Peptides (25 .Math.g/mouse) were injected subcutaneously at the base of the tail.

    [0114] For tumour challenge experiments, mice were challenged with 1×10.sup.5 B16 HHDII/iDP4, B16F1HHDIIMHCIIKO or B16 HHDII/PAD2KOcDP4 cells subcutaneously on the right flank 3 days before primary immunisation (unless stated otherwise) and then immunised as described above. Tumour growth was monitored at 3-4 days intervals and mice humanely euthanised once tumour reached ≥10 mm in diameter.

    1.8 Analysis of Immune Responses

    1.8.1 Isolation and Analysis of Animal Tissue

    [0115] Spleens were disaggregated and treated with red cell lysis buffer for 2 mins. Tumours were harvested and mechanically disaggregated.

    1.8.2 Peripheral Blood Mononuclear Cell (PBMC) Isolation

    [0116] Peripheral blood samples were drawn into lithium heparin tubes (Becton Dickinson) and processed immediately following venepuncture. PBMCs were isolated by density gradient centrifugation using Ficoll-Hypaque. Proliferation and cultured ELISpot assay of PBMCs were performed immediately after isolation.

    1.8.3 Ex Vivo ELISpot Assay

    [0117] ELISpot assays were performed using murine IFNy capture and detection reagents according to the manufacturer’s instructions (Mabtech, Sweden). In brief, anti-IFNʏ antibody was coated onto wells of a 96-well Immobilin-P plate. Synthetic peptides (at a variety of concentrations) and 5×10.sup.5 per well splenocytes were added to the wells of the plate in triplicate. LPS at 5 .Math.g/mL was used as a positive control. Peptide pulsed target cells were added where relevant at 5×10.sup.4 per well in triplicate and plates incubated for 40 hours at 37° C. After incubation, captured IFNy was detected by a biotinylated anti-IFNʏ antibody and developed with a streptavidin alkaline phosphatase and chromogenic substrate. Lipopolysaccharide (LPS; 5 .Math.g/mL) was used as a positive control. For blocking studies, anti-CD4 blocking antibody (RPA-T4) and anti-CD8 blocking antibody (2.43) from Bioxcell were used at 20 .Math.g/mL. Spots were analysed and counted using an automated plate reader (Cellular Technologies Ltd).

    1.9 Proliferation Assay

    [0118] Peripheral blood sample (approx. 50 mL) was drawn into lithium heparin tubes (Becton Dickinson). Samples were maintained at room temperature and processed immediately following venepuncture. PBMCs were isolated by density gradient centrifugation using Ficoll-Hypaque. Proliferation assay of PBMCs were performed immediately after PBMC isolation. The median number of PBMCs routinely derived from healthy donor samples was 1.04 × 10.sup.6 PBMC/mL whole blood (range: 0.6 × 10.sup.6- 1.48 × 10.sup.6 / mL). The median viability as assessed by trypan blue exclusion was 93% (range 90-95%).

    [0119] Freshly isolated PBMCs were loaded with carboxyfluorescein succinimidyl ester (CFSE) (ThermoFisher). Briefly, a 50 .Math.M stock solution in warm PBS was prepared from a master solution of 5 mM in DMSO. CFSE was rapidly added to PBMCs (5 × 10.sup.6 cells/mL loading buffer (PBS with 5% v/v heat inactivated FCS)) to achieve a final concentration of 5 .Math.M. PBMCs were incubated at room temperature in the dark for 5 mins after which non-cellular incorporated CFSE was removed by washing twice with excess (x10 v/v volumes) of loading buffer (300 g x 10 mins). Cells were made up in complete media to 1.5 × 10.sup.6/mL and plated and stimulated with media containing vehicle (negative control), PHA (positive control, final concentration 10 .Math.g/mL) or peptides (10 .Math.g/mL) as described above.

    [0120] On day 7-11, 500 .Math.L of cells were removed from culture, washed in PBS and stained with 1:50 dilution of anti-CD4 (PE-Cy5, clone RPA-T4, ThermoFisher), anti-CD8 efluor 450, clone RPA-T8, ThermoFisher) and anti-CD134 (PE-Cy7, Clone REA621, Miltenyi). Cells were washed, fixed and permeabilized using intracellular fixation/permeablization buffers (ThermoFisher) according to the manufacturer’s instructions. Intracellular staining for cytokines was performed using a 1:50 dilution of anti-IFNʏ (clone 4S.B3, ThermoFisher) or anti-Granzyme B (PE, Clone GB11, Thermofisher). Stained samples were analysed on a MACSQuant 10 flow cytometer equipped with MACSQuant software version 2.8.168.16380 using stained vehicle stimulated controls to determine suitable gates.

    1.10 FACS Cell Sorting

    [0121] On day 10, the contents of the culture wells were mixed gently, pooled (according to peptide stimulation) and washed in PBS (300 g x 10mins). Pellets were gently re-suspended in 500.Math.L of PBS containing 10.Math.l of anti CD4 eFluo450 (clone RPA-T4, ThermoFisher, cat no 48-0049-42) and 10.Math.L of anti-CD8 APC (clone RPA-T8, ThermoFisher, cat 17-0088-41). Cells were stained at 4oC for 30 mins before being washed (5 min x 300 g) in 1.0ml of PBS and resuspended in 300.Math.l of FACS sorting buffer (PBS supplemented with 1 mM EDTA, 25 mM HEPES and 1 %v/v HI FCS). 10.Math.l of sample was removed from each stained sample and 90.Math.l of FACS sorting buffer added. 10,000 events were collected on a MACSQuant Analyser 10 flow cytometer to determine proliferation. The remaining cells were used for bulk FACS sorting.

    [0122] Cells are sorted using sterile conditions in a MoFlo XDP High Speed Cell Sorter machine. All samples are sorted into 1.0 ml of RNA protect (5 parts Protect, Qiagen: 1 part FACS sorting buffer, Sigma) separating the CD4+ve/CFSEhigh and CD4+ve/CFSEIow populations. Sorted cells (bulk) are stored at -80° C.

    [0123] Determination of the α and β chain pairing of TCRs recognising NPM peptides containing citrulline. Sorted cells (bulk) from CD4+ve/CFSEhigh and CD4+ve/CFSEIow populations in RNA protect are shipped to iRepertoire Inc (Huntsville, AL, USA) for NGS sequencing of the TCRA and TCRB chain to confirm expansion of TCR’s in the CD4+ve/CFSElow cells, proliferating to the peptide in contrast to the non-proliferating CD4+ve/CFSEhigh population. In brief RNA is purified from sorted cells, RT-PCR is performed, cDNA is then subjected to Amplicon rescued multiplex PCR (ARM-PCR) using human TCR α and β 250 PER primers (iRepertoire Inc., Huntsville, AL, USA). Information about the primers can be found in the United States Patent and Trademark Office (Patent Nos. 7,999,092 and 9,012,148B2). After assessment of PCR/DNA samples, 10 sample libraries were pooled and sequenced using the Illumina MiSeq platform (Illumina, San Diego, CA, USA). The raw data was analysed using IRweb software (iRepertoire). V, D, and J gene usage and CDR3 sequences were identified and assigned and tree maps generated using iRweb tools. Tree maps show each unique CDR3 as a coloured rectangle, the size of each rectangle corresponds to each CDR3 abundance within the repertoire and the positioning is determined by the V region usage.

    [0124] To elucidate the cognate pairing and sequencing of TCRα and TCRβ chains IRepertoire use their iPairTM technology, CD4+ve/CFSElow populations of cells (bulk sorted, that were simultaneously bulk sequenced) are seeded at 1 cell/well into an iCapture 96 well plate. RT-PCR is performed and the TCRα and β chains can be amplified from the single cells using Amplicon rescued multiplex PCR (arm-PCR). Data can be analysed utilising the iPair ™ Software program for frequency of specific chain pairing and the sequences ranked on comparison to bulk data.

