ENGINEERED NUCLEIC ACIDS AND USES THEREOF
20230174982 · 2023-06-08
Inventors
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to engineered nucleic acids that target CAG repeat sequences or viral polynucleotides. The present disclosure also relates to the uses of the engineered nucleic acids for treating polyglutamine diseases or a viral infection.
Claims
1. An engineered nucleic acid, comprising: a first binding arm, a catalytic core domain, and a second binding arm, wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm are complementary to a CAG repeat sequence.
2. The engineered nucleic acid of claim 1, wherein the catalytic core domain comprises a sequence at least 80% identical to SEQ ID NO: 287.
3. (canceled)
4. The engineered nucleic acid of claim 1, wherein the first binding arm and the second binding arm comprise at least 3 nucleotides.
5. The engineered nucleic acid of claim 4, wherein the first and the second binding arms comprise 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides.
6. (canceled)
7. (canceled)
8. The engineered nucleic acid of claim 1, wherein the first binding arm and the second binding arm comprise a sequence at least 80% identical to SEQ ID NOs: 265-286.
9. The engineered nucleic acid of claim 1, wherein at least one nucleotide of the engineered nucleic acid is a chemically modified ribose.
10. The engineered nucleic acid of claim 1, wherein at least one nucleotide at the 5′-terminus and at least one nucleotide at the 3′-termius of the engineered nucleic acid are chemically modified.
11. The engineered nucleic acid of claim 9,wherein the chemically modified ribose is a locked nucleic acid (LNA) or a peptide nucleic acid (PNA).
12. The engineered nucleic acid of claim 1, wherein the engineered nucleic acid comprises a sequence at least 80% identical to SEQ ID NOs: 121-132.
13. A method of treating a polyglutamine disease in subject in need thereof comprising administering to the subject in need thereof a therapeutically effective amount of the engineered nucleic acid of claim 1.
14. The method of claim 13, wherein the engineered nucleic acid decreases a level of a polyglutamine disease-related polynucleotide.
15. The method of claim 14, wherein the polyglutamine disease-related polynucleotide comprises an increased level of CAG repeat sequence as compared to a reference control.
16. The method of claim 14 , wherein the polyglutamine disease-related polynucleotide is selected from a huntingtin (HTT) polynucleotide, an ATXN1 polynucleotide, an ATXN2 polynucleotide, an ATXN7 polynucleotide, a TATA binding protein-coding polynucleotide, an androgen receptor (AR) polynucleotide, and an atrophin 1 (ATN1) polynucleotide.
17. The method of claim 14, wherein the polyglutamine disease is selected from Huntington’s disease (HD), spinocerebellar ataxias (SCA) type 1, SCA type 2, SCA type 3, SCA type 6, SCA type 7, SCA type 17, Dentatorubral-pallidoluysian atrophy (DRPLA), and spinobulbar muscular atrophy (SBMA).
18. An engineered nucleic acid, comprising: a first binding arm, a catalytic core domain, and a second binding arm, wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm are complementary to a SARS-CoV-2 polynucleotide.
19-24. (canceled)
25. The engineered nucleic acid of claim claim 18, wherein the first binding arm and the second binding arm comprise a sequence at least 80% identical to SEQ ID NOs: 203-264.
26-28. (canceled)
29. The engineered nucleic acid of claim 18, wherein the engineered nucleic acid comprises a sequence at least 80% identical to SEQ ID NOs: 172-202.
30. A method of treating a SARS-CoV-2 infection in a subject in need thereof, comprising administering to the subject in need thereof a therapeutically effective amount of the engineered nucleic acid of claim 18.
31. The method of claim 30, wherein the engineered nucleic acid decreases a level of a SARS-CoV-2 polynucleotide.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.
[0029]
TABLE-US-00001 *T*G*C*T*G*C*T*G*T*C*C*G*A*G*C*C*G*G*A*C*G*A*G*C*T *G*C*T*G*C*T (SEQ ID NO: 131).
The T.Math.G mismatch is indicated.
TABLE-US-00002 CTGCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTGCTG (SEQ ID NO : 129),
TABLE-US-00003 CAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 288),
TABLE-US-00004 +T+G+C+T+GCTGTCCGAGCCGGACGAGCTG+C+T+G+C+T (SEQ ID NO: 130),
TABLE-US-00005 AGCAGCAGCAGCAGCAGCA (SEQ ID NO: 289),
TABLE-US-00006 *T*G*C*T*G*C*T*G*T*C*C*G*A*G*C*C*G*G*A*C*G*A*G*C*T *G*C*T*G*C*T (SEQ ID NO: 131).
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
TABLE-US-00007 AGTTTTTCTCATGGTGTATTTATTCTTTTAAGTTTTGTTTTTTAAATATA CTTCACTTTTGAATGTTTCAGACAGCAGCAAAAGCAGCAACAGCAGCAGC AGCAGCAGCAGCAGGGGGACATATCAGGACAGAGTTCACATCCATGTGAA (SEQ ID NO: 290).
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
TABLE-US-00008 TCCGAGCCGGACGA (SEQ ID NO: 287).
The sequence for the 10-23 DNAzyme core in
TABLE-US-00009 GGCTAGCTACAACGA (SEQ ID NO: 291).
DETAILED DESCRIPTION
[0053] DNAzymes are DNA molecules that specifically recognize and cleave a polynucleotide in a sequence-specific manner. A major challenge lies in the design of a functional DNAzyme that targets CAG repeats. Further, a DNAzyme that targets highly conserved regions of a polynucleotide of a pathogen (e.g., a virus) is needed. Accordingly, disclosed herein are DNAzyme compositions and methods for cleaving nucleic acids and treating polyglutamine diseases and viral diseases.
[0054] Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein.
[0055] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise.
[0056] The following definitions are provided for the full understanding of terms used in this specification.
Terminology
[0057] The term “about” as used herein when referring to a measurable value such as an amount, a percentage, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, or ±1% from the measurable value.
[0058] “Complementary” or “substantially complementary” refers to the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid. Complementary nucleotides are, generally, A and T/U, or C and G. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98% to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary. See Kanehisa (1984) Nucl. Acids Res. 12:203.
[0059] The term “DNAzyme” as used herein means a DNA molecule that specifically recognizes and cleaves a polynucleotide in a sequence-specific manner. A DNAzyme normally contains a catalytic core that is responsible for catalysis and two substrate-binding arms of variable length and sequence. The substrate-binding arms bind the target polynucleotide in a sequence-specific manner. It will be appreciated by those skilled in the art, however, that strict complementarity may not be required for the DNAzyme to bind to and cleave the target nucleic acid.
[0060] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom, Thus, a gene encodes a protein if transcription and translation of mRNA.
[0061] The term “gene” or “gene sequence” refers to the coding sequence or control sequence, or fragments thereof. A gene may include any combination of coding sequence and control sequence, or fragments thereof. Thus, a “gene” as referred to herein may be all or part of a native gene. A polynucleotide sequence as referred to herein may be used interchangeably with the term “gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term “gene” or “gene sequence” includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site.
[0062] The “fragments,” whether attached to other sequences or not, can include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified peptide or protein. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc.
[0063] As used herein, the terms “may,” “optionally,” and “may optionally” are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation “may include an excipient” is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.
[0064] The term “promoter” or “regulatory element” refers to a region or sequence determinants located upstream or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. Promoters need not be of bacterial origin, for example, promoters derived from viruses or from other organisms can be used in the compositions, systems, or methods described herein. The term “regulatory element” is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). A tissue-specific promoter may direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs, or particular cell types (e.g. lymphocytes). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g. 1, 2, 3, 4, 5, or more pol I promoters), one or more pol II promoters (e.g. 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and H1 promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter. Also encompassed by the term “regulatory element” are enhancer elements, such as WPRE; CMV enhancers; the R-U5′ segment in LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31, 1981). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc.
[0065] The term “recombinant” refers to a human manipulated nucleic acid (e.g. polynucleotide) or a copy or complement of a human manipulated nucleic acid (e.g. polynucleotide), or if in reference to a protein (i.e, a “recombinant protein”), a protein encoded by a recombinant nucleic acid (e.g. polynucleotide). In embodiments, a recombinant expression cassette comprising a promoter operably linked to a second nucleic acid (e.g. polynucleotide) may include a promoter that is heterologous to the second nucleic acid (e.g. polynucleotide) as the result of human manipulation (e.g., by methods described in Sambrook et al., Molecular Cloning—A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). In another example, a recombinant expression cassette may comprise nucleic acids (e.g. polynucleotides) combined in such a way that the nucleic acids (e.g. polynucleotides) are extremely unlikely to be found in nature. For instance, human manipulated restriction sites or plasmid vector sequences may flank or separate the promoter from the second nucleic acid (e.g. polynucleotide). One of skill will recognize that nucleic acids (e.g. polynucleotides) can be manipulated in many ways and are not limited to the examples above.
[0066] The term “expression cassette” or “vector” refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of a RNA or polypeptide, respectively. In embodiments, an expression cassette comprising a promoter operably linked to a second nucleic acid (e.g. polynucleotide) may include a promoter that is heterologous to the second nucleic acid (e.g. polynucleotide) as the result of human manipulation (e.g., by methods described in Sambrook et al., Molecular Cloning—A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). In some embodiments, an expression cassette comprising a terminator (or termination sequence) operably linked to a second nucleic acid (e.g. polynucleotide) may include a terminator that is heterologous to the second nucleic acid (e.g. polynucleotide) as the result of human manipulation. In some embodiments, the expression cassette comprises a promoter operably linked to a second nucleic acid (e.g. polynucleotide) and a terminator operably linked to the second nucleic acid (e.g. polynucleotide) as the result of human manipulation. In some embodiments, the expression cassette comprises an endogenous promoter. In some embodiments, the expression cassette comprises an endogenous terminator. In some embodiments, the expression cassette comprises a synthetic (or non-natural) promoter. In some embodiments, the expression cassette comprises a synthetic (or non-natural) terminator.
[0067] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,94%, 95%, 96%, 97%, 98%, 99% or higher identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site or the like). Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 10 amino acids or 20 nucleotides in length, or more preferably over a region that is 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) amino acid sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to the amino acids in a reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared can be determined by known methods.
[0068] For sequence comparisons, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0069] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990) J. Mol. Biol. 215:403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0070] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01.
[0071] The phrase “codon optimized” as it refers to genes or coding regions of nucleic acid molecules for the transformation of various hosts, refers to the alteration of codons in the gene or coding regions of polynucleic acid molecules to reflect the typical codon usage of a selected organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that selected organism.
[0072] Nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, “operably linked” means that the DNA sequences being linked are near each other, and, in the case of a secretory leader, contiguous and in reading phase. However, operably linked nucleic acids (e.g. enhancers and coding sequences) do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. In embodiments, a promoter is operably linked with a coding sequence when it is capable of affecting (e.g. modulating relative to the absence of the promoter) the expression of a protein from that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
[0073] The term “nucleobase” refers to the part of a nucleotide that bears the Watson/Crick base-pairing functionality. The most common naturally-occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T) bear the hydrogen-bonding functionality that binds one nucleic acid strand to another in a sequence specific manner.
[0074] As used throughout, by a “subject” (or a “host”) is meant an individual. Thus, the “subject” can include, for example, domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) mammals, non-human mammals, primates, non-human primates, rodents, birds, reptiles, amphibians, fish, and any other animal. The subject can be a mammal such as a primate or a human. Administration of the therapeutic agents can be carried out at dosages and for periods of time effective for treatment of a subject.
[0075] “Therapeutically effective amount” or “therapeutically effective dose” of a composition refers to an amount that is effective to achieve a desired therapeutic result. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and/or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.
[0076] As used herein, the terms “treating” or “treatment” of a subject includes the administration of a drug to a subject with the purpose of curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, stabilizing or affecting a disease or disorder, or a symptom of a disease or disorder. The terms “treating” and “treatment” can also refer to reduction in severity and/or frequency of symptoms, elimination of symptoms and/or underlying cause, and improvement or remediation of damage.
[0077] As used herein, the term “preventing” a disease, a disorder, or unwanted physiological event in a subject refers to the prevention of a disease, a disorder, or unwanted physiological event or prevention of a symptom of a disease, a disorder, or unwanted physiological event.
[0078] “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
[0079] “Pharmaceutically acceptable” component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.
