ARRAY AND METHOD FOR DETECTING SPATIAL INFORMATION OF NUCLEIC ACIDS

Abstract

Provided are a method for detecting spatial information of nucleic acids in a sample, as well as a nucleic acid array used in the method and a method for producing the nucleic acid array.

Claims

1. A nucleic acid array for detecting spatial information of a nucleic acid in a sample, which comprises a solid support (e.g., a chip) with multiple kinds of carrier sequences attached to its surface, in which each kind of carrier sequence occupies a different position in the array, said each kind of carrier sequence comprises a plurality of copies of the carrier sequence, and the carrier sequence in the direction from 5′ to 3′ comprises a positioning sequence and a first immobilization sequence, wherein, the positioning sequence has a unique nucleotide sequence corresponding to the position of the kind of carrier sequence on the array; the first immobilization sequence allows annealing to its complementary nucleotide sequence and initiating an extension reaction.

2. The nucleic acid array according to claim 1, wherein the nucleic acid array further comprises a first nucleic acid molecule, the first nucleic acid molecule in the direction from 5′ to 3′ comprises: a complement of the first immobilization sequence and a complement of the positioning sequence, and the first nucleic acid molecule hybridizes to the first immobilization sequence and the positioning sequence of the carrier sequence to form a double strand; preferably, each copy of each kind of carrier sequence comprises a first nucleic acid molecule hybridized therewith.

3. The nucleic acid array according to claim 1 or 2, wherein the nucleic acid array further comprises a second nucleic acid molecule, the second nucleic acid molecule is ligated to the first nucleic acid molecule, and the second nucleic acid molecule comprises a capture sequence; the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, and comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a free 3′ end to enable the second nucleic acid molecule to function as an extension primer; preferably, each first nucleic acid molecule is ligated to the second nucleic acid molecule.

4. The nucleic acid array according to claim 1 or 2, wherein each carrier sequence further comprises a second immobilization sequence at its 5′ end, and the second immobilization sequence allows annealing to its complementary nucleotide sequence; the second immobilization sequence allows annealing to its complementary nucleotide sequence and initiating an extension reaction.

5. The nucleic acid array according to claim 4, wherein the nucleic acid array further comprises a second nucleic acid molecule, and the second nucleic acid molecule in the direction from 5′ to 3′ comprises a complement of the second immobilization sequence and a capture sequence; the complement of second immobilization sequence hybridizes to the second immobilization sequence of the carrier sequence to form a double strand; the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, and comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a free 3′ end to enable the second nucleic acid molecule to function as an extension primer; preferably, each copy of each kind of carrier sequence comprises a second nucleic acid molecule hybridized therewith.

6. The nucleic acid array according to claim 1, wherein the multiple copies of carrier sequence are an amplification product formed by amplification using a complementary sequence of the carrier sequence as a template, and the amplification is selected from rolling circle amplification (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA) or emulsion PCR amplification; preferably, the multiple copies of carrier sequence are a DNB formed by a concatemer of the carrier sequence; preferably, the multiple copies of carrier sequence are a DNB formed by rolling circle amplification using a complementary sequence of the carrier sequence as a template; preferably, the multiple copies of carrier sequence are a DNA cluster formed by a clone population of the carrier sequence; for example, the multiple copies of carrier sequence are a DNA cluster formed by bridge PCR amplification using a complementary sequence of the carrier sequence as a template; for example, the multiple copies of carrier sequence are a DNA cluster formed by emulsion PCR amplification using a complementary sequence of the carrier sequence as a template; for example, the multiple copies of carrier sequence are a DNA cluster formed by multiple strand displacement amplification using a complementary sequence of the carrier sequence as a template.

7. The nucleic acid array according to claim 2, wherein the first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, and the UMI sequence is located at the 5′ end of the complement of first immobilization sequence; the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T; preferably, the UMI sequence contained in each first nucleic acid molecule is different from each other.

8. The nucleic acid array according to claim 3, wherein the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5′ end of the capture sequence; the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T; preferably, the UMI sequence contained in each second nucleic acid molecule is different from each other.

9. The nucleic acid array according to claim 1, wherein the solid support is a chip; preferably, the solid support can be used as a sequencing platform, such as a sequencing chip; preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platform.

10. (canceled)

11. The nucleic acid array according to claim 1, wherein the carrier sequence further comprises a capture sequence template located upstream of the positioning sequence, the capture sequence template comprises a complementary sequence of the capture sequence, and the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, which comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the first immobilization sequence of the carrier sequence also comprises a cleavage site, and the cleavage can be selected from enzymatic cleavage with nicking enzyme, enzymatic cleavage with USER enzyme, photocleavage, chemical cleavage or CRISPR-based cleavage; and, the nucleic acid array further comprises a first nucleic acid molecule, and the first nucleic acid molecule in the direction from 5′ to 3′ comprises: a binding region, a cleavage region, and a carrier sequence complementary region, the binding region comprises a linker capable of ligating to the surface of the solid support; the cleavage region comprises a cleavage site; the carrier sequence complementary region comprises a sequence that can be complementary to the carrier sequence, and in the direction from 5′ to 3′, comprises: a complement of the first immobilization sequence, a complement of the positioning sequence, and a capture sequence; and, the capture sequence has a free 3′ end to enable the first nucleic acid molecule to function as an extension primer; and, the carrier sequence complementary region of the first nucleic acid molecule hybridizes to the carrier sequence to form a double strand; preferably, each copy of each kind of carrier sequence comprises a first nucleic acid molecule hybridized therewith.

12. The nucleic acid array according to claim 11, wherein the carrier sequence further comprises a complement of UMI sequence located downstream of the capture sequence template and upstream of the first immobilization sequence, the complement of UMI sequence is complementary to the UMI sequence, the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, and each N is independently any one of A, C, G and T; and, the carrier sequence complementary region of the first nucleic acid molecule further comprises the UMI sequence located upstream of the capture sequence and downstream of the complement of first immobilization sequence; preferably, the complement of UMI sequence is located between the positioning sequence and the capture sequence template, or between the first immobilization sequence and the positioning sequence; preferably, each copy of each kind of carrier sequence (i.e., carrier sequences comprising the same positioning sequence) comprises a complement of UMI sequence different from each other.

13. The nucleic acid array according to claim 11, wherein the linker of the first nucleic acid molecule is a linking group capable of coupling with an activating group (e.g., NH.sub.2), and the surface of the solid support is modified by the activating group (e.g., NH.sub.2); preferably, the linker comprises —SH, -DBCO or —NHS; preferably, the linker is ##STR00005##  (Azido-dPEG®8-NHS ester) is attached to the surface of the solid support.

14. The nucleic acid array according to claim 11, wherein the cleavage site contained in the cleavage region of the first nucleic acid molecule is a site where controlled cleavage can be performed by a chemical, enzymatic, or photochemical method; preferably, the cleavage site contained in the cleavage region of the first nucleic acid molecule is an enzyme cleavage site; preferably, the cleavage region of the first nucleic acid molecule is different from the cleavage site contained in the first immobilization sequence of the carrier sequence.