    1.11 Knock Out of PAD2

    [0125] PAD2 knock out of B16F1 cells was performed by Sigma-Aldrich Cell Design Studio™. CompoZr zinc finger nuclease (ZFN) technology was used targeting NPM exon 1 with pair sequences NM008812-r649a1: CTGCAGCCGCACGGTCCGTTCCCGCAGC and NM008812-656a1: TGGGAGCCGCGTGGAGGCGGTGTACGTG. Following several rounds of retargeting, 89% cutting was achieved and single cell cloning was then performed to establish a stable clone. ddPCR and flow cytometry (ab50257 & ab150063, Abcam) were used by Sigma-Aldrich Cell Design Studio ™ to assess the knockout of PAD2 of the clone. The primers and probes used for ddPCR were from Thermo fisher proprietary (Mm00447012_m1 & Mm00447020_m1).

    1.12 Statistical Methods

    [0126] Data were expressed as the number of spots per million splenocytes. Means and standard deviations (SD) were calculated from the quadruplicate readings. Means and SDs were also calculated for each group of three mice. Where appropriate Anova analysis was performed using GraphPad Prism 6 software.

    Example 1 - Sequence Alignment and Homology of Nucleophosmin

    [0127] In mammals the most prevalent form of NPM is NPM1.1, two alternatively spliced isoforms exist (NPM1.2 and NPM1.3), these are shorter versions of NPM but share a high degree of homology (FIG. 1).

    Example 2 - T Cell Responses in HHDII/DP4 and HHDII/DR4 Mice to Nucleophosmin Epitopes

    [0128] T cell responses to tumour associated epitopes are often weak or non-existent due to tolerance and T cell deletion within the thymus. The citrullinated NPM peptides were screened in HLA-DR4 and HHDII/DP4 transgenic mice for their ability to stimulate IFNy responses. Every peptide containing an arginine was selected and the arginine residue was replaced with citrulline (cit). The selected peptides are summarised in Table 2.

    Screening of Nucleophosmin Peptide Responses

    [0129] Screening was performed to identify potential citrullinated NPM epitopes that could generate an immune response in mice. Mice were immunised with pools of 4-6 human citrullinated peptides. To reduce the effect of possible cross reactivity, the peptides within each pool were chosen so that they did not contain any overlapping amino acid sequences. Each pool was administered subcutaneously as a single immunisation given once a week for three weeks. Each peptide pool contained 25 .Math.g of each peptide in combination with CpG/MPLA as an adjuvant. Mice were culled 7 days after the third immunisation, the immune response to each peptide within the immunising pool were assessed by ex vivo IFNy ELISpot (FIG. 2). We have previously shown that citrullinated peptides can induce responses in the transgenic DR4 mouse strain. Given that different mouse strains have different MHC repertoires, two different transgenic strains (DR4 and DP4) were used for screening.

    [0130] Significant IFNy responses were detected to human NPM citrullinated peptides in HHDII/DP4 and HLA-DR4 transgenic mice (FIG. 2). In the HHDII/DP4 mice (A) the NPM citrullinated peptides 261-280 and 266-285 induced significant immune responses (p=<0.0001 and p=<0.0001 respectively). In contrast, the known citrullinated position at aa197 (B cell epitope) encompassed by peptide 186-205 and 191-210 failed to induce an immune response. In the HLA-DR4 mice, significant IFNy responses (B) were only detected in response to the NPM citrullinated peptide 266-285 (p=<0.0001), no other responses were detected against any other NPM peptides in these mice. There was also no detectable immune response generated to the described B cell epitope contained a citrullinated residue at position 197 (Tanikawa et al. 2009).

    TABLE-US-00004 Nucleophosmin peptide utilised Coordinates Sequence DP4 predicted cores DR4 predicted cores T cell response 1-20 MEDSMDMDMSPL-cit-PQNYLFG PLRPQNYLF MDMSPLRPQ MDMDMSPLR LRPQNYLFG No 6-25 DMDMSPL-cit-PQNYLFGCELKA LRPQNYLFG LRPQNYLFG No 31-50 FKVDNDENEHQLSL-cit-TVSLG QLSLRTVSL QLSLRTVSL No 36-55 DENEHQLSL-cit-TVSLGAGAKD QLSLRTVSL QLSLRTVSL LSLRTVSLG No 41-60 QLSL-cit-TVSLGAGAKDELHIV QLSLRTVSL QLSLRTVSL LRTVSLGAG LSLRTVSLG No 86-105 TVSLGGFEITPPVVL-cit-LKCG None None No 91-110 GFETPPVVL-cit-LKCGSGPVH None None No 96-115 PPVVL-cit-LKCGSGPVHISGQH RLKCGSGPV VLRLKCGSG No 126-145 EDEEEEDVKLLSISGK-cit-SAP LLSISGKRS LLSISGKRS No 131-150 EDVKLLSISGK-cit-SAPGGGSK LLSISGKRS ISGKRSAPG LLSISGKRS No 136-155 LSISGK-cit-SAPGGGSKVPQKK ISGKRSAPG ISGKRSAPG LSISGKRSA No 181-200 FDDEEAEEKAPVKKSI-cit-DTP VKKSIRDTP VKKSIRDTP No 186-205 AEEKAPVKKSI-cit-DTPAKNAQ RDTPAKNAQ IRDTPAKNA IRDTPAKNA No 191-210 PVKKSI-cit-DTPAKNAQKSNQN IRDTPAKNA IRDTPAKNA No 206-225 KSNQNGKDSKPSSTP-cit-SKGQ SSTPRSKGQ PSSTPRSKG SKPSSTPRS No 211-230 GKDSKPSSTP-cit-SKGQESFKK RSKGQESFK PRSKGQESF SKPSSTPRS No 216-235 PSSTP-cit-SKGQESFKKQEKTP RSKGQESFK PSSTPRSKG No 261-280 LPKVEAKFI NYVKNCF-cit-MTD YVKNCFRMT INYVKNCFR Yes 266-280 AKFINYVKNCF-cit-MTD* Yes 266-285 AKFINYVKNCF-cit-MTDQEAIQ FRMTDQEAI FRMTDQEAI Yes 271-290 YVKNCF-cit-MTDQEAI QDLWQW CFRMTDQEA FRMTDQEAI YVKNCFRMT FRMTDQEAI No 276-294 F-cit-MTDQEAIQDLWQWcitKSL FRMTDQEAI FRMTDQEAI No

    [0131] The two peptides, 261-280 cit and 266-285 cit, share a common 15 amino acid epitope, these peptides generated high frequency IFNy responses in HHDII/DP4 and HLA-DR4 mice (FIGS. 2A & 2B). When aligned,

    TABLE-US-00005 (261-280)  LPKVEAKFINYVKNCF-cit-MTD (266-285)  AKFINYVKNCF-cit-MTDQEAIQ

    the core epitope for responses in both HLA-DR4 and HHDII/DP4 mice must lie within the sequence:

    TABLE-US-00006 (266-280)  AKFINYVKNCF-cit-MTD

    [0132] The core epitope was confirmed by immunising mice once weekly for three weeks with 25 .Math.g of the NPM 261-280 cit or 266-285 cit peptide. HHDII/DP4 mice were immunised with the individual peptides whereas HLA-DR4 mice were immunised with a combination of NPM 261-280 cit and 266-285 cit, all given with CpG/MPLA. Mice were culled 7 days after the third immunisation. The immune response to NPM 261-280 cit and NPM 266-285 cit was assessed by ex vivo IFNy ELISpot alongside the response to NPM 266-280 cit, the suggested core epitope (FIG. 3). Significant IFNʏ responses were detected to human NPM 261-280 cit and NPM 266-285 cit peptides in HHDII/DP4 and to NPM 266-285 cit peptide in HLA-DR4 transgenic mice. There was no significant difference between the response to the core peptide NPM 266-280 cit and NPM 261-280 cit or NPM 266-285 cit in HHDII/DP4 transgenic mice. There was a significant difference in the response to NPM 266-280 cit and NPM 266-285 cit in HLA-DR4 transgenic mice, indicating that in HLA-DR4 mice the core peptide is different and possibly includes amino acids QEAIQ (position 281-285).