[0080] “Pharmaceutically acceptable carrier” (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and/or human pharmaceutical or therapeutic use. The terms “carrier” or “pharmaceutically acceptable carrier” can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil/water or water/oil emulsion) and/or various types of wetting agents. As used herein, the term “carrier” encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.
[0081] “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “therapeutic agent” is used, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.
[0082] “Administration” to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, or via a transdermal patch, and the like. Administration includes self-administration and the administration by another.
[0083] The phrases “concurrent administration”, “administration in combination”, “simultaneous administration” or “administered simultaneously” as used herein, means that the compounds are administered at the same point in time or immediately following one another.
[0084] The term “biocompatible” generally refers to a material and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant adverse effects to the subject
[0085] The term “polypeptide” refers to a compound made up of a single chain of D- or L-amino acids or a mixture of D- and L-amino acids joined by peptide bonds.
[0086] The term “nucleic acid” as used herein means a polymer composed of nucleotides, e.g. deoxyribonucleotides or ribonucleotides.
[0087] The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides.
[0088] The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides.
[0089] The term “polynucleotide” refers to a single or double stranded polymer composed of nucleotide monomers.
Engineered Nucleic Acids
[0090] Disclosed herein are engineered nucleic acids that target CAG repeat sequences or viral polynucleotides.
[0091] In some aspects, disclosed herein is an engineered nucleic acid comprising: [0092] a first binding arm, [0093] a catalytic core domain, and [0094] a second binding arm, [0095] wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm target a CAG repeat sequence.
[0096] The term “CAG repeat sequence” refers to a polynucleotide sequence comprising at least 3 continuous repeats of CAG (including, for example, at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 repeats of CAG.
[0097] In some embodiments, the catalytic core domain is an 8-17 catalytic core. In some embodiments, the catalytic core domain comprises a sequence at least about 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 287. In some embodiments, the catalytic core domain comprises the sequence SEQ ID NO: 287.
[0098] In some embodiments, the catalytic core domain is a 10-23 catalytic core. In some embodiments, the catalytic core domain comprises a sequence at least about 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 291. In some embodiments, the catalytic core domain comprises the sequence SEQ ID NO: 291.
[0099] In some embodiments, the first binding arm and the second binding arm comprise at least 3 nucleotides (for example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides). In some embodiments, the first and the second binding arms comprise 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides. In some embodiments, the first binding arm and the second binding arm comprise 9 nucleotides.
[0100] The first binding arm and the second binding arm of the engineered nucleic acid can target the CAG repeat sequence. In some embodiments, the first binding arm and the second binding arm of the engineered nucleic acid is at least about at least about 90% (for example, at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to the CAG repeat sequence.
[0101] In some embodiments, the first binding arm and the second binding arm comprise a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 265-286. In some embodiments, the first binding arm and the second binding arm comprise the sequence selected from SEQ ID NO: 265-286.
[0102] In some embodiments, the first binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, or 285. In some embodiments, the first binding arm comprises the sequence selected from SEQ ID NOs: 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, and 285.
[0103] In some embodiments, the second binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, or 286. In some embodiments, the second binding arm comprises the sequence selected from SEQ ID NOs: 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, and 286.
[0104] Also disclosed herein is an engineered nucleic acid comprising: [0105] a first binding arm, [0106] a catalytic core domain, and [0107] a second binding arm, [0108] wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm target a viral polynucleotide.
[0109] In some embodiments, the first binding arm and the second binding arm are complementary to a viral polynucleotide. The viral polynucleotide can be a polynucleotide of a virus selected from the group consisting of Herpes Simplex virus-1, Herpes Simplex virus-2, Varicella-Zoster virus, Epstein-Barr virus, Cytomegalovirus, Human Herpes virus-6, Variola virus, Vesicular stomatitis virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Rhinovirus, Coronavirus (including, but not limited to avian coronavirus (IBV), porcine coronavirus HKU15 (PorCoV HKU15), Porcine epidemic diarrhea virus (PEDV), HCoV-229E, HCoV-OC43, HCoV-HKU1, HCoV-NL63, SARS-CoV, SARS-CoV-2, or MERS-CoV), Influenza virus A, Influenza virus B, Measles virus, Polyomavirus, Human Papilomavirus, Respiratory syncytial virus, Adenovirus, Coxsackie virus, Dengue virus, Mumps virus, Poliovirus, Rabies virus, Rous sarcoma virus, Reovirus, Yellow fever virus, Zika virus, Ebola virus, Marburg virus, Lassa fever virus, Eastern Equine Encephalitis virus, Japanese Encephalitis virus, St. Louis Encephalitis virus, Murray Valley fever virus, West Nile virus, Rift Valley fever virus, Rotavirus A, Rotavirus B, Rotavirus C, Sindbis virus, Simian Immunodeficiency virus, Human T-cell Leukemia virus type-1, Hantavirus, Rubella virus, Simian Immunodeficiency virus, Human Immunodeficiency virus type-1, and Human Immunodeficiency virus type-2.
[0110] In some embodiments, the viral polynucleotide is a coronavirus polynucleotide. In some embodiments, the viral polynucleotide is a SARS-CoV-2 polynucleotide (e.g., an RNA).
[0111] In some examples, the first binding arm and the second binding arm of the engineered nucleic acid disclosed herein can target a conserved region of a SARS-CoV-2 polynucleotide. In some embodiments, the first binding arm and the second binding arm of the engineered nucleic acid is at least about at least about 90% (for example, at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to the SARS-CoV-2 polynucleotide. In some embodiments, the SARS-CoV-2 polynucleotide is selected from SEQ ID NOs: 141-171.
[0112] In some embodiments, the first binding arm and the second binding arm comprise a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 203-264. In some embodiments, the first binding arm and the second binding arm comprise the sequence selected from SEQ ID NOs: 203-264.
[0113] In some embodiments, the first binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 203-233. In some embodiments, the first binding arm comprises the sequence selected from SEQ ID NOs: 203-233.
[0114] In some embodiments, the second binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 234-264. In some embodiments, the second binding arm comprises the sequence selected from SEQ ID NOs: 234-264.
[0115] In some embodiments, at least one nucleotide of the engineered nucleic acid is a chemically modified ribose. In some embodiments, at least one nucleotide at the 5′-terminus and at least one nucleotide at the 3′-termius of the engineered nucleic acid are chemically modified. In one embodiment, the chemically modified ribose is selected from 2′-O-methyl (2′-O-Me), 2′-Fluoro (2′-F), 2′-deoxy-2′-fluoro-beta-D-arabino-nucleic acid (2′F-ANA), 4′-S, 4′-SFANA, 2′-azido, UNA, 2′-O-methoxy-ethyl (2′-O-ME), 2′-O-Allyl, 2′-O-Ethylamine, 2′-O-Cyanoethyl, locked nucleic acid (LAN), peptide nucleic acid (PNA), Methylene-cLAN, N-MeO-amino BNA, or N-MeO-aminooxy BNA. In one embodiment, the chemically modified ribose is a locked nucleic acid (LAN). In one embodiment, a peptide nucleic acid (PNA).
[0116] The structures of these modified riboses are shown below:
##STR00001##
##STR00002##
2′-O-methyl (2′-O-Me)
##STR00003##
2′-Fluoro (2′-F)
##STR00004##
2′-deoxy-2′-fluoro-beta-D-arabino-nucleic acid (2′F-ANA)
##STR00005##
4′-S
##STR00006##
4′-SFANA
##STR00007##
2′-azido
##STR00008##
UNA
##STR00009##
2′-O-methoxy-ethyl (2′-O-ME)
##STR00010##
2′-O-Allyl
##STR00011##
2′-O-Ethylamine
##STR00012##
2′-O-Ethylamine
##STR00013##
Locked nucleic acid (LAN)
##STR00014##
Methylene-cLAN
##STR00015##
N-MeO-amino BNA
##STR00016##
N-MeO-aminooxyBNA
[0117] In one embodiment, the at least one chemically modified nucleotide is a chemically modified phosphodiester linkage.
[0118] In one embodiment, the chemically modified phosphodiester linkage is selected from phosphorothioate (PS), boranophosphate, phosphodithioate (PS2), 3′,5′-amide, N3′-phosphoramidate (NP), Phosphodiester (PO), or 2′,5′-phosphodiester (2′,5′-PO). In one embodiment, the chemically modified phosphodiester linkage is phosphorothioate.
[0119] The structures of these modified phosphodiester linkages are shown below:
##STR00017##
##STR00018##
Phosphorothioate (PS)
##STR00019##
Boranophosphate
##STR00020##
Phosphodithioate(PS2)
##STR00021##
3′, 5′ -amide
##STR00022##
N3′-phosphoramidate (NP)
##STR00023##
Phosphodiester (PO)
##STR00024##
2′,5′-phosphodiester (2′,5′-PO)
[0120] In some embodiments, the engineered nucleic acid targeting CAG repeat sequence comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 121-132.
[0121] In some embodiments, the engineered nucleic acid targeting SARS-CoV-2 polynucleotide sequence comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 172-202
[0122] The engineered nucleic acid disclosed herein can be any metal-assisted DNAzyme (for example, Pb.sup.2+, Mn.sup.2+, Mg.sup.2+, Zn.sup.2+, or Ca.sup.2+). In some embodiments, the DNAzyme cleaves the target RNA in the presence of Ca.sup.2+. In some embodiments, the DNAzyme cleaves the target RNA in the presence of Mg.sup.2+. In some embodiments, the DNAzyme cleaves the target RNA in the presence of Zn.sup.2+. In some embodiments, the DNAzyme cleaves the target RNA in the presence of Pb.sup.2+. In some embodiments, the DNAzyme cleaves the target RNA in the presence of Mn.sup.2+.
[0123] In some aspects, disclosed herein is a pharmaceutical composition comprising the engineered nucleic acid disclosed herein and a pharmaceutically acceptable carrier.
[0124] In some aspects, disclosed herein is an engineered nucleic acid, comprising: [0125] a first binding arm, [0126] a catalytic core domain, and [0127] a second binding arm, wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm specifically bind to a CAG repeat RNA sequence.
[0128] In some aspects, disclosed herein is an engineered nucleic acid, comprising: [0129] a first binding arm, [0130] a catalytic core domain, and [0131] a second binding arm, wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm specifically bind to a SARS-CoV-2 RNA sequence. Also disclosed herein is a method for cleaving a CAG repeat RNA sequence comprising the step of contacting the CAG repeat RNA sequence with an engineered nucleic acid under conditions suitable for the cleavage of the CAG repeat RNA sequence by the engineered nucleic acid, wherein the engineered nucleic acid comprises: [0132] a first binding arm, [0133] a catalytic core domain, and [0134] a second binding arm, wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm specifically bind to a CAG repeat RNA sequence.
[0135] Further disclosed herein is a method for cleaving a SARS-CoV-2 RNA sequence comprising the step of contacting the SARS-CoV-2 RNA sequence with an engineered nucleic acid under conditions suitable for the cleavage of the SARS-CoV-2 RNA sequence by the engineered nucleic acid, wherein the engineered nucleic acid comprises: [0136] a first binding arm, [0137] a catalytic core domain, and [0138] a second binding arm, wherein the catalytic core domain is in between the first binding arm and the second binding arm, and wherein the first binding arm and the second binding arm specifically bind to a SARS-CoV-2 RNA sequence.
Methods for Treating Polyglutamine Diseases
[0139] The disclosed invention targets CAG repeats on an RNA level rather than a DNA level (as opposed to CRISPR-Cas) and can be much safer without inducing permanent genomic damage. DNAzymes are also more stable than RNA-based therapies and can be further stabilized through chemical modifications.
[0140] Accordingly, also disclosed herein are methods of preventing, inhibiting, reducing, and/or treating a polyglutamine disease in subject in need thereof comprising administering to the subject in need thereof a therapeutically effective amount of the engineered nucleic acid disclosed herein.
[0141] It should be understood herein that the term “polyglutamine disease” refers to a group of neurodegenerative disorders caused by an increased numbers of CAG repeats that encode glutamine. The increased numbers of CAG repeats can occur throughout all genomes, within a gene, within one or more coding regions of a gene, or within an RNA. In some embodiments, the number of the CAG repeats in the subject is at least about 1.5 times (for example, at least about 1.5 times, at least about 1.6 times, at least about 1.7 times, at least about 1.8 times, at least about 2 times, at least about 3 times, at least about 4 time, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 15 times, at least about 20 times, at least about 25 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 100 times, at least about 150 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times) more than a reference control. The term “reference control” refers to a level in detected in a subject in general or a study population (e.g., healthy control).