15. The nucleic acid array according to claim 11, wherein the solid support is a chip; preferably, the solid support can be used as a sequencing platform, such as a sequencing chip; preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platform.

16. (canceled)

17. A kit, which comprises: (i) the nucleic acid array according to claim 2, wherein the nucleic acid array does not comprise a second nucleic acid molecule; and, (ii) a second nucleic acid molecule, wherein the second nucleic acid molecule in the direction from 5′ to 3′ comprises an immobilization region and a capture sequence; the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, and comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a free 3′ end to enable the second nucleic acid molecule to function as an extension primer.

18. The kit according to claim 17, wherein the immobilization region of the second nucleic acid molecule comprises a double-stranded nucleic acid sequence (for example, a double-stranded DNA sequence).

19. A kit comprising: (i) the nucleic acid array according to claim 4, and (ii) a second nucleic acid molecule, wherein the second nucleic acid molecule in the direction from 5′ to 3′ comprises an immobilization region and a capture sequence; the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, and comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a free 3′ end to enable the second nucleic acid molecule to function as an extension primer; wherein the immobilization region of the second nucleic acid molecule comprises a complement of second immobilization sequence.

20. The kit according to claim 17, wherein the first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, and the UMI sequence is located at the 5′ end of the complement of first immobilization sequence; or, the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5′ end of the capture sequence; the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T.

21. A method for generating a nucleic acid array for detecting spatial information of a nucleic acid in a biological sample, which comprises the following steps: (1) providing multiple kinds of carrier sequences, each kind of carrier sequence comprises a plurality of copies of the carrier sequence, and the carrier sequence in the direction from 5′ to 3′ comprises a positioning sequence and a first immobilization sequence, the positioning sequence has a unique nucleotide sequence corresponding to the position of the kind of carrier sequence on the array; the first immobilization sequence allows annealing to its complementary nucleotide sequence and initiating an extension reaction; (2) ligating the multiple kinds of carrier sequences to a surface of a solid support (e.g., a chip); (3) providing a first primer, and perform a primer extension reaction by using the carrier sequence as a template, so that a region of the first immobilization sequence and the positioning sequence of the carrier sequence forms a double strand, wherein the strand that hybridizes to the carrier sequence is a first nucleic acid molecule, the first nucleic acid molecule in the direction from 5′ to 3′ comprises the first immobilization sequence and a complementary sequence of the positioning sequence; wherein, the first primer comprises a first immobilization sequence complementary region at its 3′ end, the first immobilization sequence complementary region comprises a complementary sequence of the first immobilization sequence or a fragment thereof, and has a free 3′ end.

22. The method according to claim 21, wherein in step (1), the multiple kinds of carrier sequences are provided by the following steps: (i) providing multiple kinds of carrier sequence templates, the carrier sequence template comprising a complementary sequence of the carrier sequence; (ii) perform a nucleic acid amplification reaction by using each kind of carrier sequence template as a template, to obtain an amplification product of each kind of carrier sequence template, the amplification product comprising a plurality of copies of the carrier sequence; preferably, the amplification is selected from rolling circle amplification (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA) or emulsion PCR amplification; preferably, rolling circle amplification is performed to obtain a DNB formed by a concatemer of the carrier sequence; preferably, bridge PCR amplification, emulsion PCR amplification or multiple strand displacement amplification is performed to obtain a DNA cluster formed by a clone population of the carrier sequence.

23. The method according to claim 21 or 22, wherein the method further comprises the following steps: (4) providing a second nucleic acid molecule, the second nucleic acid molecule comprising a capture sequence; the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, which comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a free 3′ end to enable the second nucleic acid molecule to function as an extension primer, (5) ligating the second nucleic acid molecule to the first nucleic acid molecule (for example, using a ligase to ligate the second nucleic acid molecule to the first nucleic acid molecule).

24. The method according to claim 23, wherein the second nucleic acid molecule in the direction from 5′ to 3′ comprises an immobilization region and a capture sequence, and the immobilization region comprises a double-stranded DNA sequence.

25. The method according to claim 23, wherein each carrier sequence further comprises a second immobilization sequence at its 5′ end, and the second immobilization sequence allows annealing to its complementary nucleotide sequence; the method further comprises the following steps: (4) providing a second nucleic acid molecule, the second nucleic acid molecule in the direction from 5′ to 3′ comprising a complement of second immobilization sequence and a capture sequence; the complement of second immobilization sequence allows hybridization to its complementary nucleotide sequence; the capture sequence is capable of hybridizing with the whole or part of the nucleic acid to be captured, and comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a free 3′ end to enable the second nucleic acid molecule to function as an extension primer; (5) hybridizing the complement of second immobilization sequence with the second immobilization sequence under a condition that allow annealing, thereby ligating the second nucleic acid molecule to the carrier sequence; (6) optionally, ligating the first nucleic acid molecule and the second nucleic acid molecule that are hybridized to the carrier sequence respectively (for example, using a ligase to ligate the second nucleic acid molecule to the first nucleic acid molecule).

26. The method according to claim 23, wherein, in step (3), the first primer further comprises a unique molecular identifier (UMI) at the 5′ end of its first immobilization sequence complementary region, so that the first nucleic acid molecule comprises the UMI sequence at the 5′ end of its complement of first immobilization sequence; or, in step (4), the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5′ end of the capture sequence; the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T.

27. The method according to claim 21, wherein: in step (1), the carrier sequence further comprises a capture sequence template located upstream of the positioning sequence, the capture sequence template comprises a complementary sequence of the capture sequence, and the capture sequence can hybridize to the whole or part of the nucleic acid to be captured, which comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and/or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and the first immobilization sequence of the carrier sequence also comprises a cleavage site, and the cleavage can be selected from enzymatic cleavage with nicking enzyme, enzymatic cleavage with USER enzyme, photocleavage, chemical cleavage or CRISPR-based cleavage; in step (3), a region of the first immobilization sequence, the positioning sequence and the capture sequence template of the carrier sequence forms a double strand, so that the first nucleic acid molecule in the direction from 5′ to 3′ comprises a complement of first immobilization sequence, a complement of positioning sequence and a capture sequence; wherein, the first primer in the direction from 5′ to 3′ comprises a binding region, an cleavage region, and a first immobilization sequence complementary region, the binding region comprises a linker capable of ligating to the surface of the solid support, and the cleavage region comprises a cleavage site; and, the method further comprises the following steps: (4) ligating the first primer to the surface of the solid support; wherein, steps (3) and (4) are performed in any order; (5) optionally, performing cleavage at the cleavage site contained in the first immobilization sequence of the carrier sequence to digest the carrier sequence, so that the extension product in step (3) is separated from the template where such extension product is formed (i.e., carrier sequence), and the first nucleic acid molecule is therefore ligated to the surface of the solid support (e.g., chip); preferably, each kind of carrier sequence is a DNB formed by a concatemer of the multiple copies of carrier sequence.

28. The method according to claim 27, wherein, in step (1), the cleavage site contained in the first immobilization sequence is a cleavage site of nicking enzyme; preferably, the nicking enzyme is selected from USER, BamHI, and BmtI.