    [0133] The 266-285 cit peptide generated the strongest immune response in both HLA-DR4 and HHDII/DP4 mice (FIGS. 2A and 2B). Further investigations focused on this peptide.

    [0134] To determine if the immune response to the NPM 266-285 peptide is specific to the citrullinated peptide and not the wild type (wt) version, mice were immunised with NPM 266-285 cit or NPM 266-285 wt peptides. HHDII/DP4 mice received 25 .Math.g peptide (NPM 266-285 cit or NPM 266-285 wt) subcutaneously once a week for three weeks. Mice were culled 7 days after the third immunisation, the immune response to each peptide was assessed by ex vivo ELISpot (FIGS. 4A and 4B). Low to moderate IFNy responses were detected in mice immunised with NPM 266-285 wt and the response cross reacted with the citrullinated peptide (FIG. 4B), these responses were not specific to the NPM 266-285 wt peptide as similar responses were seen when cells were stimulated with the NPM 266-285 cit peptide. In contrast, strong IFNy responses were detected in mice immunised with NPM 266-285 cit, these responses were significant when compared to the response to the NPM 266-285 wt peptide (p=0.0002) and the control (p=<0.0001). This confirmed that the immune response generated in HHDII/DP4 mice is in response to the citrullinated version of the NPM 266-285 peptide.

    Example 3 - Cit Nucleophosmin Peptide Presented on Tumour Cells Can Be Targeted For Tumour Therapy

    [0135] The inventors had already established by Western blotting that the melanoma B16F1 cell lines constitutively express NPM and in vitro citrullination of NPM generates citrulline at position 277 (FIG. 5A and B). Next, the anti-tumour effect of NPM 266-285 cit peptide immunisation was assessed in vivo. The effect of immunisation with NPM 266-285 (cit and wt) on the growth of the mouse B16 melanoma cell line transfected with IFNy inducible human DP4 (iDP4) was assessed. Mice were challenged with B16 HHDII/iDP4 tumour cells 3 days prior to immunisation with NPM 266-285 wt or NPM 266-285 cit. Mice immunised with NPM 266-285 cit peptide showed a significant survival advantage over control mice immunised with CpG/MPLA only (FIG. 6A). Control mice showed 0% survival at 50 days whereas NPM 266-285 cit immunised mice showed 65% survival (p=<0.0001), mice immunised with 266-285 wt also showed a significant 30% survival (p=0.0018) suggesting again that the T cells stimulated by the wild type peptide can cross react with the citrullinated epitope and recognise tumours. There was no associated toxicity. The tumour volumes at day 24 post tumour implant was also significantly lower (p=<0.0001) in the NPM 266-285 cit immunised mice (FIG. 6B, median 0 mm.sup.3) compared to the control group (median 1425 mm.sup.3). The tumour volume was also significantly lower (p=0.0152) in the NPM 266-285 wt immunised mice (median 34 mm.sup.3) compared to the control group (median 1425 mm.sup.3).

    Example 4 - Responses to NPM in Healthy Human Donors and Cancer Patients

    [0136] In HHDII/iDP4 mice, the response to NPM 266-285 cit peptide could not be detected 2 days post immunisation, but could be detected 12 days after immunisation. This suggests that these are naive responses and no pre-existing immunity exists in these mice. This raised the question of whether humans have or can generate immune responses to NPM 266-285 cit peptide. To investigate this, PBMC’s were isolated from ten healthy donors and cultured in the presence of NPM 266-285 cit peptide. Nine donors were HLA-DP4 positive, two of these were also HLA-DR4 positive, an additional donor (donor 10) was HLA-DP4 and HLA-DR4 negative (negative control).

    [0137] PBMCs from ten healthy donors were labelled with Carboxyfluorescein succinimidyl ester (CFSE) prior to in vitro culture in the presence of NPM 266-285 cit peptide. On day 7 and 10 cells were stained with anti-CD4 and anti-CD8 fluorochome conjugated antibodies, proliferation was then assessed by flow cytometry (FIG. 7A). On day 7, a CD4 NPM 266-285 specific proliferating (CFSE.sup.low) population could be detected in four out of ten donors (nine are HLA-DP4 positive donors), this increased at day 10 with seven out of ten donors (nine are HLA-DP4 positive donors) showing a specific response (FIG. 7B). On day 10, functional analysis was performed on the seven donors that showed a good CD4 NPM 266-285 specific proliferative response. The expression of IFNy, Granzyme B and CD134 was determined for all donors, comparing the proliferating and non-proliferating CD4 T cells (FIG. 7C, D and E). The proliferating CD4 NPM 266-285 specific T cells from all seven donors expressed granzyme B. In addition; six out of seven donors also expressed IFNy and CD134, this expression was only associated with the proliferating T cells in the majority of donors (six out of seven).

    [0138] PBMCs from eleven cancer patients and nine ovarian cancer patients were labelled with Carboxyfluorescein succinimidyl ester (CFSE) prior to in vitro culture in the presence of NPM 266-285 cit peptide. On day 7 and 10, cells were stained with anti-CD4 and anti-CD8 fluorochome conjugated antibodies, proliferation was then assessed by flow cytometry (FIG. 7F). On day 7, a CD4 NPM 266-285 cit specific proliferating (CFSE.sup.low) population could be detected in four out of eleven lung cancer patients. This decreased at day 10 with only three out of eleven patients showing a specific response (FIG. 7F). On day 7, CD4 NPM 266-285 cit specific proliferating (CFSE.sup.low) population could be detected in one ovarian cancer patient out of nine. This remained the same on day 10 with only the one patient showing a specific response to 266-285 NPM cit peptide.

    [0139] These results suggest that the majority of heathy donors are able to generate a CD4 proliferative response to NPM 266-285 cit peptide which is also associated with the upregulation of functional markers associated with cytotoxic activity. PBMCs from some cancer patients are able to develop a CD4 response to NPM 266-285 cit peptide, but this is lower than the number of responding healthy donors. This lower frequency maybe due to medication or some degree of tumour mediated immune suppression in these patients.

    Example 5 - In Healthy Human Donors Naive T Cell Populations Respond to NPM Cit Peptide

    [0140] PBMCs were isolated from two healthy donors, and split into two fractions, CD45RO cells were depleted from one fraction and the second fraction were left non-depleted. PBMCs were labelled with Carboxyfluorescein succinimidyl ester (CFSE) prior to in vitro culture in the presence of NPM 266-285 cit peptide. On day 11, cells were stained with anti-CD4 and anti-CD8 fluorochrome conjugated antibodies, proliferation was then assessed by flow cytometry (FIG. 8). On day 11, a CD4 NPM 266-285 cit specific proliferating (CFSE.sup.low) population could be detected in both the CD45RO depleted and non-depleted populations. The percentage of proliferating CD4 T cells was higher (23.6%) in the CD45RO depleted population indicating that the naive T cells are responding to the NPM cit peptide.

    Example 6 - Homology of Nucleophosmin Between Different Species

    [0141] Nucleophosmin is highly conserved between, mouse, dog, sheep, cows, horse, pig and humans (FIG. 9). As the vaccine induces T cell responses in humans and mice, and anti-tumour responses in mice, it can be assumed similar responses will be seen in other species.