[0142] As discussed herein, the engineered nucleic acid can target CAG repeat sequences. In some embodiments, the subject comprises a polyglutamine disease-related polynucleotide comprising an increased level of CAG repeat sequence as compared to a reference control. Accordingly, in some embodiments, the engineered nucleic acid decreases a level of a polyglutamine disease-related polynucleotide.
[0143] The polyglutamine disease-related polynucleotide disclosed herein includes, for example, a huntingtin (HTT) polynucleotide, an ATXN1 polynucleotide, an ATXN2 polynucleotide, an ATXN7 polynucleotide, a TATA binding protein-coding polynucleotide, an androgen receptor (AR) polynucleotide, or an atrophin 1 (ATN1) polynucleotide.
[0144] Huntingtin (HTT) is a disease gene linked to Huntington’s disease. “Huntingtin protein” or “Huntingtin polypeptide” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the HTT gene. In some embodiments, the HTT polynucleotide is that identified in one or more publicly available databases as follows: NC_000004.12, NM_002111.8, AB016794.1, AB209506.1, AK025918.1, AK290544.1, BC014028.2, BM661887.1, KJ535072.1, L12392.1, or L20431.1.
[0145] ATXN1 (Ataxin 1) is a diseases gene associated with spinocerebellar ataxia type 1 (SCA1) and hereditary ataxia. “ATXN1 protein” or “ATXN1 polypeptide” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the ATXN1 gene. In some embodiments, the ATXN1 polynucleotide is that identified in one or more publicly available databases as follows: NC_000006.12, NM_000332.3, NM_001128164.2, or NM_001357857.2.
[0146] ATXN2 (Ataxin 2) is a diseases gene associated with spinocerebellar ataxia type 2 (SCA2) and Parkinson’s disease. “ATXN2 protein” or “ATXN2 polypeptide” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the ATXN2 gene. In some embodiments, the ATXN2 polynucleotide is that identified in one or more publicly available databases as follows: NC_000012.12, NM_001310121.1, NM_001310123.1, NM_001372574.1, or NM_002973.4.
[0147] ATXN7 (Ataxin 7) is a diseases gene associated with Spinocerebellar Ataxia type 7 (SCA7) and retinal degeneration. “ATXN7 protein” or “ATXN7 polypeptide” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the ATXN7 gene. In some embodiments, the ATXN7 polynucleotide is that identified in one or more publicly available databases as follows: NM_000333.4, NM_001128149.3, NM_001177387.1, NM_001377405.1, or NM_001377406.1.
[0148] TATA-Box binding protein (TBP) is associated with spinocerebellar ataxia 17 and Parkinson’s disease. “TBP” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the TBP gene. In some embodiments, the TBP polynucleotide is that identified in one or more publicly available databases as follows: NC_000006.12, NM_001172085.1, or NM_003194.5.
[0149] Androgen receptor (AR) is associated with spinobulbar muscular atrophy (SBMA). “AR” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the AR gene. In some embodiments, the AR polynucleotide is that identified in one or more publicly available databases as follows: NC_000023.11, NM_000044.6, NM_001011645.3, NM _001348061.1, NM_001348063.1, or NM_001348064.1.
[0150] ATN1 (atrophin 1) is a diseases gene associated with Dentatorubral-pallidoluysian atrophy (DRPLA). “ATN1 protein” or “ATN1 polypeptide” refers herein to a polypeptide that synthesizes and hydrolyzes cyclic adenosine 5′-diphosphate-ribose, and in humans, is encoded by the ATN1 gene. In some embodiments, the ATN1 polynucleotide is that identified in one or more publicly available databases as follows: NC_000012.12, NM_001007026.2, NM_001940.4.
[0151] The methods and compositions disclosed herein are effective on decreasing polyglutamine disease-related polynucleotide. Accordingly, in some embodiments, the methods and compositions disclosed herein are effective on treating/preventing/mitigating a polyglutamine disease selected from Huntington’s disease (HD), spinocerebellar ataxias (SCA) type 1, SCA type 2, SCA type 3, SCA type 6, SCA type 7, SCA type 17, Dentatorubral-pallidoluysian atrophy (DRPLA), spinobulbar muscular atrophy (SBMA), hereditary ataxia, Parkinson’s disease, and retinal degeneration. In some embodiments, the methods and compositions disclosed herein are effective on treating/preventing/mitigating a polyglutamine disease selected from Huntington’s disease (HD), spinocerebellar ataxias (SCA) type 1, SCA type 2, SCA type 3, SCA type 6, SCA type 7, SCA type 17, Dentatorubral-pallidoluysian atrophy (DRPLA), and spinobulbar muscular atrophy (SBMA).
[0152] The CAG-repeat based DNAzyme can also target antisense CAG RNA (or RNA foci) arising from sense CUG repeat expansions, as many repeat expansions are bi-directionally transcribed. Examples of CUG expansion diseases include myotonic dystrophy type 1, Fuchs endothelial corneal dystrophy (FECD), Huntington disease like 2 (HDL2) and SCA8. The antisense CAG RNA/foci can contribute to pathology by sequestering RNA binding proteins in the nucleus/cytoplasm (RNA gain-of-function) or by initiating repeat-associated non-AUG (RNA) translation after being transported to the cytoplasm.
[0153] In addition, by changing the binding arm specificity, unique sequences can be targeted in addition to CAG repeats. Thus, the DNAzyme technology can be applied to a disease with a toxic RNA component/etiology. The combination of 8-17 and/or 10-23 DNAzymes can cover almost all repeat types from microsatellite expansion diseases.
[0154] “Huntington’s Disease” or “HD” herein refers to an inherited autosomal dominant genetic disorder caused by expansions of CAG repeats (polyglutamine-polyQ) at the N-terminus, within, for example, exon 1, of the HTT protein. These polyglutamine expansions are highly associated with cytotoxicity and aggregates formation. HD is marked by neuronal tissue degeneration and appears be due to the development of protein aggregates that arise initially from the misfolding of the mutant HTT protein. It should be understood that a treatment of HD may be a treatment of one or more of movement, thinking (cognitive), and/or psychiatric disorders, and/or shown as a decrease in the level of CAG repeat, disease-associated polynucleotides/polypeptides, or a slower formation of aggregates.
[0155] Spinocerebellar ataxia (SCA) is a term referring to a group of hereditary ataxias that are characterized by degenerative changes in the part of the brain related to the movement control (cerebellum), and sometimes in the spinal cord. There are many different types of SCA, and they are classified according to the mutated (altered) gene responsible for the specific type of SCA. The types are described using “SCA” followed by a number, according to their order of identification: SCA1 through SCA40 (and the number continues to grow). The signs and symptoms may vary by type but are similar, and may include an uncoordinated walk (gait), poor hand-eye coordination, and abnormal speech (dysarthria). It should be understood that a treatment of spinocerebellar ataxia may be a treatment of one or more of uncoordinated walk (gait), poor hand-eye coordination, and/or abnormal speech (dysarthria), and/or shown as a decrease in the level of CAG repeat or disease-associated polynucleotides/polypeptides.
[0156] Dentatorubral-pallidoluysian atrophy (DRPLA) is an autosomal dominant neurodegenerative disorder characterized by ataxia, choreoathetosis, dementia, and psychiatric disturbance in adults and ataxia, myoclonus, seizures, and progressive intellectual deterioration. Characteristic neuropathologic observations include degeneration of the dentatorubral and pallidoluysian systems of the central nervous system. It should be understood that a treatment of Dentatorubral-pallidoluysian atrophy may be a treatment of one or more of degeneration of the dentatorubral and pallidoluysian systems of the central nervous system, and/or shown as a decrease in the level of CAG repeat or disease-associated polynucleotides/polypeptides.
[0157] “X-linked spinal and bulbar muscular atrophy” (or spinobulbar muscular atrophy: SBMA; or Kennedy disease) is characterized by onset of progressive muscle weakness, atrophy, and fasciculations typically in the fourth or fifth decade of life. SBMA is caused by an expansion of the CAG trinucleotide repeat in, for example, exon 1 of the human androgen receptor (AR) gene. It should be understood that a treatment of spinocerebellar ataxia may be a treatment of one or more of muscle weakness, atrophy, and fasciculations, and/or shown as a decrease in the level of CAG repeat or disease-associated polynucleotides/polypeptides.
[0158] In some embodiments, the catalytic core domain is an 8-17 catalytic core or a 10-23 catalytic core. In some embodiments, the catalytic core domain comprises a sequence at least about 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 287. In some embodiments, the catalytic core domain comprises the sequence SEQ ID NO: 287.
[0159] In some embodiments, the catalytic core domain is a 10-23 catalytic core. In some embodiments, the catalytic core domain comprises a sequence at least about 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 291. In some embodiments, the catalytic core domain comprises the sequence SEQ ID NO: 291.
[0160] In some embodiments, the first binding arm and the second binding arm comprise at least 3 nucleotides (for example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides). In some embodiments, the first and the second binding arms comprise 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides. In some embodiments, the first binding arm and the second binding arm comprise 9 nucleotides.
[0161] The first binding arm and the second binding arm of the engineered nucleic acid can target the CAG repeat sequence. In some embodiments, the first binding arm and the second binding arm of the engineered nucleic acid is at least about at least about 90% (for example, at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to the CAG repeat sequence.
[0162] In some embodiments, the first binding arm and the second binding arm comprise a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 265-286. In some embodiments, the first binding arm and the second binding arm comprise the sequence selected from SEQ ID NO: 265-286.
[0163] In some embodiments, the first binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, or 285. In some embodiments, the first binding arm comprises the sequence selected from SEQ ID NOs: 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, and 285.
[0164] In some embodiments, the second binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO: 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, or 286. In some embodiments, the second binding arm comprises the sequence selected from SEQ ID NOs: 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, and 286.
[0165] In some embodiments, at least one nucleotide of the engineered nucleic acid is a chemically modified ribose. In some embodiments, at least one nucleotide at the 5′-terminus and at least one nucleotide at the 3′-termius of the engineered nucleic acid are chemically modified. In one embodiment, the chemically modified ribose is selected from 2′-O-methyl (2′- O-Me), 2′-Fluoro (2′-F), 2′-deoxy-2′-fluoro-beta-D-arabino-nucleic acid (2′F-ANA), 4′-S, 4′-SFANA, 2′-azido, UNA, 2′-O-methoxy-ethyl (2′-O-ME), 2′-O-Allyl, 2′-O-Ethylamine, 2′-O-Cyanoethyl, locked nucleic acid (LAN), peptide nucleic acid (PNA), Methylene-cLAN, N-MeO-amino BNA, or N-MeO-aminooxy BNA. In one embodiment, the chemically modified ribose is a locked nucleic acid (LAN). In one embodiment, a peptide nucleic acid (PNA).
[0166] In one embodiment, the at least one chemically modified nucleotide is a chemically modified phosphodiester linkage.
[0167] In some embodiments, the engineered nucleic acid comprises a sequence at least 80% identical to SEQ ID NOs: 121-132.
[0168] The engineered nucleic acid disclosed herein can be any metal-assisted DNAzyme (for example, Pb.sup.2+, Mn.sup.2+, Mg.sup.2+, Zn.sup.2+, or Ca.sup.2+).
[0169] In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the engineered nucleic acid disclosed herein and a pharmaceutically acceptable carrier.
[0170] In some embodiments, the composition described herein may be in a dosage form. The dosage forms can be adapted for administration by any appropriate route. Appropriate routes include, but are not limited to, oral (including buccal or sublingual), rectal, epidural, intracranial, intraocular, inhaled, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, intraurethral, parenteral, intracranial, subcutaneous, intramuscular, intravenous, intraperitoneal, intradermal, intraosseous, intracardiac, intraarticular, intracavernous, intrathecal, intravitreal, intracerebral, gingival, subgingival, intracerebroventricular, and intradermal. Such formulations may be prepared by any method known in the art.