29. The method according to claim 27, wherein, in step (1), the carrier sequence further comprises a complement of UMI sequence located downstream of the capture sequence template and upstream of the first immobilization sequence, the complement of UMI sequence is complementary to a UMI sequence, and the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T; and, in step (3), a region of the first immobilization sequence, the positioning sequence, the capture sequence template, and the complement of UMI sequence of the carrier sequence forms a double strand, so that the first nucleic acid molecule in the direction from 5′ to 3′ comprises the complement of first immobilization sequence, the complement of positioning sequence and the capture sequence, and the UMI sequence located upstream of the capture sequence and downstream of the complement of first immobilization sequence; preferably, the complement of UMI sequence is located between the positioning sequence and the capture sequence template, or between the first immobilization sequence and the positioning sequence.

30. The method according to claim 27, wherein the linker of the first primer is a linking group capable of coupling with an activating group (e.g., NH.sub.2), and the surface of the solid support is modified by the activating group (e.g., NH.sub.2); preferably, the linker comprises —SH, -DBCO or —NHS; preferably, the linker is ##STR00006##  (Azido-dPEG®8-NHS ester) is attached to the surface of the solid support.

31. The method according to claim 27, wherein the cleavage site contained in the cleavage region of the first primer is a site where controlled cleavage can be performed by a chemical, enzymatic, or photochemical method; preferably, the cleavage site contained in the cleavage region of the first primer is an enzyme cleavage site; preferably, the cleavage region of the first primer is different from the cleavage site contained in the first immobilization sequence of the carrier sequence.

32. (canceled)

33. The method according to claim 21, wherein the solid support is a chip; preferably, the solid support can be used as a sequencing platform, such as a sequencing chip; preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platform.

34. The method according to claim 21, wherein, in step (3), while performing an extension reaction, the carrier sequence is sequenced to obtain the sequence information of the positioning sequence contained in the carrier sequence.

35. The method according to claim 21, wherein, before step (3), a step of sequencing the carrier sequence is comprised; preferably, after the sequencing is completed, washing is performed to remove dNTP added to the synthetic strand due to the sequencing.

36-37. (canceled)

38. A method for detecting spatial information of a nucleic acid in a sample, which comprises the following steps: (1) providing the nucleic acid array according to claim 3; wherein, the nucleic acid array comprises multiple kinds of carrier sequences attached to a surface of a solid support (e.g., a chip), each kind of carrier sequence occupies a different position in the array, and said each kind of carrier sequence comprises a plurality of copies of the carrier sequence; each carrier sequence comprises a first nucleic acid molecule hybridized therewith, and the first nucleic acid molecule is ligated to a second nucleic acid molecule; the first nucleic acid molecule comprises a complement of positioning sequence corresponding to the position of the kind of carrier sequence on the array, the second nucleic acid molecule comprises a capture sequence capable of capturing the nucleic acid in the sample; (2) contacting the nucleic acid array with the sample to be tested under a condition that allows annealing, so that the nucleic acid in the sample to be tested anneals to the capture sequence of the second nucleic acid molecule, and thus the position of the nucleic acid can be correlated with the position of the carrier sequence on the nucleic acid array; (3) performing a primer extension reaction by using the ligated first and second nucleic acid molecules as a primer, and using the captured nucleic acid molecule as a template under a condition that allows the primer extension, to produce an extension product, in which the strand that hybridizes to the captured nucleic acid molecule has the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag; and/or, performing a primer extension reaction by using the captured nucleic acid molecule as a primer, and using the ligated first and second connected nucleic acid molecules as a template under a condition that allows the primer extension, to produce an extended captured nucleic acid molecule, in which the extended captured nucleic acid molecule has the positioning sequence as a spatial information tag; (4) releasing at least part of the nucleic acid molecules labeled with spatial information tags from the surface of the array, wherein the part comprises the positioning sequence or its complementary strand and the captured nucleic acid molecule or its complementary strand; and (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4); preferably, the spatial information of the nucleic acid comprises the location, distribution and/or expression of the nucleic acid; preferably, the sample is a tissue sample, such as a tissue section; preferably, the tissue section is prepared from a fixed tissue, for example, a formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

39. The method according to claim 38, which is used to detect a transcriptome in a sample, wherein: (a) in step (3), generating a cDNA molecule from the captured RNA molecule by using the ligated first and second nucleic acid molecules as a reverse transcription primer, the cDNA molecule has the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag, and optionally, amplifying the cDNA molecule; and, (b) in step (4), releasing at least part of the cDNA molecules and/or their amplicons from the surface of the array, wherein the released nucleic acid molecule may be the first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the part comprises the positioning sequence or its complementary strand; preferably, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

40. A method for detecting spatial information of a nucleic acid in a sample, which comprises the following steps: (1) providing the nucleic acid array according to claim 11; wherein the nucleic acid array comprises a solid support (e.g., a chip) with multiple kinds of carrier sequences attached to its surface, each kind of carrier sequence occupies a different position in the array, and said each kind of carrier sequence comprises a plurality of copies of the carrier sequence; each carrier sequence comprises a first nucleic acid molecule hybridized therewith, and the first nucleic acid molecule comprises a complement of positioning sequence corresponding to the position of the kind of carrier sequence on the array and a capture sequence capable of capturing the nucleic acid in the sample; (2) contacting the nucleic acid array with the sample to be tested under a condition that allows annealing, so that the nucleic acid in the sample to be tested anneals to the capture sequence of the first nucleic acid molecule, and thus the position of the nucleic acid can be correlated with the position of the first nucleic acid molecule on the nucleic acid array; (3) performing a primer extension reaction by using the first nucleic acid molecule as a primer and using the captured nucleic acid molecule as a template under a condition that allows the primer extension, to produce an extension product, in which the strand that hybridizes to the captured nucleic acid molecule has the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag; (4) releasing at least part of the nucleic acid molecules labeled with the spatial information tags from the surface of the array, wherein the part comprises the positioning sequence or its complementary strand and the captured nucleic acid molecule or its complementary strand; and (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4); preferably, the spatial information of the nucleic acid comprises the location, distribution and/or expression of the nucleic acid; preferably, the sample is a tissue sample, such as a tissue section; preferably, the tissue section is prepared from a fixed tissue, for example, a formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

41. The method according to claim 40, in which the method is used to detect a transcriptome in a sample, wherein: in step (3), generating a cDNA molecule from the captured RNA molecule by using the first nucleic acid molecule as an RT primer, the cDNA molecule has the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag, and optionally, amplifying the cDNA molecule; in step (4), releasing at least part of the cDNA molecules and/or their amplicons from the surface of the array, wherein the released nucleic acid molecule may be the first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the part comprises the positioning sequence or its complementary strand; preferably, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

42-49. (canceled)

50. The nucleic acid array according to claim 5, wherein the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5′ end of the capture sequence; the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T; preferably, the UMI sequence contained in each second nucleic acid molecule is different from each other.

51. The kit according to claim 19, wherein the first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, and the UMI sequence is located at the 5′ end of the complement of first immobilization sequence; or, the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5′ end of the capture sequence; the UMI sequence is a nucleotide sequence consisting of at least 1 (for example, at least 2, at least 3, at least 4, or at least 5; for example, 5 to 100) nucleotide N, each N is independently any one of A, C, G and T.