    Example 7 - PAD2 Is Responsible for Citrullination of Arginine 277 in Tumours in Vivo

    [0142] To determine whether the PAD2 or PAD4 enzyme is responsible for the citrullination in vivo, a B16 tumour cell line that lacks PAD2 (B16F1cDP4PAD2KO) was generated. Knocking out the PAD4 enzyme was unsuccessful with cells failing to grow following the knockout of PAD4. Transgenic HLA-DP4 mice were implanted with B16F1cDP4PADKO tumour cells that lacked the PAD2 enzyme. Tumour growth was assessed following immunisation with NPM266-285cit given in combination with CPG/MPLA and compared to tumour growth in a CPG/MPLA control group (FIG. 10). Overall there was no significant survival advantage in B16F1cDP4PADKO tumour bearing mice immunised with NPM266cit when compared to the unimmunised CPG/MPLA control group (p = 0.6826, FIG. 10A). The tumour volumes were calculated on day 28 (FIG. 10B) and there was no significant difference (p=0.2050) between CpG/MPLA control mice (median 190.5 mm.sup.3) and NPM266-285 cit (median 696.6 mm.sup.3) immunised mice. The anti-tumour responses were lost in B16F1cDP4PADKO tumour bearing mice, demonstrating that PAD2 is critical for the citrullination of arginine 277 in the tumour cells in vivo and for the anti-tumour effects.

    Example 8 - MHC Class II Is Essential For Anti-Tumour Responses Following Immunisation With NPM 266-285 Cit

    [0143] To determine if MHC class II is essential for the anti-tumour responses observed in tumour bearing mice following immunisation with NPM 266-285 cit, the B16 cell line was engineered where MHC-II had been knocked out (B16F1HHDIIMHCIIKO). Transgenic HHDII mice were implanted with B16F1HHDIIMHCIIKO tumour cells that lack MHC-II. Tumour growth was assessed following immunisation with NPM266-285cit given in combination with CPG/MPLA and compared to tumour growth in a CPG/MPLA control group (FIG. 11). Overall, there was a 10% improvement in overall survival in B16F1HHDIIMHCIIKO tumour bearing mice immunised with NPM 266-285 cit when compared to the CPG/MPLA control group (p = 0.0144, FIG. 11A). The tumour volumes were calculated on 28 day (FIG. 11B) and there was no significant difference (p=0.2050) between CpG/MPLA control mice (median 1027 mm.sup.3) and NPM266-285 cit (median 904.3 mm.sup.3) immunised mice. The small improvement in survival in MHC-II KO tumours suggests that the CD4 T cells can induce anti-tumour responses by bystander effect by improving CD8 and/or NK responses but the superior anti-tumour responses when tumour express MHC-II suggests that the CD4 T cells can also mediate direct tumour killing.

    REFERENCES

    [0144] Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. ‘Basic local alignment search tool’, J Mol Biol, 215: 403-10.

    [0145] Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. ‘Gapped BLAST and PSI-BLAST: a new generation of protein database search programs’, Nucleic Acids Res, 25: 3389-402.

    [0146] Andreatta, M., V. I. Jurtz, T. Kaever, A. Sette, B. Peters, and M. Nielsen. 2017. ‘Machine learning reveals a non-canonical mode of peptide binding to MHC class II molecules’, Immunology, 152: 255-64.

    [0147] Arnold, P. Y., N. L. La Gruta, T. Miller, K. M. Vignali, P. S. Adams, D. L. Woodland, and D. A. Vignali. 2002. ‘The majority of immunogenic epitopes generate CD4+ T cells that are dependent on MHC class II-bound peptide-flanking residues’, J Immunol, 169: 739-49.

    [0148] Arstila, T. P., A. Casrouge, V. Baron, J. Even, J. Kanellopoulos, and P. Kourilsky. 1999. ‘A direct estimate of the human alphabeta T cell receptor diversity’, Science, 286: 958-61.

    [0149] Ausubel, JM. 1992. Short protocols in molecular biology (John Wiley & Sons).

    [0150] Bernard, K., E. Litman, J. L. Fitzpatrick, Y. G. Shellman, G. Argast, K. Polvinen, A. D. Everett, K. Fukasawa, D. A. Norris, N. G. Ahn, and K. A. Resing. 2003. ‘Functional proteomic analysis of melanoma progression’, Cancer Res, 63: 6716-25.

    [0151] Bird, R. E., K. D. Hardman, J. W. Jacobson, S. Johnson, B. M. Kaufman, S. M. Lee, T. Lee, S. H. Pope, G. S. Riordan, and M. Whitlow. 1988. ‘Single-chain antigen-binding proteins’, Science, 242: 423-6.

    [0152] Bobisse, S., R. Genolet, A. Roberti, J. L. Tanyi, J. Racle, B. J. Stevenson, C. Iseli, A. Michel, M. A. Le Bitoux, P. Guillaume, J. Schmidt, V. Bianchi, D. Dangaj, C. Fenwick, L. Derre, I. Xenarios, O. Michielin, P. Romero, D. S. Monos, V. Zoete, D. Gfeller, L. E. Kandalaft, G. Coukos, and A. Harari. 2018. ‘Sensitive and frequent identification of high avidity neo-epitope specific CD8 (+) T cells in immunotherapy-naive ovarian cancer’, Nat Commun, 9: 1092.

    [0153] Bodanzsky, Bodanzsky &. 1984. The practice of peptide synthesis (Springer Verlag: New York).

    [0154] Borer, R. A., C. F. Lehner, H. M. Eppenberger, and E. A. Nigg. 1989. ‘Major nucleolar proteins shuttle between nucleus and cytoplasm’, Cell, 56: 379-90.

    [0155] Boulter, J. M., M. Glick, P. T. Todorov, E. Baston, M. Sami, P. Rizkallah, and B. K. Jakobsen. 2003. ‘Stable, soluble T-cell receptor molecules for crystallization and therapeutics’, Protein Eng, 16: 707-11.

    [0156] Brentville, V. A., R. L. Metheringham, B. Gunn, P. Symonds, I. Daniels, M. Gijon, K. Cook, W. Xue, and L. G. Durrant. 2016. ‘Citrullinated Vimentin Presented on MHC-II in Tumor Cells Is a Target for CD4+ T-Cell-Mediated Antitumor Immunity’, Cancer Res, 76: 548-60.

    [0157] Brentville, V. A., P. Symonds, K. W. Cook, I. Daniels, T. Pitt, M. Gijon, P. Vaghela, W. Xue, S. Shah, R. L. Metheringham, and L. G. Durrant. 2019. ‘T cell repertoire to citrullinated self-peptides in healthy humans is not confined to the HLA-DR SE alleles; Targeting of citrullinated self-peptides presented by HLA-DP4 for tumour therapy’, Oncoimmunology, 8: e1576490.

    [0158] Brown, J. H., T. S. Jardetzky, J. C. Gorga, L. J. Stern, R. G. Urban, J. L. Strominger, and D. C. Wiley. 1993. ‘Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1’, Nature, 364: 33-9.

    [0159] Carson, R. T., K. M. Vignali, D. L. Woodland, and D. A. Vignali. 1997. ‘T cell receptor recognition of MHC class II-bound peptide flanking residues enhances immunogenicity and results in altered TCR V region usage’, Immunity, 7: 387-99.

    [0160] Chan, W. Y., Q. R. Liu, J. Borjigin, H. Busch, O. M. Rennert, L. A. Tease, and P. K. Chan. 1989. ‘Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth’, Biochemistry, 28: 1033-9.

    [0161] Chang, J. H., and M. O. Olson. 1990. ‘Structure of the gene for rat nucleolar protein B23’, J Biol Chem, 265: 18227-33.

    [0162] Chen, J., J. Sun, L. Yang, Y. Yan, W. Shi, J. Shi, Q. Huang, J. Chen, and Q. Lan. 2015. ‘Upregulation of B23 promotes tumor cell proliferation and predicts poor prognosis in glioma’, Biochem Biophys Res Commun, 466: 124-30.

    [0163] Choy, E. 2012. ‘Understanding the dynamics: pathways involved in the pathogenesis of rheumatoid arthritis’, Rheumatology (Oxford), 51 Suppl 5: v3-11.