[0171] As the timing of a disease can often not be predicted, it should be understood the disclosed methods of treating, preventing, reducing, and/or inhibiting the disease or disorder described herein can be used prior to or following the onset of the disease or disorder, to treat, prevent, inhibit, and/or reduce the disease or disorder or symptoms thereof. In one aspect, the disclosed methods can be employed 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 years, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 months, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 days, 60, 48, 36, 30, 24, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2 hours, 60, 45, 30, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 minute prior to onset of the disease or disorder; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 75, 90, 105, 120 minutes, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18, 24, 30, 36, 48, 60 hours, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 days, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more years after onset of the disease or disorder.
[0172] Dosing frequency for the composition of any preceding aspects, includes, but is not limited to, at least once every year, once every two years, once every three years, once every four years, once every five years, once every six years, once every seven years, once every eight years, once every nine years, once every ten year, at least once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, at least once every month, once every three weeks, once every two weeks, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, daily, two times per day, three times per day, four times per day, five times per day, six times per day, eight times per day, nine times per day, ten times per day, eleven times per day, twelve times per day, once every 12 hours, once every 10 hours, once every 8 hours, once every 6 hours, once every 5 hours, once every 4 hours, once every 3 hours, once every 2 hours, once every hour, once every 40 min, once every 30 min, once every 20 min, or once every 10 min. Administration can also be continuous and adjusted to maintaining a level of the compound within any desired and specified range.
Methods for Treating a Viral Infection
[0173] Also disclosed herein are methods of preventing, treating, reducing, and/or inhibiting a viral infection in subject in need thereof comprising administering to the subject in need thereof a therapeutically effective amount of the engineered nucleic acid disclosed herein.
[0174] In some embodiments, a viral infection is an infection with a virus selected from the group consisting of Herpes Simplex virus-1, Herpes Simplex virus-2, Varicella-Zoster virus, Epstein-Barr virus, Cytomegalovirus, Human Herpes virus-6, Variola virus, Vesicular stomatitis virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Rhinovirus, Coronavirus (including, but not limited to avian coronavirus (IBV), porcine coronavirus HKU15 (PorCoV HKU15), Porcine epidemic diarrhea virus (PEDV), HCoV-229E, HCoV-OC43, HCoV-HKU1, HCoV-NL63, SARS-CoV, SARS-CoV-2, or MERS-CoV), Influenza virus A, Influenza virus B, Measles virus, Polyomavirus, Human Papilomavirus, Respiratory syncytial virus, Adenovirus, Coxsackie virus, Dengue virus, Mumps virus, Poliovirus, Rabies virus, Rous sarcoma virus, Reovirus, Yellow fever virus, Zika virus, Ebola virus, Marburg virus, Lassa fever virus, Eastern Equine Encephalitis virus, Japanese Encephalitis virus, St. Louis Encephalitis virus, Murray Valley fever virus, West Nile virus, Rift Valley fever virus, Rotavirus A, Rotavirus B, Rotavirus C, Sindbis virus, Simian Immunodeficiency virus, Human T-cell Leukemia virus type-1, Hantavirus, Rubella virus, Simian Immunodeficiency virus, Human Immunodeficiency virus type-1, and Human Immunodeficiency virus type-2. In some embodiments, the infection is a coronavirus infection. In some embodiments, the infection is s SARS-CoV-2 infection.
[0175] In some aspects, disclosed herein are methods of preventing, treating, reducing, and/or inhibiting a SARS-CoV-2 infection in subject in need thereof comprising administering to the subject in need thereof a therapeutically effective amount of the engineered nucleic acid disclosed herein.
[0176] In some examples, the first binding arm and the second binding arm of the engineered nucleic acid disclosed herein can target a conserved region of a SARS-CoV-2 polynucleotide. In some embodiments, the first binding arm and the second binding arm of the engineered nucleic acid is at least about at least about 90% (for example, at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to the SARS-CoV-2 polynucleotide. In some embodiments, the SARS-CoV-2 polynucleotide is selected from SEQ ID NOs: 1-120. In some embodiments, the first binding arm and the second binding arm of the engineered nucleic acid is at least about at least about 90% (for example, at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) complementary to the SARS-CoV-2 polynucleotide. In some embodiments, the SARS-CoV-2 polynucleotide is selected from SEQ ID NOs: 141-171.
[0177] In some embodiments, the first binding arm and the second binding arm comprise a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 203-264. In some embodiments, the first binding arm and the second binding arm comprise the sequence selected from SEQ ID NOs: 203-264.
[0178] In some embodiments, the first binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 203-233. In some embodiments, the first binding arm comprises the sequence selected from SEQ ID NOs: 203-233.
[0179] In some embodiments, the second binding arm comprises a sequence at least 80% (for example, at least about 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NOs: 234-264. In some embodiments, the second binding arm comprises the sequence selected from SEQ ID NOs: 234-264.
[0180] In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the engineered nucleic acid disclosed herein and a pharmaceutically acceptable carrier.
[0181] In some embodiments, the composition described herein may be in a dosage form. The dosage forms can be adapted for administration by any appropriate route. Appropriate routes include, but are not limited to, oral (including buccal or sublingual), rectal, epidural, intracranial, intraocular, inhaled, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, intraurethral, parenteral, intracranial, subcutaneous, intramuscular, intravenous, intraperitoneal, intradermal, intraosseous, intracardiac, intraarticular, intracavernous, intrathecal, intravitreal, intracerebral, gingival, subgingival, intracerebroventricular, and intradermal. Such formulations may be prepared by any method known in the art.
[0182] The disclosed methods of treating, preventing, reducing, and/or inhibiting the infection described herein can be used prior to or following the onset of the infection, to treat, prevent, inhibit, and/or reduce the infection or symptoms thereof. In one aspect, the disclosed methods can be employed 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 months, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 days, 60, 48, 36, 30, 24, 18, 15, 12, 10, 9, 8, 7, 6, 5, 4, 3, 2 hours, 60, 45, 30, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 minute prior to the infection; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 75, 90, 105, 120 minutes, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 18, 24, 30, 36, 48, 60 hours, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 days, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months after the infection.
[0183] Dosing frequency for the composition of any preceding aspects, includes, but is not limited to, at least once every year, once every two years, once every three years, once every four years, once every five years, once every six years, once every seven years, once every eight years, once every nine years, once every ten year, at least once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, at least once every month, once every three weeks, once every two weeks, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, daily, two times per day, three times per day, four times per day, five times per day, six times per day, eight times per day, nine times per day, ten times per day, eleven times per day, twelve times per day, once every 12 hours, once every 10 hours, once every 8 hours, once every 6 hours, once every 5 hours, once every 4 hours, once every 3 hours, once every 2 hours, once every hour, once every 40 min, once every 30 min, once every 20 min, or once every 10 min. Administration can also be continuous and adjusted to maintaining a level of the compound within any desired and specified range.
EXAMPLES
[0184] The following examples are set forth below to illustrate the compositions, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art.
Example 1. DNAzyme Cleavage of CAG Repeat RNA in Polyglutamine Diseases
[0185] DNAzymes (Dzs) are single-stranded RNA-cleaving DNAs that typically consist of a catalytic core and two flanking RNA binding arms for target recognition. The catalytic core cleaves a phosphodiester bond in the presence of divalent cations, generating a 5′- product with a 2′, 3′-cyclic phosphate at the 3′-end and a 3′-product with a hydroxyl groupat the 5′-end. The 8-17 DNAzyme is amongst the first identified DNAzymes that efficiently cleave RNA substrates. The 15-nucleotide (nt) core has been independently isolatedunder different cation selections such as Mg.sup.2+, Mn.sup.2+, Ca.sup.2+, Zn.sup.2+ and Pb.sup.2+ and shown to twist into a pseudoknot with the two RNA binding arms 70 ° apart in the crystal structure. Despite their high reprogrammability and versatility for chemical modification and nanoconjugation, the theranostic value and means of delivery are largely unexplored.
[0186] Polyglutamine (polyQ) diseases are a group of incurable neurodegenerative disorders caused by CAG repeat expansion in coding regions, including Huntington’s disease (HD), spinocerebellar ataxias (SCA types 1, 2, 3, 6, 7 and 17), dentatorubropallidoluysian atrophy (DRPLA), and spinobulbar muscular atrophy (SBMA). A toxic gain-of-function of the expanded polyQ proteins has been proposed to cause a variety of potential pathogenic cellular events, including single- or double-stranded (ss/ds) DNA breaks, impaired protein homeostasis, transcription dysregulation, protein sequestration, disruption of nucleocytoplasm transport and endoplasmic reticulum architecture, and mitochondrial dysfunction in different diseases. In addition, the expanded RNA can also give rise to noncanonical repeat- associated non-ATG (RAN) translation products. Thus, ridding cells of the mutant polyQ RNA/protein has become a major disease intervention and its success is thought to ameliorate any downstream pathomechanistic defects.
[0187] Significant progresses have been made through CRISPR-Cas genome editing and antisense oligonucleotides (ASOs) therapies in many polyQ diseases, especially in HD, SCA2 and SCA3. Efforts towards engineering high fidelity Cas proteins with various controller modules, split Cas proteins for efficient viral packaging, and non-viral delivery approaches are underway to improve precision and safety. ASOs have been successfully tested in HD, SCA1, SCA2, SCA3 and SCA7 cells or mouse models and with HD ASO entering Phase III clinical trial. The efficacy of ASO can vary from case to case and can largely depend on RNase H activity, accessibility of target sites, design chemistry and bioavailability in target tissue. Observations from clinical trials and animal studies indicate that targeting both mutant and normal alleles of the polyQ protein does not associate with any pathology ordeleterious side effects. In addition, no off-target effects were detected using CAG complementary ASOs in HD and SCA3 patient cells or HD Q175 mice. The aboveobservations have clearly outlined the possibility and benefit of using a single repeat-based agent to reduce mutant polyQ RNA and protein load across multiple diseases.
[0188] Since the 8-17 core cleaves the phosphodiester bond between ribonucleotides A and G, an 8-17 DNAzyme was designed that binds to and cleaves CAG repeat RNA. The designer DNAzyme cleaves its target in the presence of different ions and under physiological concentrations. The chemically stabilized DNAzyme retainsthe catalytic activity and knocks down or eliminates mutant polyQ RNA or protein load in cells from several polyQ disease origins and high molecular weight (HMW) ATXN3proteins in a SCA3 mouse model.
Methods
[0189] General methods and DNA. Unmodified DNA oligonucleotides were purchased from Sigma Aldrich. PNA oligonucleotides were purchased from PNA Bio. LNA oligonucleotides were purchased from Qiagen. Q5 High fidelity DNA Polymerase (New England Biolabs) were used for routine PCR amplification. Restriction digestion and ligation were performed with FastDigest enzymes and T4 DNA Ligase Kit (Thermo Fisher Scientific) respectively. DNA plasmids were propagated in chemically competent Escherichia coli Stbl3 (Thermo Fisher Scientific) and sequenced at GENEWIZ.
[0190] HEK293 and SH-SY5Y cells were cultured at 37° C. with 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO) containing 10% non-inactivated fetal calf serum (FBS, GIBCO) and 100 U/ml penicillin-streptomycin (P/S, GIBCO). Normal (GM23973) and patient derived SCA1 (GM06927, 52/29 CAG repeats) and SCA3 (GM06151, 74/24 CAG repeats) fibroblast cells were purchased from Coriell Cell Repositories and cultured in DMEM supplemented with 10% FBS and 1% P/S. Fibroblasts used in this study are no more than 2 passages different across cell lines and are all below 15 passages for nucleofection. BMECs (brain microvascular endothelial cells, gift of Dr. Kyuson Yun) were cultured on plates coated with 2 .Math.g/cm.sup.2 fibronectin at 37° C. in Medium 199 (Gibco) containing 5% NuSerum, 5% FBS and 1% P/S. Normal WTC11 iPSCs (GM25256) were purchased from Coriell Cell Repositories. Different iPSC lines were cultured in TeSR™-E8™ (STEMCELL Technologies) on plates or round coverslips coated with Matrigel (Corning).
[0191] The expanded ATXN1 (gift of Dr. Huda Zoghbi), TBP (gift of Dr. Shihua Li), ATXN7 (gift of Dr. Harry Orr) and AR (Addgene #28235) genes were cloned from their parental backbones into pCMV-(DYKDDDDK)-N vector to acquire a FLAG tag (Clonetech). The pEGFP-Q74 (for HTTex1, #40262), pEGFP-C1-ATXN3-Q28 (#22122) and pEGFP-C1-ATXN3-Q84 (#22123) plasmids were purchased from Addgene.