52. A method for detecting spatial information of a nucleic acid in a sample, which comprises the following steps: (1) providing the nucleic acid array according to claim 5; wherein, the nucleic acid array comprises multiple kinds of carrier sequences attached to a surface of a solid support (e.g., a chip), each kind of carrier sequence occupies a different position in the array, and said each kind of carrier sequence comprises a plurality of copies of the carrier sequence; each carrier sequence comprises a first nucleic acid molecule and a second nucleic acid molecule that are hybridized therewith; the first nucleic acid molecule comprises a complement of positioning sequence corresponding to the position of the kind of carrier sequence on the array, the second nucleic acid molecule comprises a capture sequence capable of capturing the nucleic acid in the sample; (2) contacting the nucleic acid array with the sample to be tested under a condition that allows annealing, so that the nucleic acid in the sample to be tested anneals to the capture sequence of the second nucleic acid molecule, and thus the position of the nucleic acid can be correlated with the position of the carrier sequence on the nucleic acid array; (3) (i) when the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other, ligating the first nucleic acid molecule and the second nucleic acid molecule that are hybridized to each carrier sequence (for example, using a ligase); performing a primer extension reaction by using the ligated first and second nucleic acid molecules as a primer, and using the captured nucleic acid molecule as a template under a condition that allows the primer extension, so as to produce an extension product, in which the strand that hybridizes to the captured nucleic acid molecule has the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag; and/or, performing a primer extension reaction by using the captured nucleic acid molecule as a primer, and using the ligated first and second nucleic acid molecules as a template under a condition that allows the primer extension, so as to produce an extended captured nucleic acid molecule, in which the extended captured nucleic acid has the positioning sequence as a spatial information tag; alternatively, (ii) when the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other, performing a primer extension reaction by using the second nucleic acid molecule as a primer and using the captured nucleic acid molecule as a template under a condition that allows the primer extension, to produce an extended second nucleic acid molecule, in which the extended second nucleic acid molecule comprises a complementary sequence of the captured nucleic acid; ligating the first nucleic acid molecule and the extended second nucleic acid molecule that are hybridized to each carrier sequence (for example, by using a ligase), in which the extended second nucleic acid molecule which is ligated to the first nucleic acid molecule has the complement of positioning contained in the first nucleic acid molecule as a spatial information tag; (4) releasing at least part of the nucleic acid molecules labeled with spatial information tags from the surface of the array, wherein the part comprises the positioning sequence or its complementary strand and the captured nucleic acid molecule or its complementary strand; and (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4); preferably, the spatial information of the nucleic acid comprises the location, distribution and/or expression of the nucleic acid; preferably, the sample is a tissue sample, such as a tissue section; preferably, the tissue section is prepared from a fixed tissue, for example, a formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

53. The method according to claim 52, which is used to detect a transcriptome in a sample, wherein: (a) in step (3)(i), generating a cDNA molecule from the captured RNA molecule by using the ligated first and second nucleic acid molecules as a reverse transcription primer, the cDNA molecule has the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag, and optionally, amplifying the cDNA molecule; or, in step (3)(ii), generating a cDNA molecule from the captured RNA molecule by using the second nucleic acid molecule as a reverse transcription primer, ligating the first nucleic acid molecule and the cDNA molecule that hybridizes to each carrier sequence (for example, by using ligase), to generate a cDNA molecule having the complement of positioning sequence contained in the first nucleic acid molecule as a spatial information tag, and optionally, amplifying the cDNA molecule; and, (b) in step (4), releasing at least part of the cDNA molecules and/or their amplicons from the surface of the array, wherein the released nucleic acid molecule may be the first and/or second strand of the cDNA molecule or an amplicon thereof, and wherein the part comprises the positioning sequence or its complementary strand; preferably, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

54. The method according to claim 38, which is characterized by one or more of the following: (i) in step (1), the multiple copies of the carrier sequence is a DNB formed by a concatemer of the carrier sequence, or the multiple copies of the carrier sequence is a DNA cluster formed by a clone population of the carrier sequence; (ii) in step (5), the sequence analysis comprises sequencing or a sequence-specific PCR reaction; (iii) the method further comprises step (6): correlating the sequence analysis information obtained in step (5) to an image of the sample, wherein the sample is imaged before or after step (3); preferably, the imaging of the sample uses light, bright field, dark field, phase contrast, fluorescence, reflection, interference, confocal microscopy or a combination thereof; (iv) before or after the nucleic acid molecule labeled with spatial information tag is released from the surface of the array, the complementary strand is generated; preferably, the synthesis of the complementary strand uses a random primer and a strand displacement polymerase; (v) before the sequence analysis, the method further comprises a step of amplifying the nucleic acid molecule labeled with the spatial information tag; preferably, the amplification step is performed after the nucleic acid molecule labeled with the spatial information tag is released from the array, or the amplification step is performed in situ on the array; preferably, the amplification step comprises PCR; (vi) before the sequence analysis, the method further comprises a step of purifying the released nucleic acid molecule; (vii) before step (4), the method further comprises a step of washing the array to remove a residue of the sample (e.g., tissue); (viii) in step (4), the nucleic acid molecule is released from the surface of the array by the following method: (i) nucleic acid cleavage; (ii) denaturation; and/or (iii) physical method.

55. The method according to claim 52, which is characterized by one or more of the following: (i) in step (1), the multiple copies of the carrier sequence is a DNB formed by a concatemer of the carrier sequence, or the multiple copies of the carrier sequence is a DNA cluster formed by a clone population of the carrier sequence; (ii) in step (5), the sequence analysis comprises sequencing or a sequence-specific PCR reaction; (iii) the method further comprises step (6): correlating the sequence analysis information obtained in step (5) to an image of the sample, wherein the sample is imaged before or after step (3); preferably, the imaging of the sample uses light, bright field, dark field, phase contrast, fluorescence, reflection, interference, confocal microscopy or a combination thereof; (iv) before or after the nucleic acid molecule labeled with spatial information tag is released from the surface of the array, the complementary strand is generated; preferably, the synthesis of the complementary strand uses a random primer and a strand displacement polymerase; (v) before the sequence analysis, the method further comprises a step of amplifying the nucleic acid molecule labeled with the spatial information tag; preferably, the amplification step is performed after the nucleic acid molecule labeled with the spatial information tag is released from the array, or the amplification step is performed in situ on the array; preferably, the amplification step comprises PCR; (vi) before the sequence analysis, the method further comprises a step of purifying the released nucleic acid molecule; (vii) before step (4), the method further comprises a step of washing the array to remove a residue of the sample (e.g., tissue); (viii) in step (4), the nucleic acid molecule is released from the surface of the array by the following method: (i) nucleic acid cleavage; (ii) denaturation; and/or (iii) physical method.