    [0164] Coimbra, S., A. Figueiredo, E. Castro, P. Rocha-Pereira, and A. Santos-Silva. 2012. ‘The roles of cells and cytokines in the pathogenesis of psoriasis’, Int J Dermatol, 51: 389-95; quiz 95-8.

    [0165] Consogno, G., S. Manici, V. Facchinetti, A. Bachi, J. Hammer, B. M. Conti-Fine, C. Rugarli, C. Traversari, and M. P. Protti. 2003. ‘Identification of immunodominant regions among promiscuous HLA-DR-restricted CD4+ T-cell epitopes on the tumor antigen MAGE-3’, Blood, 101: 1038-44.

    [0166] Corper, A. L., T. Stratmann, V. Apostolopoulos, C. A. Scott, K. C. Garcia, A. S. Kang, I. A. Wilson, and L. Teyton. 2000. ‘A structural framework for deciphering the link between I-Ag7 and autoimmune diabetes’, Science, 288: 505-11.

    [0167] Davis, M. M., J. J. Boniface, Z. Reich, D. Lyons, J. Hampl, B. Arden, and Y. Chien. 1998. ‘Ligand recognition by alpha beta T cell receptors’, Annu Rev Immunol, 16: 523-44.

    [0168] Dessen, A., C. M. Lawrence, S. Cupo, D. M. Zaller, and D. C. Wiley. 1997. ‘X-ray crystal structure of HLA-DR4 (DRA*0101, DRB1*0401) complexed with a peptide from human collagen II’, Immunity, 7: 473-81.

    [0169] Di Matteo, A., M. Franceschini, S. Chiarella, S. Rocchio, C. Travaglini-Allocatelli, and L. Federici. 2016. ‘Molecules that target nucleophosmin for cancer treatment: an update’, Oncotarget, 7: 44821-40.

    [0170] Douat-Casassus, C., N. Marchand-Geneste, E. Diez, N. Gervois, F. Jotereau, and S. Quideau. 2007. ‘Synthetic anticancer vaccine candidates: rational design of antigenic peptide mimetics that activate tumor-specific T-cells’, J Med Chem, 50: 1598-609.

    [0171] Duployez, N., L. Chebrek, N. Helevaut, E. Fournier, M. Bemba, A. Caillault, S. Geffroy, and C. Preudhomme. 2018. ‘A novel type of NPM1 mutation characterized by multiple internal tandem repeats in a case of cytogenetically normal acute myeloid leukemia’, Haematologica, 103: e575-e77.

    [0172] Durrant, L. G., R. L. Metheringham, and V. A. Brentville. 2016. ‘Autophagy, citrullination and cancer’, Autophagy, 12: 1055-6.

    [0173] Falini, B., C. Mecucci, E. Tiacci, M. Alcalay, R. Rosati, L. Pasqualucci, R. La Starza, D. Diverio, E. Colombo, A. Santucci, B. Bigerna, R. Pacini, A. Pucciarini, A. Liso, M. Vignetti, P. Fazi, N. Meani, V. Pettirossi, G. Saglio, F. Mandelli, F. Lo-Coco, P. G. Pelicci, M. F. Martelli, and Gimema Acute Leukemia Working Party. 2005. ‘Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype’, N Engl J Med, 352: 254-66.

    [0174] Falini, B., I. Nicoletti, N. Bolli, M. P. Martelli, A. Liso, P. Gorello, F. Mandelli, C. Mecucci, and M. F. Martelli. 2007. ‘Translocations and mutations involving the nucleophosmin (NPM1) gene in lymphomas and leukemias’, Haematologica, 92: 519-32.

    [0175] Feuerstein, N., P. K. Chan, and J. J. Mond. 1988. ‘Identification of numatrin, the nuclear matrix protein associated with induction of mitogenesis, as the nucleolar protein B23. Implication for the role of the nucleolus in early transduction of mitogenic signals’, J Biol Chem, 263: 10608-12.

    [0176] Folch, G., D. Scaviner, V. Contet, and M. P. Lefranc. 2000. ‘Protein displays of the human T cell receptor alpha, beta, gamma and delta variable and joining regions’, Exp Clin Immunogenet, 17: 205-15.

    [0177] Fremont, D. H., W. A. Hendrickson, P. Marrack, and J. Kappler. 1996. ‘Structures of an MHC class II molecule with covalently bound single peptides’, Science, 272: 1001-4.

    [0178] Fremont, D. H., D. Monnaie, C. A. Nelson, W. A. Hendrickson, and E. R. Unanue. 1998. ‘Crystal structure of I-Ak in complex with a dominant epitope of lysozyme’, Immunity, 8: 305-17.

    [0179] Garboczi, D. N., D. T. Hung, and D. C. Wiley. 1992. ‘HLA-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides’, Proc Natl Acad Sci USA, 89: 3429-33.

    [0180] Gebauer, M., and A. Skerra. 2009. ‘Engineered protein scaffolds as next-generation antibody therapeutics’, Curr Opin Chem Biol, 13: 245-55.

    [0181] Ghosh, P., M. Amaya, E. Mellins, and D. C. Wiley. 1995. ‘The structure of an intermediate in class II MHC maturation: CLIP bound to HLA-DR3’, Nature, 378: 457-62.

    [0182] Godkin, A. J., K. J. Smith, A. Willis, M. V. Tejada-Simon, J. Zhang, T. Elliott, and A. V. Hill. 2001. ‘Naturally processed HLA class II peptides reveal highly conserved immunogenic flanking region sequence preferences that reflect antigen processing rather than peptide-MHC interactions’, J Immunol, 166: 6720-7.

    [0183] Gonzalez-Galarza, F. F., L. Y. Takeshita, E. J. Santos, F. Kempson, M. H. Maia, A. L. da Silva, A. L. Teles e Silva, G. S. Ghattaoraya, A. Alfirevic, A. R. Jones, and D. Middleton. 2015. ‘Allele frequency net 2015 update: new features for HLA epitopes, KIR and disease and HLA adverse drug reaction associations’, Nucleic Acids Res, 43: D784-8.

    [0184] Green, D. R., and B. Levine. 2014. ‘To be or not to be? How selective autophagy and cell death govern cell fate’, Cell, 157: 65-75.

    [0185] Greten, T. F., and J. P. Schneck. 2002. ‘Development and use of multimeric major histocompatibility complex molecules’, Clin Diagn Lab Immunol, 9: 216-20.

    [0186] Grisendi, S., C. Mecucci, B. Falini, and P. P. Pandolfi. 2006. ‘Nucleophosmin and cancer’, Nat Rev Cancer, 6: 493-505.

    [0187] Grunewald, J., and A. Eklund. 2007. ‘Role of CD4+ T cells in sarcoidosis’, Proc Am Thorac Soc, 4: 461-4.

    [0188] Herrera, J. E., J. J. Correia, A. E. Jones, and M. O. Olson. 1996. ‘Sedimentation analyses of the salt-and divalent metal ion-induced oligomerization of nucleolar protein B23’, Biochemistry, 35: 2668-73.

    [0189] Hingorani, K., A. Szebeni, and M. O. Olson. 2000. ‘Mapping the functional domains of nucleolar protein B23’, J Biol Chem, 275: 24451-7.

    [0190] Holliger, P., and G. Winter. 1993. ‘Engineering bispecific antibodies’, Curr Opin Biotechnol, 4: 446-9.

    [0191] Holmberg Olausson, K., T. Elsir, K. Moazemi Goudarzi, M. Nister, and M. S. Lindstrom. 2015. ‘NPM1 histone chaperone is upregulated in glioblastoma to promote cell survival and maintain nucleolar shape’, Sci Rep, 5: 16495.