[0192] Animals. All animal procedures were approved by the Houston Methodist Institutional Animal Care and Use Committee and conducted in compliance with the National Institutes of Health guidelines for the use of experimental animals. Genotyping was performed using tail biopsy DNA isolated prior to weaning. PCR was performed using Qiagen DNeasy Blood and Tissue Kit and primers recommended by the Jackson Laboratory to amplify a fragment of the ATXN3 transgene. Animals were matched for age, sex and weight for this study. Six-month old animals were injected with either saline or DNAzyme and brain tissues were harvested after one month for imaging and biochemical analyses. Before euthanization, blood was drawn and analyzed for clinical chemistry and hematology at the MD Anderson core facility. Different experimental stages — such as injection, brain harvest and biochemical assays — were carried out by different personnel to ensure data reproducibility.
[0193] In vivo Imaging System (I.V.I.S.) and stereotaxic injection. I.V.I.S. imaging was performed using a Caliper Xenogen 200 system and images were normalized using the Living Image Software.
[0194] DNAzyme was stereotaxically administered into the right lateral ventricle. Intracerebroventricular (i.c.v.) injections were performed on mice under intraperitoneal ketamine anesthesia. For each i.c.v. injection, a small incision was made to expose the Bregma and a small hole was drilled at the coordinates pre-determined by the NEUROSTAR software (mediolateral +1 mm; anterior-posterior -0.3 mm; dorsoventral -2.5 mm). Four hundred .Math.g LNA8-17Dz9 was delivered at an infusion rate of 4 turns/min using a Hamilton syringe on a Global Biotech stereotaxic instrument. After the injection was complete, the needle was slowly retracted at a rate of 1 mm/min and animals were sutured and supplied with pain killer.
[0195] RNA in vitro transcription and cleavage assay. CAG.sub.X30 and CAGx42 was cloned into pcDNA3.1-hygro+ at NheI and HindIII sites, linearized at EcoRV site, and in vitro transcribed at 30° C. overnight using HiScribe T7 High Yield RNA Synthesis Kit (NEB) with approximately 500 ng of DNA input. The transcribed RNA was digested with TURBO DNaseI at 37° C. for 30 min before column purified using RNA Clean and Concentrator (Zymo Research).
[0196] RNA cleavage assays were performed in 1x Dz digestion buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl and varying concentrations of Mg.sup.2+ or Ca.sup.2+) with 100 nM target RNA and 500 nM 8-17 Dz at 37° C. for the indicated time. Samples were quenched in 2x TBE-Urea Loading Buffer (BioRad) mixed with 3x formamide dye (100% formamide, 0.5 M EDTA), boiled at 95° C. for 5 min, and loaded on 10% TBE-Urea gels. After running at 200 V for approximately 1 h, RNA cleavage was detected in SYBR Gold (Invitrogen, 1:50,000) on an Azure c400 Biosystem.
[0197] Transfection. HEK293 or SH-SY5Y cells were seeded at 700,000 per well (6-well format) approximately 16 h before transfection. Transfection was performed with 2 .Math.g plasmid DNA ± 200 pmol 8-17Dz in the presence of 15 .Math.l Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction.
[0198] Fibroblasts were nucleofected using the P2 Primary Cell 4D-Nucleofector X Kit (100 .Math.l format) on a 4D-Nucleofactor X unit (Lonza) according to the manufacturer’s instruction. One million cells combined ± 200 or 300 pmol DNAzyme were nucleofected under the program “CZ167” and plated in pre-warmed medium in each well. Analyses (immunoblot/IF/functional assays) were performed 48 h post transfection.
[0199] Each 100 pmol DNAzyme was transfected with 1.5 .Math.l Lipofectamine Stem Reagent (Thermo Fisher Scientific) into iPSCs or differentiating iNeurons according to the manufacturer’s protocol.
[0200] RNA Isolation and quantitative RT-PCR (qRT-PCR). Total RNA was isolated using RNeazy Mini Kit (Qiagen), digested with TURBO DNaseI (Thermo Fisher Scientific), and purified using RNA Clean and Concentrator (Zymo Research) according to the manufacturer’s protocol. One microgram input RNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad). PCR amplification was performed with 2.5 .Math.l of diluted cDNA (1:3 dilution) on a CFX96 Real-time System (Bio-Rad). RNA expression was normalized against that of GAPDH and the relative normalized expression was calculated using CFX Manager 3.1 (Bio-Rad).
[0201] DCL64 liposome packaging. 1,2-Dipalmitoyl-sn-glycero-3-phosphocoline (DPPC) and cholesterol were purchased from Avanti Polar Lipids and poloxamer L64 was purchased from Sigma-Aldrich. DCL64 liposomes were prepared by mixing DPPC, cholesterol and Poly(ethylene glycose)-block-poly(propylene glycol)-block-poly(ethylene glycol) L64 (poloxamer L64) at a 5:3:7 weight ratio at room temperature. DNAzyme was mixed with DCL64 at a 1:10 weight ratio at room temperature. All DCL64 liposomes were prepared in Wheaton glass vials and mixed with excess tert-butanol at room temperature prior to freezing at -80° C. overnight. The DCL64 liposomes were then lyophilized overnight, using a FreeZone 2.5 lyophilizer (Labconco), until a thin film had formed and there was no evidence of liquid within the glass vial. DCL64 liposomes not needed for use immediately were stored at -20° C. The DCL64 liposomes were reconstituted with sterile 1X PBS to the desired concentration immediately before use.
[0202] DNA tetrahedron assembly and packaging. PAGE-purified DNA oligonucleotides (Table 1) were purchased from Sigma-Aldrich. DNA tetrahedra were generated by mixing equimolar quantities (1 .Math.M) of each strand (± DNAzyme) in 1x TM buffer (20 mM Tris-HCl pH7.5, 50 mM MgCl.sub.2-H2O), and the mixture was slowly cooled from 95° C. to 25° C. over 2 h. The assembled structure was characterized by 1% agarose gel and 4% native PAGE gel. Two assembly reactions were pooled (equivalent to 200 pmol of DNAzyme) for cell delivery.
TABLE-US-00010 List of oligonucleotides used in this study. The catalytic core sequences are shown as bolded 8-17Dz5 GCTGTCCGAGCCGGACGAGCTGC SEQ ID NO: 121 8-17Dz6 TGCTGTCCGAGCCGGACGAGCTGCT SEQ ID NO: 122 8-17Dz7 CTGCTGTCCGAGCCGGACGAGCTGCTG SEQ ID NO: 123 8-17Dz8 GCTGCTGTCCGAGCCGGACGAGCTGCTGC SEQ ID NO: 124 8-17Dz9 TGCTGCTGTCCGAGCCGGACGAGCTGCTGCT SEQ ID NO: 125 8-17Dz10 CTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTG SEQ ID NO: 126 8-17Dz11 GCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCGC SEQ ID NO: 127 8-17Dz12 TGCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTGCT SEQ ID NO: 128 8-17Dz13 CTGCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTGCTG SEQ ID NO: 129 LNA8-17Dz9 +T+G+C+T+GCTGTCCGAGCCGGACGAGCTG+C+T+G+C+T SEQ ID NO: 130 PNA8-17Dz9 *T*G*C*T*G*C*T*G*T*C*C*G*A*G*C*C*G*G*A*C*G*A*G*C*T*G*C*T*G*C*T SEQ ID NO: 131 polyT20LNA8-7Dz9 TTTTTTTTTTTTTTTTTTTT+T+G+C+T+GCTGTCCGAGCCGGACGAGCTG+C+T+G+C+T SEQ ID NO: 132 polyA20A20 AAAAAAAAAAAAAAAAAAAAATTGCTGTATTGGCTCTGGTGATGCGTTAAAGGATCTCGTATAGCAGCTCAGTCCACTCGAAC SEQ ID NO: 133 B20 CATAGTCAATAACGCATCACCAGAGCCAAATGACGACATCTGTGCGATGAAACCTAGCAGACC SEQ ID NO: 134 C20 GAGATCCTATGACTATGGGTCTGCTAGGTACAGTCTGTCGCTTATGCACTAGAGCTGCTATAC SEQ ID NO: 135 D20 TGTCGTCAAACAGCAATGTTCGAGTGGACAAGTGCATAAGCGACAGACTGATCATCGCACAGA SEQ ID NO: 136 qRT-PCR pimers for GAPDH GACAGTCAGCCGCATCTTCT SEQ ID NO: 137 GCGCCCAATACGACCAAATC SEQ ID NO: 138 qRT-PCR primers for GFP CAAGATCCGCCACAACATCG SEQ ID NO: 139 GACTGGGTGCTCAGGTAGTG SEQ ID NO: 140
[0203] Protein isolation and immunoblot. Proteins were isolated from cells 48 h post transfection and lysed in Pierce IP Lysis Buffer (Thermo Fisher Scientific) supplemented with cOmplete Protease Inhibitor Cocktail (Roche) and PhosSTOP (Sigma-Aldrich) at 4° C. for 30 min. Soluble fractions were collected after centrifugation at 13,200 rpm at 4° C. for 15 min and quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific).
[0204] For immunoblot analysis, approximately 40 .Math.g of proteins were denatured in 4x Laemmli Sample Buffer (Bio-Rad) and P-mercaptoethanol at 95° C. for 5 min before loaded on 4-15% SDS-PAGE gels (Bio-Rad). Proteins were transferred onto PVDF membranes (Bio-Rad) using a Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad) at 100 V for approximately 1.5-2 h at 4° C. Membranes were incubated with blocking buffer (5% Blotting-Grade Blocker, Bio-Rad, in 1x TBST, 0.1% Tween 20) at room temperature for 1 h, followed by primary antibody incubation at 4° C. overnight and secondary antibody incubation at room temperature for 1 h. Chemilunimescent signals were detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) on an Azure c400 Biosystem and quantified using ImageJ.
[0205] Cortical tissues from mouse brain were flash frozen for protein analysis. Total protein lysate was extracted using mechanical homogenization in 500 .Math.l RIPA buffer containing cOmplete mini protease inhibitor cocktail and PhoStop phosphatase inhibitor. Homogenate was incubated at 4° C. with agitation for 2 h prior to clearing the debris via centrifugation at 12,000 rpm for 20 min at 4° C. Supernatants were used for immunoblotting analysis.
[0206] Primary antibodies used in this study include mouse anti-ATXN1 (2F5, 1:1,000, Thermo Fisher Scientific), rabbit anti-ATXN2 (NBP1-90063, 1:200, Novusbio), mouse anti-ATXN3 (MAB5360, 1:1,000, Millipore), rabbit anti-ATXN3 (13505-1-AP, 1:500, Proteintech), mouse anti-FLAG (M2, 1:1,000, Sigma-Aldrich), mouse HRP-conjugated GAPDH (HRP-60004, Proteintech), mouse anti-GFP (GF28R, 1:1,000, Thermo Fisher Scientific), mouse anti-polyglutamine (MAB1574/5TF1-1C2, 1:1,000, Millipore), rabbit anti-Oct4 (#2750, 1:200, Cell Signaling Technology), rabbit anti-Sox2 (D6D9, 1:200, Cell Signaling Technology), rabbit anti-Nanog (D73G4, 1:200, Cell Signal Technnology), mouse anti-8-OHdG (E-8, 1:200, Santa Cruz Biotechnology), rabbit anti-ATXN7 (PA1-749, 1:1,000, Thermo Fisher Scientific), mouse anti-TBP (1TBP18, 1:1,000, Thermo Fisher Scientific), and mouse anti-p62/SQSTMl (D-3, 1:500, Santa Cruz Biotechnology).
[0207] iNeuron differentiation and harvest. iNeurons were differentiated as previously described. Briefly, WTC11 iPSCs with integrated hNGN2 were cultured on 6-well plates coated with Matrigel and induced in cortical neuron culture medium (DMEM/F 12 with HEPES, 1x B27 supplement, doxycycline 2 .Math.g/ml). On day 3, cells were individualized by Accutase (STEMCELL Technologies), seeded on Matrigel coated 6-well plates, and transfected using Lipofectamine Stem Transfection Reagent with HTTex1-Q74 ± DNAzyme (total DNA: LipoStem ratio is 1: 2) according to the manufacturer’s protocol. Cells were harvested for immunoblot or imaging on day 5 and day 7.