56. The method according to claim 40, which is characterized by one or more of the following: (i) in step (1), the multiple copies of the carrier sequence is a DNB formed by a concatemer of the carrier sequence, or the multiple copies of the carrier sequence is a DNA cluster formed by a clone population of the carrier sequence; (ii) in step (5), the sequence analysis comprises sequencing or a sequence-specific PCR reaction; (iii) the method further comprises step (6): correlating the sequence analysis information obtained in step (5) to an image of the sample, wherein the sample is imaged before or after step (3); preferably, the imaging of the sample uses light, bright field, dark field, phase contrast, fluorescence, reflection, interference, confocal microscopy or a combination thereof; (iv) before or after the nucleic acid molecule labeled with spatial information tag is released from the surface of the array, the complementary strand is generated; preferably, the synthesis of the complementary strand uses a random primer and a strand displacement polymerase; (v) before the sequence analysis, the method further comprises a step of amplifying the nucleic acid molecule labeled with the spatial information tag; preferably, the amplification step is performed after the nucleic acid molecule labeled with the spatial information tag is released from the array, or the amplification step is performed in situ on the array; preferably, the amplification step comprises PCR; (vi) before the sequence analysis, the method further comprises a step of purifying the released nucleic acid molecule; (vii) before step (4), the method further comprises a step of washing the array to remove a residue of the sample (e.g., tissue); (viii) in step (4), the nucleic acid molecule is released from the surface of the array by the following method: (i) nucleic acid cleavage; (ii) denaturation; and/or (iii) physical method.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0324] FIG. 1 shows a schematic diagram of cDNA synthesis after capturing mRNA in Example 2.

[0325] FIG. 2 shows a schematic diagram of the molecule released from the chip in Example 2.

[0326] FIG. 3 shows the results of the 2100 detection of cDNA fragment distribution in Example 2.

[0327] FIG. 4 shows the matching result of the 25 bp sequence of first strand obtained by cDNA sequencing in Example 3 and the fq of the positioning sequence on the capture chip.

[0328] FIG. 5 shows a graph of the expression of mRNA in the tissue section in Example 3.

[0329] FIG. 6 shows a schematic diagram of the probe primer and the carrier sequence contained in the DNB of an exemplary embodiment in Example 4.

[0330] FIG. 7 shows a schematic diagram of the probe ligated to the chip in Example 4.

[0331] FIG. 8 shows a schematic diagram of cDNA synthesis of the captured nucleic acid molecule in Example 5.

[0332] FIG. 9 shows a schematic diagram of the molecule released from the chip in Example 5.

[0333] FIG. 10 shows the results of the 2100 detection of cDNA fragment distribution in Example 5.

[0334] FIG. 11 shows the matching result of the 20 bp sequence of first strand obtained by cDNA sequencing in Example 6 and the fq of the positioning sequence on the capture chip.

[0335] FIG. 12 shows a graph of the expression of mRNA in the tissue section in Example 6.

EXAMPLES

[0336] The present invention is now described with reference to the following examples which are intended to illustrate the invention rather than limit the invention.

[0337] Unless otherwise specified, the experiments and methods described in the examples were basically performed according to conventional methods well known in the art and described in various references. In addition, for those without specific conditions in the examples, they were carried out in accordance with the conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without the manufacturer's indication were all conventional products that were purchased commercially. Those skilled in the art know that the examples describe the present invention by way of example, and are not intended to limit the scope of protection claimed by the present invention. All publications and other references mentioned in herein are incorporated by reference in their entirety.

Example 1. Preparation of Capture Chip (1)

[0338] 1. The following DNA library sequence was designed and synthesized. The sequence synthesis was performed by Beijing Liuhe BGI.

[0339] 5′-phosphorylated-AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (Linker A, SEQ ID NO: 1) NNNNNNNNNNNNNNNNNNNNNNNNNNN (complement of positioning sequence, N represented any base, such as C, G, A or T) CTGATAAGGTCGCCA (complement of second immobilization sequence, SEQ ID NO: 2) CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT (Linker B, SEQ ID NO: 3)-3′. Wherein, Linker A comprised a part of the complement of first immobilization sequence and a circularization site, and Linker B comprised another part of the complement of first immobilization sequence, a cleavage site, and a circularization site.

[0340] 2. In situ amplification of library

[0341] Preparation of DNA nanoball (DNB): 40 ul of the following reaction system was prepared, and 80 fmol of the above DNA library was added, in which the DNB primer has a sequence of GGCCTCCGACTTAAGTCGGATCGT (SEQ ID NO: 4) and synthesized by Beijing Liuhe BGI.

TABLE-US-00001 Final Ingredient Volume (ul) concentration DNA library sequence 80 fmol (X) 10× phi29 buffer (produced by BGI) 4 1× DNB primer sequence, 10 uM 4 1 uM H.sub.2O 32-x

[0342] The above reaction system was placed in a PCR machine for reaction. The reaction conditions were as follows: 95° C. for 3 min, 40° C. for 3 min; after the reaction, it was placed on ice, added with 40 ul of mixed enzyme I and 2 ul of mixed enzyme II required to prepare DNB in DNBSEQ sequencing kit, as well as 1 ul of ATP (100 mM mother liquor, Thermo Fisher), and 0.1 ul of T4 ligase (produced by BGI). After mixing well, the above reaction system was transferred to a PCR machine at 30° C. and reacted for 20 minutes to form DNB. The DNB was loaded on BGISEQ500 sequencing chip according to the method described in the BGISEQ500 SE50 kit.

[0343] 3. Sequencing and decoding of the positioning sequence: According to the instructions of the BGISEQ500 SE50 sequencing kit, the positioning sequence is decoded and sequenced, with a sequencing length of 25 bp. The fq file formed by sequencing was stored for later use.

[0344] 4. Immobilizing capture sequence: the following DNA sequence was synthesized by Beijing Liuhe BGI: 5′-phosphorylated-CTGATAAGGTCGCCA (complement of second immobilization sequence, SEQ ID NO: 5) NNNNNNNNNN(UMI)TTTTTTTTTTTTTTTTTTTVN (capture sequence, SEQ ID NO: 6)-3′, wherein N represented any base (for example, C, G, A, or T). The sequencing chip was taken from the sequencer, the cleavage reagent of Hole 7 of the BGISEQ500 SE50 kit was pumped into the chip (it was ensured that the reagent covered the entire chip and no bubbles were generated). The chip was allowed to stand at 60° C., and reaction was performed for 10 minutes. After the reaction, an appropriate amount of 5×SSC (purchased from Shanghai Shenggong) was pumped into the sequencing chip to replace the previous reagent in the chip. The capture sequence was diluted with 5×SSC to 1 uM, and an appropriate amount of the diluted capture sequence was added to the chip, so that the chip was filled with the capture sequence. The chip was allowed to stand for about 30 minutes at room temperature so that the capture sequence fully hybridized with the DNB.

[0345] 5. Chip dicing: The prepared chip was cut into several small slices, in which the size of the slices was adjusted according to the needs of the experiment, and the chip was immersed in 50 mM tris buffer with pH8.0, and stored at 4° C. for later use.

Example 2. Capture of Tissue mRNA and cDNA Synthesis

[0346] 1. Frozen tissue section. The cerebellar tissue sections of mice were made according to the standard procedure of frozen section.