    [0192] Holmdahl, R., L. Klareskog, K. Rubin, E. Larsson, and H. Wigzell. 1985. ‘T lymphocytes in collagen II-induced arthritis in mice. Characterization of arthritogenic collagen II-specific T-cell lines and clones’, Scand J Immunol, 22: 295-306.

    [0193] Hoppes, R., R. Oostvogels, J. J. Luimstra, K. Wals, M. Toebes, L. Bies, R. Ekkebus, P. Rijal, P. H. Celie, J. H. Huang, M. E. Emmelot, R. M. Spaapen, H. Lokhorst, T. N. Schumacher, T. Mutis, B. Rodenko, and H. Ovaa. 2014. ‘Altered peptide ligands revisited: vaccine design through chemically modified HLA-A2-restricted T cell epitopes’, J Immunol, 193: 4803-13.

    [0194] Hosken, N. A., and M. J. Bevan. 1990. ‘Defective presentation of endogenous antigen by a cell line expressing class I molecules’, Science, 248: 367-70.

    [0195] Huston, J. S., D. Levinson, M. Mudgett-Hunter, M. S. Tai, J. Novotny, M. N. Margolies, R. J. Ridge, R. E. Bruccoleri, E. Haber, R. Crea, and et al. 1988. ‘Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli’, Proc Natl Acad Sci USA, 85: 5879-83.

    [0196] Ireland, J. M., and E. R. Unanue. 2011. ‘Autophagy in antigen-presenting cells results in presentation of citrullinated peptides to CD4 T cells’, J Exp Med, 208: 2625-32.

    [0197] Jairajpuri, Z. S., S. Rana, S. Khetrapal, M. A. Talikoti, and S. Jetley. 2014. ‘Extranodal anaplastic large cell lymphoma mimicking sarcoma: A report of an interesting case’, IntJ Appl Basic Med Res, 4: S50-2.

    [0198] Jian, Y., Z. Gao, J. Sun, Q. Shen, F. Feng, Y. Jing, and C. Yang. 2009. ‘RNA aptamers interfering with nucleophosmin oligomerization induce apoptosis of cancer cells’, Oncogene, 28: 4201-11.

    [0199] June, C. H., M. V. Maus, G. Plesa, L. A. Johnson, Y. Zhao, B. L. Levine, S. A. Grupp, and D. L. Porter. 2014. ‘Engineered T cells for cancer therapy’, Cancer Immunol Immunother, 63: 969-75.

    [0200] Jurtz, V., S. Paul, M. Andreatta, P. Marcatili, B. Peters, and M. Nielsen. 2017. ‘NetMHCpan-4.0: Improved Peptide-MHC Class I Interaction Predictions Integrating Eluted Ligand and Peptide Binding Affinity Data’, J Immunol, 199: 3360-68.

    [0201] Kang, Y. J., M. O. Olson, and H. Busch. 1974. ‘Phosphorylation of acid-soluble proteins in isolated nucleoli of Novikoff hepatoma ascites cells. Effects of divalent cations’, J Biol Chem, 249: 5580-5.

    [0202] Kang, Y. J., M. O. Olson, C. Jones, and H. Busch. 1975. ‘Nucleolar phosphoproteins of normal rat liver and Novikoff hepatoma ascites cells’, Cancer Res, 35: 1470-5.

    [0203] Karlin, S., and S. F. Altschul. 1993. ‘Applications and statistics for multiple high-scoring segments in molecular sequences’, Proc Natl Acad Sci USA, 90: 5873-7.

    [0204] Kim, A., I. Z. Hartman, B. Poore, T. Boronina, R. N. Cole, N. Song, M. T. Ciudad, R. R. Caspi, D. Jaraquemada, and S. Sadegh-Nasseri. 2014. ‘Divergent paths for the selection of immunodominant epitopes from distinct antigenic sources’, Nat Commun, 5: 5369.

    [0205] Kovats, S., P. E. Whiteley, P. Concannon, A. Y. Rudensky, and J. S. Blum. 1997. ‘Presentation of abundant endogenous class II DR-restricted antigens by DM-negative B cell lines’, Eur J Immunol, 27: 1014-21.

    [0206] Kuo, Y. H., Y. T. Chen, H. P. Tsai, C. Y. Chai, and A. L. Kwan. 2015. ‘Nucleophosmin overexpression is associated with poor survival in astrocytoma’, APMIS, 123: 515-22.

    [0207] Latek, R. R., A. Suri, S. J. Petzold, C. A. Nelson, O. Kanagawa, E. R. Unanue, and D. H. Fremont. 2000. ‘Structural basis of peptide binding and presentation by the type I diabetes-associated MHC class II molecule of NOD mice’, Immunity, 12: 699-710.

    [0208] Lee, K. H., K. W. Wucherpfennig, and D. C. Wiley. 2001. ‘Structure of a human insulin peptide-HLA-DQ8 complex and susceptibility to type 1 diabetes’, Nat Immunol, 2: 501-7.

    [0209] Lee, S. B., T. L. Xuan Nguyen, J. W. Choi, K. H. Lee, S. W. Cho, Z. Liu, K. Ye, S. S. Bae, and J. Y. Ahn. 2008. ‘Nuclear Akt interacts with B23/NPM and protects it from proteolytic cleavage, enhancing cell survival’, Proc Natl Acad Sci U S A, 105: 16584-9.

    [0210] Lefranc, M. P. 2001. ‘Nomenclature of the human T cell receptor genes’, Curr Protoc Immunol, Appendix 1: Appendix 10. ---. 2003. ‘IMGT databases, web resources and tools for immunoglobulin and T cell receptor sequence analysis, http://imgt.cines.fr’, Leukemia, 17: 260-6.

    [0211] Leotoing, L., L. Meunier, M. Manin, C. Mauduit, M. Decaussin, G. Verrijdt, F. Claessens, M. Benahmed, G. Veyssiere, L. Morel, and C. Beaudoin. 2008. ‘Influence of nucleophosmin/B23 on DNA binding and transcriptional activity of the androgen receptor in prostate cancer cell’, Oncogene, 27: 2858-67.

    [0212] Li, Y., H. Li, R. Martin, and R. A. Mariuzza. 2000. ‘Structural basis for the binding of an immunodominant peptide from myelin basic protein in different registers by two HLA-DR2 proteins’, J Mol Biol, 304: 177-88.

    [0213] Li, Y., R. Moysey, P. E. Molloy, A. L. Vuidepot, T. Mahon, E. Baston, S. Dunn, N. Liddy, J. Jacob, B. K. Jakobsen, and J. M. Boulter. 2005. ‘Directed evolution of human T-cell receptors with picomolar affinities by phage display’, Nat Biotechnol, 23: 349-54.

    [0214] Li, Y. P., R. K. Busch, B. C. Valdez, and H. Busch. 1996. ‘C23 interacts with B23, a putative nucleolar-localization-signal-binding protein’, EurJ Biochem, 237: 153-8.

    [0215] Liddy, N., G. Bossi, K. J. Adams, A. Lissina, T. M. Mahon, N. J. Hassan, J. Gavarret, F. C. Bianchi, N. J. Pumphrey, K. Ladell, E. Gostick, A. K. Sewell, N. M. Lissin, N. E. Harwood, P. E. Molloy, Y. Li, B. J. Cameron, M. Sami, E. E. Baston, P. T. Todorov, S. J. Paston, R. E. Dennis, J. V. Harper, S. M. Dunn, R. Ashfield, A. Johnson, Y. McGrath, G. Plesa, C. H. June, M. Kalos, D. A. Price, A. Vuidepot, D. D. Williams, D. H. Sutton, and B. K. Jakobsen. 2012. ‘Monoclonal TCR-redirected tumor cell killing’, Nat Med, 18: 980-7.

    [0216] Lindstrom, M. S. 2011. ‘NPM⅟B23: A Multifunctional Chaperone in Ribosome Biogenesis and Chromatin Remodeling’, Biochem Res Int, 2011: 195209.