[0208] Generation of SCA3 Ipsc. The study was approved by the University of Florida Institutional Review Board. The SCA3 subject was provided with the approved informed consent. Skin biopsy was performed by punch biopsy (6 mm in diameter) under local anesthesia. The skin specimens were placed in sterile DMEM medium supplemented with 20% FBS and 1% P/S at room temperature for transport to the lab. Biopsy specimens were processed into 0.5 mm cubes and placed into duplicate 25 cm2 flasks. The explants were allowed to air-dry for 30 min and 12 ml of primary culture medium (DMEM with 20% FBS) was added to the flask. The flasks were placed in a 37° C. 5% CO2 incubator. Medium was replenished after 7 days. When fibroblasts from adjacent explants started to merge, the flasks were treated with 0.05% Trypsin/EDTA and passed to a 75 cm2 flask. These cells were designated as passage 1. Passage 3 fibroblasts were used for reprogramming.
[0209] Reprogramming was performed by a non-integrating method using CytoTune Sendai Reprogramming Kit (Thermo Fisher Scientific) on the fibroblasts according to the manufacturer’s protocol as previously published. Isolated iPSC clones were cultured on either vitronectin- or Matrigel-coated plates in TeSR-E8 medium (STEMCELL Technologies).
[0210] Fluorescent microscopy and immunofluorescence (IF). To evaluate DNAzyme’s cellular uptake, BMEC or SH-SY5Y cell were incubated with naked or DCL64-packaged Cy3-LNA8-17Dz9 for 48 h, washed five times with PBS (5 min each), fixed in 4% Paraformaldehyde (PFA) Solution in PBS (Thermo Fisher Scientific) for 10 min, permeabilized in 0.2% Triton X-100 in PBS for 10 min, and mounted in Mounting Medium with DAPI for Fluorescence (Vectorshield). Images were taken on a Nikon A1 Confocal Imaging system.
[0211] IF was carried out 48 h post transfection. Fibroblasts, iPSCs or iNeurons on coverslips were washed with PBS, fixed in 4% PFA, permeabilized in 0.2% Triton X-100 in PBS, and blocked in 5% BSA in PBST (0.05% Tweeen 20). Primary antibody incubation was carried out at 4° C. overnight, followed by fluorophore-tagged secondary antibody incubation at room temperature for 1 h before mounting in DAPI medium. A Nikon A1 Confocal Imaging system was used.
[0212] After brain harvest, sagittal sections of all mouse brains were fixed in 4% PFA for 48 h, cryoprotected in a sucrose gradient and embedded in OCT. Cryostat sections from OCT embedded tissue were cut at 10 .Math.m thickness and mounted on slides. Sections were fixed in 4% PFA, washed in PBS and blocked in 5% normal goat serum, 0.2% Triton X-100 in PBS. Sections were then incubated in mouse anti-GFAP antibody (1:500, sc-33673, Santa Cruz Biotechnology) at 4° C. overnight. After washing, the sections were incubated in secondary antibody, washed in PBS and mounted in Mounting Medium with DAPI (Vectorshield). Slides were imaged with a Nikon A1 Confocal Imaging system.
[0213] Cell proliferation assay. Cell proliferation was assessed using the Aqueous One Solution Cell Proliferation Assay (Promega). In brief, 5,000 cells (± nucleofected DNAzyme) were plated in each 96 well and treated with 20 .Math.l MTS at 37° C. for 3 h. Absorbance at 490 nm was recorded on a PerkinElmer EnSpire Mulitmode Plate Reader.
[0214] Mitochondrial membrane potential assay. Mitochondrial membrane potential was measured using the JC-10 dye according to the manufacturer’s protocol (G-Biosciences). In brief, 5,000 cells (from the same nucleofection used for cell proliferation assays) were plated in each 96 well, incubated with 100 .Math.l JC-10 solution (1: 200 dilution) for 20 min at 37° C., washed twice with 1x MMP solution (1: 5 dilution), and recorded at excitation/emission 535 nm /595 nm and 485 nm/535 nm on the EnSpire plate reader. The red-to-green fluorescence ratio was used for plotting the graph.
[0215] Statistical Analysis and image processing. Statistical analyses of all data were performed using t test in GraphPad Prism Version 7.03 (*P < 0.05, **P < 0.01, ***P < 0.001).
[0216] Quantification of p62 aggresome/cell was performed in Fuji ImageJ. p62 foci were counted using “Find maxima” with the threshold set to 60. Cells were counted in 8-bit images with threshold set to 30-255 and particle size set to 60-infinity.
Results
Designer DNAzyme 8-17 (8-17 Dz) Cleaves CAG Repeat RNA Biochemically
[0217] Three 8-17 Dzs with varying lengths of CAG complementing arms were initially designed and tested for cleavage efficiency of in vitro transcribed CAGx30 RNA (
Locked Nucleic Acid Modification Retains 8-17 Dz’s Catalytic Activity
[0218] Unmodified DNAzyme can be degraded by cellular nucleases; increased stability and affinity towards its target RNA can offer persistent therapeutic benefit in cells. Amongst the repertoire of chemical modifications, the locked nucleic acid (LNA) and peptide nucleic acid (PNA) were chosen for base substitutions in 8-17 Dz9 due to their strong binding affinity and incompatibility with RNase H. The terminal five nucleotides of each binding arm were substituted to LNA to create the LNA8-17Dz9 and all nucleic acids were substituted to PNA to create the PNA8-17Dz9 (
LNA8-17Dz9 Significantly Knocks Down or Eliminates Multiple Mutant polyQ Proteins in HEK293 Cells
[0219] Huntington’s disease is the most common inherited neurodegenerative disease and is caused by CAG repeat expansion in the first exon of Huntingtin (HTTex1). The mutant HTT (mutHTT) undergoes extensive autolysis and produces exon 1 fragments that aggregates in neuronal nuclei of brain tissue. To test if DNAzyme can knock down mutHTTex1, an HTTex1 fragment containing 74 Qs (HTTex1- Q74) was co-transfected with the three 8-17Dz9 designs in HEK293 cells for 48 h. The highest HTTex1-Q74 RNA knockdown was observed by LNA8-17Dz9, followed by unmodified 8-17 Dz9 and PNA8-17Dz9 (
[0220] CAG expansion in ataxin 1 (ATXN1), TATA binding protein (TBP), ataxin 7 (ATXN7) and androgen receptor (AR) causes SCA1, SCA17, SCA7 and SBMA respectively. Each mutant polyQ protein was cloned to acquire a FLAG tag and subsequently co-transfected with LNA8-17Dz9 in HEK293 cells for immunoblot analysis. The LNA8-17Dz9 completely eliminates TBP-Q94 and ATXN7-Q61 protein expression and significantly reduces ATXN1-Q83 and AR-Q40 protein levels by approximately 80% (
LNA8-17Dz9 Significantly Reduces polyQ Protein Load in Neuroblastoma Cells and iNeurons
[0221] To test if LNA8-17Dz9 can work in neuron-like cells, HTTex1-Q74 and LNA8-17Dz9 were co-transfected into SH-SY5Y neuroblastoma cells. A >90% target protein knockdown was observed (
LNA8-17Dz9 Targets Both Normal and Expanded ATXN3 Alleles Without Affecting p62-Aggresome Levels in SCA3 iPSCs
[0222] SCA3 is the most common inherited ataxia and is caused by a CAG repeat expansion in the ATXN3 gene. Although its role as a deubiquitinase has been associated with aggresome formation, autophagy, antiviral response, and transcription-coupled DNA repair, different Ataxin3-knockout (KO) mice exhibit normal viability and fertility, indicating that its function is c essential. Thus, lowering the expression of both wildtype and mutant ATXN3 can be well tolerated. A patient- derived SCA3 iPSC line that expresses pluripotency markers Oct4, Sox2 and Nanog and has a repeat size close to CAGX80 were generated (
Allele Specific Targeting of Mutant polyQ Protein can be Achieved in Patient-Derived Fibroblasts
[0223] To further investigate if LNA8-17Dz9 can achieve allele specificity, SCA1 and SCA3 patient-derived fibroblasts were nucleofected with either 200 or 300 pmol LNA8-17Dz9 for 48 h. In both cell lines, significant target knockdown (ATXN1 RNA in SCA1 and ATXN3 RNA in SCA3) were observed (
[0224] The DNAzyme-treated SCA3 fibroblasts were subject to further cell proliferation studies, given that potential off-target knockdown of wtATXN3, wtATXN2 and wtTBP was observed. The LNA8-17Dz9 treatment consistently improved SCA3 cell survival (even better survival than wt cells at low concentration,
[0225] Enhanced delivery to target tissues/cells is an important area of research for translational application of DNAzyme. Two packaging/delivery methods were explored in this study, namely the liposome DCL64 formulation and DNA tetrahedron. Despite the significantly increased cellular uptake in both blood brain barrier endothelial and neuroblastoma cells (
[0226] Stereotaxically injected LNA8-17Dz9 knocks down high molecular weight ATXN3 in vivo.
[0227] To evaluate the stability of LNA8-17Dz9 in vivo, a low dosage (25 .Math.g) of Cy5-labeled DNAzyme was administered in the right ventricle of 6-week old SCA3 MJD84.2 mice by stereotaxic injection. Amongst several well established SCA3 mouse models, the transgenic MJD84.2 mouse was chosen for the following studies because the YAC construct harbors a human ATXN3 gene (with Q3KQ80 repeats) under its native promoter and the mouse exhibits disease-relevant neuropathological phenotype and behavioral abnormalities from 4 weeks of age. I.V.I.S. imaging was performed 48 h to 42 days post injection and indicates that the low-dose LNA8-17Dz9 is detectable in mouse brain for at least 1 month (
Example 2 Designer DNAzymes Directly Eliminate Essential Viral RNA in Coronaviridae
[0228] The 2019 coronavirus (COVID-19 or SARS-CoV-2) originated in Wuhan quickly spread beyond China. Since the pathogenesis of this virus is not well understood, there are limited front-line diagnostic tools or therapeutic agents available to fight this pandemic. The estimated timeline for an effective treatment for SARS-CoV-2 is at least one year away, despite tremendous global resources are dedicated to drug development. Antibody- or antagonistic peptide-based vaccines may benefit patients by neutralizing circulating viruses at protein epitopes, however, they may not stop viral replication inside cells due to their limited cell-penetrating capacity. In addition, evidence indicates that the virus is actively acquiring new mutations, which can help it escape antiviral molecules and render existing vaccines inefficacious. These therapeutic limitations also apply to other deadly RNA viruses such as SARS-CoV (Severe Acute Respiratory Syndrome-related coronavirus) or MERS-CoV (Middle East Respiratory Syndrome).
[0229] An RNA-cleaving DNAzyme that can eliminate repeat CAG RNA from several polyglutamine diseases in vitro and in cellula was developed. The DNAzyme has a catalytic core and two RNA binding arms that can be reprogrammed to anneal to different RNA targets (in this case different SARS-CoV-2 viral RNA). It cleaves the target RNA under physiological ionic strength without requiring any protein component. The present study shows that the DNAzyme can be used to target the RNA genome of SARS-CoV-2, especially the highly conserved regions within five essential genes, namely the papain-like protease (PLpro), 3-chymotrypsin-like protease (3CLpro), RNA-dependent RNA polymerase (RdRp), helicase and spike (S); without these genes the virus cannot replicate or survive in human cells. It can be particularly important to target the RdRp gene because this protein is responsible for transcribing other viral RNA into mRNA for further translation in the host cell. The advantages of our DNAzyme approach are: (1) the DNAzyme targets highly conserved RNA regions that are unlikely to mutate (even under evolutionary pressure), (2) these RNA regions are conserved across the coronaviridae family and can be used to treat different viral outbreaks (e.g., SARS-CoV and SARS-CoV-2), and (3) the DNAzyme works within cells before viral proteins are made, thus terminating the viral life cycle before spreading. The approach can be used for treating SARS-CoV-2 because other DNAzymes with different catalytic cores have been used to inhibit the replication of RNA viruses. For instance, the DNAzyme that cleaves between G and U inhibits the Japanese encephalitis viral replication in mouse brain and hepatitis C gene expression in human cells. The DNAzyme that cleaves between U and G inhibits hepatitis B and influenza viral gene expression in human cells by targeting the translation start codon. Given that the AG site targeted by our DNAzyme is more prevalent in the viral genome (AG is present in the stop codon (UAG), glutamine (CAG), lysine (AAG) and glutamate (GAG)) than the start codon (AUG), the DNAZyme has a broader targetability for RNA viruses.