[0347] 2. mRNA capture. According to the size of the tissue section, the chip with suitable size prepared in Example 1 was taken and placed at room temperature. After the liquid on the chip was evaporated, the tissue section was attached to the capture chip by virtue of the temperature difference between the tissue section and the chip in the tissue chopper. The attached tissue section was placed at room temperature, 5×SSC reaction solution was added to the chip (and fully covered the region to which the tissue attached), and reaction was performed at 30° C. for 30 minutes to allow the mRNA in the tissue to fully hybridize with the capture region on the chip.

[0348] 3. cDNA synthesis. 5×SSC was used to wash the chip twice at room temperature, 200 ul of the following reverse transcriptase reaction system was prepared, the reaction solution was added to the chip to fully cover it, reaction was performed at 42° C. for 90 min to 180 min. The mRNA would use polyT as primer to perform cDNA synthesis, the 3′ end of mRNA carried TSO tag (AAGTCGGAGGCCAAGCGGTC/rG//rG//iXNA_G/) (SEQ ID NO: 7) for the synthesis of cDNA complementary strand. The structure diagram of the above process was shown in FIG. 1.

TABLE-US-00002 Final Ingredient Volume (ul) concentration Superscript II First strand buffer 40 1× (5×), Thermo Fisher Betaine (5M), Aladdin 40 1M dNTP (10 mM), Thermo Fisher 20 1 mM MgCl.sub.2 (100 mM), Aladdin 15 7.5 mM TSO sequence (50 uM), synthesized 10 1 uM by Beijing Liuhe BGI Superscript II RT (200 U/ul), 10 10 U/ul Thermo Fisher DTT(100 mM) 10 5 mM RNase inhibitor (40 U/ul), 5 1 u/ul Thermo Fisher Nucleic acid-free molecular water 50 (NF H.sub.2O)

[0349] 4. Ligating spatial positioning region to capture region. After cDNA synthesis, the chip was washed twice with 5×SSC. 1 ml of the following reaction system was prepared, an appropriate volume thereof was pumped into the chip to ensure that the chip was filled with the following ligation reaction solution, and the nick shown in FIG. 1 was ligated. Reaction was performed at room temperature for 30 minutes. After the reaction, the chip was washed with 5×SSC at a temperature of 55° C. for 3 times, 5 min for each time.

TABLE-US-00003 Ingredient Volume (ul) Concentration 10× T4 ligase buffer (produced by BGI) 100 1× T4 ligase (600 U/ul, produced by BGI) 100 60 u/ul Glycerin (Aladdin) 10 10% H.sub.2O 790

[0350] 5. cDNA release. After first strand of cDNA was synthesized on the chip, an appropriate amount of formamide solution was added to the chip and reacted at 55° C. for 10 minutes to release the cDNA strand from the chip. The released molecule had the structure shown in FIG. 2. The reaction solution released from the chip was collected, 2×XP magnetic beads were used to purify the cDNA strand, and finally 45 ul of TE buffer (Thermo Fisher) was used to recover the product. The qubit ssDNA detection kit was used to quantitatively detect single-stranded cDNA.

[0351] 6. cDNA amplification. 100 ul of the following reaction system was prepared:

TABLE-US-00004 Ingredient Volume (ul) Concentration recovery product of cDNA first strand 42 Rolling circle amplification primer  8 0.8 uM AAGTCGGAGGCCAAGCGGTC (with 5′-phosphorylation, SEQ ID NO: 8, 10 uM) (Beijing Liuhe BGI) 2x HiFi (produced by BGI) 50 1x

[0352] The above reaction system was placed in the PCR machine, and the following reaction program was set: 95° C. for 3 min, 11 cycles (98° C. for 20 s, 58° C. for 20 s, 72° C. for 3 min), 72° C. for 5 min, 4° C. for ∞. After the reaction was completed, XP beads were used to purify and recover. The qubit kit was used to quantify the concentration of dsDNA, and the 2100 was used to detect the distribution of cDNA fragments. The 2100 detection results were shown in FIG. 3. The cDNA length was normal.

Example 3. Construction and Sequencing of cDNA Library

[0353] 1. Tn5 interruption. According to the cDNA concentration, 20 ng of cDNA was added with 0.5 uM of Tn5 enzyme and corresponding buffer (the coating method for Tn5 enzyme was performed according to stLFR library construction kit), and mixed well to form 20 ul of reaction system. The reaction was performed at 55° C. for 10 min, 5 ul of 0.1% SDS was added and mixed well at room temperature for 5 minutes to end the Tn5 interruption step.

[0354] 2. PCR amplification. 100 ul of the following reaction system was prepared:

TABLE-US-00005 Ingredient Volume (ul) Concentration Product after Tn5 interruption 25 2x Hifi ready mix (produced by BGI) 50 0.8 uM Primer AAGTCGGAGGCCAAGCGGTC  4 0.4 uM (5-phosphorylation modification, SEQ ID NO: 9, 10 uM) (Beijing Liuhe BGI) Primer GAGACGTTCTCGACTCAGAAGATG (SEQ ID  4 0.4 uM NO: 10) (synthesized by Beijing Liuhe BGI) NF H.sub.2O 17

[0355] After mixing, it was placed in PCR machine, the following program was set: 95° C. 3 min, 11 cycles (98° C. for 20 s, 58° C. for 20 s, 72° C. for 3 min), 72° C. for 5 min, 4° C. for ∞. After the reaction was completed, XP beads were used to purify and recover. The qubit kit was used to quantify dsDNA concentration.

[0356] 3. Sequencing. 80 fmol of the amplified product after the above interruption was taken to prepare DNB. 40 ul of the following reaction system was prepared:

TABLE-US-00006 Ingredient Volume (ul) Final concentration Amplification product after the above 80 fmol (X) interruption 10x phi29 buffer (produced by BGI)  4 1X DNB primer sequence 10 uM  4 1 uM (GGCCTCCGACTTGAGACGTTCTCG, SEQ ID NO: 11) (synthesized by Beijing Liuhe BGI) H.sub.2O 32-x

[0357] The above reaction system was placed in the PCR machine for reaction, and the reaction conditions were as follows: 95° C. for 3 min, 40° C. for 3 min. After the reaction was completed, it was placed on ice, added with 40 ul of mixed enzyme I and 2 ul of mixed enzyme II required to prepare DNB in DNBSEQ sequencing kit, as well as 1 ul of ATP (100 mM mother liquor, Thermo Fisher), 0.1 ul of T4 ligase (produced by BGI). After mixing well, the above reaction system was transferred to PCR machine at 30° C. and reacted for 20 minutes to form DNB. The DNB was loaded on the sequencing chip of MGISEQ2000 according to the method described in the PESO kit of MGISEQ2000, and the sequencing was performed according to the relevant instructions with the PESO sequencing model, wherein the sequencing of first strand was divided into two stages, i.e., sequencing 25 bp and then performing 15 cycles of dark reaction, then sequencing 10 bp UMI sequence, and 50 bp was sequenced for second strand.