    [0217] Liu, Q. R., and P. K. Chan. 1993. ‘Characterization of seven processed pseudogenes of nucleophosmin/B23 in the human genome’, DNA Cell Biol, 12: 149-56.

    [0218] Liu, S., J. Matsuzaki, L. Wei, T. Tsuji, S. Battaglia, Q. Hu, E. Cortes, L. Wong, L. Yan, M. Long, A. Miliotto, N. W. Bateman, S. B. Lele, T. Chodon, R. C. Koya, S. Yao, Q. Zhu, T. P. Conrads, J. Wang, G. L. Maxwell, A. A. Lugade, and K. Odunsi. 2019. ‘Efficient identification of neoantigen-specific T-cell responses in advanced human ovarian cancer’, J Immunother Cancer, 7: 156.

    [0219] Lo-Coco, F., G. Avvisati, M. Vignetti, C. Thiede, S. M. Orlando, S. lacobelli, F. Ferrara, P. Fazi, L. Cicconi, E. Di Bona, G. Specchia, S. Sica, M. Divona, A. Levis, W. Fiedler, E. Cerqui, M. Breccia, G. Fioritoni, H. R. Salih, M. Cazzola, L. Melillo, A. M. Carella, C. H. Brandts, E. Morra, M. von Lilienfeld-Toal, B. Hertenstein, M. Wattad, M. Lubbert, M. Hanel, N. Schmitz, H. Link, M. G. Kropp, A. Rambaldi, G. La Nasa, M. Luppi, F. Ciceri, O. Finizio, A. Venditti, F. Fabbiano, K. Dohner, M. Sauer, A. Ganser, S. Amadori, F. Mandelli, H. Dohner, G. Ehninger, R. F. Schlenk, U. Platzbecker, dell’Adulto Gruppo Italiano Malattie Ematologiche, Group German-Austrian Acute Myeloid Leukemia Study, and Leukemia Study Alliance. 2013. ‘Retinoic acid and arsenic trioxide for acute promyelocytic leukemia’, N Engl J Med, 369: 111-21.

    [0220] Martelli, M. P., I. Gionfriddo, F. Mezzasoma, F. Milano, S. Pierangeli, F. Mulas, R. Pacini, A. Tabarrini, V. Pettirossi, R. Rossi, C. Vetro, L. Brunetti, P. Sportoletti, E. Tiacci, F. Di Raimondo, and B. Falini. 2015. ‘Arsenic trioxide and all-trans retinoic acid target NPM1 mutant oncoprotein

    [0221] levels and induce apoptosis in NPM1-mutated AML cells’, Blood, 125: 3455-65. McCormack, E., K. J. Adams, N. J. Hassan, A. Kotian, N. M. Lissin, M. Sami, M. Mujic, T. Osdal, B. T. Gjertsen, D. Baker, A. S. Powlesland, M. Aleksic, A. Vuidepot, O. Morteau, D. H. Sutton, C. H. June, M. Kalos, R. Ashfield, and B. K. Jakobsen. 2013. ‘Bi-specific TCR-anti CD3 redirected T-cell targeting of NY-ESO-1- and LAGE-1-positive tumors’, Cancer Immunol Immunother, 62: 773-85.

    [0222] Mendes-da-Silva, P., A. Moreira, J. Duro-da-Costa, D. Matias, and C. Monteiro. 2000. ‘Frequent loss of heterozygosity on chromosome 5 in non-small cell lung carcinoma’, Mol Pathol, 53: 184-7.

    [0223] Metheringham, R. L., V. A. Pudney, B. Gunn, M. Towey, I. Spendlove, and L. G. Durrant. 2009. ‘Antibodies designed as effective cancer vaccines’, MAbs, 1: 71-85.

    [0224] Morris, S. W., M. N. Kirstein, M. B. Valentine, K. G. Dittmer, D. N. Shapiro, D. L. Saltman, and A. T. Look. 1994. ‘Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin’s lymphoma’, Science, 263: 1281-4.

    [0225] Munz, C. 2012. ‘Antigen Processing for MHC Class II Presentation via Autophagy’, Front Immunol, 3: 9.

    [0226] Myers, E. W., and W. Miller. 1989. ‘Approximate matching of regular expressions’, Bull Math Biol, 51: 5-37.

    [0227] Namboodiri, V. M., I. V. Akey, M. S. Schmidt-Zachmann, J. F. Head, and C. W. Akey. 2004. ‘The structure and function of Xenopus NO38-core, a histone chaperone in the nucleolus’, Structure, 12: 2149-60.

    [0228] Nozawa, Y., N. Van Belzen, A. C. Van der Made, W. N. Dinjens, and F. T. Bosman. 1996. ‘Expression of nucleophosmin/B23 in normal and neoplastic colorectal mucosa’, J Pathol, 178: 48-52.

    [0229] Nygren, P. A. 2008. ‘Alternative binding proteins: affibody binding proteins developed from a small three-helix bundle scaffold’, FEBSJ, 275: 2668-76.

    [0230] Okuwaki, M., K. Matsumoto, M. Tsujimoto, and K. Nagata. 2001. ‘Function of nucleophosmin/B23, a nucleolar acidic protein, as a histone chaperone’, FEBS Lett, 506: 272-6.

    [0231] Pearson, W. R., and D. J. Lipman. 1988. ‘Improved tools for biological sequence comparison’, Proc Natl Acad Sci USA, 85: 2444-8.

    [0232] Pianta, A., C. Puppin, A. Franzoni, D. Fabbro, C. Di Loreto, S. Bulotta, M. Deganuto, I. Paron, G. Tell, E. Puxeddu, S. Filetti, D. Russo, and G. Damante. 2010. ‘Nucleophosmin is overexpressed in thyroid tumors’, Biochem Biophys Res Commun, 397: 499-504.

    [0233] Pluckthun, A. 1991. ‘Antibody engineering: advances from the use of Escherichia coli expression systems’, Biotechnology (N Y), 9: 545-51.

    [0234] Qi, W., K. Shakalya, A. Stejskal, A. Goldman, S. Beeck, L. Cooke, and D. Mahadevan. 2008. ‘NSC348884, a nucleophosmin inhibitor disrupts oligomer formation and induces apoptosis in human cancer cells’, Oncogene, 27: 4210-20.

    [0235] Redner, R. L., E. A. Rush, S. Faas, W. A. Rudert, and S. J. Corey. 1996. ‘The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion’, Blood, 87: 882-6.

    [0236] Reff, M. E. 1993. ‘High-level production of recombinant immunoglobulins in mammalian cells’, Curr Opin Biotechnol, 4: 573-6.

    [0237] Remington, RP. 1980. Remington’s pharmaceutical sciences (Mack Pub. Co).

    [0238] Robins, H. S., P. V. Campregher, S. K. Srivastava, A. Wacher, C. J. Turtle, O. Kahsai, S. R. Riddell, E. H. Warren, and C. S. Carlson. 2009. ‘Comprehensive assessment of T-cell receptor beta-chain diversity in alphabeta T cells’, Blood, 114: 4099-107.

    [0239] Sambrook, J, Fritsch and Maniatis. 1989. Molecular cloning: A laboratory manual (Cold Spring Harbor Laboratory Press).

    [0240] Sato, K., R. Hayami, W. Wu, T. Nishikawa, H. Nishikawa, Y. Okuda, H. Ogata, M. Fukuda, and T. Ohta. 2004. ‘Nucleophosmin/B23 is a candidate substrate for the BRCA1-BARD1 ubiquitin ligase’, J Biol Chem, 279: 30919-22.

    [0241] Schmid, D., M. Pypaert, and C. Munz. 2007. ‘Antigen-loading compartments for major histocompatibility complex class II molecules continuously receive input from autophagosomes’, Immunity, 26: 79-92.