[0230] The example analyzed the viral genome of 4 SARS-CoV (AY508724, AY485277, AY390556 and AY278489), 19 SARS-CoV-2 (including 5 strains in the US: MN988713.1 -Illinois, MN985325.1 - Washington, MN997409.1 - Arizona, MN994468.1 - California and MN994467.1 - California; 13 strains in China: MN975262.1, LR757995.1, MN938384.1, MN996527.1, LR757996.1, MN988669.1, MN996528.1, MN908947.3, MN988668.1, MN996530.1, MN996531.1, MN996529.1 and LR757998.1; 1 strain in Australia: MT007544.1), and 1 MERS-CoV (JX869059). DNA (RNA) sequences encoding PLpro (SEQ ID NOs: 1-24), 3CLpro (SEQ ID NOs:25-48), RdRp (SEQ ID NOs:49-72), helicase (SEQ ID NOs:73-96) and S (SEQ ID NOs:97-120) proteins were aligned using Multalin. Different SARS-CoV and SARS-CoV-2 strains show highly conserved regions in these genes, while MERS-CoV shows a low level of similarity to SARS-CoV and SARS-CoV-2. The target selection criteria include the following parameters: (1) a central AG site (adenine-guanine) for DNAzyme cleavage, (2) the AG site must be flanked by at least 9 absolutely conserved nucleotides on both sides, and (3) the DNAzyme must target both SARS-CoV and SARS-CoV-2 viral RNA. The target sites and their DNAzyme designs are listed in
[0231] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference.
[0232] Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.
SEQUENCES
[0233] SEQ ID NOs: 1-24 PLpro DNA/RNA from 4 SARS-CoV strains, 19 SARS-CoV-2 and 1 MERS-CoV strain.
[0234] SEQ ID NOs: 25-48 3CLpro DNA/RNA from 4 SARS-CoV strains, 19 SARS-CoV-2 and 1 MERS-CoV strain.
[0235] SEQ ID NOs: 49-72 RdRp DNA/RNA from 4 SARS-CoV strains, 19 SARS-CoV-2 and 1 MERS-CoV strain
[0236] SEQ ID NOs: 73-96 helicase DNA/RNA from 4 SARS-CoV strains, 19 SARS-CoV-2 and 1 MERS-CoV strain.
[0237] SEQ ID NOs: 97-120 S DNA/RNA from 4 SARS-CoV strains, 19 SARS-CoV-2 and 1 MERS-CoV strain.
[0238] SEQ ID NO: 121 8-17Dz5
TABLE-US-00011 GCTGTCCGAGCCGGACGAGCTGC
[0239] SEQ ID NO: 122 8-17Dz6
TABLE-US-00012 TGCTGTCCGAGCCGGACGAGCTGCT
[0240] SEQ ID NO: 123 8-17Dz7
TABLE-US-00013 CTGCTGTCCGAGCCGGACGAGCTGCTG
[0241] SEQ ID NO: 124 8-17Dz8
TABLE-US-00014 GCTGCTGTCCGAGCCGGACGAGCTGCTGC
[0242] SEQ ID NO: 125 8-17Dz9
TABLE-US-00015 TGCTGCTGTCCGAGCCGGACGAGCTGCTGCT
[0243] SEQ ID NO: 126 8-17Dz10
TABLE-US-00016 CTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTG
[0244] SEQ ID NO: 127 8-17Dz11
TABLE-US-00017 GCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTGC
[0245] SEQ ID NO: 128 8-17Dz12
TABLE-US-00018 TGCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTGCT
[0246] SEQ ID NO: 129 8-17Dz13
TABLE-US-00019 CTGCTGCTGCTGTCCGAGCCGGACGAGCTGCTGCTGCTG
[0247] SEQ ID NO: 130 LNA8-17Dz9
TABLE-US-00020 +T+G+C+T+GCTGTCCGAGCCGGACGAGCTG+C+T+G+C+T
[0248] SEQ ID NO: 131 PNA8-17Dz9
TABLE-US-00021 *T*G*C*T*G*C*T*G*T*C*C*G*A*G*C*C*G*G*A*C*G*A*G*C*T *G*C*T*G*C*T
[0249] SEQ ID NO: 132 polyT20LNA8-17Dz9
TABLE-US-00022 TTTTTTTTTTTTTTTTTTTT+T+G+C+T+GCTGTCCGAGCCGGACGAGCT G+C+T+G+C+T
[0250] SEQ ID NO: 133 polyA20A20
TABLE-US-00023 AAAAAAAAAAAAAAAAAAAAATTGCTGTATTGGCTCTGGTGATGCGTTAA AGGATCTCGTATAGCAGCTCAGTCCACTCGAAC
[0251] SEQ ID NO: 134 B20
TABLE-US-00024 CATAGTCAATAACGCATCACCAGAGCCAAATGACGACATCTGTGCGATGA AACCTAGCAGACC
[0252] SEQ ID NO: 135 C20
TABLE-US-00025 GAGATCCTATGACTATGGGTCTGCTAGGTACAGTCTGTCGCTTATGCACT AGAGCTGCTATAC
[0253] SEQ ID NO: 136 D20
TABLE-US-00026 TGTCGTCAAACAGCAATGTTCGAGTGGACAAGTGCATAAGCGACAGACTG ATCATCGCACAGA
[0254] SEQ ID NO: 137 qRT-PCR pimers for GAPDH
TABLE-US-00027 GACAGTCAGCCGCATCTTCT
[0255] SEQ ID NO: 138 qRT-PCR pimers for GAPDH
TABLE-US-00028 GCGCCCAATACGACCAAATC
[0256] SEQ ID NO: 139 qRT-PCr primers for GFP
TABLE-US-00029 CAAGATCCGCCACAACATCG
[0257] SEQ ID NO: 140 qRT-PCr primers for GFP
TABLE-US-00030 GACTGGGTGCTCAGGTAGTG
[0258] SEQ ID NO: 141
TABLE-US-00031 TCATGTGGTAGTGTTGGTT
[0259] SEQ ID NO: 142
TABLE-US-00032 GATGTTGTTAGACAATGCT
[0260] SEQ ID NO: 143
TABLE-US-00033 TGCGGTGTAAGTGCAGCCC
[0261] SEQ ID NO: 144
TABLE-US-00034 GTGCGGCACAGGCACTAGT
[0262] SEQ ID NO: 145
TABLE-US-00035 ACAGGCACTAGTACTGATG
[0263] SEQ ID NO: 146
TABLE-US-00036 TACATAATCAGGATGTAAA
[0264] SEQ ID NO: 147
TABLE-US-00037 GTTTCTTTAAGGAAGGAAG
[0265] SEQ ID NO: 148
TABLE-US-00038 CTTTAAGGAAGGAAGTTCT
[0266] SEQ ID NO: 149
TABLE-US-00039 AAGGAAGGAAGTTCTGTTG
[0267] SEQ ID NO: 150
TABLE-US-00040 AATGGGGTAAGGCTAGACT
[0268] SEQ ID NO: 151
TABLE-US-00041 GGTAAGGCTAGACTTTATT
[0269] SEQ ID NO: 152
TABLE-US-00042 TGAGTTATGAGGATCAAGA
[0270] SEQ ID NO: 153
TABLE-US-00043 TGAGGATCAAGATGCACTT
[0271] SEQ ID NO: 154
TABLE-US-00044 TGAATCTTAAGTATGCCAT
[0272] SEQ ID NO: 155
TABLE-US-00045 TATGCCATTAGTGCAAAGA
[0273] SEQ ID NO: 156
TABLE-US-00046 GCAAAGAATAGAGCTCGCA
[0274] SEQ ID NO: 157
TABLE-US-00047 AAAGAATAGAGCTCGCACC
[0275] SEQ ID NO: 158
TABLE-US-00048 TCGCACCGTAGCTGGTGTC
[0276] SEQ ID NO: 159
TABLE-US-00049 TCTATCTGTAGTACTATGA
[0277] SEQ ID NO: 160
TABLE-US-00050 GCCGCCACTAGAGGAGCTA
[0278] SEQ ID NO: 161
TABLE-US-00051 CGCCACTAGAGGAGCTACT
[0279] SEQ ID NO: 162
TABLE-US-00052 GTTGGACTGAGACTGACCT
[0280] SEQ ID NO: 163
TABLE-US-00053 ATCCTAATCAGGAGTATGC
[0281] SEQ ID NO: 164
TABLE-US-00054 CTAATCAGGAGTATGCTGA
[0282] SEQ ID NO: 165
TABLE-US-00055 GGGAACCTGAGTTTTATGA
[0283] SEQ ID NO: 166
TABLE-US-00056 AGTTTTATGAGGCTATGTA
[0284] SEQ ID NO: 167
TABLE-US-00057 CTTTGAAAAAGGTGACTAT
[0285] SEQ ID NO: 168
TABLE-US-00058 TCTCAGATGAGTTTTCTAG
[0286] SEQ ID NO: 169
TABLE-US-00059 GAGTTTTCTAGCAATGTTG
[0287] SEQ ID NO: 170
TABLE-US-00060 GTACTGGTAAGAGTCATTT
[0288] SEQ ID NO: 171
TABLE-US-00061 TTCTCTATGAGAACCAAAA
[0289] SEQ ID NO: 172
TABLE-US-00062 AACCAACATCCGAGCCGGACGAACCACATGA
[0290] SEQ ID NO: 173
TABLE-US-00063 AGCATTGTTCCGAGCCGGACGAAACAACATC
[0291] SEQ ID NO: 174
TABLE-US-00064 GGGCTGCATCCGAGCCGGACGATACACCGCA
[0292] SEQ ID NO: 175
TABLE-US-00065 ACTAGTGCTCCGAGCCGGACGAGTGCCGCAC
[0293] SEQ ID NO: 176
TABLE-US-00066 CATCAGTATCCGAGCCGGACGAAGTGCCTGT
[0294] SEQ ID NO: 177
TABLE-US-00067 TTTACATCTCCGAGCCGGACGAGATTATGTA
[0295] SEQ ID NO: 178
TABLE-US-00068 CTTCCTTCTCCGAGCCGGACGATAAAGAAAC
[0296] SEQ ID NO: 179
TABLE-US-00069 AGAACTTCTCCGAGCCGGACGATCCTTAAAG
[0297] SEQ ID NO: 180
TABLE-US-00070 CAACAGAATCCGAGCCGGACGATCCTTCCTT
[0298] SEQ ID NO: 181
TABLE-US-00071 AGTCTAGCTCCGAGCCGGACGATACCCCATT
[0299] SEQ ID NO: 182
TABLE-US-00072 AATAAAGTTCCGAGCCGGACGAAGCCTTACC
[0300] SEQ ID NO: 183
TABLE-US-00073 TCTTGATCTCCGAGCCGGACGACATAACTCA
[0301] SEQ ID NO: 184
TABLE-US-00074 AAGTGCATTCCGAGCCGGACGATGATCCTCA
[0302] SEQ ID NO: 185
TABLE-US-00075 ATGGCATATCCGAGCCGGACGATAAGATTCA
[0303] SEQ ID NO: 186
TABLE-US-00076 TCTTTGCATCCGAGCCGGACGAAATGGCATA
[0304] SEQ ID NO: 187
TABLE-US-00077 TGCGAGCTTCCGAGCCGGACGAATTCTTTGC
[0305] SEQ ID NO: 188
TABLE-US-00078 GGTGCGAGTCCGAGCCGGACGACTATTCTTT
[0306] SEQ ID NO: 189
TABLE-US-00079 GACACCAGTCCGAGCCGGACGAACGGTGCGA
[0307] SEQ ID NO: 190
TABLE-US-00080 TCATAGTATCCGAGCCGGACGAACAGATAGA
[0308] SEQ ID NO: 191
TABLE-US-00081 TAGCTCCTTCCGAGCCGGACGAAGTGGCGGC
[0309] SEQ ID NO: 192
TABLE-US-00082 AGTAGCTCTCCGAGCCGGACGACTAGTGGCG
[0310] SEQ ID NO: 193
TABLE-US-00083 AGGTCAGTTCCGAGCCGGACGACAGTCCAAC
[0311] SEQ ID NO: 194
TABLE-US-00084 GCATACTCTCCGAGCCGGACGAGATTAGGAT
[0312] SEQ ID NO: 195