[0358] Data Analysis

[0359] 1. The 25 bp sequence of first strand obtained by cDNA sequencing was matched with the fq of the positioning sequence on the capture chip (the sequencing result obtained in step 3 in Example 1) by alignment. The matching result was shown in FIG. 4, in which the bright area represented the region where the 25 bp of cDNA sequencing exactly matched the capture chip, and this region represented the region on the capture chip for tissue capture. It showed that the capture chip could use the spatial positioning region to accurately locate the tissue capture region.

[0360] 2. The DNB matched to the capture chip by the cDNA sequencing was further analyzed, and the alignment analysis between the second strand sequencing result of cDNA (mRNA expression in reaction tissue) of these DNB reads and mouse genome was performed. For the DNB aligned to mouse genome, the mouse mRNA information was aligned to the capture chip through the 25 bp sequencing result. As shown in FIG. 5, the left side showed the full overall picture of the mRNA expression in the analyzed tissue section, the overall picture showed that this capture chip could analyze the mRNA expression differences in tissues; the right side of this figure showed the tissue expression level of a randomly selected gene expressed in mouse cerebellum, which indicated that this chip could analyze the expression differences of a certain gene in the whole tissue.

Example 4. Preparation of Capture Chip (2)

[0361] 1. The following DNA library sequence was designed and synthesized. The sequence synthesis was performed by Beijing Liuhe BGI.

[0362] 5′-phosphorylated-GAACGACATGGCTTTTTCCCGTAGCCATGTCGTTCTGCGCCTTC CCGATG (immobilization sequence 1, SEQ ID NO: 12) NNNNNNNNNNNNNNNNNNNNNN (positioning sequence template, N represented any base, for example, C, G, A or T) IIIIIIIIII (UMI template, I represented Inosine) TTTTTTTTTTTTTTTTTTTTT (capture sequence, SEQ ID NO: 13) CCTCAGC (cleavage site, SEQ ID NO: 14) CCTTGGCTCACA (immobilization sequence 2, SEQ ID NO: 15). Wherein, the immobilization sequence 1 comprised a partial sequence of the complement of first immobilization sequence and a circularization site, and the immobilization sequence 2 comprised a partial sequence of the complement of first immobilization sequence and a circularization site.

[0363] 2. In Situ Amplification of Library

[0364] Preparation of DNA nanoball (DNB): 40 ul of the following reaction system was prepared, 80 fmol of the above-mentioned DNA library was added, the DNB primer has a sequence of GACATGGCTACGTGTGAGCCAAGG (SEQ ID NO: 16), which was synthesized by Beijing Liuhe BGI.

TABLE-US-00007 Final Ingredient Volume (ul) concentration DNA library sequence 80 fmol (x) 10× phi29 buffer (produced by BGI) 4 1× DNB primer sequence, 10 uM 4 1 uM H.sub.2O 32-x

[0365] The above reaction system was placed in a PCR machine for reaction, and the reaction conditions were as follows: 95° C. for 3 min, 40° C. for 3 min; after the reaction, it was placed on ice, added with 40 ul of mixed enzyme I and 2 ul of mixed enzyme II required to prepare DNB in DNBSEQ sequencing kit, and 1 ul of ATP (100 mM mother liquor, Thermo Fisher), 0.1 ul of T4 ligase (produced by BGI). After mixing well, the above reaction system was transferred to a PCR machine at 30° C. and reacted for 20 minutes to form DNB. The DNB was loaded on the BGISEQ500 sequencing chip according to the method described in the BGISEQ500 SE50 kit.

[0366] 3. Decoding of spatial information

[0367] (1) Surface modification of chip:

[0368] The surface of the above BGISEQ-500 platform chip was allowed to contact with Azido-dPEG®8-NHS ester that had a structure as follows:

##STR00004##

[0369] The chip surface modification was carried out according to the following method: NHS-PEG8-Azido (564.58 g/mol) concentration was 45 μM, and 100 ml was prepared by the method:

TABLE-US-00008 Reagent Dosage Unit NHS-PEG8-Azido 2.54 mg 1× PBS (pH 7.4) 100 ml

[0370] Stored at −20° C., avoided repeated freezing and thawing.

[0371] DBCO-primer had a concentration of 1 uM, and diluted with PBS.

[0372] (2) Coupling of primer probe:

[0373] The following primer probe sequences were synthesized by Beijing Liuhe BGI:

[0374] DBCO (linking group)-UUU (USER cleavage site) TTTTTCCCGTAGCCATGTCGTTCT GCGCCTTCCCGATG (SEQ ID NO: 17, this sequence comprised a complement of first immobilization sequence, a PCR amplification site sequence, an intermediate sequence). 1 uM of the above primer probe was diluted with PBS and introduced to the chip modified with azido, and reacted at room temperature for 1 hour or overnight.

[0375] (3) Decoding of spatial information. According to the instructions of the BGISEQ500 SE50 sequencing kit, the spatial information sequence was decoded and sequenced with a sequencing length of 30 bp (the first 20 bp was spatial information sequence, and the last 10 bp was probe tag sequence). The fq file formed by sequencing was stored for later use.

[0376] (4) Synthesis of capture region:

[0377] A mixed solution of dTTP and Hifi polymerase was prepared, DNB was used as a template, a probe sequence comprising a spatial positioning region was used as a primer, and dTTP was used as a substrate, to extend an oligo dT sequence.

[0378] 4. Release of probe comprising spatial information

[0379] 1 uM of Spatial_RNA_BbvCI primer (diluted with 5×SSC) was prepared, the primer sequence CCTCAGCCAACTCCT (SEQ ID NO: 18) was synthesized by Beijing Liuhe BGI. hybridization was performed at room temperature for 30 minutes. BbvCI excision system (1.5 ml) was prepared: 15 ul RE+150 ul 10×CS Buffer+1335 ul ddH.sub.2O, and introduced to the chip after the spatial positioning region was decoded, reaction was performed at 37° C. for 1 h or overnight. Washing was performed twice by adding WB2 of the sequencing kit (MGI), then reaction was performed using formamide at 55° C. for 15 min, followed by washing with WB2 twice. The schematic diagram of the obtained probe was shown in FIG. 7, and the probe sequence was as follows:

[0380] UUU (cleavage region) TTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG (complement of first immobilization sequence, SEQ ID NO: 19) NNNNNNNNNNNNNNNNNNN (complement of positioning sequence, which was the same as the positioning sequence template in the DNA library sequence in step 1) NNNNNNNNNN (UMI sequence, which was a complementary sequence of the random base sequence obtained from the UMI template which is used as a template in step 1) TTTTTTTTTTTTTTTTTTTTT (capture sequence, SEQ ID NO: 20).

[0381] 5. Chip dicing

[0382] The prepared capture chip was cut into several small slices, the size of the slices was adjusted according to the needs of the experiment, and the chip was immersed in 50 mM tris buffer, pH8.0, and stored at 4° C. for later use.

Example 5. Capture of Tissue mRNA and Synthesis of cDNA

[0383] 1. Frozen tissue section. Cerebellar tissue sections of mice were made according to the standard procedure of frozen section.