    [0242] Scott, C. A., P. A. Peterson, L. Teyton, and I. A. Wilson. 1998. ‘Crystal structures of two I-Ad-peptide complexes reveal that high affinity can be achieved without large anchor residues’, Immunity, 8: 319-29.

    [0243] Sekhar, K. R., M. Benamar, A. Venkateswaran, S. Sasi, N. R. Penthala, P. A. Crooks, S. R. Hann, L. Geng, R. Balusu, T. Abbas, and M. L. Freeman. 2014. ‘Targeting nucleophosmin 1 represents a rational strategy for radiation sensitization’, IntJ Radiat Oncol Biol Phys, 89: 1106-14.

    [0244] Sette, A., L. Adorini, S. M. Colon, S. Buus, and H. M. Grey. 1989. ‘Capacity of intact proteins to bind to MHC class II molecules’, J Immunol, 143: 1265-7.

    [0245] Shields, L. B., C. Gercel-Taylor, C. M. Yashar, T. C. Wan, W. A. Katsanis, J. A. Spinnato, and D. D. Taylor. 1997. ‘Induction of immune responses to ovarian tumor antigens by multiparity’, J Soc Gynecol Investig, 4: 298-304.

    [0246] Skaar, T. C., S. C. Prasad, S. Sharareh, M. E. Lippman, N. Brunner, and R. Clarke. 1998. ‘Two-dimensional gel electrophoresis analyses identify nucleophosmin as an estrogen regulated protein associated with acquired estrogen-independence in human breast cancer cells’, J Steroid Biochem Mol Biol, 67: 391-402.

    [0247] Skerra, A. 2008. ‘Alternative binding proteins: anticalins - harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities’, FEBSJ, 275: 2677-83.

    [0248] Smith, K. J., J. Pyrdol, L. Gauthier, D. C. Wiley, and K. W. Wucherpfennig. 1998. ‘Crystal structure of HLA-DR2 (DRA*0101, DRB1*1501) complexed with a peptide from human myelin basic protein’, J Exp Med, 188: 1511-20.

    [0249] Stern, L. J., J. H. Brown, T. S. Jardetzky, J. C. Gorga, R. G. Urban, J. L. Strominger, and D. C. Wiley. 1994. ‘Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza virus peptide’, Nature, 368: 215-21.

    [0250] Stewart. 1984. Solid phase peptide synthesis (Illinois Pierce Chemical Company: Rockford).

    [0251] Subong, E. N., M. J. Shue, J. I. Epstein, J. V. Briggman, P. K. Chan, and A. W. Partin. 1999. ‘Monoclonal antibody to prostate cancer nuclear matrix protein (PRO:4-216) recognizes nucleophosmin/B23’, Prostate, 39: 298-304.

    [0252] Swaminathan, V., A. H. Kishore, K. K. Febitha, and T. K. Kundu. 2005. ‘Human histone chaperone nucleophosmin enhances acetylation-dependent chromatin transcription’, Mol Cell Biol, 25: 7534-45.

    [0253] Szebeni, A., J. E. Herrera, and M. O. Olson. 1995. ‘Interaction of nucleolar protein B23 with peptides related to nuclear localization signals’, Biochemistry, 34: 8037-42.

    [0254] Szebeni, A., and M. O. Olson. 1999. ‘Nucleolar protein B23 has molecular chaperone activities’, Protein Sci, 8: 905-12.

    [0255] Tanaka, M., H. Sasaki, I. Kino, T. Sugimura, and M. Terada. 1992. ‘Genes preferentially expressed in embryo stomach are predominantly expressed in gastric cancer’, Cancer Res, 52: 3372-7.

    [0256] Tanikawa, C., K. Ueda, H. Nakagawa, N. Yoshida, Y. Nakamura, and K. Matsuda. 2009. ‘Regulation of protein Citrullination through p53/PADI4 network in DNA damage response’, Cancer Res, 69: 8761-9.

    [0257] Thomsen, M. C., and M. Nielsen. 2012. ‘Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion’, Nucleic Acids Res, 40: W281-7.

    [0258] Torelli, A., and C. A. Robotti. 1994. ‘ADVANCE and ADAM: two algorithms for the analysis of global similarity between homologous informational sequences’, Comput Appl Biosci, 10: 3-5.

    [0259] Traunecker, A., A. Lanzavecchia, and K. Karjalainen. 1991. ‘Bispecific single chain molecules (Janusins) target cytotoxic lymphocytes on HIV infected cells’, EMBOJ, 10: 3655-9.

    [0260] Trill, J. J., A. R. Shatzman, and S. Ganguly. 1995. ‘Production of monoclonal antibodies in COS and CHO cells’, Curr Opin Biotechnol, 6: 553-60.

    [0261] Tsui, K. H., A. J. Cheng, Pe Chang, T. L. Pan, and B. Y. Yung. 2004. ‘Association of nucleophosmin/B23 mRNA expression with clinical outcome in patients with bladder carcinoma’, Urology, 64: 839-44.

    [0262] Wang, D., H. Umekawa, and M. O. Olson. 1993. ‘Expression and subcellular locations of two forms of nucleolar protein B23 in rat tissues and cells’, Cell Mol Biol Res, 39: 33-42.

    [0263] Ward, E. S., D. Gussow, A. D. Griffiths, P. T. Jones, and G. Winter. 1989. ‘Binding activities of a repertoire of single immunoglobulin variable domains secreted from Escherichia coli’, Nature, 341: 544-6.

    [0264] Watt, P. M. 2006. ‘Screening for peptide drugs from the natural repertoire of biodiverse protein folds’, Nat Biotechnol, 24: 177-83.

    [0265] Wulff, J. E., R. Siegrist, and A. G. Myers. 2007. ‘The natural product avrainvillamide binds to the oncoprotein nucleophosmin’, JAm Chem Soc, 129: 14444-51.

    [0266] Xue, W., R. L. Metheringham, V. A. Brentville, B. Gunn, P. Symonds, H. Yagita, J. M. Ramage, and L. G. Durrant. 2016. ‘SCIB2, an antibody DNA vaccine encoding NY-ESO-1 epitopes, induces potent antitumor immunity which is further enhanced by checkpoint blockade’, Oncoimmunology, 5: e1169353.

    [0267] Yoneda-Kato, N., A. T. Look, M. N. Kirstein, M. B. Valentine, S. C. Raimondi, K. J. Cohen, A. J. Carroll, and S. W. Morris. 1996. ‘The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1’, Oncogene, 12: 265-75.

    [0268] Yun, J. P., E. C. Chew, C. T. Liew, J. Y. Chan, M. L. Jin, M. X. Ding, Y. H. Fai, H. K. Li, X. M. Liang, and Q. L. Wu. 2003. ‘Nucleophosmin/B23 is a proliferate shuttle protein associated with nuclear matrix’, J Cell Biochem, 90: 1140-8.

    [0269] Yun, J. P., J. Miao, G. G. Chen, Q. H. Tian, C. Q. Zhang, J. Xiang, J. Fu, and P. B. Lai. 2007. ‘Increased expression of nucleophosmin/B23 in hepatocellular carcinoma and correlation with clinicopathological parameters’, Br J Cancer, 96: 477-84.

    [0270] Zhu, X., H. J. Belmont, S. Price-Schiavi, B. Liu, H. I. Lee, M. Fernandez, R. L. Wong, J. Builes, P. R. Rhode, and H. C. Wong. 2006. ‘Visualization of p53(264-272)/HLA-A*0201 complexes naturally presented on tumor cell surface by a multimeric soluble single-chain T cell receptor’, J Immunol, 176: 3223-32.

    [0271] Zhu, Y., M. Shi, H. Chen, J. Gu, J. Zhang, B. Shen, X. Deng, J. Xie, X. Zhan, and C. Peng. 2015. ‘NPM1 activates metabolic changes by inhibiting FBP1 while promoting the tumorigenicity of pancreatic cancer cells’, Oncotarget, 6: 21443-51.