TABLE-US-00085 TCAGCATATCCGAGCCGGACGACCTGATTAG
[0313] SEQ ID NO: 196
TABLE-US-00086 TCATAAAATCCGAGCCGGACGACAGGTTCCC
[0314] SEQ ID NO: 197
TABLE-US-00087 TACATAGCTCCGAGCCGGACGACATAAAACT
[0315] SEQ ID NO: 198
TABLE-US-00088 ATAGTCACTCCGAGCCGGACGATTTTCAAAG
[0316] SEQ ID NO: 199
TABLE-US-00089 CTAGAAAATCCGAGCCGGACGACATCTGAGA
[0317] SEQ ID NO: 200
TABLE-US-00090 CAACATTGTCCGAGCCGGACGAAGAAAACTC
[0318] SEQ ID NO: 201
TABLE-US-00091 AAATGACTTCCGAGCCGGACGATACCAGTAC
[0319] SEQ ID NO: 202
TABLE-US-00092 TTTTGGTTTCCGAGCCGGACGACATAGAGAA
[0320] SEQ ID NO: 203, 3CLpro (147/306), left arm,
TABLE-US-00093 AACCAACA
[0321] SEQ ID NO: 204, 3CLpro (298/306), left arm,
TABLE-US-00094 AGCATTGT
[0322] SEQ ID NO: 205, RdRp (15/932), left arm,
TABLE-US-00095 GGGCTGCA
[0323] SEQ ID NO: 206, RdRp (24/932), left arm,
TABLE-US-00096 ACTAGTGC
[0324] SEQ ID NO: 207, RdRp (27/932), left arm,
TABLE-US-00097 CATCAGTA
[0325] SEQ ID NO: 208, RdRp (357/932), left arm,
TABLE-US-00098 TTTACATC
[0326] SEQ ID NO: 209, RdRp (430/932), left arm,
TABLE-US-00099 CTTCCTTC
[0327] SEQ ID NO: 210, RdRp (432/932), left arm,
TABLE-US-00100 AGAACTTC
[0328] SEQ ID NO: 211, RdRp (433/932), left arm,
TABLE-US-00101 CAACAGAA
[0329] SEQ ID NO: 212, RdRp (511/932), left arm,
TABLE-US-00102 AGTCTAGC
[0330] SEQ ID NO: 213, RdRp (513/932), left arm,
TABLE-US-00103 AATAAAGT
[0331] SEQ ID NO: 214, RdRp (522/932), left arm,
TABLE-US-00104 TCTTGATC
[0332] SEQ ID NO: 215, RdRp (524/932), left arm,
TABLE-US-00105 AAGTGCAT
[0333] SEQ ID NO: 216, RdRp (545/932), left arm,
TABLE-US-00106 ATGGCATA
[0334] SEQ ID NO: 217, RdRp (549/932), left arm,
TABLE-US-00107 TCTTTGCA
[0335] SEQ ID NO: 218, RdRp (553/932), left arm,
TABLE-US-00108 TGCGAGCT
[0336] SEQ ID NO: 219, RdRp (553/932), left arm,
TABLE-US-00109 GGTGCGAG
[0337] SEQ ID NO: 220, RdRp (557/932), left arm,
TABLE-US-00110 GACACCAG
[0338] SEQ ID NO: 221, RdRp (563/932), left arm,
TABLE-US-00111 TCATAGTA
[0339] SEQ ID NO: 222, RdRp (583/932), left arm,
TABLE-US-00112 TAGCTCCT
[0340] SEQ ID NO: 223, RdRp (584/932), left arm,
TABLE-US-00113 AGTAGCTC
[0341] SEQ ID NO: 224, RdRp (801/932), left arm,
TABLE-US-00114 AGGTCAGT
[0342] SEQ ID NO: 225, RdRp (875/932), left arm,
TABLE-US-00115 GCATACTC
[0343] SEQ ID NO: 226, RdRp (876/932), left arm,
TABLE-US-00116 TCAGCATA
[0344] SEQ ID NO: 227, RdRp (919/932), left arm,
TABLE-US-00117 TCATAAAA
[0345] SEQ ID NO: 228, RdRp (922/932), left arm,
TABLE-US-00118 TACATAGC
[0346] SEQ ID NO: 229, Helicase (202/601), left arm,
TABLE-US-00119 ATAGTCAC
[0347] SEQ ID NO: 230, Helicase (261/601), left arm,
TABLE-US-00120 CTAGAAAA
[0348] SEQ ID NO: 231, Helicase (264/601), left arm,
TABLE-US-00121 CAACATTG
[0349] SEQ ID NO: 232, Helicase (288/601), left arm,
TABLE-US-00122 AAATGACT
[0350] SEQ ID NO: 233, S (918/1274), left arm,
TABLE-US-00123 TTTTGGTT
[0351] SEQ ID NO: 234, 3CLpro (147/306), right arm,
TABLE-US-00124 ACCACATGA
[0352] SEQ ID NO: 235, 3CLpro (298/306), right arm,
TABLE-US-00125 AACAACATC
[0353] SEQ ID NO: 236, RdRp (15/932), right arm,
TABLE-US-00126 TACACCGCA
[0354] SEQ ID NO: 237, RdRp (24/932), right arm,
TABLE-US-00127 GTGCCGCAC
[0355] SEQ ID NO: 238, RdRp (27/932), right arm,
TABLE-US-00128 AGTGCCTGT
[0356] SEQ ID NO: 239, RdRp (357/932), right arm,
TABLE-US-00129 GATTATGTA
[0357] SEQ ID NO: 240, RdRp (430/932), right arm,
TABLE-US-00130 TAAAGAAAC
[0358] SEQ ID NO: 241, RdRp (432/932), right arm,
TABLE-US-00131 TCCTTAAAG
[0359] SEQ ID NO: 242, RdRp (433/932), right arm,
TABLE-US-00132 TCCTTCCTT
[0360] SEQ ID NO: 243, RdRp (511/932), right arm,
TABLE-US-00133 TACCCCATT
[0361] SEQ ID NO: 244, RdRp (513/932), right arm,
TABLE-US-00134 AGCCTTACC
[0362] SEQ ID NO: 245, RdRp (522/932), right arm,
TABLE-US-00135 CATAACTCA
[0363] SEQ ID NO: 246, RdRp (524/932), right arm,
TABLE-US-00136 TGATCCTCA
[0364] SEQ ID NO: 247, RdRp (545/932), right arm,
TABLE-US-00137 TAAGATTCA
[0365] SEQ ID NO: 248, RdRp (549/932), right arm,
TABLE-US-00138 AATGGCATA
[0366] SEQ ID NO: 249, RdRp (553/932), right arm,
TABLE-US-00139 ATTCTTTGC
[0367] SEQ ID NO: 250, RdRp (553/932), right arm,
TABLE-US-00140 CTATTCTTT
[0368] SEQ ID NO: 251, RdRp (557/932), right arm,
TABLE-US-00141 ACGGTGCGA
[0369] SEQ ID NO: 252, RdRp (563/932), right arm,
TABLE-US-00142 ACAGATAGA
[0370] SEQ ID NO: 253, RdRp (583/932), right arm,
TABLE-US-00143 AGTGGCGGC
[0371] SEQ ID NO: 254, RdRp (584/932), right arm,
TABLE-US-00144 CTAGTGGCG
[0372] SEQ ID NO: 255, RdRp (801/932), right arm,
TABLE-US-00145 CAGTCCAAC
[0373] SEQ ID NO: 256, RdRp (875/932), right arm,
TABLE-US-00146 GATTAGGAT
[0374] SEQ ID NO: 257, RdRp (876/932), right arm,
TABLE-US-00147 CCTGATTAG
[0375] SEQ ID NO: 258, RdRp (919/932), right arm,
TABLE-US-00148 CAGGTTCCC
[0376] SEQ ID NO: 259, RdRp (922/932), right arm,
TABLE-US-00149 CATAAAACT
[0377] SEQ ID NO: 260, Helicase (202/601), right arm,
TABLE-US-00150 TTTTCAAAG
[0378] SEQ ID NO: 261, Helicase (261/601), right arm,
TABLE-US-00151 CATCTGAGA
[0379] SEQ ID NO: 262, Helicase (264/601), right arm,
TABLE-US-00152 AGAAAACTC
[0380] SEQ ID NO: 263, Helicase (288/601), right arm,
TABLE-US-00153 TACCAGTAC
[0381] SEQ ID NO: 264, S (918/1274), right arm,
TABLE-US-00154 CATAGAGAA
[0382] SEQ ID NO: 265, (8-17Dz5, left arm)
TABLE-US-00155 GCTG
[0383] SEQ ID NO: 266, (8-17Dz5, right arm)
TABLE-US-00156 GCTGC
[0384] SEQ ID NO: 267, (8-17Dz6, left arm)
TABLE-US-00157 TGCTG
[0385] SEQ ID NO: 268, (8-17Dz6, right arm)
TABLE-US-00158 GCTGCT
[0386] SEQ ID NO: 269, (8-17Dz7, left arm)
TABLE-US-00159 CTGCTG
[0387] SEQ ID NO: 270, (8-17Dz7, right arm)
TABLE-US-00160 GCTGCTG
[0388] SEQ ID NO: 271, (8-17Dz8, left arm)
TABLE-US-00161 GCTGCTG
[0389] SEQ ID NO: 272, (8-17Dz8, right arm)
TABLE-US-00162 GCTGCTGC
[0390] SEQ ID NO: 273, (8-17Dz9, left arm)
TABLE-US-00163 TGCTGCTG
[0391] SEQ ID NO: 274, (8-17Dz9, right arm)
TABLE-US-00164 GCTGCTGCT
[0392] SEQ ID NO: 275, (8-17Dz10, left arm)
TABLE-US-00165 CTGCTGCTG
[0393] SEQ ID NO: 276, (8-17Dz10, right arm)
TABLE-US-00166 GCTGCTGCTG
[0394] SEQ ID NO: 277, (8-17Dz11, left arm)
TABLE-US-00167 GCTGCTGCTG
[0395] SEQ ID NO: 278, (8-17Dz11, right arm)
TABLE-US-00168 GCTGCTGCTGC
[0396] SEQ ID NO: 279, (8-17Dz12, left arm)
TABLE-US-00169 TGCTGCTGCTG
[0397] SEQ ID NO: 280, (8-17Dz12, right arm)
TABLE-US-00170 GCTGCTGCTGCT
[0398] SEQ ID NO: 281, (8-17Dz13, left arm)
TABLE-US-00171 CTGCTGCTGCTG
[0399] SEQ ID NO: 282, (8-17Dz13, right arm)
TABLE-US-00172 GCTGCTGCTGCTG
[0400] SEQ ID NO: 283, (LNA8-17Dz9, left arm)
TABLE-US-00173 +T+G+C+T+GCTG
[0401] SEQ ID NO: 284, (LNA8-17Dz9, right arm)
TABLE-US-00174 GCTG+C+T+G+C+T
[0402] SEQ ID NO: 285, (PNA8-17Dz9, left arm)
TABLE-US-00175 *T*G*C*T*G*C*T*G
[0403] SEQ ID NO: 286, (PNA8-17Dz9, right arm)
TABLE-US-00176 *G*C*T*G*C*T*G*C*T
[0404] SEQ ID NO: 287, (8-17 catalytic core)
TABLE-US-00177 TCCGAGCCGGACGA
[0405] SEQ ID NO: 288,
TABLE-US-00178 CAGCAGCAGCAGCAGCAGCAGCAGCAG
[0406] SEQ ID NO: 289,
TABLE-US-00179 AGCAGCAGCAGCAGCAGCA
[0407] SEQ ID NO: 290,
TABLE-US-00180 AGTTTTTCTCATGGTGTATTTATTCTTTTAAGTTTTGTTTTTTAAATATA CTTCACTTTTGAATGTTTCAGACAGCAGCAAAAGCAGCAACAGCAGCAGC AGCAGCAGCAGCAGGGGGACATATCAGGACAGAGTTCACATCCATGTGAA
[0408] SEQ ID NO: 291, (10-23 catalytic core)
TABLE-US-00181 GGCTAGCTACAACGA