[0384] 2. Capture of mRNA. According to the size of the tissue section, the chip with suitable size prepared in Example 4 was taken and placed at room temperature. After the liquid on the chip had evaporated, the tissue section was attached to the capture chip by virtue of the temperature difference between the tissue section and the chip in the tissue chopper. The attached tissue section was placed at room temperature, 5×SSC reaction solution was added to the chip (and fully covered the tissue-attached area), and reaction was performed at 30° C. for 30 minutes to allow the mRNA in the tissue to fully hybridize with the capture region on the chip.

[0385] 3. Synthesis of cDNA. 5×SSC was used to wash the chip twice at room temperature, 200 ul of the following reverse transcriptase reaction system was prepared, the reaction solution was added to the chip to fully cover it, reaction was performed at 42° C. for 90 min to 180 min. mRNA would use polyT as primer for cDNA synthesis, and the 3′ end of mRNA carried TSO tag (CGTAGCCATGTCGTTCTGCG/rG//rG//iXNA_G/) (SEQ ID NO: 21) for the synthesis of cDNA complementary strand. The structure diagram of the above process was shown in FIG. 8.

TABLE-US-00009 Final Ingredient Volume (ul) concentration Superscript II First strand buffer 40 1× (5×), Thermo Fisher Betaine (5M), Aladdin 40 1M dNTP (10 mM), Thermo Fisher 20 1 mM MgCl.sub.2 (100 mM), Aladdin 15 7.5 mM TSO sequence (50 uM), synthesized 10 1 uM by Beijing Liuhe BGI Superscript II RT (200 U/ul), 10 10 U/ul Thermo Fisher DTT (100 mM) 10 5 mM RNase inhibitor (40 U/ul), 5 1 u/ul Thermo Fisher NF H.sub.2O 50

[0386] 4. Release of cDNA. After the cDNA first strand was synthesized on the chip, a USER enzyme reaction system was prepared, and the reaction was carried out according to the USER enzyme instruction manual. The released molecule had the structure shown in FIG. 9. The reaction solution released from the chip was collected, 2×XP magnetic beads were used to purify the cDNA first strand, and finally 45 ul of TE buffer (Thermo fisher) was used to recover the product.

[0387] 5. Amplification of cDNA. 100 ul of the following reaction system was prepared:

TABLE-US-00010 Ingredient Volume (ul) Concentration Recovery product of cDNA first strand 42 Primer CGTAGCCATGTCGTTCTGCG (with  8 0.8 uM 5′-phosphorylation, 10 uM, SEQ ID NO: 22) (Beijing Liuhe BGI) 2x HiFi (produced by BGI) 50 1X

[0388] The above reaction system was transferred to PCR machine, and the following reaction program was set: 95° C. for 3 min, 11 cycles (98° C. for 20 s, 58° C. for 20 s, 72° C. for 3 min), 72° C. for 5 min, 4° C. for co. After the reaction was completed, XP beads were used to purify and recover. The qubit kit was used to quantify the concentration of dsDNA, and the 2100 was used to detect the distribution of cDNA fragments. The 2100 test results were shown in FIG. 10, in which the cDNA length was normal.

Example 6. Construction and Sequencing of cDNA Library

[0389] 1. Tn5 interruption. According to the cDNA concentration, 20 ng of cDNA was added with 0.5 uM of Tn5 enzyme and corresponding buffer (the coating method for Tn5 enzyme was performed according to the stLFR library construction kit), and mixed well to form 20 ul of reaction system. The reaction was performed at 55° C. for 10 min, and 5 ul of 0.1% SDS was added and mixed at room temperature for 5 minutes to end the Tn5 interruption step.

[0390] 2. PCR amplification. 100 ul of the following reaction system was prepared:

TABLE-US-00011 Ingredient Volume (ul) Concentration Product after Tn5 interruption 25 2x Hifi ready mix (produced by BGI) 50 0.8 uM Primer CGTAGCCATGTCGTTCTGCG (with  4 0.4 uM 5′-phosphorylation, 10 uM, SEQ ID NO: 23) (Beijing Liuhe BGI) Primer GAGACGTTCTCGACTCAGAAGATG (SEQ ID  4 0.4 uM NO: 24) (synthesized by Beijing Liuhe BGI) NF H.sub.2O 17

[0391] After mixing, it was placed in a PCR machine, the following program was set: 95° C. for 3 min, 11 cycles (98° C. for 20 s, 58° C. for 20 s, 72° C. for 3 min), 72° C. for 5 min, 4° C. for co. After the reaction was completed, XP beads were used to purify and recover. The dsDNA concentration was quantified using the qubit kit.

[0392] 3. Sequencing. 80 fmol of the amplification product after the above interruption was taken to prepare DNB. 40 ul of the following reaction system was prepared:

TABLE-US-00012 Ingredient Volume (ul) Final concentration Amplification product after the above 80 fmol (X) interruption 10x phi29 buffer (produced by BGI)  4 1X DNB primer sequence 10 uM  4 1 uM (CGAGAACGTCTCCGTAGCCATGTC, SEQ ID NO: 25) (synthesized by Beijing Liuhe BGI) H.sub.2O 32-x

[0393] The above reaction system was placed in a PCR machine for reaction, and the reaction conditions were as follows: 95° C. for 3 min, 40° C. for 3 min After the reaction, it was placed on ice, added with 40 ul of mixed enzyme I and 2 ul of mixed enzyme II required to prepare DNB in DNBSEQ sequencing kit, as well as 1 ul of ATP (100 mM mother liquor, Thermo Fisher) and 0.1 ul of T4 ligase (produced by BGI). After mixing well, the above reaction system was transferred to a PCR machine at 30° C. and reacted for 20 minutes to form DNB. The DNB was loaded to the sequencing chip of MGISEQ2000 according to the method described in the PESO kit of MGISEQ2000, and the sequencing was performed according to the relevant instructions with the customer sequencing mode, wherein the sequencing of first strand was divided into two stages, i.e., sequencing 20 bp and then sequencing 10 bp probe tag sequence, and 50 bp was sequenced for second strand.

[0394] Data Analysis

[0395] 1. The 20 bp sequence of first strand obtained by cDNA sequencing was matched with the fq of spatial information sequence on the chip (the sequencing result obtained in step 3 in Example 4) by alignment. The matching result was shown in FIG. 11, in which the bright area represented the region where the 20 bp of cDNA sequencing exactly matched the capture chip, and this region represented the region on the capture chip for tissue capture. It showed that the capture chip could use the spatial positioning region to accurately locate the tissue capture region.

[0396] 2. The DNB matched the capture chip by cDNA sequencing was further analyzed, and the alignment analysis between the second strand sequencing results of cDNA (mRNA expression in reaction tissue) of these DNB reads and mouse genome was performed. For the DNB aligned to the mouse genome, the mouse mRNA information was aligned to the capture chip through the 20 bp sequencing result. As shown in FIG. 12, the left side showed the overall picture of the mRNA expression in the analyzed tissue section, and the overall picture showed that this capture chip could analyze mRNA expression differences in tissues; the right side of this figure showed the tissue expression level of a randomly selected gene expressed in mouse cerebellum, which indicated that this chip could analyze the expression differences of a certain gene in the whole tissue.

[0397] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details according to all the teachings that have been published, and these changes are within the protection scope of the present invention. All of the present invention is given by the appended claims and any equivalents thereof.